Gene, 77 (1989) 309-315

Elsevier

GEN 02956

309

Carp growth hormone: molecular cloning and sequencing of cDNA

(Recombinant DNA; phage @lo; pituitary gland; gene library; Cyprinus carpio; RNA blot hybridization;

Southern blot; nucleotide sequence; amino acid sequence)

Yair Koren a, Sara Sarid b, Raphael Ber a and Violet Daniel a

Departments of a Biochemistry and b Biophysics, Weizmann Institute of Science, Rehovot 76100 (Israel)

Received by H.G. Zachau: 9 August 1988

Accepted: 15 December 1988

SUMMARY

cDNA clones of the fish Cyprinus carpio growth hormone (GH) mRNA have been isolated from a cDNA

library prepared from carp pituitary gland poly(A)+ RNA. The nucleotide sequence of one of the carp GH

cDNA clones containing an insert of 1164 nucleotides (nt) was determined. The cDNA sequence was found

to encode a polypeptide of 210 amino acids (aa) including a signal peptide of 22 aa and to contain 5’ and 3’

untranslated regions of the mRNA of 36 and 498 nt, respectively. The carp GH presents a 63 y0 amino acid

sequence homology with the salmon GH, has structural features common with other GH polypeptides of

mammalian or avian origin and contains domains of conserved sequence near the N- and C-terminal regions.

Southern blot hybridization of carp genomic DNA with GH cDNA probes shows the presence of at least two

GH-coding sequences in the fish genome.

INTRODUCTION

Growth hormone (GH), a 22-kDa polypeptide

produced by the pituitary gland is essential for nor-

mal growth and development of vertebrates. GH,

together with prolactin and chorionic somatomam-

Correspondence to: Dr. Violet Daniel, Department of Bio-

chemistry, Weizmann Institute of Science, Rehovot 76100

(Israel) Tel. 972-8483639; Fax 972-8466966.

Abbreviations: aa, amino acid(s); bp, base pair(s); cDNA, DNA

complementary to mRNA; GH, growth hormone(s); GH, gene

(DNA) coding for GH; kb, kilobase or 1000 bp; mRNA, mes-

senger RNA; nt, nucleotide(s); ORF, open reading frame; SDS,

sodium dodecyl sulfate; SSC, 0.15 M NaCl/O.OlS M Na, citrate

pH 7.6.

motropin, forms a set of polypeptides of related

structure and function (Moore et al., 1982; Miller

and Eberhardt, 1983) whose sequences seem to have

evolved from a common ancestral gene (Niall et al.,

1971). Thus, these related genes are considered an

excellent model for the study of structure-function

relationships, evolution and regulation of expression.

GH genes and the corresponding mRNAs have been

isolated from a number of mammalian species and

their structure was comparatively studied and

characterized (Seeburg et al., 1977; Martial et al.,

1979; Miller et al., 1980; Seeburg, 1982; Seeburg

et al., 1983; Yamano et al., 1988). In order to learn

about the evolution of GH gene structure and regu-

lation of expression these studies have been recently

extended to lower vertebrate species such as chicken

0378-l 119/X9/$03.50 0 1989 Elsevier Science Publishers B.V. (Biomedical Division)

310

(Souza et al., 1984) and fish (Sekine et al., 1985;

Agellon and Chen, 1986). The isolation and sequenc-

ing of GH mRNA cDNA clones from two related

fish species Chum salmon, Oncorhyncus keta, and

rainbow trout, Salmon gairdneri, have provided in-

formation for an identical primary structure for the

growth hormone polypeptide of the two fish species.

In this report we describe the molecular cloning and

characterization of the GH mRNA from a more

distant teleost, Cyprinus carpio. We have cloned a

cDNA molecule encoding the entire carp pre-growth

hormone polypeptide and report the nucleotide se-

quence of the cDNA and the primary structure of the

derived precursor polypeptide molecule.

MATERIALS AND METHODS

(a) Materials

Restriction enzymes and T4-DNA ligase were

purchased from New England Biolabs, calf intestinal

alkaline phosphatase and Escherichia coli DNA

polymerase I from Boehringer, Mannheim, phage A

DNA in vitro packaging kit and radioactive nucleo-

tides from Amersham Corporation (England).

(b) Construction of cDNA library

Total RNA was prepared from carp pituitary

glands by the urea LiCl method (Auffray and

Rougeon, 1980) and the poly(A) + RNA was isolated

by chromatography on oligo(dT)-cellulose. A carp

pituitary cDNA library was constructed in &gtlO

vector following the procedure of Huynh et al.

(1985). The carp pituitary cDNA library, 1.5 x lo6

recombinant phages, was screened for GH

sequences by hybridization with heterologous rat

and chicken GH cDNA probes.

(c) Nucleotide sequence analysis

DNA restriction fragments were 5’-end-labeled

by T4 polynucleotide kinase and [ Y-~~P]ATP or

3’-end-labeled by reverse transcriptase and the

appropriate deoxyribonucleoside triphosphate. Nu-

cleotide sequencing was carried out by the chemical

method of Maxam and Gilbert (1980).

(d) RNA and DNA blot hybridizations

The RNA blots on nitrocellulose filters were pre-

hybridized for 3 h in a solution containing 0.9 M

NaC1/0.09 M Na, *citrate, 5 x Denhardt mixture

(0.1% Ficol, 0.1% polyvinyl pyrrolidone, 0.1%

bovine serum albumin), 0.1% SDS and 100 pg/ml

sonicated, heat-denatured calf thymus DNA. The

32P-labeled probe was then added and hybridization

was carried out for 18 h at 65°C. The filters were

then washed twice for 30 min with 2 x S SC at 50 ‘C.

DNA blots (Southern) were prehybridized for

3-4 h at 42” C in a solution containing 50% for-

mamide in addition to the components described

above for the RNA blots. The hybridization with the

32P-labeled probe was then carried out for 24 h at

42°C in the same mixture containing, in addition,

10% dextran sulfate. The filters were washed twice

at 25°C for 30 min with SSC and twice at 60°C for

30 min with 0.1 x SSC, and subjected to autoradio-

graphy.

1.6

1.0

0.5

-

-

Fig. 1. Northern blot hybridization of carp pituitary po-

ly(A) + RNA to 32P-labeled GH cDNA probes from rat (lane 1)

and chicken (lane 2). 3 pg of carp pituitary poly(A) + RNA were

electrophoresed on a 1.2% agarose/l y0 formaldehyde gel, trans-

ferred onto nitrocellulose filters (Maniatis et al., 1982) and

hybridized to the respective probes as described in MA-

TERIALS AND METHODS, section d. Fragment sizes in kb

(pBR322 digested with Hid and EcoRI) are shown on the left

margin.

RESULTS AND DISCUSSION

(a) Isolation and sequencing

coding carp growth hormone

311

of cDNA clones en-

screened for carp GH cDNA clones by plaque hybridization using rat and chicken GH cDNA

probes. The ability of these probes to detect carp GH

cDNA sequences was previously tested by electro- phoresis of carp pituitary poly(A) + RNA on a 1%

A cDNA library constructed from carp pituitary formaldehyde/l.2% agarose gel (Lehrach et al.,

poly(A)+ RNA into &tlO cloning vector was 1977) followed by transfer of the RNA onto nitro-

A

B

100 bp

-22 Met Ala

AACTAAGCCTGCAAGAGTTTGTCTACCCTGAGCGAA ATG GCT 1 -1

Arg Val Leu Val Leu Leu Ser Val Val Leu Val Ser Leu Leu Val Asn Gln Gly Arg Ala AGA GTA TTA GTG CTA TTG TCG GTG GTG CTG GTT AGT TTG TTG GTA AAC CAG GGG AGA GCA 1 20 Ser Asp TCA GAC

Ala Ala GCT GCA

Ser Lys AGT AAA

Asp Glu GRT GAA

Ser Trp TCC TGG

Asn Gln Arg Leu Phe Asn Asn Ala Val Ile Arg Val Gln His Leu His Gln Leu AAC CAG CGG CTC TTC AAT AAT GCA GTC ATT CGT GTA CAA CAC CTG CAC CAG CTG

40 Lys Met Ile Asn Asp Phe Glu Asp Ser Leu Leu Pro Glu Glu Arg Arg Gln Leu AAA ATG ATT AAC GAC TTT GAG GAC AGC CTG TTG CCT GAG GAA CGC AGA CAG CTG

60 Ile Phe Pro Leu Ser Phe Cys Asn Ser Asp Tyr Ile Glu Ala Pro Ala Gly Lys ATC TTC CCT CTG TCT TTC TGC AAT TCT GAC TAC ATT GAG GCG CCT GCT GGA AAA

80 Thr Gln Lys Ser Ser Met Leu Lys Leu Leu Arg Ile Ser Phe His Leu Ile Glu ACA CAG AAG AGC TCT ATG CTG AAG CTT CTT CGC ATC TCT TTT CAC CTC ATT GAG

100 Glu Phe Pro Ser Gln Ser Leu Ser Gly Thr Val Ser Asn Ser Leu Thr Val Gly GAG TTC CCA AGC CAG TCC CTG AGC GGA ACC GTC TCA AAC AGC CTG ACC GTA GGG

120 Asn Pro Asn Gln Leu Thr Glu Lys Leu Ala Asp Leu Lys Met Gly Ile Ser Val Leu Ile AAC CCC AAC CAG CTC ACT GAG AAG CTG GCC GAC TTG AAA ATG GGC ATC AGT GTG CTC ATC

140 Gln Ala Cys Leu Asp Gly Gln Pro Aan Met Asp Asp Asn Asp Ser Leu Pro Leu Pro Phe CAG GCA TGT CTC GAT GGT CM CCA AAC ATG GAT GAT AAC GAC TCC TTG CCG CTG CCT TTT

160 Glu Asp Phe Tyr Leu Thr Met Gly Glu Asn Asn Leu Arg Glu Ser Phe Arg Leu Leu Ala GAG GAC TTC TAC TTG ACC ATG GGG GAG AAC AAC CTC AGA GAG AGC TTT CGT CTG CTG GCT

180 Cys Phe Lys Lys Asp Met His Lys Val Glu Thr Tyr Leu Arg Val Ala Asn Cys Arg Arg TGC TTC AAG AAG GAC ATG CAC AAA GTC GAG ACC TAC TTG AGG GTT GCA AAT TGC AGG AGA

188 Ser Leu Asp Ser Asn Cys Thr Leu End TCC CTG GAT TCC AAC TGC ACC CTG TAG ATGGCACCGGTGTATTGTTAGTCAATGCCTGTAACACATTTGT

670 700 GCTTTGCTGCAAATATAAGACCAGTTTACAGTCTGGTCTTATATGTGCAGG~TGTCMCCAGCATGCCTAGGTCTGT

750 GTTTTCTTTTTTCCCTCCCATATTTAAACATTACCTATTACCTATTGTATTTATTCTTCTCATTTGGGAGTGTCTCAT~TTT~

800 850 MCCGTTCCTTTAAAACGTAAGGGATGGATCTGGMCATTTCACAGTGGTGTCT~GCAATTTATGGCAATATTTTAAA

900 948 ATGTGGCCAAATTGACCTTAGTCAAAGTGCTGACAATATGTTAAAAAAA GGGCTAAAGATCAGTGTTACGTGGAAATTG

1000 TAATTTAAATCGGATGTGTTCACTCTTCGGTGTATGCATGTTMCATTTGTCTCATATATTATGCTCTTATTATTAACT

1050 1100 CATCGTATCCTCTTCMGCGCTGTGTCTTTCTCTATTAAA(A)n

1164

Fig. 2. Sequencing of the GH gene. (A) Restriction map of the carp GH cDNA clone. Arrows indicate the sequencing strategy. (B) The

complete nucleotide sequence of carp GH and deduced amino acid sequence. Numbers above the aa relate to the amino acid sequence(aa

-22 to -1, signal peptide, and 1 to 188, mature GH) and numbers below the nt (last digit aligned with the corresponding nt) relate to

the nucleotide sequence. The polyadenylation signal ATTAAA is underlined. (A)n is the poly(A) sequence. ‘End’ is the stop codon.

312

cellulose filter and hybridization with 32P-labeled

nick-translated (Rigby et al., 1977) cDNA sequences

of rat or chicken GH mRNAs. Fig. 1 shows the

Northern blot hybridization of carp pituitary

poly(A) + RNA with rat and chicken GH probes. An

RNA band of about 1.3 kb was detected with both

probes and found to encode the carp GH poly-

peptide. An additional 2.1-kb RNA species detected

only with the chicken GH cDNA probe (Fig. 1, lane

2) was not found to be related to the carp GH. A

number of carp GH cDNA clones were isolated, the

DNA inserts excised, subcloned into the EcoRI site

of pBR322 and the resulting plasmids amplified in

E. coZi HBlOl. The plasmids were cleaved with

several restriction endonucleases and analyzed by

Southern blot hybridization using the rat and chicken

GH cDNA probes. Fig. 2A shows the restriction

endonuclease mapping of a clone containing a carp

GH cDNA insert of 1164 bp. The nucleotide se-

quence for carp GH and the deduced amino acid

sequence are shown in Fig. 2B. This sequence

contains 36 nt of a 5’ noncoding region followed by

AC T A

T G T T

G.C A.T C.G C,G A.T G.C A.T A.T T.A A,T T.A A.T AG A.T C.G G.C T.A C.G

% 715,T.p1,765

.GTGCT.ATGTC

ATT T C

T T T T A c

T T G.C T-A TT A.T

c’.G’ C.G AG T.A T,G A,T

TA T A

T T AA

A,T T.G A.T AG C.G G.C G.C T,A

AT.A

TT.A T.A A.T A.T C.GA

G.C C A.T T.A C.G

TAATGG..

C,G A.T A CT A.TA ’ T.A

El,,,;: $65 .CCATA.TTTAA.

Fig.3. Putative secondary structures at the 3' untranslated

regionofcarp GH mRNA derivedfromthe sequence presented

in Fig. 2.

an ORF of 630 nt and a 3’ noncoding region of

498 nt. From the ORF a primary structure for carp

GH polypeptide can be deduced which includes

22 aa of the signal peptide and 188 aa of the mature

hormone. The 3’ noncoding region which starts with

cGH -22 Met Ala Arg Val Leu Val Leu Leu Ser Val Val Leu Val Ser Leu Leu Val Asn -5 sGH -22 --- Gly Gln --- Phe Leu --- Met Pro --- Leu --- --- --- Cys Phe Leu Ser -5

-1 1 Gln Gly Arg Ala Ser Asp Asn Gln Arg Leu Phe Asn Aan Ala Val Ile Arg Val 14 _-- -_- Ala --- 11s Glu -__ __- _-_ --- --- _-_ Ile _-_ -__ Ser _-_ -_- 14

Gln His Leu His Gln Leu Ala Ala Lys Met Ile Asn Asp Phe Glu Asp Ser Leu 32 --- -_- --- ___ Leu _-_ --- Gln _-- -__ phe __- ___ ___ Aep Gly Thr ___ 32

Leu Pro Glu Glu Arg Arg Gln Leu Ser Lys 110 Phe Pro Leu Ser Phe Cys Asn 50 -_- ___ Asp m-m s-w ___ --- ___ bn __- ___ ___ L,z.u ___ Asp mm_ -me --- 50

Ser Asp Tyr Ile Glu Ala Pro Ala Gly Lys Asp Glu Thr Gln Lys Ser Ser Met 68 --- --- Ser --- Val Ser --- Val Asp --- ais --- ___ ___ __- --- --- Val 68

Leu Lys Leu Leu Arg Ile Ser Phe His Leu Ile Glu Ser Trp Glu Phe Pro Ser 86 ___ __- --_ --- Hie ___ ___ __- ug m-w -mm __- _-_ --- --- Tyr --- --- 86

Gln Ser Leu Ser Gly Thr Val Ser Asn Ser Leu Thr Val Gly Asn Pro Aen Gln 104 __- Thr --- ( ) Ile Ile --- ___ ___ ___ Met ___ bg -__ Ala -__ ___ 102

Leu Thr Glu Lys Leu Ala Asp Leu Lys Met Gly Ile Ser Val Leu Ile Gln Ala 122 Ile Ser _-_ ___ ___ Ser ___ __I _a_ Val _-_ -__ bn Leu ___ ___ Tbr Gly 120

Cys Leu Asp Gly Gln Pro Aen Met Asp Asp Asn Asp Ser Leu Pro Leu ( ) Pro 139 Ser Gln --- --- Val Leu Ser Leu --- --- ___ -_- _-- Gln Gln --- Pro --- 138

Phe Glu Asp Phe Tyr Leu Thr Met Gly Glu Azn ( ) Asn Leu Arg Glu Ser Phe 156

Tyr Gly Asn Tyr --- Gln Aen Leu --- Gly Asp Gly --- Val --- Arg Asn Tyr 156

Arg Leu Leu Ala Cys Phe Lys Lys Asp Met His Lys Val Glu Thr Tyr Leu Arg 174

Glu --- ___ ___ __- ___ __- ___ -a- a-- -_- ___ 0-q --- --- _-_ ___ Thr 174

Val Ala Asn Cys Arg Arg Ser Leu Asp Ser Asn Cys Thr Leu 188 ___ ___ LY,g ___ --- Ly.q __- _-_ G,J, =a _-_ -__ ___ ___ 188

Fig. 4. Comparison of amino acid sequence of pre-processed carp GH (cGH) and salmon GH (sGH). For maximal homology, the

sequences were aligned by introducing two gaps shown by parentheses. The signal peptide is from aa -22 to -1 and the mature hormone

sequence from aa 1 to 188. Identical sGH aa are indicated by dashes.

313

the translation stop codon TAG contains, 16 nt

upstream the polyadenylation site, the sequence

ATTAAA, which probably functions as a signal for

cleavage and polyadenylation of the pre-mRNA.

Fig. 3 shows that the 3’ noncoding region can form

three hairpins of secondary structures starting 100 nt

from the TAG stop codon, and located 100 nt apart.

It is not clear, however, whether this structure at the

3’ end of carp GH mRNA fulfils any function.

(b) Comparison of carp growth hormone to other

growth hormones

The amino acid sequences predicted from the

cDNA sequence of the carp GH mRNA presently

described bring new information about the GH

structure of a teleost. The two other fish GH se-

quences previously reported, those of rainbow trout

(Agellon and Chen, 1986) and Chum salmon (Sekine

et al., 1985) have proved to differ by only six nt

substitutions and to have an identical amino acid

sequence. These two fish species belong to the

closely related genera Salmo and Oncorhyncus and

probably have diverged only recently from a common

ancestor. A comparison of carp GH to the salmon

GH amino acid sequences as derived from the

cDNA is presented in Fig. 4. The first 22 aa at the

N-terminus of carp GH, like those of salmon GH

sequence, probably represent the signal peptide of

the pre-GH which is cleaved upon hormone se-

cretion. The signal peptide appears, however, to be

shorter in fish by 4-5 aa as compared to that of the

mammalian GH (26 aa in rat and human, 27 aa in

bovine GH). The sequence of this peptide, which is

hydrophobic in nature, is generally more divergent

among species than that of the mature GH polypep-

tide. For carp and salmon, the similarity of amino

acid and nucleotide sequence in the signal peptide is

46% and 60%, respectively, as compared to 63%

and 72% in the mature GH polypeptide. Fig. 4

shows that carp GH and salmon GH share structural

features which have been observed also in mam-

malian (rat, bovine, porcine, human, goat, horse) and

chicken GH. Four Cys residues (Cys-49, Cys-161,

Cys-178, Cys-186 in carp and salmon GH) are

located in all GH polypeptides in similar positions,

and by forming two disullide bonds are assumed to

contribute to the tertiary structure of the hormone

molecule. The existence of the two disulfide bonds

Fig. 5. Southern blot hybridization analysis of 10 pg carp ge-

nomic DNA digested with (1) EcoRI or (2) HindIII, and probed

with 32P-labelled carp cDNA fragments: Panel A: Mixture of

200 bp of 5’ region and 800 bp of 3’ region of the GH coding

sequence. Panel B: 800 bp of 3’ region of the GH. The hybridiza-

tion conditions are described in MATERIALS AND METH-

ODS, section d. Fragment sizes in kb (phage I DNA digested

with Hind111 and pBR322 digested with Hid) are shown on the

right margin.

was demonstrated in several mammalian GHs and

their presence was found to be essential for the

biological activity ofthe hormone (Lewis et al., 1980;

Paladini et al., 1981). Comparison of amino acid

sequence of carp GH with that of mammalian and

chicken GH shows an absolute homology of about

40%. However, when functional amino acid dis-

tribution (charge, hydrophobicity) is compared

between carp GH and other GH an increased degree

of structural homology is observed. Carp GH shares

domains of conserved sequence with the other GH,

especially at the N and C termini, which may be

important for the hormone function. There are two

Asn-X-Ser/Thr motifs in carp GH amino acid se-

quence (Asn-13 1 and Asn- 185) which are potential

sites for N-linked glycosylation (Marshall, 1972).

Similar sequences have also been observed by Sekine

et al. (1985) in the salmon GH.

(c) Genomic distribution of GH sequences

An evaluation of the number of GH genes in the

carp genome was attempted by carp genomic DNA

314

Southern blot hybridization with carp GH 32P-

labeled cDNA probes. Carp genomic DNA was di-

gested by EcoRI or HindIII, fractionated by electro-

phoresis on agarose gel, blotted onto nitrocellulose

filter and hybridized with probes representing 200 bp

of the 5’ region and 800 bp of the 3’ region of the

carp GH cDNA. Hybridization of a mixture of both

probes with the Southern blot of carp DNA digested

by EcoRI, an enzyme which does not cleave into the

carp GH-coding sequence, reveals three major

hybridization bands, of 16.5, 11.8 and 7.0 kb and

three minor bands, of 4.9, 4.0, and 2.3 kb (Fig. 4A,

lane 1). In the same Southern blot the 800-bp probe

containing the 3’ region of carp GH lights up only the

two large DNA fragments, of 16.5 and 11.8 kb

(Fig. 4B, lane 1). Digestion of carp DNA with

HindIII, which cleaves into the GH-mRNA-coding

sequence about 300 bp from the 5’ end, produces

shorter hybridization bands. From the hybridization

pattern with the 800-bp probe (Fig. 4B) it may be

assumed that the carp genome contains at least two

GH genes.

(d) Conclusions

(1) We have described here the molecular cloning

and characterization of carp GH cDNA. Total RNA

was extracted from carp pituitary glands and the

poly(A) + RNA-enriched fraction was used as tem-

plate for cDNA synthesis and construction of a

cDNA library into &tlO vector. Using heterologous

cDNA probes from rat and chicken GH, we have

isolated a full-length cDNA clone of carp GH

mRNA. The nucleotide sequence of this cDNA and

the derived amino acid sequence bring information

about the pre-GH polypeptide structure of a member

of the Pisces class of vertebrates. The amino acid

sequence of mature carp GH presents a 63% simi-

larity with the GH of two closely related and more

primitive fish species, salmon and rainbow trout

(Sekine et al., 1985; Agellon and Chen, 1986). A

comparison of the cDNA and the deduced amino

acid sequences for fish and mammalian GHs enables

us to make some observations concerning evolu-

tionary changes among species. While the putative

pre-GH signal peptide was shortened by 4-5 amino

acids in fish, as compared to mammals and the

overall amino acid sequence homologies are rather

low (about 40%), there are structural features com-

mon to all GHs. There are four cysteine residues in

nearly identical positions in fish (carp, trout, salmon)

GH as well as in mammalian GH and domains of

conserved amino acid sequences at the N and C

termini of the mature GH molecule.

(2) Southern-blot hybridizations with carp GH

cDNA probes have shown that there are at least two

GH-coding sequences in the carp genome.

(3) The cloned carp GH cDNA should be useful

in the studies on the growth-promoting activities of

the hormone in the developing fish. One approach is

to express the carp GH cDNA under the control of

a prokaryotic promoter in E. coli, to produce large

quantities of this growth hormone and test its activity

by injecting it into fish in culture. Another approach,

which is now under investigation, is to construct the

carp GH cDNA under the control of eukaryotic

promoters and microinject it into fertilized fish eggs

for integration into the fish genome. Then the expres-

sion of the inserted carp GH sequences and the

impact of increased levels of growth hormone could

be examined following the increase in body size and

weight of the developing fish.

ACKNOWLEDGEMENTS

We thank Dr. Z. Yaron for providing us with carp

pituitary glands and Y. Tichauer for technical assis-

tance with nucleotide sequencing. This work was

supported in part by grants from the National

Council for Research and Development of Israel and

the Ministry of Industry and Trade.

REFERENCES

Agellon, L.B. and Chen, T.T.: Rainbow trout growth hormone;

molecular cloning of cDNA and expression in E. coli. DNA

5 (1986) 463-471.

Aufiay, C. and Rougeon, F.: Purification of mouse immuno-

globulin heavy-chain messenger RNAs from total myeloma

tumor RNA. Eur. J. Biochem. 107 (1980) 303-314.

Huynh, T.V., Young, R.A. and Davis, R.W.: Constructing and

screening cDNA libraries in &gtlO and lgtll. In Glover, I.D.

(Ed.), DNA Cloning: A Practical Approach. IRL Press,

Oxford and Washington D.C., 1985, pp. 49-88.

Lehrach, H., Diamond, D., Wozney, J.M. and Boedtker, H.:

RNA molecular weight determinations by gel electrophoresis

315

under denaturing conditions, a critical reexamination. Biochemistry 16 (1977) 4743-4751.

Lewis, U.J., Singh, R.N.P., Tutwiller, G.F., Sigel, M.B., Vander- iaan, E.F. and Vanderlaan, W.: Human growth hormone: a complex of proteins. Rec. Progr. Harm. Res. 36 (1980)

477-509. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Moiecular Cloning.

A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982.

Marshall, R.D.: Glycoproteins. Annu. Rev. Biochem. 41 (1972) 673-702.

Martial, J.A., Hallewell, R.A., Baxter, J.D. and Goodman, H.M.: Human growth hormone: complementary DNA cloning and expression in bacteria. Science 205 (1979) 602-606.

Maxam, A. and Gilbert, ‘ix/.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560.

Miller, W.L. and Eberhardt, N.L.: Structure and evolution ofthe growth hormone gene family. Endocrine Rev. 4 (1983) 97-129.

Miller, W.L., Martial, J.A. and Baxter, J.D.: Molecular cloning of DNA complementary to bovine growth hormone mRNA. J. Biol. Chem. 255 (1980) 7521-7524.

Moore, D.D., Walker,M.D., Diamond, D.J., Conkling,M.A. and Goodman, H.M.: Structure, expression and evolution of growth hormone genes. Rec. Progr. Horm. Res. 38 (1982) 197-225.

Niall, H.D., Hogan, M.L., Sauer, R., Rosenblum, Y. and Greenwood, F.C.: Sequences of pituitary and placental lacto- genie growth hormones: evolution from a primordial peptide by gene reduplication. Proc. Natl. Acad. Sci. USA 68 (1971) 866-869.

Paladini, A.C., Pena, C. and Poskus, E.: Molecular biology of growth hormone. CRC Crit. Rev. 15 (1981) 25-26.

Rigby, P.W.J., Dieckmann, M., Rhodes, C. and Berg, P.: Labeling deoxynucleic acid to high specific activity in vitro by nick translation with DNA poiymerasc. 3. Mol. Biol. 113 (1977) 237-251.

Seeburg, P.H., Shine, J., Martial, J.A., Baxter, J.D. and Goodman, H.M.: Nucleotide sequence and amplification in bacteria of structural gene for rat growth hormone. Nature 270 (1977) 486-494.

Seeburg, P.H.: The human growth hormone gene family: nucleo- tide sequences show recent divergence and predict a new polypeptide hormone. DNA 1 (1982) 239-249.

Seeburg, P.H., Sias, S., Adehnan, J., de Boer, H.A., Hayflick, J., Jhurani, P., Goeddel, D.V. and Heyneker, H.L.: Efficient bacterial expression of bovine and porcine growth hormones. DNA 2 (1983) 37-45.

Sekinc, S., Mizukami, T., Nishi, T. Kuwana, Y., Saito, A., Sato, M., Itoh, S. and Kawauchi, H.: Cloning and expression of cDNA for salmon growth hormone in E. coli. Proc. Natl. Acad. Sci. USA 82 (1985) 4306-4310.

Souza, L.M., Boone, T.C., Murdock, D., Langley, K., Wypych, J., Fenton, D., Johnson, S., Lay, PH., Everett, R., Hsu, R.-Y. and Bosselman, R.: Application of recombinant DNA tech- nologies to studies on chicken growth hormone. J. Exp. Zool. 232 (1984) 465-473.

Yamano, Y., Oyabayashi, K., Okuno, M., Yato, M., Kioka, N., Manabe, E., Hashi, H., Sakai, H., Komano, T., Utsumi, K. and Iritani, A.: Cloning and sequencing of cDNA that en- codes goat growth hormone. FEBS Lett. 228 (1988) 301-304.