C-reactive protein induces p53-
mediated cell cycle arrest
in H9c2 cardiac myocyte
Ji-Won Choi
Department of Medical Science
The Graduate School, Yonsei University
C-reactive protein induces p53-mediated cell cycle arrest in H9c2 cardiac myocyte
Directed by Professor Seok-Min Kang
The Master's Thesis submitted to the Department of Medical Science,
the Graduate School of Yonsei University in partial fulfillment of the requirements for the
degree of Master of Medical Science
Ji-Won Choi
December 2010
This certifies that the Master's Thesis of Ji-Won Choi is approved.
------------------------------------ Thesis Supervisor : Seok-Min Kang
------------------------------------ Thesis Committee Member#1 : Hoguen Kim
------------------------------------ Thesis Committee Member#2 : Sungha Park
The Graduate School Yonsei University
December 2010
ACKNOWLEDGEMENTS
I am really grateful to my thesis supervisor Dr. Seok-Min
Kang for encouragement and support. I would like to thank
Dr. Hoguen Kim and Sungha Park for their advice and
concern. I want to show my sincere gratitude to Dr. Ji Hyung
Chung for advice and concern and Kyung Hye Lee for help
and support from experimental guidance to discussion. I wish
to thank those colleagues who have worked at SIRIC: Hyun
Ju Jeon, Soo-Young Kim, Beom Seob Lee, Da Jeong Lee, Bo
Hyun Kim, Sun-Ju Lee, Il-Kwon Kim, Byeong-Wook Song,
Min-ji Cha, EunJu Choi, Onju Ham, Se Yeon Lee, Chang
Yeon Lee, Jun Hee Park, Eun Hye Lee, Hyung-Ho Moon,
Dong Kyu Kim, Sook Kyoung Kim, Pil Sung Yang, Su-
hyouck Kim, Eun Young Choi, Eun Sook Kim.
Finally, I would like to give my gratitude to my family for
their understanding and sacrifice especially my husband
Chang Hyun Park.
TABLE OF CONTENTS
ABSTRACT .................................................................................... 1
I. INTRODUCTION ....................................................................... 3
II. MATERIALS AND METHODS ................................................ 5
1. MATERIALS ........................................................................... 5
2. METHODS ................................................................................ 5
A. Cell culture .............................................................................. 6
B. Measurement of cell viability and proliferation ...................... 6
C. Caspase-3 activity assay ........................................................ 8
D. Cell cycle analysis ................................................................... 8
E. Western blot ............................................................................. 9
F. RT-PCR ............................................................................... 10
G. DNA-PK activity assay ......................................................... 12
H. siRNA transfection .............................................................. 13
III. RESULTS ............................................................................... 14
1. Effect of CRP on viability, proliferation, and apoptosis of H9c2
cardiac myocytes .................................................................... 14
2. Effect of CRP on cell cycle progression of H9c2 cardiac
myocytes .............................................................................. 17
3. Effect of CRP on cell cycle related proteins, p21, and p53
expression ............................................................................. 19
4. CRP-induced p53 activation depends on ERK pathway ...... 24
5. Intracellular signaling mechanism of CRP through FcγIIIa
receptor ................................................................................. 27
IV. DISCUSSION ....................................................................... 29
V. CONCLUSION ...................................................................... 35
REFERENCES ............................................................................. 36
ABSTRACT(IN KOREAN) ......................................................... 43
LIST OF FIGURES
Fig. 1. CRP inhibits cell viability and cell proliferation .... 15
Fig. 2. CRP has no effect on apoptosis .................................. 16
Fig. 3. CRP induces G0/G1-phase cell cycle arrest .............. 18
Fig. 4. Effects of CRP on regulated proteins related to cell
cycle ................................................................................ 20
Fig. 5. CRP induced p53, p21 expression and
phosphorylation level of p53 ........................................... 22
Fig. 6. CRP-induced p53 activation via ERK pathway ..... 25
Fig. 7. CRP activates ERK pathway and inhibits cell
proliferation ................................................................................ 26
Fig. 8. FcγRIIIa-mediated cell cycle arrest of H9c2 cardiac
myocytes by CRP ...................................................................... 28
1
ABSTRACT
C-reactive protein induces p53-mediated cell cycle arrest
in H9c2 cardiac myocyte
Ji-Won, Choi
Department of Medical Science
The Graduate School, Yonsei University
(Directed by Professor Seok-Min Kang)
C-reactive protein (CRP) is one of the most important biomarkers for
cardiovascular diseases. Recent studies have shown that CRP regulates cell survival,
differentiation, and hypoxia-induced apoptosis. However, the effect of CRP on cell
cycle has not been studied yet. Therefore, our study investigated whether CRP
would regulate cell cycle progression in H9c2 cardiac myocytes.
CRP (10-3 50 μg/ml) inhibited the proliferation of H9c2 cardiac
myocytes dose dependently. Apoptotic analysis demonstrated no effect of CRP on
apoptosis of H9c2 cardiac myocytes. However, flow cytometry analysis showed that
2
CRP-treated H9c2 cardiac myocytes displayed cell cycle arrest in G0/G1 phase. CRP
reduced cell cycle related proteins such as, cdk4 and cdk6, as well as resulted in
increased p53 phosphorylation and p21. CRP-induced activation of p53 was
reduced by extracellular signal-regulated kinase (ERK) inhibitor, U0126 and CRP
also activated ERK activity. We demonstrated that H9c2 cardiac myocytes highly
expressed high amount of FcγRIIIa receptor with activation after CRP treatment.
Silencing FcγRIIIa receptor by siRNA suppressed CRP-mediated ERK, p53, p21
activation and resulted in normalization of cdk6 expression.
These results suggest that activation of ERK and p53 are involved in CRP-
mediated H9c2 cardiac myocytes cell cycle arrest via FcγRIIIa receptor. Our
findings implicate potential effect of CRP on cardiac myocyte survival in
cardiovascular diseases.
Key words : C-reactive protein, cell cycle arrest, cardiac myocyte
3
C-reactive protein induces p53-mediated cell cycle arrest
in H9c2 cardiac myocyte
Ji-Won, Choi
Department of Medical Science
The Graduate School, Yonsei University
(Directed by Professor Seok-Min Kang)
I. INTRODUCTION
CRP (C-reactive protein), an acute phase protein, which belong to the
pentraxin family of protein is a marker of inflammation and a risk factor in
cardiovascular diseases (CVD).1 Previous studies have implicated that CRP acts as a
potential mediator of CVD. CRP is induced in endothelial dysfunction, relative to
atherosclerotic lesion and triggers plaque rupture. CRP is a direct partaker in
pathogenesis as vascular endothelium, coagulation pathway, plaque remodeling, and
complement pathway.2-5 CRP mediates its biological effects in various cell lines via
up-regulation of the FcγI, II, and III. For example, CRP interacts to FcγI receptor in
macrophage-like cell line.6 In human monocytic cell line U-937, CRP interacts to
4
FcγI receptor specifically.7 CRP induces adhesion molecule expression in human
endothelial cells, therefore CRP plays an important role directly in promoting the
inflammatory component of atherosclerosis.8 Moreover, CRP attenuates the
angiogenic and arteriogenic functions of human endothelial progenitor cells (EPCs).
These results cause dysfunction and the vascular regenerative capacity of EPCs.9 In
addition, CRP inhibits EPC survival, differentiation, and function.10 Recently,
inhibition of CRP limits myocardial damage during acute myocardial infarction in
rat models, which suggests that CRP may play an important role in the progression
of cardiac function. Yang et al. demonstrated that CRP augments hypoxia-induced
apoptosis through mitochondrion-dependent pathway in rat neonatal
cardiomyocytes.11 In CRP transgenic mice model, CRP promotes cardiac fibrosis
and inflammation under high Ang II conditions.12 However, the precise underlying
mechanisms of CRP on cardiac myocytes were not completely clear. Furthermore,
the effect of CRP on cell cycle of cardiac myocytes has not been studied yet.
In this study, we investigated the molecular mechanisms of CRP effects on
cell cycle to determine how intracellular signaling pathways are regulated in CRP-
treated H9c2 cardiac myocytes.
5
II. MATERIALS AND METHOD
1. MATERIALS
Human CRP protein purified from pleural fluid was used in this study (cat. no.
AG723, Millipore Co, Bedford, MA, USA). 0.1% NaN3 was removed from purified
human CRP by several dialysis of buffer containing 100mM NaCl, 10mM Tris-HCl
and 2mM Ca2+. To examine the role of kinases in this study, several kinase
inhibitors were selected. ATM/ATR kinase inhibitor, DNA-PK inhibitor (DMNB),
JNK inhibitor (SP600125), PI3K/AKT inhibitor (LY294002) and MEK/ERK
inhibitor (U0126) were obtained from Calbiochem (San Diego, CA, USA). PFT-α,
an inhibitor of p53 transactivation was purchased from Sigma-Aldrich (St. Louis,
MO, USA). Mouse monoclonal antibodies to CDK6, cdc2, and CyclinA and rabbit
polyclonal antibodies to Bcl-2, Bax, p21, CDK2, CyclinE and p21 were acquired
from Abcam (Cambridge, MA, USA). Mouse monoclonal antibody to CyclinD1 and
rabbit polyclonal antibodies to p53 and phospho-specific p53 were obtained from
Cell Signaling Technology (Danvers, MA, USA). Mouse monoclonal antibodies to
phospholyated -ERK, and β-actin and rabbit polyclonal antibodies to Cdk4,
cyclinD1, cyclinB1, Akt, phospholyated -Akt, and ERK were purchased from Santa
Cruz biotechnology (Santa Cruz, CA, USA). HRP-conjugated secondary antibodies
to mouse and rabbit were also acquired from Santa Cruz biotechnology.
2. METHODS
6
A. Cell culture
H9c2 cardiac myocytes from Rattus norvegicus embryo myoblast
myocardium were used in this study. H9c2 cardiac myocytes obtained from
American Type Culture Collection (ATCC, Manassa, VA, USA). Cells were
maintained at 37℃ in a 5% CO2-95% air humidified atmosphere, in Dulbecco’s
modified Eagle’s medium (DMEM, GIbco, Grand Island, NY, USA) supplemented
with 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY, USA) and
1% antibiotics (100 Units/ml of penicillin and 100μg/ml streptomycin) (Gibco,
Grand Island, NY, USA). Cells were plated 2.0 x 104/cm2 every subculture. All
experiments were performed using cells between passage numbers 10 to 25.
B. Measurement of cell viability and proliferation
Cell viability was monitored by the classical 2-(4,5-dimethyltriazol-2-yl)-
2,5-diphenyl tetrazolium bromide (MTT) assay (amresco, Solon, OH, USA). H9c2
cardiac myocytes (2 x 104 cells/well) were incubated for 24 hours in 48-well tissue
culture plate and changed to 0.5% FBS DMEM media for 20 hours starvation. After
starvation, it was treated with CRP of following dose; from 1 ng/ml to 50 μg/ml
during 24 hours, 48 hours, and 72 hours. After treatment, the media was removed
and the media containing 5 mg/ml MTT reagent was added to each well. After
incubation for 2 hours at 37℃, cell supernatants were discarded. MTT crystals were
dissolved with DMSO. Stained MTT was eluted and transferred to 96-well cell
culture plate. The samples were read on 570 nm wave length by ELISA reader (Bio-
7
Rad, Hercules, CA, USA). All assays were performed in triplicate, and the data are
presented as average ± S.D. value. Percent viability was defined as the relative
absorbance of treated versus untreated control cells.
Cell proliferation was determined with Bromodeoxyuridine (BrdU) assay.
BrdU is incorporated into newly synthesized DNA strands of actively proliferating
cells. It is detected immunochemically population of synthesizing DNA. H9c2
cardiac myocytes were plated in 96-well tissue culture plate at 1 x 104 cells/well of
appropriate DMEM and changed 0.5% FBS DMEM for starvation. After starvation
cells were treated with CRP from 1 ng/ml to 50 μg/ml during 24 hours. After then,
cells were detected by BrdU assay kit (Millipore Co, Bedford, MA, USA). Diluted
BrdU addition was 2 hours prior to the end of the CRP incubation. It is necessary to
fix the cells and denature the DNA using the fixing solution. Remove media in plate,
Add 200 μl/well of the fixing solution and incubate at room temperature for 30
minutes. The plate was washed by washing buffer for three times. Then, 100 μl/well
of diluted anti-BrdU were added to the plate and incubated for 1 hour at room
temperature. It was washed three times with washing buffer. After washing, Goat
anti-Mouse IgG, peroxidase conjugate antibody was filtered using a 0.22 μm syringe
filter. This antibody was added 100 μl/well and incubated for 30 minutes at room
temperature. Once more washing step, the plate was included 100 μl/ml of 3,3’,5,5’-
tetramethyl benzidine (TMB) peroxidase substrate and incubated for 30 minutes at
room temperature in the dark. Finally, the plate was added the stop solution 100
μl/well and read using a spectrophotometer microplate reader set at 450 nm.
8
C. Caspase-3 activity assay
Caspase-3 activity assay was measured with ApoAlert® Caspase-3 assay
Kit (Clontech, Palo Alto, USA). It detected the emission shift of 7-amino-
4trifluoromethyl coumarin (AFC). The AFC-substrate conjugate usually emits blue
light at 485 nm. However, cleavage of the substrate fluoresces in yellow-green light
at 535 nm. Fluorometric detection for caspase-3 is performed using a 485 nm
excitation filter and 535 nm emission filter. After plating H9c2 cardiac myocytes on
60 mm cell culture dish, CRP was treated from 0.1 μg/ml to 50 μg/ml during 24
hours. Cells were harvested and centrifuged at 7000 rpm for 3 minutes twice. Then,
cells were suspended 50 μl of chilled cell lysis buffer and incubated on ice for 30
minutes. Cells were centrifuged at 14000 rpm for 1 hour at 4℃ and transferred
supernatants to new microcentrifuge tubes. Protein in supernatants was determined
concentration using bicinchoinic acid (BCA) assay reagent kit as standard with
bovine serum albumin (Sigma, St. Louis, MO, USA). 20 μg of protein mixed 2x
reaction buffer containing 20 mM HEPES (pH 7.4), 100 mM NaCl, 0.5% NP-40, 10
mM DTT, and 1 mM PMSF and 5 μl of 1 mM caspase-3 substrate to each tube. The
mixture was incubated at 37℃ for 2 hours in a water bath. Finally, it is read in a
fluorometer with a 485 nm excitation filter and 535 nm emission filter (multilaverl
counter VICTOR 3, Perkin Elmer, MA, USA).
D. Cell cycle analysis
9
To analyze cell cycle, cells were stained with propidium iodide (PI). PI
was stained whole cells or nucleus that conjugated main groove of double-stranded
DNA, therefore it generated fluorescent. PI was also conjugated double-stranded
RNA, so protected this phenomenon, its mixture were added with RNase. After
treatment 50 μg/ml CRP during 24 hours, cells were washed by PBS twice and
released by trypsinization. It was harvested by centrifuge and washed by PBS for
remove trypsin. Cells were then fixed in 70% ethanol overnight at -20℃. After
centrifugation, ethanol was removed and incubated RNase at 37℃ for 20 minutes.
Cells were subsequently stained with PI and subjected to DNA content analysis
FACS caliber (BD, Ramsey, MN, USA).
E. Western blot
CRP treated cells were suspended in cell lysis buffer containg 40 mM
HEPES (pH 7.5), 120 mM NaCl, 1 mM EDTA, 10% Triton-x100, and 1tablet
EDTA-free protease inhibitor cocktail and incubated on ice for 30 minutes. Cells
were centrifuged at 14000 rpm for 1 hour and supernatants were transferred to new
tubes. Protein concentration of the cell samples was determined using the BCA
assay reagent kit with bovine serum albumin as standard. For Western blot analysis,
10 ~ 30 μg of protein was denatured by heating 95℃ for 5 minutes in SDS sample
buffer, loaded onto 8 ~ 12% SDS polyacrylamide gels, and then transferred
electrically to a poly vinylidene difluoride (PVDF) membrane. (Millipore Co,
10
Bedford, MA, USA) The membrane was blocked in 5% skim milk TBS-tween 20
(TBS-T, 0.1% tween 20) buffer for 1 hour. After blocking the membrane, it was
rinsed three or four times with TBS-T buffer and incubated with primary antibodies
for overnight at 4℃ or 1 hour room temperature. The membrane was washed four
or five times with TBS-T buffer for 7 minutes, and then incubated for 1 hour at
room temperature with horseradish peroxidase (HRP)-conjugated secondary
antibodies. After then, it was visualized for immunoreactivity using an ECL
reagent.(KPL, DC. USA)
F. RT-PCR (Reverse Transcription Polymerase Chain Reaction)
F.1. Isolation of total RNA
Total RNA from H9c2 cardiac myocytes was extracted by Tri-reagent
(Sigma, St. Louis, MO, USA) 1 ml per 100 mm dish and poured chloroform above
Tri-reagent, voltexing a sample about 15 seconds. Then, samples were centrifuged
at 13000 rpm, 4℃ for 15 minutes. The upper layer was transferred into in new tubes
and chloroform was added again. After centrifugation, 2-propanol added to the
upper aqueous phase, and the samples centrifuged at 13000 rpm, 4℃ and 1 hour.
The pellet was washed by 75% ethanol-mixed diethylpyrocarbonate (DEPC) water.
It was centrifuged at 7500g, 4℃ and 5 minutes, supernatants were removed, then
dried on room temperature about 10 minutes. Finally, the RNA pellet was dissolved
11
with 30 μl RNase-free water, and measured by OD260/OD280 with spectrophotometer
(Eppendorf ) for quality and quantity of RNA.
F.2. cDNA synthesis
Complementary DNA (cDNA) was synthesized with ImProm-IITM reverse
transcription system (Promega, Madison, WI, USA). The mixture of 1 μg total RNA
and oligo dT was incubated in heat block at 70℃ for 5 minutes and cooled at ice for
5 minutes. It was added to 5x reaction buffer, dNTP mixture, reverse transcriptase
and NFW and incubated in heat block at 25℃ for 5 minutes. Then the samples were
incubated in heat block at 42℃ for 1 hour, finally reverse transcriptase in the
samples was inactivated at 70℃ for 15 minutes.
F.3. PCR analysis
The cDNA reaction mixture, each 10 pmol primer (forward and backward),
0.1 mM dNTP mixture, 1.25 U of taq polymerase and 10x reaction buffer were
mixed with NFW to final volume of 50 μl. PCR condition was designed as follows:
one cycle of denaturing at 95℃ for 3 minutes followed by number of 25 to 30
cycles of denaturation at 95℃ for 30 seconds, annealing at 58℃ to 60.4℃ for 40
seconds, and elongation at 72℃ for 30 seconds.
The following primer sequence was used: p53 sense primer (5' –GTCATGGAG
GATTCACAGTCGGAT - 3') ; p53 anti-sense primer (5' –TCCTTCCACCCGGATA
12
AGATGTTG- 3') ; FcγR I sense primer (5' –GATAAGAAAGTGTACAATGTGG
CT- 3') ; FcγR I anti-sense primer (5' -GCTGCCCATGTAGAAGGAGAAGTA- 3');
FcγR II sense primer (5' -ATGGACAGCAACAGGACTGTCGTC- 3') ; FcγR II
anti-sense primer (5' -AATCGTCAATACCGGCAACGA- 3') ; FcγR IIIa sense
primer (5' -ATGACTTTGGAGACCCAGATG- 3') ; FcγR IIIa anti-sense primer (5'
-GAACCACACTAGAGAGCTGGT- 3'); GAPDH sense primer (5' –AATGCATCC
TGCACCACCAACTGC- 3') ; GAPDH anti-sense primer (5' –GGAGGCCATGT
AGGCCATGAGGTC- 3'). PCR product was separated by electrophoresis in a
1.0% agarose gel and visualized in Gel- Doc system after staining with Gel-red
(Biotium, Hayward, CA, USA).
G. DNA-PK activity assay
To quantitate DNA-dependent protein kinase activity, SignaTECT® DNA-
Dependent protein kinase (DNA-PK) assay System(a) was used. Using [α-32P]ATP,
phosphorylated DNA-PK was bound to SAM2® membrane. Whole-cell lysates were
prepared from H9c2 cardiac myocyte. 25μg of protein lysate were mixed with
deionized water upto 25μl. It was incubated at 30℃ for 5 minutes and added to
termination buffer. This sample was spotted 10μl onto the SAM2® membrane. It was
washed with 2M NaCl and heated 5 minutes under a heat lamp. This membrane was
detected using liquid scintillation countor LS6500 (Beckman, Pasadena, CA, USA)
adding scintillation fluid.
13
H. siRNA transfection
For silencing FcγR IIIa in H9c2 cardiac myocytes, siRNA was synthesized
based on the selected target sequence: 5' - CTGACTAAGGTCTTGTTGT - 3'. After
plating H9c2 cardiac myocytes in 60 mm dish, Fcγ receptor IIIa siRNA 20nM was
transfected into H9c2 cells using G-fectin reagents (genolution) 7 μl. After 24 hours
incubation, the cells were starved for 20 hours and treated with CRP 50 μg/ml for
RT-PCR and western blot.
14
III. RESULTS
1. Effect of CRP on viability, proliferation, and apoptosis of H9c2 cardiac
myocytes
To investigate the effect of CRP on cell viability, cells were cultured with
various concentration of CRP for 24, 48, 72 hours. CRP was not an effective
inhibitor of viability until 48 hours. However, at 72 hours incubation, CRP inhibited
viability of cells in dose-dependent manner up to 50 μg/ml. (Fig. 1A) To exaine the
effect of CRP on the proliferation of cells, cells were cultured with various
concentration of CRP for 24 hours. CRP inhibited significantly 10 % FBS-
stimulated proliferation of cells. (Fig. 1B) However, caspase-3 activity was not
significantly changed in CRP treated H9c2 cardiac myocytes up to 50 μg/ml. (Fig.
2A) Also, Bcl-2 and Bax expression were not significantly changed by CRP
treatment. (Fig. 2B) Taken together, CRP had an inhibitory effect of CRP on
viability and proliferation, but did not have an effect on apoptosis of H9c2 cardiac
myocytes.
15
Fig. 1. CRP inhibits cell viability and cell proliferation.
A. Cells were serum-starved for 20 hours and then were treated CRP from 1 ng/ml
to 50 μg/ml for 24 hours, 48 hours, and 72 hours. After then, cells were measured
using MTT assay. B. Cells were serum-starved for 20 hours and were treated CRP
for 24 hours. Cell proliferation was confirmed detecting by BrdU assay. (* P < 0.01
vs control)
16
Fig. 2. CRP has no effect on apoptosis.
A. Cells were serum-starved for 20 hours and then were treated with 0.1, 1, 10, and
50 μg/ml of CRP for 24 hours. After treated, cells were harvested and quantified
protein. It was incubated with mixture and measured by fluorometric detector. B.
Cells were serum-starved for 20 hours and incubated with 0.1, 1, 10, and 50 μg/ml
CRP for 48 hours. After incubation, cells were harvested and whole cell lysate was
collected. Bcl-2, Bax and β-actin were detected by western blot. The optical density
is expressed in arbitrary units normalized against a control. Data in histograms
represent means±SD from 3 experiments.
17
2. Effect of CRP on cell cycle progression of H9c2 cardiac myocytes
Next, we investigated relationship between CRP and cell cycle
progression using FACS analysis. Cell cycle analysis showed that 50 μg/ml of CRP
led to increase in the percentage of cells in G0/G1 phase about 15% and decrease in
the percentage of S and G2/M phase about 15% (Fig. 3). This finding suggests that
CRP induces G0/G1 phase cell cycle arrest in H9c2 cardiac myocytes.
18
Fig. 3. CRP induces G0/G1-phase cell cycle arrest.
Cells were plated at 1 x 105 cells/well and serum-starved for 20 hours and incubated
with 1 and 50 μg/ml CRP for 24 hours in 10% FBS. Then, cells were fixed for
alcohol and strained PI solution. Cells were analyzed by means of a FACS Calibur
cytometer. A representative set of data from one of three independent experiments is
shown. A. Shown the cell number and DNA content in graph. B.
19
3. Effect of CRP on cell cycle related proteins, p21, and p53 expression
To investigate the change of cell cycle related proteins, we performed
western blots for CDK2, CDK4, CDK6, cdc2, cyclin A, cyclin B1, cyclin D1, cyclin
E. Among them, levels of CDK4 and CDK6 were decreased significantly following
CRP treatment in dose-dependent manner. Compared with untreated cells, cyclin D1
and CDK2 were also significantly decreased at 50 μg/ml of CRP. (Fig. 4)
The cell cycle proteins are regulated by upstream regulator, p21 mediated by p53.
As shown in Fig. 5A, 50 μg/ml of CRP induced phosphorylation of p53
dramatically after 48 hours incubation, so we performed further study with 48 hours
incubation. Expression of p53 and p21 and phosphorylation level of p53 were
increased dose dependently in CRP treated H9c2 cardiac myocytes. (Fig. 5B)
Moreover, RT-PCR product of p53 expression was also steadily increased after CRP
treatment. (Fig. 5C)
20
21
Fig. 4. Effects of CRP on regulated proteins related to cell cycle.
Cells were serum-starved for 20 hours and incubated with 0.1, 1, 10, and 50 μg/ml
CRP for 24 hours. After incubation, the cells were harvested and whole cell lysate
was collected. Expression of CDK4, CDK6, clyclin D1, cyclin E, CDK2, cyclin A,
cdc2, cyclin B1, and β-actin were detected by western blot. The optical density is
expressed in arbitrary units normalized against a control. Data in histograms
represent means±SD from 3 experiments. (* P < 0.01 vs control)
22
23
Fig. 5. CRP induced p53, p21 expression and phosphorylation level of p53.
Cells were incubated with 50 μg/ml CRP for 24, 48, 72 hours. After treatment cell
lysates were detected p-p53, p53, p21 and β-actin using western blot. B. Cells were
incubated with 0.1, 1, 10 and 50 μg/ml CRP during 48 hours. Western blot was
executed with whole cell lysates. C. CRP were treated with cells and incubated for
24 hours. Isolation of total RNA was used chloroform and 2-propanol and cDNA
synthesis was used reverse transcription system kit. The optical density is expressed
in arbitrary units normalized against a control. Data in histograms represent
means±SD from 3 experiments.
24
4. CRP-induced p53 activation depends on ERK pathway.
p53 are activated by various upstream kinases, such as ATM/ATR, DNA-
PK, JNK, ERK, AKT. To determine which of these kinases is responsible for the
activation of p53, inhibitor experiments for kinases were performed. The levels of
p21 expression and p53 phosphorylation were decreased after only DNA-PK
inhibitor (5 M), EKR inhibitor, U0126 (5 M) and AKT inhibitor, LY294002 (2
M) pre-treatment in CRP treated H9c2 cardiac myocytes. (Fig. 6A) We set out
further study to determine which kinases are responsible for inhibitory effect of
CRP on cell proliferation. Fig. 6B shows that the inhibitory effect of CRP on cell
proliferation and CDK4 were disappeared after pre-treatment of U0126 (5 M), but
not after LY294002 pre-treatment. In addition, DNA-PK activity was not change
incubating with CRP (Fig. 6C). Therefore, we suggest that CRP induced p53
activation via ERK activation. We next examined the level of expression and
phosphorylation of ERK in CRP treated H9c2 cardiac myocytes. The level of
phosphorylated ERK was increased dramatically after 4 hours, 12 hours, 24 hours,
and 48 hours (Fig. 7A). The level of phosphorylated Akt was also increased only
after 48 hours. (data not shown)
We also determined the effects of U0126 and PFT-α (p53 inhibitor) on the
phosphorylation level of 53 and p21 expression. The increased level of
phosphorylated p53 and p21 expression by CRP were dramatically attenuated by
U0126 and PFT-α pre-treatment (Fig. 7B). Fig. 7C shows that the inhibitory effect
of CRP on cell proliferation was also disappeared after pre-treatment of PFT-α.
25
Fig. 6. CRP-induced p53 activation via ERK pathway.
A. Inhibitors were pretreated with the cells and incubated for 1 hour. (2 μM
ATM/ATR inhibitor, 5 μM DNA-PK inhibitor, 2 μM JNK inhibitor, 5 μM U0126,
and 2 μM LY294002) Then, 50 μg/ml of CRP were incubated with the cells during
48 hours. Western blot was executed with whole cell lysates. B. Inhibitors were
pretreated with the cells and incubated for 1 hour. (5 μM, U0126 and 2 μM,
LY2946002) After pre-treatment, 50 μg/ml of CRP were incubated with the cells
during 48 hours. BrdU assay and western blot were executed with whole cells.
(**P<0.05 vs control) C. Cells were incubated with 0.1, 1, 10 and 50 μg/ml CRP
during 48 hours. DNA-PK activity was executed with whole cell lysates using
DNA-PK assay system kit.
26
Fig. 7. CRP activates ERK pathway and inhibits cell proliferation.
A. Cells were incubated with 50 μg/ml CRP for 30 minutes, 1 hour, 4 hours, 12
hours, 24 hours, 48 hours. Whole cell lysates were executed for western blot
analysis to detect changes in phosphorylated ERK, and ERK. B. 5 μM of U0126
and 5 μM of PFT-α were pretreated with the cells and incubated for 1 hour. 50
μg/ml of CRP were incubated with the cells during 48 hours. Western blot was
executed with whole cell lysates. C. Cells were plated in 96-well tissue culture
plates. Inhibitors were pretreated with the cells and incubated for 1 hour (5 μM of
U0126 and 5 μM of PFT-α). After then, 50 μg/ml of CRP were incubated with cells
during 48 hours. BrdU assay was executed with whole cells. The optical density is
expressed in arbitrary units normalized against a control. Data in histograms
represent means±SD from 3 experiments. (**P < 0.05 vs control)
27
5. Intracellular signaling mechanism of CRP through FcγIIIa receptor.
First, we investigated the presence of CRP receptors with RT-PCR in
H9c2 cardiac myocytes. We found that expression of FcγIIIa receptor was certainly
detected and its expression was more increased after treatment with 50 μg/ml of
CRP. (Fig. 8A) To verify intracellular signaling mechanism of CRP through FcγIIIa
receptor, H9c2 cardiac myocytes were exposed to 20 nM of FcγIIIa small
interference RNA (siRNA) for 24 hours. Transient transfection with siRNA
attenuated CRP-induced expression of FcγIIIa receptor and p53 activity. In addition,
siRNA attenuated CRP-induced expression of phosphorylated p53, p21,
phosphorylated ERK, and CDK6.
28
Fig. 8. FcγRIIIa-mediated cell cycle arrest of H9c2 cardiac myocytes by CRP.
A. Each panel shows RT-PCR products for expression of Fcγ receptors. Cells were
incubated in the presence or absence of CRP for 24 hours. Cells were isolated into
mRNA and synthesized cDNA. PCR product was established by DNA
electrophoresis and visualized by Gel-red. Only FcγIIIa receptor was identified. B.
Cells were plated with FcγIIIa siRNA transfection during 24 hours, and starved for
20 hours. After starvation, cells were treated with 50 μg/ml of CRP and harvested
for RT-PCR and western blot. The optical density is expressed in arbitrary units
normalized against a control. Data in histograms represent means ± SD from 3
experiments.
29
IV. DISCUSSION
Numerous studies in the past few years have carried out on the value of CRP
as a risk factor or biomarker of cardiovascular diseases. In addition, recent evidence
from several cell types suggests that CRP is not only a serum marker but also plays
a key role in cell death, angiogenesis, and immune response.16-18 Although
increasing evidences suggest that, besides CRP’s role as a diagnostic and prognostic
marker, it may play important roles in pathophysiological processes against
different cells, little is known about the effect of CRP on cell cycle. The present
study revealed that CRP leads to G0/G1 phase cell cycle arrest via p53-dependent
pathways by ERK activation. Several major in vitro studies have shown that CRP
exerts a multitude of harmful effects on vascular endothelial cells.19-20 CRP also
elicits direct proatherogenic effects on vascular smooth muscle cells via
upregulation of angiotensin II type I receptor, stimulating reactive oxygen species
(ROS) production.21 Furthermore, CRP has recently emerged as an important factor
in the progression of cardiac dysfunction.11,22 However, direct biological effects of
CRP on cardiac myocytes were poorly studied. Because, in particular, terminally
differentiated mammalian tissues such as adult cardiomyocytes have been thought
as being definitively withdrawn from the cell cycle,23 it is not surprising that effects
of CRP for cell cycle of cardiac myocytes have remained neglected until recently.
Several evidences have shown that replication of cardiac myocytes is
required for the maintenance of cardiac mass under ischemic and non-ischemic
injury. Indeed, more studies have showed that transplantation of precursor cells,
30
such as cardiac, mesenchymal, or bone marrow stem cells, could improve cardiac
function.24-26 These results indicate that undifferentiated precursor cells can
contribute to the formation of new cardiac tissue, which is accompanied by cell
divisions with cell cycle progression.27 In contrast, changes of cell cycle proteins in
response to some types of cellular injury results in the cell cycle arrest that
subsequently induces cell division defect and cellular senescence, leading to cell
death.28 A number of studies have reported that CRP induces apoptosis in coronary
vascular smooth muscle cells and endothelial progenitor cells, via upregulation of
growth arrest gene and ROS production, respectively.16,29 On the other hand, CRP
alone does not induce apoptosis in cardiac myocytes under normal condition, even
though it can enhance apoptotic cell death in hypoxia-stimulated myocytes.11 Also,
in our results, CRP has no significant apoptotic effect on H9c2 cells which is
cardiac myoblasts derived from embryonic rat heart tissue, although the long-term
treatment of cells with CRP decreases cell viability. Thus, it is conceivable that CRP
may affect events leading to cell death in cardiac myocytes, mediated by different
action mechanisms (i.e. cell cycle arrest), rather than apoptotic cell death.
In the present study we have shown that CRP-treated H9c2 cells undergo
G0/G1 phase cell cycle arrest which is accompanied by decreases in CDK4, CDK6,
and cyclin D1. Cell cycle is one of the key factors contributing to cardiac growth
during early embryonic cardiac cells like H9c2 cells. Cell cycle progression of
cardiac myocytes at embryonic stage of heart is coupled with the sequential
expression and activation of cyclins and cyclin‐dependent kinases (CDKs) just like
31
basic events of the mammalian cell cycle.27 In our results, interestingly, p53 protein
levels increased following exposure to CRP in a dose-dependent manner. CRP
treatment could also lead to a significant increase in p53 phosphorylation on Ser15.
The p53 protein has a very short half-life and low levels under normal condition in
cells which exists in a largely inactive state. Activation of p53 in response to a
variety of stimuli is associated with an increase in its protein levels and post-
translational modifications such as phosphorylation, which induces to the activation
of a number of genes like p21, leading to trigger cell cycle arrest.30 We also
observed that CRP induces a significant increase in the level of p21 that is known to
inhibit the activity of cyclin D-CDK4 complex, thus leading to G0/G1 phase arrest.
These observations suggest that p53 may play a critical role in CRP-induced cell
cycle arrest in cardiac cells. Indeed, treatment with a specific p53 inhibitor PFT-α
restored the levels of CDK4, CDK6, and cyclin D1 reduced by CRP.
The N-terminal transcriptional activation domain of p53 contains several
phosphorylation sites including Ser15 and Ser20, crucial for its activation. Several
protein kinases have been shown to phosphorylate p53 at distinct sites in N-terminal
domain. Among N-terminal phosphorylation sites, Ser15 has been known to be one
of the key residues, which contributes to the stabilization and accumulation of p53
through disruption of mdm2 binding.30 Previous studies have been reported that
several protein kinases, such as DNA-PK and ATM are thought to be responsible for
Ser15 phosphorylation of p53.31,32 Recently, ERK has been shown to phosphorylate
p53 protein at Ser 15 in response to acrylamide and doxorubicin in neuroblastoma
32
and H9c2 cells, respectively.33,34 In this study, we found that significant increase
was detected in the phosphorylation level of ERK in CRP-treated cells. Furthermore,
pretreatment of a specific ERK inhibitor, U0126, resulted in decreased
phosphorylation at Ser15 of p53. These results strongly suggest that ERK acts as the
upstream kinase for CRP-induced p53 phosphorylation. In addition, change of p53
phosphorylation by ERK inhibitor was found to parallel the protein levels of p53
and p21, consecutive to reentry into the cell cycle. As a result, CRP-induced p53
phosphorylation through ERK activation thought to be correlated with total level of
p53, possibly implicating Ser15 in stabilization and activation of p53, and leading to
cell cycle arrest.
The p53 traditionally has been thought to be a key guardian of the genome.
It is well documented that p53 is activated in response to a variety of genotoxic
stimuli, such as ultraviolet light, ionizing radiation, and mutagenic chemical agents,
which cause DNA damage, resulting in cell cycle arrest or apoptosis.35 The cell
cycle arrest that occurs in response to diverse genotoxic stresses is indispensable for
DNA repair to maintain genomic integrity. If DNA damage cannot be successfully
repaired, activated p53 induces mechanisms that lead to apoptotic cell death in order
to block abnormal cell proliferation.30,35 However, recent studies demonstrated that
nongenotoxic compounds, such as RITA, Nutlin-3, and MI-219 also can induce
stabilization and accumulation of p53, resulting in the activation of p53 in absence
of DNA damage.36-38 In normal cells, the activation of p53 by a nongenotoxic agent
induces cell cycle arrest but not cell death.33 Recent work has suggested that a
33
nongenotoxic compound rather induces cellular senescence.39 It has been reported
that low dose of doxorubicin also slightly increases p53 protein, thereafter inducing
cellular senescence instead of apoptotic cell death in cultured neonatal rat
cardiomyocytes.40 Although relationship between p53 regulating cell cycle arrest
and apoptosis has been extensively studied, little is known about p53 involvement
in cellular senescence yet. The cell cycle arrest is a hallmark of cellular senescence
that is accompanied by changes in the expression of many proteins that regulates
cell cycle, cytoskeletal structures, and cellular morphology.41 H9c2 cells treated
with CRP presented morphological changes, such as flattened and enlarged cell
shapes, consistent with phenotypic characteristics of cellular senescence. Based on
these findings including CRP-induced p53 activation, we propose that cardiac cell
death in response to CRP is not due to the apoptotic mechanisms, but rather is the
result of cellular senescence, given that p53 is regarded as a typical inducer of
senescence, acting as the regulator of cell cycle. In particular, cardiac myoctyes are
continually exposed to stresses from many endogenous sources, and cellular
senescence is likely to be the factor responsible for the decrease in cardiac myocytes
number in aging heart.42 As elevation of CRP reflects the extent of myocardial death
and correlates with cardiac outcomes following AMI,43,44 cardiac cell senescence
may be affected by CRP, which induces cell death and net reduction in myocyte
number, subsequent pathological consequences of the heart, such as myocardial
infarction and heart failure. Further investigation is required to determine the
contribution of CRP to change cell fate through induction of cell cycle arrest and
34
cellular senescence in adult cardiomyocytes, given that no cell division or limited
proliferation particularly in response to pathological stimuli is observed in adult
myocardium.
Previous studies have reported that CRP binds to Fc-gamma (Fcγ) receptors,
such as CD16a (FcγRIIIa), CD32 (FcγRII), and CD64 (FcγRI) in various cells.45
However, to date, no reports have determined a CRP receptor on cardiomyoctyes. In
our study, we observed that FcγRIIIa was expressed in H9c2 cells, and its
expression level increased in response to CRP treatment. In addition, increased
phosphorylation of p53 and ERK induced by CRP is reversed considerably by
FcγRIIIa knock-down using siRNA. FcγRIIIa siRNA transfection also restored the
levels of cell cycle proteins. These results indicate that CRP binding to activating
FcγRIIIa may be necessary for the ERK signaling and thereby activating the p53-
mediated cell cycle arrest in H9c2 cells. Although additional studies are required to
determine specific signaling molecules between FcγRIIIa and ERK for CRP-
mediated p53 activation, our data have provided the first proposal on the novel
insights into how CRP directly affects pathophysiological processes such as cell
cycle and senescence in cardiac myocytes.
35
V. CONCLUSION
In conclusion, we found that CRP induces G0/G1 phase cell cycle arrest
through activation of ERK and p53 in H9c2 cardiac myocytes via FcγRIIIa receptor.
Therefore, our studies implicate potential effect of CRP on cardiac myocyte survival
and senescence in cardiovascular diseases.
36
REFERENCE
1. Tillett WS, Francis T. Serological reactions in pneumonia with a non-protein
somatic fraction of pneumococcus. J Exp Med. 1930; 30; 52: 561-71.
2. Jialal I, Devaraj S, Venugopal SK. C-reactive protein: Risk marker or Mediator in
atherothrombosis? Hypertension. 2004l; 44: 6-11.
3. Scirica BM, Morrow DA. Is C-reactive protein an innocent bystander or
proatherogenic culprit? The verdict is still out. Circulation. 2006; 113: 2128-34.
4. Blake GJ, Ridker PM. C-reactive protein: a surrogate risk marker or mediator of
therothrombosis? Am J Physiol Regul Integr Comp Physiol. 2003; 285: R1250-2.
5. Bisoendial RJ, Boekholdt SM, Vergeer M, Stroes ES, Kastelein JJ. C-reactive
protein is a mediator of cardiovascular disease. Eur Heart J. 2010; 31: 2087-91.
6. Tron K, Manolov DE, Röcker C, Kächele M, Torzewski J, Nienhaus GU. C-
reactive protein specifically binds to Fcgamma receptor type I on a macrophage-like
cell line. Eur. J. Immunol. 2008; 38: 1414–22
7. Crowell RE, Du Clos TW, Montoya G, Heaphy E, Mold C. C-reactive protein
receptors on the human monocytic cell line U-937. Evidence for additional binding
to Fc gamma RI. J Immunol. 1991; 15; 147 :3445-51.
8. Pasceri V, Willerson JT, Yeh ET. Direct Proinflammatory Effect of C-Reactive
Protein on Human Endothelial Cells. Circulation. 2000; 102: 2165-8.
9. Suh W, Kim KL, Choi JH, Lee YS, Lee JY, Kim JM, Jang HS, et al. C-reactive
37
protein impairs angiogenic functions and decreases the secretion of arteriogenic
chemo-cytokines in human endothelial progenitor cells. Biochem Biophys Res
Commun. 2004; 321: 65–71
10. Verma S, Kuliszewski MA, Li SH, Szmitko PE, Zucco L, Wang CH, et al. C-
reactive protein attenuates endothelial progenitor cell survival, differentiation, and
function: further evidence of a mechanistic link between C-reactive protein and
cardiovascular disease. Circulation. 2004; 109: 2058-67
11. Yang J, Wang J, Zhu S, Chen X, Wu H, Yang D, Zhang J. C-reactive protein
augments hypoxia-induced apoptosis through mitochondrion-dependent pathway in
cardiac myocytes. Mol Cell Biochem. 2008; 310: 215-26.
12. Zhang R, Zhang YY, Huang XR, Wu Y, Chung AC, Wu EX, et al. C-reactive
protein promotes cardiac fibrosis and inflammation in angiotensin II-induced
hypertensive cardiac disease. Hypertension. 2010; 55: 953-60.
13. Doronzo G, Russo I, Trovati M, Anfossi G. Sodium azide in commercially
available C-reactive protein preparations does not influence matrix
metalloproteinase-2 synthesis and release in cultured human aortic vascular smooth
muscle cells. Clin Chem. 2006; 52: 1200-1.
14. Swafford AN Jr, Bratz IN, Knudson JD, Rogers PA, Timmerman JM, Tune JD,
et al. C-reactive protein does not relax vascular smooth muscle: effects mediated by
sodium azide in commercially available preparations. Am J Physiol Heart Circ
Physiol. 2005; 288: H1786-95.
15. Lafuente N, Azcutia V, Matesanz N, Cercas E, Rodríguez-Mañas L, Sánchez-
38
Ferrer CF, et al. Evidence for sodium azide as an artifact mediating the modulation
of inducible nitric oxide synthase by C-reactive protein. J Cardiovasc Pharmacol.
2005; 45: 193-6.
16. Fujii H, Li SH, Szmitko PE, Fedak PW, Verma S. C-reactive protein alters
antioxidant defenses and promotes apoptosis in endothelial progenitor cells.
Arterioscler Thromb Vasc Biol. 2006; 26: 2476-82.
17. Schneeweis C, Gräfe M, Bungenstock A, Spencer-Hänsch C, Fleck E, Goetze S.
Chronic CRP-exposure inhibits VEGF-induced endothelial cell migration. J
Atheroscler Thromb. 2010; 17: 203-12.
18. Hanriot D, Bello G, Ropars A, Seguin-Devaux C, Poitevin G, Grosjean S, et al.
C-reactive protein induces pro- and anti-inflammatory effects, including activation
of the liver X receptor alpha, on human monocytes. Thromb Haemost. 2008; 99:
558-69.
19. Wang Q, Zhu X, Xu Q, Ding X, Chen YE, Song Q. Effect of C-reactive protein
on gene expression in vascular endothelial cells. Am J Physiol Heart Circ Physiol
2005; 288: H1539-45.
20. Li L, Roumeliotis N, Sawamura T, Renier G. C-reactive protein enhances LOX-
1 expression in human aortic endothelial cells: relevance of LOX-1 to C-reactive
protein-induced endothelial dysfunction. Circ Res. 2004; 95: 877-83.
21. Wang CH, Li SH, Weisel RD, Fedak PW, Dumont AS, Szmitko P, Li RK,
Mickle DA, Verma S. C-reactive protein upregulates angiotensin type 1 receptors in
vascular smooth muscle. Circulation. 2003; 107: 1783-90.
39
22. Pepys MB, Hirschfield GM, Tennent GA, Gallimore JR, Kahan MC, Bellotti V,
et al. Targeting C-reactive protein for the treatment of cardiovascular disease.
Nature 2006; 440: 1217-21.
23. Walsh S, Ponten A, Fleischmann BK, Jovinge S. Cardiomyocyte cell cycle
control and growth estimation in vivo - an analysis based on cardiomyocyte nuclei.
Cardiovasc Res. 2010; 86: 365-73.
24. Barile L, Chimenti I, Gaetani R, Forte E, Miraldi F, Frati G, et al. Cardiac stem
cells: isolation, expansion and experimental use for myocardial regeneration. Nat
Clin Pract Cardiovasc Med. 2007; 4: S9-S14.
25. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, et al.
Monolayered mesenchymal stem cells repair scarred myocardium after myocardial
infarction. Nat Med. 2006; 12: 459-65.
26. Zeng L, Hu Q, Wang X, Mansoor A, Lee J, Feygin J, et al. Bioenergetic and
functional consequences of bone marrow-derived multipotent progenitor cell
transplantation in hearts with postinfarction left ventricular remodeling. Circulation.
2007; 115: 1866-75.
27. Ahuja P, Sdek P, MacLellan WR. Cardiac myocyte cell cycle control in
development, disease, and regeneration. Physiol Rev. 2007; 87: 521-44.
28. Campisi J, d'Adda di Fagagna F. Cellular senescence: when bad things happen
to good cells. Nat Rev Mol Cell Biol. 2007; 8: 729-40.
29. Blaschke F, Bruemmer D, Yin F, Takata Y, Wang W, Fishbein MC, et al. C-
reactive protein induces apoptosis in human coronary vascular smooth muscle cells.
40
Circulation. 2004; 110: 579-87.
30. Lavin MF, Gueven N. The complexity of p53 stabilization and activation. Cell
Death Differ. 2006; 13: 941-50.
31. Achanta G, Pelicano H, Feng L, Plunkett W, Huang P. Interaction of p53 and
DNA-PK in response to nucleoside analogues: potential role as a sensor complex
for DNA damage. Cancer Res. 2001; 61: 8723-9.
32. Tritarelli A, Oricchio E, Ciciarello M, Mangiacasale R, Palena A, Lavia P, et al.
p53 localization at centrosomes during mitosis and postmitotic checkpoint are
ATM-dependent and require serine 15 phosphorylation. Mol Biol Cell. 2004; 15:
3751-7.
33. Okuno T, Matsuoka M, Sumizawa T, Igisu H. Involvement of the extracellular
signal-regulated protein kinase pathway in phosphorylation of p53 protein and
exerting cytotoxicity in human neuroblastoma cells (SH-SY5Y) exposed to
acrylamide. Arch Toxicol. 2006; 80: 146-53.
34. Liu J, Mao W, Ding B, Liang CS. ERKs/p53 signal transduction pathway is
involved in doxorubicin-induced apoptosis in H9c2 cells and cardiomyocytes. Am J
Physiol Heart Circ Physiol. 2008; 295: H1956-65.
35. Helton ES, Chen X. p53 modulation of the DNA damage response. J Cell
Biochem. 2007; 100: 883-96.
36. Secchiero P, Barbarotto E, Tiribelli M, Zerbinati C, di Iasio MG, Gonelli A, et al.
Functional integrity of the p53-mediated apoptotic pathway induced by the
nongenotoxic agent nutlin-3 in B-cell chronic lymphocytic leukemia (B-CLL).
41
Blood. 2006; 107: 4122-9.
37. Rinaldo C, Prodosmo A, Siepi F, Moncada A, Sacchi A, Selivanova G, et al.
HIPK2 regulation by MDM2 determines tumor cell response to the p53-reactivating
drugs nutlin-3 and RITA. Cancer Res. 2009; 69: 6241-8.
38. Shangary S, Qin D, McEachern D, Liu M, Miller RS, Qiu S, et al. Temporal
activation of p53 by a specific MDM2 inhibitor is selectively toxic to tumors and
leads to complete tumor growth inhibition. Proc Natl Acad Sci U S A. 2008; 105:
3933-8.
39. Efeyan A, Ortega-Molina A, Velasco-Miguel S, Herranz D, Vassilev LT, Serrano
M. Induction of p53-dependent senescence by the MDM2 antagonist nutlin-3a in
mouse cells of fibroblast origin. Cancer Res. 2007; 67: 7350-7.
40. Maejima Y, Adachi S, Ito H, Hirao K, Isobe M. Induction of premature
senescence in cardiomyocytes by doxorubicin as a novel mechanism of myocardial
damage. Aging Cell 2008; 7: 125-36.
41. Fridman AL, Tainsky MA. Critical pathways in cellular senescence and
immortalization revealed by gene expression profiling. Oncogene. 2008; 27: 5975-
87.
42. Bernhard D, Laufer G. The aging cardiomyocyte. Gerontology. 2008; 54: 24-31.
43. Sano T, Tanaka A, Namba M, Nishibori Y, Nishida Y, Kawarabayashi T, et al. C-
reactive protein and lesion morphology in patients with acute myocardial infarction.
Circulation. 2003; 108: 282-5.
44. Arruda-Olson AM, Enriquez-Sarano M, Bursi F, Weston SA, Jaffe AS, Killian
42
JM, et al. Left ventricular function and C-reactive protein levels in acute myocardial
infarction. Am J Cardiol. 2010; 105: 917-21.
45. Marnell L, Mold C, Du Clos TW. C-reactive protein: ligands, receptors and role
in inflammation. Clin Immunol. 2005; 117: 104-11.
43
ABSTRACT (IN KOREAN)
C-reactive protein 에 의한 p53 활성화와 심근세포의 세포주기억제
< 지도교수 강 석 민 >
연세대학교 대학원 의과학과
최 지 원
C-reactive protein (CRP)는 다양한 심혈관 질환에서 중요한
생체표지인자 중의 하나이다. 최근 연구들에서 CRP가 세포의 생존, 분화,
그리고 저산소 상태에서 유도된 세포사멸에 관여한다는 것을 보여주고
있다. 그러나 세포주기에 대한 CRP의 효과는 아직 연구 된 바가 없다.
본 연구에서는 CRP가 심근세포인 H9c2 세포에서 세포주기 진행에
관여하는지에 대해서 살펴보고자 한다.
CRP의 농도 (10-3 50 μg/ml)가 증가 함에 따라 H9c2 세포의
증식은 억제되었다. 이에 반해 CRP은 H9c2 세포의 세포사멸에는 효과가
없었다. 그러나, 유세포 분석에서는 CRP를 처리한 H9c2 세포에서 G0/G1
44
상의 세포주기가 억제되는 것을 관찰 할 수 있었다. CRP는 CDK4와
CDK6 같은 세포주기관련 단백질의 농도를 감소시켰고, p53과 p21의
활성을 증가시켰다. CRP로 인해 활성된 p53은 ERK 억제자인 U0126에
의해서 감소되었고, 또한 CRP는 ERK를 활성화시켰다. H9c2 세포에서
FcγIIIa 수용체의 발현을 확인하였고, CRP 처리 후 발현이 더 증가 되는
것을 알 수 있었다. siRNA를 이용한 FcγIIIa 수용체의 발현 억제는 CRP로
인해서 활성화된 ERK, p53, p21을 억제시켰고, CDK6의 발현을 정상화
시켰다.
결론적으로 본 연구에서는 CRP가 H9c2 세포의 FcγIIIa 수용체를
통하여 ERK와 p53의 활성화를 유도하고 이에 따른 CDK4와 CDK6 의
발현을 감소 시켜 G0/G1 상의 세포주기를 억제함을 알 수 있었다. 본
연구의 결과들은 다양한 심혈관 질환에서 심근세포의 생존에 대해
CRP가 영향을 미칠 수 있다는 가능성을 제시할 수 있을 것이다.
----------------------------------------------------------------------------------------------------------
핵심 되는 말 : C-reactive protein, 세포주기억제, 심근세포