- 15 -
대 한 주 산 회 지 제27권 제1호, 2016Korean J Perinatol Vol.27, No.1, Mar., 2016http://dx.doi.org/10.14734/kjp.2016.27.1.15
� Original article �
retardation, learning disability, and epilepsy.1, 2 It is
important to identify and develop therapeutic pro
cedures to reduce brain injury in neonates with HIE.
The immature brain has generally been considered
to be resistant to the damaging effects of hypoxia and
hypoxicischemic (HI). However, it is now appreciat
ed that there are specific periods of increased sus
ceptibility, which relate to the maturational stage at
the time of the insult.3
The central nervous system (CNS) consists of
the brain and the spinal cord. The brain is made up
of ex tensive and complex networks of neurons and
Perinatal hypoxicischemic encephalopathy (HIE)
following asphyxia during antepartum, intrapartum
and postpartum remains a common cause of chronic
handicapping conditions of cerebral palsy, mental
Received: 9 December 2015, Revised: 17 February 2016Accepted: 22 February 2016Correspondence to: Kim Woo Taek, M.D. Division of Neonatology, Department of Pediatrics, School of Medicine, Catholic University of Daegu, 33, Duryugongwon-ro 17-gil, Namgu, Daegu 42472, KoreaTel: +82-53-650-4250, Fax: +82-53-622-4240 E-mail: [email protected]
Copyrightⓒ 2016 by The Korean Society of PerinatologyThis is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided that the original work is properly cited. The Korean Journal of Perinatology · pISSN 1229-2605 eISSN 2289-0432 · e-kjp.org
Brain-Derived Neurotrophic Factor (BDNF) Exerts a
Protective Effect via an Anti-Apoptotic Mechanism
on Hypoxic-Ischemic Injury in the Rat Brain
Bong Jae Kim, M.D., Hyun Seuk Lee, M.D., Yoon Ho Han, M.D., Ji Eun Jeong, M.D., Eun Joo Lee, M.D., Eun Jin Choi, M.D. and Woo Taek Kim, M.D.
Department of Pediatrics, School of Medicine, Catholic University of Daegu, Daegu, Korea
Purpose: Perinatal hypoxic-ischemic (HI) brain injury remains a common cause of chronic handicapping con-ditions of cerebral palsy, mental retardation, learning disability, and epilepsy. HI brain injury induces cell death via either necrosis or apoptosis. Brain-derived neurotrophic factor (BDNF) is a member of the neurotrophin family. It plays key roles in survival, differentiation, and maintenance of neurons. This study was to investigate the neuroprotective effects of BDNF via the mechanisms of anti-apoptosis in HI brain injury by using cortical astrocyte and neuronal cell culture. Methods: Cortical astrocytes culture of 1-day-old Sprague-Dawley (SD) rat pups and embryonic cortical neuronal cell culture of SD rats at 14-day gestation were done. The Normoxia group was prepared in 5% CO2 incubators and the Hypoxia group and Hypoxia+BDNF group (after treatment with BDNF for 24 hours) were placed in 1% O2 incubators (94% N2, 5% CO2) for 6 or 18 hours. The expression of Bcl-2 and Bax were assess-ed by real-time PCR and western blot. The caspase-3 activation was evaluated by caspase activity assay kit.Results: In astrocyte and neuronal cell, the expressions of Bcl-2 in the hypoxia groups were reduced compared to the normoxia groups, whereas, those in the Hypoxia+BDNF groups were increased compared to the hypoxia groups. However, the expressions of Bax and caspase-3 and the ratio of Bax/Bcl-2 were revealed reversely. In astrocyte, Hypoxia group for 6 hours was not significantly altered in Bcl-2, Bax expressions.Conclusion: BDNF neuroprotective effects on HI brain injury in neonatal rats may occur via anti-apoptotic mechanism.
Key Words: Anti-apoptosis, Brain-derived neurotrophic factor, Hypoxia-ischemia, Neuroprotection
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
- 16 -
their supporting cells termed as glial cells. Neurons
are an electrically excitable cell that processes and
transmits information through electrical and chemical
signals. Astrocytes, the most abundant glial cell
types, are well known protectors of neurons. These
cells secrete a great variety of neurotrophic factors
and protect neurons against excitatory amino acids
(EAA), oxi dative injury.4
In neonatal brains, HI brain injury induces cell
death via either necrosis or apoptosis. Apoptosis is
an essential mechanism of maintaining homeostasis
during development. Whereas apoptotic cell death
usually happens in the developing brain where it is
responsible for the physiological removal of over
neurons.5 Apoptosis is an active cell death modulated
by proapoptotic (Bax, Bak, Bok etc.) and anti
apoptotic (Bcl2, BclxL, Bclw etc.) genes. The
overexpression of the antiapoptotic Bcl2 inhibits
apoptosis, but Bax overexpression forms Bax ho
modimers that advance apoptosis.68 Caspase3 has
been related to neuronal apoptosis during brain de
velopment and to delayed neuronal cell death after
brain insult.9 Activated caspase3 is directly res
ponsible for proteolytic cleavages of a variety of basic
proteins involving cytoskeletal proteins, kinases, and
DNArepair enzymes.10 In addition to morphological
evidence of apoptosis, Cheng et al. (1998)11 found
evidence of delayed caspase3 activity following HI.
Neurotrophins (NTs) are a family of proteins that
regulate neuronal survival, development, and func
tion.12 Brainderived neurotrophic factor (BDNF), a
member of the NT family, protects neurons against
different types of brain injury13 and also plays key
roles in survival, differentiation, and maintenance
of peripheral and central neurons.14 BDNF counter
regulate Bcl2 and Bax expression after cerebral
ischemia15 and protect against neonatal HI brain
injury.16
In this study, we determined the neuroprotective
effects of BDNF via the mechanisms of antiapoptosis
in HI brain injury by using cortical astrocyte and
neuronal cell culture of rats. A potential role of BDNF
was assessed by realtime PCR and western blot of
the proapoptotic protein Bax and the antiapoptotic
protein Bcl2. The effect was also evaluated via cas
pase3 activation.
Materials and Methods
1. Materials (Chemicals and Reagents)
BDNF, Caspase3/CPP32 Colorimetric Assay
kit were obtained from BioVision Inc. (Milpitas, CA,
USA). PolyDlysine was from Sigma (St. Louis,
MO, USA). Rabbit polyclonal microtubuleassociated
pro tein 2 (MAP2), Glial fibrillary acidic protein
(GFAP), mouse monoclonal Bcl2 and secondary
goat antimouse, or rabbit IgGHRP, Fluorescein
isothiocyanate (FITC) antibodies, βactin were
purchased from Santa Cruz Biotechnology (Santa
Cruz, CA, USA). Rabbit polyclonal Bax was purchased
from Cell Sig naling Technology Inc. (Danvers,
MA, USA). 3 (4,5dimethylthiazol2yl)2,5
diphenyltetra zolium bromide (MTT) was purchased
from Duchefa (Haarlem, The Netherlands). Hanks'
balanc ed salt solution (HBSS), Neurobasal media,
B27 supplement, glutamax I, 4(2hydroxyethyl)
1piperazineethanesulfonic acid (HEPES) were
purchased from GibcoBRL (Invitrogen, Grand Island,
NY, USA). Dulbecco's Mo dified Eagle's Medium
DMEM (high glucose, low glucose), Ham's F12,
fetal bovine serum (FBS), peni cillinstreptomycin,
and trypsinEDTA were obtained from Hyclone
Laboratories (Logan, UT, USA). Complete protease
inhibitor cock tail tablets were purchased from Roche
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
- 17 -
Appli ed Science (Mann heim, Germany). Enhanced
Chemilumino scence (ECL) plus western blotting
detection system was purchased from Amersham
Biosciences Corp. (Pis cataway, NJ, USA). SUPEX was
purchased from Neuronex (Pohang, Korea).
2. Cortical astrocyte and neuronal cell cultures
This study was performed in accordance with
the approved animal use guidelines of the Catholic
University of Daegu. Cortical astrocytes used for the
primary cultures were also isolated from neonatal
Sprague Dawley (SD) rats (both sexes) at day 1
postnatally.17 Briefly, the brains removed and trans
ferred into prechilled HEPES under sterile condition.
And men inges were carefully removed. Then the
cortex was chopped into pieces and resuspended in
3 mL 0.25% trypsin solution. After 5 min incubation
at 37℃, FBS was added to stop the action of trypsin.
The cells were dispersed gently and centrifuged at
1,000 rpm for 5 min. Cells were isolated by filtering
the suspension through 80 mesh screens. After
wash ing the sus pension in PBS centrifuged at 200 g
for 5 min. The final pellet was resuspended in DMEM
(high glucose) supplemented with 10% FBS, 25 mm
HEPES, 2 mm lglutamine, 100 U/mL penicillin,
and 100 lg/mL streptomycin. Cells were seeded
onto 100 mm dishes. The cultures were incubated
in a humidified incubator at 37℃ under 5% CO2. To
hypoxia, the cultures were washed with serumfree
medium, and fresh medium containing low glucose
was added to culture dish.
Culture of cortical neuronal cells from rat embryos
was performed using the Brewer method.18 Disso
ciated cultures from SD rat embryonic (E14, both
sexes) cerebral cortical neurons were prepared as
follows: the isolated cortices free of meninges were
dissected at 37℃ HBSS containing 1 mM sodium
pyruvate and 10 mM HEPES (pH 7.4). The dissected
brain cortical tissues were then placed in 2 mL trypsin
and incubated at 37℃ for 1 min. After washing five
times with 10 mL HBSS, the cells were moved in 1
mL HBSS, and dispersed by pipetting 67 times with
a smallbore Pasteur pipette. The cell suspension
was centrifuged at 1,000 rpm at 25℃ for 5 min and
pellets were washed with HBSS (without phenol red).
The pellet was resuspended in Neurobasal media
supplemented with 2% B27 and 0.5 mM glutamax
Ⅰ. Cells were plated in each dish precoated with 50
µg/mL polyDlysine. Cultures were maintained in
Neu robasal media at 37°C in a humidified atmosphere
containing 5% CO2. Half of the medium was changed
every 3 days.
The cultured cells were divided into five groups: N,
normoxia; 6H, hypoxia for 6 hr; 6HB; hypoxia for 6 hr
after treatment with BDNF for 24 hr; 18H, hypoxia for
18 hr; 18HB; hypoxia for 18 hr after treatment with
BDNF for 24 hr. The N group was prepared in 5% CO2
incubators while the other groups were cultured in
1% O2 incubators (94% N2, 5% CO2). To determine the
time of hypoxia, we re ferred to the studies of Callahan
et al.19 and Hong et al.20
3. Immunofluorescence
At the indicated time points, cells cultured on poly
Dlysine coated plastic coverslips were fixed with
4% formaldehyde for 30 min at room temperature.
Sub sequently, cells were rinsed with PBS and per
meabilized with 0.25% Triton X100 for 5 min. After
two washes with PBS, cells were incubated with
blocking solution (1% bovine serum albumin in PBS)
for 1 hr, followed by primary polyclonal antibody
against MAP2 (1:50), GFAP (1:100) overnight at 4℃.
Cells were then washed in PBS three times (5 min
each) and subsequently incubated in FITC goat anti
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
- 18 -
rabbit (1:200) secondary antibody at 37°C for 30
min. Cells were washed three times with PBS. DAPI
(1 µg/mL) was included in the final wash to stain the
nuclei. Coverslips were attached on slides, mounting
medium (Dako, Glostrup, Denmark) was added, and
the pre paration was covered with a glass coverslip.
Cover slips detected by fluorescence microscopy (TE
2000U, Nikon instruments Inc., NY, USA).
4. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-
tetrazolium bromide (MTT) assay
The MTT assay was used for estimation of cell vi
ability and growth. MTT was dissolved at a concen
tration of 5 mg/mL. 10 µL of the 5 mg/mL MTT stock
solution was added to each well. After 4 hr of incu
bation at 37℃, media was removed and added 100 µL
of the lysing buffer (Dimethyl sulfoxide (DMSO): 95%
ethanol=1:1). Absorbance of the samples was read at
540 nm using a microtiter plate enzymelink ed im
munosorbent assay (ELISA) reader. The amount of
formazan produced is proportional to the number of
live and metabolically active cells.
5. RNA extraction and real-time PCR
Total RNA was extracted from tissue with TRIzol
reagent (Invitrogen Corporation, Calsbad, CA, USA).
Briefly, cells were homogenized in 1 mL of TRIzol
reagent. Total RNA was separated from DNA and
proteins by adding chloroform and was precipitated
using isopropanol. The precipitate was washed twice
in 100% ethanol, airdried, and rediluted in diethy
plyrocarbonate (DEPC)treated distilled water. The
amount and purity of extracted RNA was quantitated
by spectrophotometry (GeneQuantTM pro RNA/
DNA calculator, GE Healthcare, USA), and the RNA
was stored at 70℃ pending further processing. For
re verse transcription, total RNA (2 µg) was reverse
transcribed for 1 hr at 37℃ in a reaction mixture
containing 20 U RNase inhibitor (Promega, Madison,
WI, USA), 1 mM dNTP (Promega), 0.5 ng oligo(dT)
15 primer (Promega), 1 x RT buffer and 200 U M
MLV reverse transcriptase (Promega). The reaction
mixture was then incubated at 95℃ for 5 min to stop
the reaction. The cDNA was stored at 20℃ until
further processing.
Realtime PCR was performed in 48well PCR
plates (Mini OpticonTM RealTime PCR System, Bio
rad, USA) using the iQTM SYBR Green Supermix
(Biorad Laboratories, CA, USA). Amplification
conditions are shown in Table 1. It was the same for all
apoptotic mRNA assayed: 95℃ for 5 min, followed by
40 cycles of 95℃ for 40 sec, annealing temperature
for 45 sec, and 72℃ for 45 sec. Realtime PCR data
were analysed with LightCycler software (BIORad
Lab, Hercules, CA, USA). All experiments were per
formed at least in six times.
6. Rat astrocyte, neuronal cell protein extraction
Samples of astrocyte, neuronal cell were homoge
nized and total protein was extracted using a protein
Table 1. Primer Pairs and Annealing Temperatures for Real-Time PCRName Primer Sequence (5'-3') Annealing Amplicon size (bp)Bcl-2 F: TTGACGCTCTCCACACACATG 57℃ 89
R: GGTGGAGGAACTCTTCAGGGABax F: TGCTGATGGCAACTTCAACT 55℃ 110
R: ATGATGGTTCTGATCAGCTCGΒ-Actin F: TTGCTGATCCACATCTGCTG 53℃ 146
R: GACAGGATGCAGAAGGAGAT
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
- 19 -
lysis buffer containing complete protease inhibitor
cocktail tablets, 1 M TrisHCl (pH 8.0), 5 M NaCl, 10%
Nonidet P40 and 1 M 1,4dithioDLthreitol (DTT).
After incubation for 10 min on ice, the samples were
centrifuged at 12,000 rpm at 4℃ for 30 min and the
supernatant was transferred to a new tube. Proteins
were quantified using the Pierce BCA Protein Assay
Kit (Thermo Scientific, Rockford, USA) and taking
spectrophotometric readings at 540 nm.
7. Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and western blot
analysis
Equal amounts of proteins (30 µg) were subjected
to 12% SDSPAGE after denaturing in 5 x SDS gel
loading buffer (60 mM TrisHCl pH 6.8, 25% glycerol,
2% SDS, 14.4 mM 2mercaptoehanol and 0.1% bro
mophenol blue) in boiling water for 10 min. After elec
trophoresis, proteins were electrotransferred to a
polyvinylidene difluoride (PVDF) membrane (Millipore,
Bedford, MA, USA) at a constant voltage of 10 V for
30 min. After transfer, the membrane was washed
twice with 1 x Trisbuffered saline (TBS) plus 0.1%
Tween20 (TBST, pH 7.4) and preincubated with a
blocking buffer (5% nonfat dry milk in TBST) at room
temperature for 1 hr. The blots were then incubated
with rabbit polyclonal Bax and mouse monoclonal Bcl
2, βactin primary antibodies at 1:1,000 dilutions in
TBST at 4℃ overnight. Following primary antibody
incubations, the blots were incubated with secondary
antirabbit or antimouse antibody conjugated with
horseradish peroxidase at 1:2,000 dilution at room
temperature for 1 hr. Finally, the membrane was
washed and developed using the ECL plus or SUPEX
reagents. The intensities of the western blot bands
were measured using a densitometer (Multi Gauge
Software, Fuji Photofilm).
8. Caspase-3 activation
The activity of caspase3 was measured using a
colorimetric assay kit according to the manufacturer's
instructions. Briefly, at the indicated time points,
cultured cells were collected into a test tube, followed
by centrifugation. The pellet was re suspended in
a lysis buffer provided by the kit. Cell lysates were
incubated at 37°C for 2 hr with 200 µM DEVDp
nitroanilide (pNA). Spectrophotometric detection of
the chromophore pNA after cleavage from the labeled
caspase substrates was then performed. Samples
were read at 405 nm in a microtiter plate reader. All
experiments were performed at least in four times.
9. Statistical analysis
Data were analyzed using the SPSS version 12.0
statistical analysis package. Examined data were
assessed using the ttest and ANOVA. In each test,
the data were expressed as the mean±SD, and P<0.05
was accepted as statistically significant.
Results
1. The identity of astrocytes and neuronal cells
Cellular characterization was performed by immu
nofluorescence analysis using polyclonal antibodies
against GFAP or MAP2 with doublelabelling by
means of DAPI in order to score the proportion of as
trocyte and neuronal cell in cultures. More than 95 %
of the cells have been shown to present immunore
activity for GFAP, MAP2 (Fig. 1A, 1B).
2. Cell viabilities according to administration with
BDNF in hypoxic ischemic brain cells injury
To determine the protective effects of BDNF in the
cultured dispersed astrocyte (Fig. 2A) and neuronal
cell (Fig. 2B) after a hypoxic (1% O2) insult, the most
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
- 20 -
effective concentration of the drug was determined
by measuring the relative cell viabilities of BDNF
in different concentrations (50, 100, and 200 ng/
mL).21 The drugtreated groups (6HB, 18HB) were
compared to the N group and cell viabilities were
determined by the MTT assay. The results showed
that the best concentration for relative cell viabilities
of BDNF was 100 ng/mL, respectively, therefore, we
used 100 ng/mL of BDNF in the experiments.
3. The expressions of Bcl-2 and Bax mRNAs
by real-time PCRs in the rat cortical astrocyte
culture
In primary astrocytes, the expression of Bcl2
mRNA (Fig. 3A) decreased in the 18H group com
pared to the N group, and increased in the 18HB group
compared to the 18H group (P<0.05). In contrast, Bax
mRNA (Fig. 3B) level and the ratio of Bax/Bcl2 (Fig.
3C) were reversed under the same experimental
conditions. However, 6H group was not significantly
altered in Bcl2, Bax mRNA levels.
Fig. 1. Fluorescence images (x 200) of rat cortical astrocyte and neuronal cell cultured for 10 days and stained for the appropriate phenotypic markers. Nuclei were stained with DAPI (blue). Approximately 95% of the cells stain positive for astrocyte marker GFAP (green) (A), more than 95% of the cells are positive for the neuronal cell marker MAP2 (green) (B).
Fig. 2. Cell viability was measured by 3-(4,5-dimethylthiazol-2-yl) -2,5-diphenyl-tetrazolium bromide (MTT) assay. Cultured dispersed astrocytes or neuronal cells were prepared with different concentrations of brain-derived neurotrophic factor (BDNF) for 24 hours before a hypoxic insult for 6 or 18 hours. The concentration of drug was 5, 100, and 200 ng/mL. The damaged cells were restored following administration of BDNF. The effective doses were 100 ng/mL in the HB groups both astrocyte and neuronal cell. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. N.
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
- 21 -
Fig. 3. Real-time PCRs of Bcl-2 (A; N, 100±5.0; 6H, 107.2±5.3; 6HB, 112.9±5.6; 18H, 52.3±2.6; 18HB, 73.2±3.7) and Bax (B; N, 100±2.0; 6H, 102.1±2.9; 6HB, 103.8±2.1; 18H, 115.6±1.7; 18HB, 113.7±3.0) mRNAs and the ratio of Bax/Bcl-2 were revealed in the cortical astrocyte culture. BDNF was administered at 100 ng/mL. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.
Fig. 4. Real-time PCRs of Bcl-2 (A; N, 100±4.5; 6H, 42.3±6.7; 6HB, 76.3±3.9; 18H, 30.8±4.0; 18HB, 62.9±5.5), Bax (B; N, 100±3.7; 6H, 121.0±5.2; 6HB, 95.9±7.1; 18H, 173.5±2.9; 18HB, 126.1±6.4) mRNAs and the ratio of Bax/Bcl-2 were revealed in the embryonic cortical neuronal cell culture. BDNF was administered at 100 ng/mL. N, normoxia H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
- 22 -
4. The expressions of Bcl-2 and Bax mRNAs by
real-time PCRs in the rat cortical neuronal cell
culture
In neuronal cells, the expression of Bcl2 mRNA
(Fig. 4A) decreased in the H groups (6H, 18H) com
pared to the N group, and increased in the HB groups
(6HB, 18HB) compared to the H groups (P<0.05). In
contrast, Bax mRNA level (Fig. 4B) and the ratio of
Bax/Bcl2 (Fig. 4C) were reversed under the same
experimental conditions.
5. The expressions of Bcl-2 and Bax proteins
by western blots (Fig. 5A) in the rat cortical
astrocyte culture
In primary astrocytes, the expression of Bcl2
protein (Fig. 5B) decreased in the 18HB group com
pared to the N group, and increased in the 18HB group
compared to the 18H group (P<0.05). In contrast,
Bax protein (Fig. 5C) level and the ratio of Bax/Bcl2
(Fig. 5D) was reversed under the same experimental
conditions. However, 6H group was not significantly
altered in Bcl2, Bax protein levels.
6. The expressions of Bcl-2 and Bax proteins
by western blots (Fig. 6A) in the rat cortical
neuronal cell culture
In neuronal cells, the expression of the Bcl2 pro
tein (Fig. 6B) decreased in the H groups (6H, 18H)
compared to the N group, and increased in the HB
groups (6HB, 18HB) compared to the H groups (P<
0.05). In contrast, Bax protein (Fig. 6C) level and the
ratio of Bax/Bcl2 (Fig. 6D) were a reverse of this
behavior.
7. Activation of DEVD-specific caspase-3 by
colorimetric substrate DEVD-pNA
In astrocyte, the activations of caspase3 increas
ed in the 18H group when compared to those of the N
Fig. 5. Western blots (A) of Bcl-2 (B; N, 100±2.0; 6H, 94.9±1.8; 6HB, 98.0±0.6; 18H, 75.4±0.73; 18HB, 89.8±2.1) and Bax (C; N, 100±5.5; 6H, 105.8±4.8; 6HB, 102.5±4.2; 18H, 151.5±6.1; 18HB, 111.9±5.6) and the ratio of Bax/Bcl-2 were revealed in the cortical astrocyte culture (n=4). BDNF was administered at 100 ng/mL. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
- 23 -
group and decreased in the 18HB group when com
pared to those of the 18H group. However, exposure
of astrocyte to 6 hr of hypoxia did not increase cas
pase3 activity compared with normoxia (Fig. 7A,
P<0.05)
In neuronal cell, the activations of caspase3 in
creased in the H groups (6H, 18H) when compared to
those of the N group and decreased in the HB groups
(6HB, 18HB) when compared to those of the H groups
(Fig. 7B).
Fig. 6. Western blots (A) of Bcl-2 (B; N, 100±2.0; 6H, 42.1±3.2; 6HB, 82.3±1.9; 18H, 30.9±4.9; 18HB, 70.4±5.2), Bax (C; N, 100±5.7; 6H, 145.6±6.9; 6HB, 105.5±7.2; 18H, 164.3±8.1; 18HB, 121.9±3.7) and the ratio of Bax/Bcl-2 were revealed in the embryonic cortical neuronal cell culture (n=4). BDNF was administered at 100 ng/mL. N, normoxia; 6H, hypoxia for 6 hours; 6HB; hypoxia for 6 hours after treatment with BDNF; 18H, hypoxia for 18 hours; 18HB; hypoxia for 18 hours after treatment with BDNF. *P<0.05, statistically significant vs. H.
Fig. 7. Astrocyte (A) and neuronal cell (B) were plated dish 24 hours before the induction of apoptosis. After treatment with 100 ng/mL BDNF for 24 hours before a hypoxic insult, the activity of caspase-3 was assayed using a caspase-3/CPP32 colorimetric assay kit. *P<0.05, statistically significant vs. N.
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
- 24 -
Discussion
Oxidative neuronal damage contributes to the pa
thogenesis of many different neurodegenerative
conditions such as ischemic stroke, Alzheimer’s dis
ease, Parkinson’s disease.22 Cerebral HI is rapidly
followed by prolonged periods of delayed cell death or
apoptosis, and inflammation.23
Cortical progenitor cells follow an intrinsic de
velopmental sequence both in vivo and in vitro.
The generation of all cell types in the cortex hap
pens in temporally distinct, albeit overlapping,
phases. Neurons are generated first, followed by
astrocytes, and then oligodendrocytes. In rats, neu
rogenesis peaks at E14, astrocytogenesis at P2, and
oligodendrocytogenesis at P14.24 To date, a lot of
effort has been expended to explain the molecular
mechanisms within neurons that me diate neuronal
death during stroke and hypoxia. Although this ap
proach certainly has advantage, astrocytes also play
important roles in health and disease. Astrocytes
provide a supporting role for neuronal integrity, cere
bral vascular development, and neuroprotection.25
Several reports show that astrocytes are active part
ners with neurons and brain vasculature participating
in communication that changes neuronal survival
and physiology.26, 27 We successfully cultured the rat
cerebral cortical astrocytes and neurons in vitro.
The cells grew and differentiated very well in the
improved culture of respective medium. No obvious
degeneration of the cultured astrocytes or neurons
was seen even after 14 days in vitro. The astrocyte
cells were identified with antiGFAP polyclonal
antibody and neuronal cells with antiMAP2 poly
clonal antibodies. The purification of astrocytes and
neurons are more than 95%.
During brain development, a large amount of neu
rons suffer apoptosis to help sculpt neural networks.28
Therefore, neurons in the developing brain are primed
to suffer apoptosis, and the apoptotic pathway can be
without difficulty activated in response to damage.29
Prominent components of apoptosis such as Bcl
230 and Bax31 and caspase311 are upregulated in
the immature when compared to the adult brain and
could be expected to have a key role in pathological
situations also. Upregulated Bcl2 expression results
in survival while upregulated Bax expression results
in apoptosis.32 Bcl2 and Bax are also thought to play
a role in cell death following HI. Multiple reports have
demonstrated that cerebral ischemia changes the
expression of Bcl2 and Bax proteins.33, 34
HI brain damage in the human perinatal period
causes significant longterm neurobehavioral dys
function, while BDNF pretreatment is protective
against brain injury.35 Moreover, BDNF in vitro has
been demonstrated to prevent apoptosis.36 The study
of Schäbitz et al.15 has shown that BDNF treatment
decreased expression of Bax and counterregulated
Bcl2 in neurons. Several reports have suggested
that BDNF can protect neurons from hypoglycemia,
ischemia, hypoxia and neurotoxicity induced injury.37, 38
We assessed the expression of Bcl2 mRNAs and
proteins as antiapoptosis and the expression of
Bax as proapoptosis to detect the apoptosis feature
following the perinatal HI brain injury. In the present
study, the expression of Bcl2 was decreased in the H
groups as compared to the normoxia group, whereas it
was increased in the BDNFtreated groups. By con
trast, the expressions of Bax and the ratio of Bax/Bcl
2 were inversely related. These results suggest that
BDNF might exert some neuroprotective effect via an
antiapoptotic mechanism. However, astrocytes were
no differences in the expression of Bcl2 and Bax
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
- 25 -
among the normoxia and 6 hr of hypoxia treatment,
but significant increase was shown between 18 hr of
hypoxia and normoxia. Shorter periods of exposure
to hypoxia were not injurious to these cells.19 Astro
cytes were very resistant to hypoxia, but less so to
simulated ischemia (under both conditions the glu
tamate concentrations in the media remained low).39
Caspase3 is known to be a major contributor
to the apoptotic machinery in many cell types, de
velopment of selective and potent caspase3 inhi
bitors has emerged as a therapeutic target. Intracere
broventricular (ICV) injection of BDNF prior to HI
injury almost completely abolished evidence of HI
induced caspase3 activation in vivo.10
In this study, astrocytes were no differences in the
proportion of caspase3 activation among the nor
moxia and 6 hr of hypoxia, but significant increase
was shown between 18 hr of hypoxia and normoxia.
The study of Al Ahmad et al.40 has shown that maxi
mal caspase3 activation occurred at 48 hr of hypo
xia. In the other groups, BDNF treatment blocks
almost all caspase3 activation and cleavage of its
substrates, resulting in significant neuroprotection
against HIinduced cortical cells injury.
In conclusion, our experiments demonstrate that
BDNF is able to prevent the degeneration of neo
natal cerebral cells caused by hypoxic insult. In ad
dition, BDNF neuroprotective effects on HI brain
injury in neonatal rats may occur via antiapoptotic
mechanism. The present study may be useful for the
further development of clinical therapies for perinatal
HI encephalopathy induced by cerebral hypoxia.
Acknowledgements
This work was supported by the grant of Research
Institute of Medical Science, Catholic University of
Daegu (2010)
References
1) Kaltschmidt C, Kaltschmidt B, Neumann H, Wekerle H, Baeuerle PA. Constitutive NF-kappa B activity in neurons. Mol Cell Biol 1994;14:3981-92.
2) Volpe JJ. Perinatal brain injury: from pathogenesis to neuroprotection. Ment Retard Dev Disabil Res Rev 2001; 7:56-64.
3) Vannucci SJ, Hagberg H. Hypoxia-ischemia in the immature brain. J Exp Biol 2004;207:3149-54.
4) Lamigeon C, Bellier JP, Sacchettoni S, Rujano M, Jacque-mont B. Enhanced neuronal protection from oxidative stress by coculture with glutamic acid decarboxylase-expressing astrocytes. J Neurochem 2001;77:598-606.
5) Oppenheim RW. Cell death during development of the nervous system. Annu Rev Neurosci 1991;14:453-501.
6) Lalier L, Cartron PF, Juin P, Nedelkina S, Mano S, Bechinger B, et al. Bax activation and mitochondrial insertion during apoptosis. Apoptosis 2007;12:887-96.
7) Oltvai Z. N, Milliman CL, Korsmeyer SJ. Bcl-2 hetero-dimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74:609-19.
8) Takada N, Yamaguchi H, Shida K, Terajima D, Satou Y, Kasuya A, et al. The cell death machinery controlled by Bax and Bcl-XL is evolutionarily conserved in Ciona intestinalis. Apoptosis 2005;10:1211-20.
9) Han BH, D'Costa A, Back SA, Parsadanian M, Patel S, Shah AR, et al. BDNF blocks caspase-3 activation in neonatal hypoxia-ischemia. Neurobiol Dis 2000;7:38-53.
10) Adamec E, Yang F, Cole GM, Nixon RA. Multiple-label immunocytochemistry for the evaluation of nature of cell death in experimental models of neurodegeneration. Brain Res Brain Res Protoc 2001;7:193-202.
11) Cheng Y, Deshmukh M, D'Costa A, Demaro JA, Gidday J, Shah A, et al. Caspase inhibitor affords neuroprotection with delayed administration in a rat model of neonatal hypoxi-cischemic brain injury. J Clin Invest 1998;101:1992-9.
12) Reichardt LF. Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci 2006;361:1545-64.
13) Tapia-Arancibia L, Rage F, Givalois L, Arancibia S. Phy-siology of BDNF: focus on hypothalamic function. Front Neuroendocrinol 2004;25:77-107.
14) Lewin GR, Barde YA. Physiology of the neurotrophins. Annu Rev Neurosci 1996;19:289-317.
15) Schäbitz WR, Sommer C, Zoder W, Kiessling M, Schwanin-
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
- 26 -
ger M, Schwab S. Intravenous brain-derived neurotrophic factor reduces infarct size and counterregulates Bax and Bcl-2 expression after temporary focal cerebral ischemia. Stroke 2000;31:2212-7.
16) Cheng Y, Gidday JM, Yan Q, Shah AR, Holtzman DM. Marked age-dependent neuroprotection by brain-derived neurotrophic factor against neonatal hypoxic-ischemic brain injury. Ann Neurol 1997;41:521-9.
17) Liu YJ, Zhuang J, Zhu HY, Shen YX, Tan ZL, Zhou JN. Cultured rat cortical astrocytes synthesize melatonin: ab-sence of a diurnal rhythm. J Pineal Res 2007;43:232-8.
18) Brewer GJ. Isolation and culture of adult rat hippocampal neurons. J Neurosci 1997;71:143-55.
19) Callahan DJ, Engle MJ, Volpe JJ. Hypoxic injury to de-veloping glial cells: protective effect of high glucose. Pediatr Res 1990;27:186-90.
20) Hong SS, Gibney GT, Esquilin M, Yu J, Xia Y. Effect of pro-tein kinases on lactate dehydrogenase activity in cortical neurons during hypoxia. Brain Res 2004;1009:195-202.
21) Arancibia S, Silhol M, Moulière F, Meffre J, Höllinger I, Maurice T, et al. Protective effect of BDNF against beta-amyloid induced neurotoxicity in vitro and in vivo in rats. Neu robiol Dis 2008;31:316-26.
22) Simonian NA, Coyle JT. Oxidative stress in neurodegenera-tive diseases. Annu Rev Pharmacol Toxicol 1996;36:83-106.
23) Dirnagl U, Iadecola C, Moskowitz MA. Pathobiology of ischaemic stroke: an integrated view. Trends Neurosci 1999; 22:391-7.
24) Sauvageot CM, Stiles CD. Molecular mechanisms con-trolling cortical gliogenesis. Curr Opin Neurobiol 2002;12: 244-9.
25) Garcia CM, Darland DC, Massingham LJ, D'Amore PA. Endothelial cell-astrocyte interactions and TGF beta are required for induction of blood-neural barrier properties. Brain Res Dev Brain Res 2004;152:25–38.
26) Chen Y, Swanson RA. Astrocytes and brain injury. J Cereb Blood Flow Metab 2003;23:137-49.
27) Nedergaard M, Ransom B, Goldman SA. New roles for astrocytes: redefining the functional architecture of the brain. Trends Neurosci 2003;26:523-30.
28) Honig LS, Rosenberg RN. Apoptosis and neurologic disease. Am J Med 2000;108:317-30.
29) Olney JW, Tenkova T, Dikranian K, Muglia LJ, Jermako-wicz WJ, D'Sa C, et al. Ethanol-induced caspase-3 activation in the in vivo developing mouse brain. Neurobiol Dis 2002; 9:205-19.
30) Merry DE, Veis DJ, Hickey WF, Korsmeyer SJ. bcl-2 protein expression is widespread in the developing nervous system and retained in the adult PNS. Development 1994;120:301-11.
31) Vekrellis K, McCarthy MJ, Watson A, Whitfield J, Rubin LL, Ham J. Bax promotes neuronal cell death and is down-regulated during the development of the nervous system. Development 1997;124:1239-49.
32) Parikh N, Koshy C, Dhayabaran V, Perumalsamy LR, Sowd hamini R, Sarin A. The N-terminus and alpha-5, alpha-6 helices of the pro-apoptotic protein Bax, modulate functional interactions with the anti-apoptotic protein Bcl-xL. BMC Cell Biol 2007;8:16.
33) Chen J, Graham SH, Nakayama M, Zhu RL, Jin K, Stetler RA, et al. Apoptosis repressor genes Bcl-2 and Bcl-x-long are expressed in the rat brain following global ischemia. J Cereb Blood Flow Metab 1997;17:2-10.
34) Hara A, Iwai T, Niwa M, Uematsu T, Yoshimi N, Tanaka T, et al. Immunohistochemical detection of Bax and Bcl-2 proteins in gerbil hippocampus following transient forebrain ischemia. Brain Res 1996;711:249-53.
35) Almli CR, Levy TJ, Han BH, Shah AR, Gidday JM, Holtz-man DM. BDNF protects against spatial memory deficits following neonatal hypoxia-ischemia. Exp Neurol 2000; 166:99-114.
36) Koh JY, Gwag BJ, Lobner D, Choi DW. Potentiated necrosis of cultured cortical neurons by neurotrophins. Science 1995;268:573-5.
37) Miyata K, Omori N, Uchino H, Yzmafuchi T, Isshiki A, Shibasaki F. Involvement of the brain-derived neurotrophic factor/TrkB pathway in neuroprotective effect of cyclos-porine A in forebrain ischemia. Neuroscience 2001;105:571-8.
38) Barnabé-Heider F, Miller FD. Endogenously produced neurotrophins regulate survival and differentiation of cor-tical progenitors via distinct signaling pathways. J Neurosci 2003;23:5149-60.
39) Sochocka E, Juurlink BH, Code WE, Hertz V, Peng L, Hertz L. Cell death in primary cultures of mouse neurons and astrocytes during exposure to and 'recovery' from hypoxia, substrate deprivation and simulated ischemia. Brain Res 1994;28:21-8.
40) Al Ahmad A, Gassmann M, Ogunshola OO. Maintaining blood-brain barrier integrity: pericytes perform better than astrocytes during prolonged oxygen deprivation. J Cell Physiol 2009;218:612-22.
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
- 27 -
= 국 문 초 록 =
목적: 주산기 저산소성 허혈성 뇌병증은 뇌성마비, 정신지체, 학습 장애, 간질 등 영구적인 신경학적 후유증을 남길
수 있다. 저산소성 허혈성 뇌손상은 necrosis 또는 apoptosis를 통해 세포 죽음을 유도한다. Neurotrophin계에 속한
BDNF는 신경세포의 생존, 분화 및 유지에 중요한 역할을 한다. 이에 본 연구에서는 신생 흰쥐의 대뇌 세포를 사용하여
저산소성 허혈성 뇌손상에서 항 세포사멸사 기전을 통한 BDNF의 신경보호작용 효과를 알아보고자 한다.
방법: 생후 1일된 신생흰쥐의 대뇌피질 세포(성상세포)와 재태기간 14일된 태아흰쥐의 대뇌피질 세포(신경세포)를 각
각 배양하였다. 저산소 상태에 노출시키기 24시간 전, BDNF를 처리 하고 1% 산소(94% N2, 5% CO2)와 low glucose 상
태에서 6시간 또는 18시간 동안 뇌세포손상을 유도하였다. 세포 사멸사와 관련된 Bcl-2와 Bax의 발현을 알아보기 위해
추출된 RNA로 real-time PCR를, 단백질은 western blotting을 시행하였다. Caspase-3 활성은 caspase activity assay
kit로 측정하였다.
결과: 성상세포와 신경세포에서 Bcl-2의 발현은 정상군과 비교했을 때 저산소군에서 감소하였으며, BDNF를 처리한 군
에서는 저산소군 보다 증가하였다. 하지만 Bax 발현과 Bax/Bcl-2의 비, Caspase-3 활성은 반대의 결과로 나타났다. 짧
은 시간인 6시간 동안 저산소 상태에 노출 시킨 성상세포에서는 세포 사멸사와 관련된 발현 반응이 뚜렷하게 나타나지
않았다.
결론: BDNF은 저산소 손상으로 야기된 대뇌세포들의 변질을 항 세포사멸사 조절을 통하여 주산기 저산소성 허혈성 뇌
손상에서 신경보호 역할을 하는 것을 알 수 있었다.
중심 단어: 항-apoptosis, BDNF, 저산소-허혈, 신경보호