www.elsevier.com/locate/ynbdi

Neurobiology of Disease 22 (2006) 523 – 537

Caspase-3 deficiency during development increases vulnerability to

hypoxic–ischemic injury through caspase-3-independent pathways

Tim West,a,b Madeliene Atzeva,a,b and David M. Holtzmana,b,c,*

aDepartment of Neurology, Washington University School of Medicine, St. Louis, MO 63110, USAbHope Center for Neurological Disorders, Washington University School of Medicine, St. Louis, MO 63110, USAcMolecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, MO 63110, USA

Received 10 October 2005; revised 17 December 2005; accepted 22 December 2005

Available online 9 February 2006

Neonatal hypoxia– ischemia (H–I) is a common cause of perinatal

morbidity and mortality leading to prominent activation of caspase-3 in

the brain. Previous studies have shown that acute inhibition of caspase-

3 can protect against neonatal H–I in rats. In this study, we

investigated brain injury following neonatal H–I in mice deficient in

caspase-3. Wild-type, caspase-3+/� and caspase-3�/� mice underwent

unilateral carotid ligation at postnatal day (P) 7, followed by 45 min of

exposure to 8% oxygen. Surprisingly, tissue loss at P14 was

significantly higher in caspase-3�/� mice when compared to wild-type

littermates. As in rats, we found that acute inhibition of caspase-3 in

mice leads to decrease in tissue loss at P14. There was no difference in

nuclear morphology, DNA laddering or calpain activation between

caspase-3�/�, caspase-3+/� and wild-type mice subjected to H–I, and

there was no evidence for compensatory activation of other caspases in

caspase-3�/� mice. Also, all genotypes showed evidence of mitochon-

drial dysfunction after H–I, suggesting that this is a critical point in

regulation of neuronal cell death following neonatal H–I. Our results

suggest that long-term inhibition of caspase-3 during development,

unlike acute inhibition, leads to upregulation of caspase-3-independent

cell death pathways and increases the vulnerability of the developing

brain to neonatal H–I injury.

D 2005 Elsevier Inc. All rights reserved.

Keywords: Neonatal; Hypoxia– ischemia; Casapse-3; Apoptosis; Cell

death; DNA laddering; Brain injury

0969-9961/$ - see front matter D 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.nbd.2005.12.017

Abbreviations: AIF, apoptosis inducing factor; BAF, boc-aspartyl-

(OMe)-fluoromethyl-ketone; DEVD, Asp-Glu-Val-Asp; H–I, hypoxia–

ischemia; OGD, oxygen glucose deprivation; PAR, poly-ADP-ribose; ROS,

reactive oxygen species; TUNEL, terminal deoxynucleotidyl transferase-

mediated dUTP nick end labeling; XIAP, X-linked inhibitor of apoptosis.

* Corresponding author. Department of Neurology Box 8111, Washington

University in St. Louis, 4566 Scott Ave., MO 63110, USA. Fax: +1 314 362

2826.

E-mail address: holtzman@neuro.wustl.edu (D.M. Holtzman).

Available online on ScienceDirect (www.sciencedirect.com).

Introduction

Neonatal hypoxia ischemia (H– I) is a major cause of

neurological impairment and can lead to cognitive and motor

dysfunction as well as seizures (Rees et al., 1998; du Plessis and

Volpe, 2002; Hamrick and Ferriero, 2003). Rodent models of

neonatal H–I have been developed in which the observed injury is

similar to what is observed in human neonates suffering from

hypoxic– ischemic encephalopathy (Levine, 1960; Ferriero et al.,

1996; Hagberg et al., 1997; Ashwal and Pearce, 2001; Han et al.,

2001). During brain development, a large number of neurons

undergo programmed cell death (apoptosis) to help sculpt neural

networks (Honig and Rosenberg, 2000). Thus, neurons in the

developing brain are primed to undergo apoptosis, and the

apoptotic pathway can be easily activated in response to injury

(Roth and D’Sa, 2001; Olney et al., 2002). Thus, features of

apoptotic cell death are much more prominent following neonatal

H–I than following stroke in adult rodents (Cheng et al., 1997; Gill

et al., 2002). The initial cell death following neonatal H–I is by

necrosis, while delayed cell death is by apoptosis combined with

cell death with morphological features of both apoptosis and

necrosis (Portera-Cailliau et al., 1997; Northington et al., 2001).

Apoptosis is an energy-dependent process by which cells die in a

controlled fashion, while necrosis leads to release of cellular

constituents, which may cause damage to neighboring cells (Yuan

and Yankner, 2000; Cowell et al., 2003).

The apoptotic cell death pathway is executed by caspases, a

family of aspartyl-specific cysteine proteases. Caspase-3 is the

main executioner caspase in the brain and is activated in neurons

following neonatal H–I (Cheng et al., 1998; Nakajima et al.,

2000). Several studies have looked at the effect of caspase

inhibition on tissue loss following H–I in neonatal rodents. To

our knowledge, the only study of the effect of caspase inhibition in

the mouse model of neonatal H–I used transgenic overexpression

of the human X-linked inhibitor of apoptosis (XIAP), which led to

a decrease in caspase-3 activation and attenuation of tissue loss

(Wang et al., 2004). In rats, caspase-3 inhibitors have been studied

T. West et al. / Neurobiology of Disease 22 (2006) 523–537524

extensively. The specific caspase-3 inhibitor, M-826, protected

against tissue loss following neonatal H–I in rats (Han et al.,

2002). Data from neonatal rats using the pan-caspase inhibitor boc-

aspartyl-(OMe)-fluoromethyl-ketone (BAF) are less conclusive.

BAF was found to decrease tissue loss in two studies (Cheng et al.,

1998; Adachi et al., 2001), but two other studies found no change

in tissue loss using this compound, in spite of decreased caspase-3

activation (Zhu et al., 2003; Joly et al., 2004). These studies

suggest that the acute administration of caspase-3 inhibitors may

only be neuroprotective under certain conditions.

To further address the chronic and acute role of caspase-3 in

neonatal H–I, we used a genetic approach utilizing caspase-3

knockout mice. Initially, knockout of caspase-3 in mice on a mixed

129sv, C57BL/6 background was found to be prematurely lethal,

and the mice were born with exencephaly (Kuida et al., 1996). In

spite of the forebrain abnormalities, caspase-3�/� embryos had a

normally developed brain stem and spinal cord (Oppenheim et al.,

2001). When caspase-3�/� mice were bred onto a pure C57BL/6

background, the forebrain abnormality phenotype disappeared,

suggesting that this phenotype was due to a partially penetrant,

strain-dependent genetic modifier (Leonard et al., 2002). Recent

studies have suggested that higher levels of caspase-7 in the

C57BL/6 strain could account for developmental cell death in

caspase-3�/� mice on this background and thus compensate for the

lack of caspase-3 during development (Houde et al., 2004). Since

caspase-3�/� mice are viable and their cerebral vasculature is

overall normal (Le et al., 2002), we set out to investigate the role of

caspase-3 in cell death following neonatal H–I using caspase-3�/�

knockout mice on the C57BL/6 background. While acute

pharmacological inhibition of caspase-3 is neuroprotective in

wild-type mice, we found that the absence of caspase-3 during

development results in increased vulnerability to H–I, most likely

secondary to a caspase-independent pathway.

Materials and methods

Animals and surgical procedures

Caspase-3 heterozygous (+/�) mice, backcrossed onto a

C57BL/6 background for at least 10 generations, were crossed to

give a mixture of +/+, +/�, and �/� pups (Kuida et al., 1996;

Leonard et al., 2002). Only pups with a body weight between 2.9

and 4.0 g at P7 were utilized in this study. Approximately 20% of

caspase-3�/� pups weighed less than 2.4 g and were excluded from

this study, while only 5% of wild-type and heterozygous mice were

excluded. In addition, to increase the number of caspase-3�/� mice

generated, male caspase-3�/� mice were mated to caspase-3+/�

females. Approximately 20% of the pups utilized in this study were

generated in this way, as opposed to being products of heterozy-

gous breedings. Results from caspase-3�/� and caspase-3+/� pups

generated from breeding caspase-3�/� males with caspase-3+/�

females did not differ from the caspase-3�/� pups generated from

breeding heterozygous mice.

Genotyping was performed by PCR on genomic DNA from the

tail of pups using the following primers: CPP common,

GCGAGTGAGAATGTGCATAAATTC; CPP endo, GGGAAAC-

CAACAGTAGTCAGTCCT and CPP neo TGCTAAAGCG-

CATGCTCCAGAGTG. Genotypes were confirmed by Western

blot or immunohistochemistry using antibody against caspase-3

(h277, Santa Cruz).

All mice were housed under a 12/12-h light/dark cycle. At P7,

pups were subjected to the modified Levine procedure as described

(Parsadanian et al., 1998; Gibson et al., 2001; Han et al., 2001).

Briefly, pups were weighed and anesthetized with 5% halothane

(balance, room air) for induction and 1.5% halothane for

maintenance and the left carotid artery exposed and cauterized.

The incision was sutured, and the pups were returned to the dam

for a 2-h recovery period after which they were put in chambers

maintained at 37-C through which 8% humidified oxygen

(balance, nitrogen) flowed for 45 min. After completion of the

H–I injury, pups were returned to the dam until sacrifice.

For caspase-3 inhibitor studies, the specific caspase-3

inhibitor M826 (Han et al., 2002) was dissolved in 100%

DMSO and then diluted to a final concentration of 10 mM in

50% DMSO using sterile PBS. P7 wild-type C57BL/6 mice

underwent unilateral carotid ligation as described before. M826

was a kind gift from Daigen Xu and Yongxin Han, Merck Frosst,

Canada. Ten minutes before being placed in the hypoxia chamber,

pups were injected intracerebroventricularly (ICV) with 1 Al of the10 mM M826 solution. This gives a final concentration of 10 nmol

of M826 per mouse. This concentration was used based on

previous studies in rats (Han et al., 2002). Littermate control mice

received ICV injections of the same volume of 50% DMSO in PBS

(vehicle).

Histology and tissue loss determination

At 7 days post H–I (P14), pupswere sacrificed by lethal injection

of pentobarbital (200 mg/kg) and perfused with ice-cold PBS

containing 3 U/ml heparin. Brains were removed, immersion fixed

in 4% paraformaldehyde, and cut into 50-Am coronal sections on a

freezing slidingmicrotome. Brain slices starting from the genu of the

corpus collosum caudally through the extent of the hippocampus

were collected, and slices 300 Am apart (every 6th slice) were

mounted and stained with cresyl violet (Cheng et al., 1998). Brains

were scanned at 1600 dpi using Silverfast (LaserSoft) plug-in for

PhotoShop (Adobe) and saved as TIF files for analysis.

Volumes of distinct parts of different brain structures in the

injured and non-injured hemisphere of the brain were measured

using the image analysis software SigmaScan Pro 5 (SPSS Inc.).

Tissue loss was calculated as ‘‘percentage volume loss’’ by

comparing the volume of the structure in injured hemisphere to

the volume of the structure in the non-injured hemisphere. For

hippocampal volume, sections starting at the rostral aspect of the

hippocampus and the next 6 sections were quantified. The first four

of these sections were also quantified for cortical volume. To assess

striatal tissue loss, two sections preceding the first section assessed

for the hippocampus were quantified, see Fig. 1D. For hippocampal

area measurements, pixel area was converted into micron2.

Tissue lysis and caspase activity assay

Pups were sacrificed at 6 and 24 h post-H–I and perfused as

before. The brain was removed and the left and right hippocampus

dissected on ice and then frozen on dry ice. Each hippocampus

was homogenized in lysis buffer (20 mM HEPES, pH 7.4, 7.5 mM

MgCl2, 1 mM BME, 1% Triton X-100, 2 mM EGTA, 230 mM

sucrose) with protease inhibitors (Roche) and centrifuged at

14,000 � rpm for 15 min at 4-C. For caspase activity measurement,

tissue lysates were incubated in an opaque 96-well plate with 90

Al of assay buffer (10 mM HEPES, pH 7.4, 42 mM KCl, 5 mM

Fig. 1. Increased tissue loss in hippocampus and cortex of caspase-3�/� mice. Tissue loss in 14-day-old mice of all 3 genotypes was compared following

neonatal H–I at P7 (A–C). Tissue loss is calculated by comparing the volume of the ipsi- and contralateral part of the structure. Volume loss was calculated

from areas in sections 300 Am apart, as illustrated by sections 1 through 9 in panel D. The structures analyzed were hippocampus (blue in panel D), cortex

(green in panel D), and striatum (red in panel D), see Materials and methods for details. Caspase-3�/� mice (n = 22) have a 50% increase in hippocampal tissue

loss as compared to wild-type mice (n = 31) (A). Hippocampal tissue loss of caspase-3+/� mice (n = 31) is not significantly different from wild-type mice but is

significantly lower than that of caspase-3�/� mice (P < 0.05). Caspase-3�/� mice also had significant increase in cortical and striatal tissue loss (B and C).

***P < 0.001 and *P < 0.05 vs. wild type. The area of the hippocampus in individual brain sections (from rostral to caudal) was also compared between

genotypes. This shows that the increase in tissue loss in caspase-3�/� mice was throughout the structure, and that the hippocampus contralateral to carotid

ligation did not differ in size between genotypes (E). The graph in panel E shows the mean area of the remaining hippocampus T SEM for each of the sections

in which the hippocampus was assessed, corresponding to section 3 to 8 in panel D. The area of the injured hippocampus (left side, L) is significantly lower in

caspase-3�/� (KO L) mice vs. caspase-3+/+ (WT L) and caspase-3+/� (HET L). However, the areas of the hippocampal sections in the non-injured (right side,

R) hemisphere do not vary significantly with genotype (WT R, HET R, and KO R). The area of the hippocampus on the right side of the brain of pups that have

undergone neonatal H– I is slightly but not significantly smaller than that of age-matched controls (P14), probably due to the fact that the brain-injured pups

have slightly retarded growth.

T. West et al. / Neurobiology of Disease 22 (2006) 523–537 525

MgCl2, 3 mM DTT, and 10% sucrose) containing 30 AM of the

following substrates: Ac-YVAD-AMC (caspase-1), Z-VDVAD-

AFC (caspase-2), Ac-DEVD-AMC (caspase-3 and 7), Ac-LEVD-

AFC (caspase-4), Ac-WEHD-AFC (caspase-5), Ac-VEID-AMC

(caspase-6), Ac-Ac-IETD-AFC (caspase-8) and LEHD-AFC (cas-

pase-9) (all from Calbiochem). The emitted fluorescence was

measured every 5 min for 30 min at an excitation wavelength of

360 T 40 nm and an emission wavelength of 460 T 40 nm using a

microplate fluorescence reader (Bio-Tek Instruments, Winooski,

VT). Protein concentration of each lysate was determined by BCA

Protein Assay (Pierce). AMC and AFC (Calbiochem) was used to

obtain a standard curve, and the enzyme activity was calculated as

picomoles of AMC or AFC generated per milligram of protein per

minute.

Immunofluorescence

Mice were sacrificed at 6 h or 24 h post-injury and the brain

extracted and prepared as for histology. 50-Am slices of the medial

hippocampus of caspase-3�/� and wild-type mice were mounted

on Superfrost microscope slides (Fisher), dried for 30 min on a

slide dryer and then washed in PBS, permeabilized in PBS +

0.25% Triton X-100 and blocked in 2% BSA PBS-X for 30 min.

Primary antibody against activated caspase-3 (1:200, 9661S, Cell

T. West et al. / Neurobiology of Disease 22 (2006) 523–537526

signaling), caspase-3 (1:200, h277, Santa Cruz), or cytochrome c

(1:100, 6H2.B4, BD Pharmingen) was applied overnight in a

humidified chamber. The slides were washed in PBS and

incubated for 1 h with fluorescent secondary antibody at 1:500

(Molecular Probes). The nuclear dye bisbenzimide (Hoechst

33258, Sigma) was applied for 5 min during the penultimate

wash of the slides. The slides were mounted in vectashield (Vector

Laboratories Inc.) and viewed under a 10�, 40�, and 63�objective lens using a Nikon Microphot-FXL fluorescent micro-

scope (Nikon) or under a 40� water objective on a Zeiss LSM 5

Pascal confocal microscope.

Hippocampal neuron counting

Postnatal day 8 mice that had not undergone H–I injury were

used for counting neurons in the CA1 and CA3 regions of the

dorsal hippocampus (caspase-3�/� mice n = 6, wild-type n = 5).

Brains were removed and cut into 50-Am sections as before. Every

3rd section was mounted and stained with bisbenzimide. CA1 and

CA3 neurons were counted in each section beginning at the most

rostral section in which the dentate gyrus appeared and through the

dorsal part of the hippocampus until the appearance of the ventral

hippocampus. The CA1 and CA3 region of the right hemisphere

was traced and neurons counted using the optical fractionator

method (Stereo Investigator; MicroBrightField Inc.). Regions were

traced at 4�, and number of neurons per structure was estimated by

counting neurons at 60� in 30 by 30 Am counting frames on a 90

by 90 Am grid within the traced area. During preparation, the

sections would shrink to an average thickness of 42 Am, and

neurons were assessed in the middle 15 Am of each section. The

software estimates total neuron number per structure based on the

counts, the volume of the structure and the measured thickness of

each section.

TUNEL staining

Terminal deoxynucleotidyl transferase-mediated dUTP nick

end labeling (TUNEL) staining was performed as directed by the

manufacturer with slight modification (ApopTag kit, Chemicon).

Briefly, brain sections were mounted, dried, and washed in PBS as

for immunofluorescence. Slices were post-fixed in ice-cold 1:1

solution of ethanol and acetic acid for 10 min, washed again and

equilibrated for 10 min in equilibration buffer. To label the 3V-OHends, slices were incubated for 1 h at 37-C with TdT enzyme and

fluorescein-labeled nucleotides. Stop buffer was then applied for 1

h after which the slices were mounted in Vectashield containing the

nuclear dye DAPI (Vector Laboratories Inc.).

DNA laddering

DNA was isolated from the triton insoluble pellet of hippo-

campal tissue lysates using a scaled down version of the TACS

apoptotic DNA laddering kit (R and D systems). Due to the small

size of the hippocampus, amplification was necessary to visualize

DNA laddering in DNA samples from single animals. DNA

ladders were amplified as in (Johnson et al., 2003). Briefly,

oligonucleotide linkers were ligated to the ends of isolated DNA

and the DNA amplified using 20 cycles of PCR. The PCR product

was run on 2% agarose gels and visualized using ethidium bromide

on an Image Station 440 CF (Kodak). Due to the amplification, this

is not a quantitative measure of the amount of DNA laddering, but

it allows us to see if DNA laddering is present or absent in the

sample.

Western blotting

Tissue lysates were pooled into groups of 3 animals. Using

protein concentration values, equal amounts of protein from each

animal were added to each pool. Samples were prepared for SDS

PAGE by boiling in SDS sample buffer, and 15 Ag of total protein

per lane was run on 3–8% Tris-acetate NuPAGE gels to resolve

high molecular weight proteins or 4–12% Bis-Tris NuPAGE gels

to resolve low molecular weight proteins (Invitrogen). Gels were

transferred to Immobilon-P membranes (Millipore) and blocked in

2% ECL Advance blocking reagent (Amersham) in TBS-T for 1–2

h at room temperature. Blots were incubated overnight at 4-C with

the following antibodies: caspase-2 (1:1000, C-20, Santa Cruz),

caspase-3 (1:1000, h277, Santa Cruz), caspase-6 (1:1000, A-16,

Santa Cruz), caspase-7 (1:1000, AAM-127, Stressgen and C-18,

Santa Cruz), caspase-8 (1:2000, poly1207, BD Biosciences),

caspase-12 (1:1000, M-108, Santa Cruz), caspase-14 (1:1000, L-

20, Santa Cruz), tubulin (1:4000, T5168, Sigma), PARP-1 (1:1000,

H-250, Santa Cruz), and spectrin (1:1000, mab1622, Chemicon).

Proteins were visualized using ECL advance (Amersham) or

SuperSignal (Pierce) on an Image Station 440 CF (Kodak).

Statistics

All data are presented as mean T SEM and were compared

using one-way ANOVA followed by Tukey’s post hoc test for

multiple comparisons and Student’s t test for comparing two

groups. Statistical significance was set at P < 0.05. Statistics were

performed using Statistica (StatSoft Inc.) and GraphPad Prism

(GraphPad Software Inc.). Statistical power calculations were done

using 2-sided 2-sample equal variance calculation with the online

UCLA department of statistics power calculator.

Results

Caspase-3 deficiency results in an increase in tissue loss after

neonatal H–I

Caspase-3+/+, +/�, and �/� littermates were subjected to

neonatal H–I on postnatal day 7 (P7), consisting of unilateral

(left) carotid artery ligation followed by 45 min of exposure to 8%

oxygen. To assess the effect that lack of caspase-3 has on the

amount of brain injury, we measured the amount of remaining

tissue in several regions of the brain at 7 days after injury (P14),

Figs. 1A–C. Since the majority of cell death has occurred by 1

week after H–I injury, measurement of remaining tissue in the

damaged hemisphere at P14 generally reflects the extent of the

injury. In the rodent neonatal H–I model, significant tissue loss

and cell death following H–I occurs almost exclusively ipsi- but

not contralateral to the carotid ligation (Rice et al., 1981; Vannucci,

1990; Vannucci and Hagberg, 2004). Thus, the non-injured

hemisphere can serve as a control for the injured hemisphere,

and tissue loss can be calculated by comparing the volume of the

different brain regions in the same brain. Volumes are calculated

from the areas of serial, 300 Am apart, coronal sections of the

hippocampus, cortex, and striatum, as seen in Fig. 1D and

T. West et al. / Neurobiology of Disease 22 (2006) 523–537 527

described in Materials and methods. The mouse model of neonatal

H–I uses an inbred strain of mice (C57BL/6), and thus, the

variability in the injury is much less than in the rat model. Also in

the mouse model the injury is mainly confined to the hippocampus

and striatum (Gibson et al., 2001; Han et al., 2001).

Surprisingly, we found that caspase-3�/� mice have signifi-

cantly more tissue loss in the hippocampus, cortex, and striatum

when compared to wild-type and heterozygous littermates, Figs.

1A–C. Data are presented as mean percentage tissue loss T SEM.

Tissue loss in different brain regions and genotypes was as

follows: hippocampal tissue loss: caspase-3�/� mice (n = 22) =

61.7 T 3.3; caspase-3+/� (n = 31) = 46.0 T 4.7 and wild type (n =

31) = 37.3 T 3.7; cortical tissue loss: caspase-3�/� = 17.1 T 5.7;

caspase-3+/� = 9.5 T 3.3 and wild type = 2.9 T 0.80; striatal tissue

loss: caspase-3�/� = 28.0 T 4.9; caspase-3+/� = 23.0 T 3.4 and wild

type = 15.1 T 1.89. Although tissue loss in the different regions of

the brain of caspase-3+/� mice is higher than what is observed in

wild-type mice, tissue loss in caspase-3+/� mice is not significantly

different from that of wild type but is significantly different from

that of caspase-3�/� mice.

It is possible that physiological factors could affect the amount

of tissue loss observed in the caspase-3�/� mice. For example,

caspase-3�/� mice could have increased brain size compared to

wild-type mice. Also, since the injury in the caspase-3�/� mice is

much higher than what is normally observed in this model, it is

possible that bilateral damage could affect the calculation of tissue

loss in these mice (Vannucci et al., 1988; D’Arceuil et al., 1999).

To ensure that the way we assess tissue loss (comparing the injured

to non-injured hemisphere) is a reliable measure of true tissue loss

in caspase-3�/� and caspase-3+/� mice, we compared the absolute

area of left and right hippocampus in each of the 6 sections where

hippocampal area was measured, Fig. 1E. This shows that the

increase in volume loss of the injured hippocampus (left, L) of

caspase-3�/� mice is due to loss of tissue throughout the

hippocampus, and that there is an absolute increase in hippocampal

volume loss, which is independent of the non-injured hemisphere.

The non-injured (right, R) hippocampus of the caspase-3�/�,

caspase-3+/� and wild-type mice also do not differ in size. Thus, at

P14 caspase-3�/� mice are not subject to bilateral injury any more

than wild-type or caspase-3+/� mice, and the brain of P14 caspase-

3�/� mice is not larger than that of wild-type mice. However, when

the areas of the non-injured hippocampus of mice that underwent

H–I is compared to age-matched wild-type mice, it is obvious that

the areas are slightly smaller in the mice undergoing H–I, compare

P14 to WT R, HET R and KO R in Fig. 1E. The smaller

hippocampus areas in the non-injured side of H–I mice are

unlikely to be due to contralateral injury but rather due to the fact

that mice that have been subjected to H–I have a reduced growth

rate and a lower body weight than non-injured littermates at P14.

To further characterize the brain of caspase-3�/� mice, we

counted neurons in the CA1 and CA3 regions of the hippocampus

of P8 caspase-3�/� and wild-type mice, Figs. 2A and B. Previous

studies have found a 26% increase in the density of neurons in a

defined part of the cortex of adult caspase-3�/� mice (Le et al.,

2002). However, there is no difference in the amount of neurons in

the anterodorsal thalamus of P21 caspase-3�/� and wild-type mice

(Young et al., 2005). Here, we find that at P8, caspase-3�/� mice

have slightly less neurons in the hippocampus when compared to

wild-type mice, Figs. 2A and B. This decrease in neuronal number

is probably due to the fact that the caspase-3�/� mice used for this

study were slightly smaller (15% lower body weight at P7) than the

wild-type mice used. The fact that caspase-3�/� mice have similar

brain size and similar number of neurons in the brain suggests that

these are not the key factors that affect the amount of tissue loss

seen in these mice.

When breeding caspase-3�/� mice, we noted that around one in

5 caspase-3�/� pups is a runt that often does not survive to

adulthood. Since utilization of these mice in H–I experiments

could confound the data, mice weighing less than 2.9 g at P7 were

not included in our studies. At this age, runts would weigh between

1.7 and 2.5 g and look severely malnourished. Since the runts were

not included, there was not a significant difference in the mean

weights at P7 of the mice of each genotype used for H–I

experiments, Fig. 2C. When looking at the effect of body weight at

P7 on tissue loss at P14, we found no correlation between weight at

P7 and tissue loss at P14 in the wild-type mice, Fig. 2D. It is thus

unlikely that gross anatomical differences or differences in body

weight between the genotypes are accounting for the increase in

tissue loss.

Inhibition of caspase-3 with M826

To investigate if the increase in tissue loss seen in caspase-3�/�

mice is due to the activation of non-caspase-3-dependent pathways

in the absence of caspase-3 during development, we looked at the

effect of the specific caspase-3 inhibitor M826 in C57BL/6 mice.

Previous work from our laboratory has shown that intracerebro-

ventricular (ICV) injection of 3–30 nmol of M826 in P7 rats

inhibits caspase-3 activation and protects the brain from tissue loss

(Han et al., 2002). Since the neonatal mouse brain is about one

third the size of a neonatal rat brain, we injected 10 nmol of M826

ICV in the mouse pups. At this concentration, M826 was able to

almost completely eliminate caspase-3 activity in the hippocampus

at 24 h post-injury, Fig. 3A. This inhibition of caspase-3 is similar

to what is observed in other studies with this compound (Han et al.,

2002; Toulmond et al., 2004). Acute inhibition of caspase-3

significantly lowered the amount of tissue loss in the hippocampus

of C57BL/6 mice by around 30%, Fig. 3B. Hippocampal tissue

loss in vehicle injected mice is slightly higher than that of non-

injected mice (compare to wild type in Fig. 1A). This may be due

to the injection of vehicle into the ventricle. Tissue loss in the

cortex and striatum of M826 injected mice is lower than vehicle-

injected mice, but this difference is not significant. Thus, acute

inhibition of caspase-3 has a different effect on tissue loss

compared to that of the developmental lack of caspase-3 in the

caspase-3�/� mice. This suggests that caspase-3-independent cell

death pathways are upregulated in caspase-3�/� mice.

Lack of caspase-3-like activity in caspase-3�/� and low

caspase-3-like activity in caspase-3+/� mice

To better understand what is resulting in the increased tissue

loss in caspase-3�/� mice, we investigated caspase activation in

these mice. Asp-Glu-Val-Asp (DEVD) is the recognition sequence

for both caspase-3 and -7 and is cleaved upon activation of these

caspases. In wild-type mice, DEVD cleavage activity is present at 3

h post-H–I and peaks at 6 h but stays high for 24 h and longer

(Han et al., 2001). No appreciable DEVD cleavage activity was

found in the hippocampus of caspase-3�/� mice at either 6 or 24

h following neonatal H–I, Figs. 4A and B. This shows that both

the early and the late component of DEVD cleavage activity is

blocked in caspase-3�/� mice. Caspase-7 has been shown to be

Fig. 2. Caspase-3�/� mice had slightly fewer neurons in the hippocampus as compared to wild-type mice. Neurons in the CA1 (A) and CA3 (B) regions of the

dorsal hippocampus were estimated using an unbiased stereological method (optical fractionator technique). Postnatal day 8 caspase-3�/� (n = 6) and wild-type

(n = 5) mice were used for this study. The caspase-3�/� mice had significantly fewer neurons in the CA1 region and also slightly fewer neurons in the CA3

region. However, the neuronal estimates take into account the size of the structure, and the caspase-3�/� mice used for the cell counting were significantly

smaller than the wild-type mice used. Average weights T SEM; caspase-3�/� = 3.12 T 0.122 and wild type = 3.66 T 0.154. The decrease in mean size

corresponds to the decrease in neuronal number (15%), suggesting that the difference in estimated neuron number is due to the difference in size. Separately, to

make sure that the weight of the mice at the time of surgery was not affecting the tissue loss, we looked at the weight at P7 of the mice that we measured tissue

loss in panel C. There is no significant difference in the body weight at P7 between genotypes. To further investigate the possible effect of body weight, we

looked for a correlation between body weight at P7 and tissue loss at P14 in wild-type mice (D). There is no significant correlation between body weight and

tissue loss. The dotted lines show the 95% confidence intervals of the linear regression. It is thus unlikely that differences in neuronal number or body weight

can account for the increase in tissue loss in the caspase-3�/� mice.

Fig. 3. M826 inhibits caspase-3 activation following neonatal H– I and has no effect on tissue loss. When injected ICV into the left hemisphere 10 min before

the H–I injury, the caspase-3 inhibitor M826 blocked the DEVD cleavage activity in the hippocampus of wild-type C57BL/6 mice (A). DEVD cleavage

activity was measured at 24 h post H–I in the hippocampus of mice injected with M826 (n = 12) or vehicle (n = 13). DEVD cleavage activity in the injured

(left, L) hippocampus of M826 injected mice (20 T 2.5 pmol/min/mg protein) is significantly reduced compared to mice injected with vehicle (137 T 21 pmol/

min/mg protein). M826 had no effect on the basal DEVD cleavage activity of the non-injured (right, R) hippocampus. Mice injected with M826 or vehicle at P7

were also used to assess the effect of M826 (n = 20) or vehicle (n = 20) on tissue loss in C57BL/6 mice (B). Tissue loss in the hippocampus is significantly

decreased in the M826 injected mice compared to vehicle injected mice. Data are presented as mean percentage tissue loss T SEM. Tissue loss in different brain

regions is as follows: hippocampal tissue loss: M826 (n = 20) = 33.7 T 4.2; vehicle (n = 20) = 46.3 T 4.3; cortical tissue loss: M826 = 7.8 T 2.2; vehicle = 8.2 T

2.2; striatal tissue loss: M826 = 25.0 T 2.9; vehicle = 30.4 T 3.1. Although striatal and cortical tissue loss is lower in the M826 injected mice, this difference was

not significant.

T. West et al. / Neurobiology of Disease 22 (2006) 523–537528

Fig. 4. Caspase-3�/� and caspase-3+/� mice have a marked reduction in caspase-3-like activity. DEVD cleavage assay was used to measure caspase-3 like

activity in hippocampal tissue from mice of all genotypes. Caspase-3 like activity is absent from caspase-3�/� mice at 6 (n = 6) and 24 (n = 4) h after neonatal

H– I (A and B). Data are represented as DEVD cleavage activity. Caspase-3+/� mice have less caspase activation after H– I at both 6 (n = 30) and 24 (n = 7)

h than wild-type mice at these time points (n = 8 and n = 17, respectively), ***P < 0.001. The absence of DEVD cleavage in tissue from caspase-3�/� mice

shows that neither caspase-3 nor caspase-7 is activated in these mice in response to neonatal H– I. To test for compensatory caspase activation, we assessed the

activity of several other caspases in the hippocampus of caspase-3�/� (n = 4, white bars) and wild-type (n = 6, dark bars) mice at 24 h post-injury using

fluorescent peptide cleavage assays (C). Data are represented as fold increase in peptide cleavage activity over non-injured wild type (n = 6) T SEM. The

peptide substrates can be cleaved by several caspases as listed in panel C (Talanian et al., 1997; Thornberry et al., 1997). The caspases which have the peptide

as their optimal sequence are highlighted in bold. The activities of caspases-1, -2, -4, -5, -6, and -8 are only slightly above (about 0.5-fold) what is found in the

non-injured hippocampus, and there is no significant difference in these activities between caspase-3�/� and wild-type mice. With the number of mice used for

this study, we have 80% power to detect a change of 2 standard deviations (sigma = 0.15-fold) in caspase activity between wild-type and caspase-3�/� mice.

Caspase-3 and caspase-9 are activated 10- to 15-fold in the non-injured hippocampus of wild-type mice, but caspase-3 activity is absent from caspase-3�/�

mice and caspase-9 activity is much lower in caspase-3�/� mice. This suggests that the apoptotic pathway involving caspase-9 and caspase-3 is non-functioning

in caspase-3�/� mice and shows that there is no evidence for compensatory caspase activation following neonatal H– I.

T. West et al. / Neurobiology of Disease 22 (2006) 523–537 529

present and may be responsible for developmental apoptosis in

caspase-3�/� mice on the C57BL/6 background (Houde et al.,

2004). Since caspase-7 recognizes the same peptide sequence as

caspase-3 and DEVD cleavage activity was not present in caspase-

3�/� mice after H–I injury, caspase-7 is unlikely to play a

compensatory role in cell death following neonatal H–I in caspase-

3�/� mice. Lack of caspase-7 activation was confirmed by Western

blotting (data not shown).

Compensatory activation of caspase-6 and -7 has been

observed in the liver of caspase-3�/� mice (Zheng et al.,

2000). To investigate the possibility of compensatory caspase

activation in the brain following neonatal H–I, we looked for the

activity of caspases-1 through -9 in the hippocampus of caspase-

3�/� and wild-type mice at 24 h post-injury, Fig. 4C. The

fluorescent peptides used for this study are listed in Fig. 4C.

Each peptide can be cleaved by several caspases, but for each

caspase, there is an optimal substrate (Talanian et al., 1997;

Thornberry et al., 1997). To make it easier to compare between

the different substrates, we present the data as fold increase in

activity as compared to the endogenous activity found in the

non-injured hippocampus of wild-type mice. Only caspase-3 and

caspase-9 were found to be activated more than 2-fold following

neonatal H–I in wild-type mice. Caspase-9 is upstream from

caspase-3 in the caspase cascade and is likely to be responsible

T. West et al. / Neurobiology of Disease 22 (2006) 523–537530

for activation of caspase-3. Interestingly, caspase-3�/� mice do

not have a high level of caspase-9 activation as compared to

wild-type mice. This is likely to be due to lack of feedback from

activated caspase-3, which is known to cleave and activate

caspase-9 (Fujita et al., 2001). Lack of compensatory activation

of caspases-2, -6, -7, -8, -12, and -14 was also observed by

Western blot (data not shown). It is thus unlikely that the

increased cell death occurring in the caspase-3�/� mice is

through a caspase-dependent pathway.

DEVD cleavage activity was significantly lower in caspase-

3+/� mice as compared to wild-type mice at both 6 and 24 h post-

H–I, Figs. 4A and B. This decrease does not necessarily mean

that fewer cells are committed to apoptosis but could mean that

the cells that are committed to apoptosis contain less overall

caspase-3 protein per cell that is available to be activated. To test

this hypothesis, we looked at caspase-3 protein levels in the

hippocampus of non-injured P7 mice of all 3 genotypes by

Western blot, Fig. 5A. caspase-3+/� mice have about half as much

caspase-3 protein when compared to wild-type littermates. This

suggests that each neuron contains approximately half the amount

of caspase-3 and thus at maximum can only activate about half the

level of caspase-3 activity per neuron as compared to wild type.

Fig. 5. Decreased caspase-3 activity in caspase-3+/� mice is due to lower

expression of caspase-3 in these mice. The expression level of caspase-3 at

postnatal day 7 was assessed in wild-type (n = 9), caspase-3+/� mice (n =

9), and caspase-3�/� mice (n = 6) by Western blotting (A). Equal amount of

protein from the hippocampus of 3 mice of the same genotype was pooled

for each lane. Caspase-3 protein level is lower in caspase-3+/� mice

compared to wild-type mice and is absent in caspase-3�/� mice, suggesting

that in caspase-3+/� mice each cell contain less caspase-3 protein. Tubulin

was used as control for loading equal amount of protein in each lane. The

presence of the active form of caspase-3 in the hippocampus of wild-type

and caspase-3+/� mice was assessed at 24 h following neonatal H– I, by

immunostaining using an antibody specifically directed against active

caspase-3 (B–E). In the CA3 region of the hippocampus, wild-type mice

(B) and heterozygous mice (C) have similar number of neurons staining

positive for active caspase-3 (scale bar in B is 50 Am). In the dentate gyrus,

wild-type (D) and heterozygous (E) mice also have comparable staining for

active caspase-3.

Another explanation for why caspase-3+/� mice have less DEVD

cleavage activity could be that less neurons undergo caspase-3

activation in the caspase-3+/� mice. To investigate this, we stained

brain sections from caspase-3+/� and wild-type mice for active

caspase-3 at 24 h following neonatal H–I, Figs. 5B–E. There are

similar numbers of active caspase-3 positive neurons in the

caspase-3+/� and wild-type mice. Thus, caspase-3 activation is

present in about the same number of neurons, but since each cell

contains a lower amount of caspase-3, there is less total activity

when caspase-3 activity is measured in lysates. This suggests that

caspase-3 activation within one cell is likely to be an all or

nothing process, and once some threshold has been reached, most

caspase-3 protein present in the cell is converted from the pro-

form to the active form.

Nuclear morphology of dying neurons in caspase-3�/� mice

To further characterize the cell death occurring in caspase-3�/�

mice, we investigated the nuclear morphology of dying cells in

wild-type and caspase-3�/� mice. The classic apoptotic nuclear

phenotype includes shrinkage of the nucleus, condensation of

chromatin, and formation of apoptotic bodies. However, the

nuclear morphology of dying cells in response to excitotoxicity

and H–I in the neonate have been found to be a continuum of

necrosis and apoptosis, making it difficult classify the exact type of

cell death based on nuclear morphology (Portera-Cailliau et al.,

1997; Northington et al., 2001). Staining brain slices from caspase-

3�/� and wild-type mice at 6 h post-H–I with the nuclear dye

bisbenzimide, we saw an increase in pyknotic nuclei in the injured

hippocampus and cortex of both genotypes, Figs. 6A–D. The

nuclei of neurons in the non-injured hippocampus are large, stain

diffusely for DNA and have distinct chromatin clumps. On the

injured side, some nuclei are small and stain intensely for DNA,

suggesting chromatin condensation. At low magnification, these

pyknotic nuclei can be seen in damaged areas of the hippocampus,

Figs. 6E–H. By staining with bisbenzimide, we found that at 6

h after H–I, caspase-3�/� mice generally had more injury than

wild-type mice. The severe injury seen in Fig. 6 F and H was

observed in 4 of 5 caspase-3�/� mice assessed at this time point but

only in 2 of 8 wild-type mice. This suggests that the enhanced

brain injury following H–I in caspase-3�/� mice is due to a greater

amount of more rapid cell death which is different from the slow

cell death that is observed during development of these mice

(Oppenheim et al., 2001) and following ethanol exposure (Young

et al., 2005).

The pyknotic nuclear morphology following H–I is indepen-

dent of activation of caspase-3 since it is seen in both wild-type and

caspase-3�/� mice. To further investigate the correlation between

caspase-3 activation and pyknotic morphology, sections from wild-

type mice at 24 h post-H–I were double labeled for activated

caspase-3 and DNA, Fig. 6J. Although some cells with condensed

nuclei are positive for the active form of caspase-3, not all cells

with condensed nuclei stain for active caspase-3. Thus, dying

neurons in the brain of wild-type and caspase-3�/� mice have a

pyknotic nuclear phenotype that is independent of caspase-3

activation.

DNA damage in caspase-3�/� and wild-type mice

To investigate the DNA changes leading to the pyknotic

phenotype, we looked at DNA damage in wild-type and caspase-

Fig. 6. Nuclear morphology of dying neurons in caspase-3�/� and wild-type neurons is similar. Brain sections from caspase-3�/� and wild-type brains at 6

h post-H– I were stained with bisbenzimide (A to H). At high magnification, there is a clear difference in the morphology of healthy hippocampal neurons

(non-injured hemisphere A and C) and dying neurons (injured hemisphere B and D) (scale bar in A is 25 Am). However, the nuclear morphology does not

obviously differ between healthy (A and C) or dying (B and D) neurons in caspase-3�/� and wild-type mice (C and D). At lower magnification, it is

obvious that there is a large amount of cell death in the hippocampus in the injured hemisphere of caspase-3�/� mice (F) and wild-type mice (H) (scale bar

in E is 100 Am). In the non-injured hemisphere, there is no gross abnormality in caspase-3�/� (E) or wild-type (G) mice. Many caspase-3�/� brains had

damage as in F at 6 h post H–I, but wild-type mice rarely had this much damage at 6 h. Sections with equivalent amounts of damage were used for this

comparison. Brain sections from wild-type mice at 24 h post-H– I were used to investigate if the pyknotic nuclear phenotype was associated with activation

of caspases-3 (J and K). Sections were stained for activated casapse-3 (red in panel K), and nuclear morphology was visualized with bisbenzimide (J and

blue in K). Although some neurons with pyknotic nuclei also stain for active caspase-3 (long arrow in panels J and K), many do not (arrowheads in panels

J and K). Also, some of the caspase-3 positive neurons did not have pyknotic nuclei (short arrows in panel K). This suggests that the pyknotic nuclear

morphology is not dependent on caspase-3 activation.

T. West et al. / Neurobiology of Disease 22 (2006) 523–537 531

3�/� mice. One-way DNA damage can be assessed is by terminal

deoxynucleotidyl transferase-mediated dUTP nick end labeling

(TUNEL) (Gavrieli et al., 1992). Using this staining procedure,

DNA breaks are labeled on the free 3V-OH group created at the

ends of the DNA. At 24 h post-neonatal H–I, TUNEL positive

cells can be found in both the hippocampus and cortex of wild-type

and caspase-3�/� mice, Figs. 7A and B and data not shown. At 6

h post-H–I, there were no TUNEL positive cells present in

sections of brains from either wild-type or caspase-3�/� mice,

suggesting that DNA damage is a delayed event (data not shown).

However, the TUNEL procedure is not specific for apoptosis, as

DNA breaks can also occur during other types of cell death

including necrosis (Collins et al., 1992).

Another way to assess DNA damage is by looking at DNA

laddering. This is one of the hallmarks of apoptosis and is due to

activation of endonucleases, which cause internucleosomal cleav-

age of genomic DNA (Kerr et al., 1972). DNA laddering has been

observed in rats at 6 to 24 h post-neonatal H–I (Cheng et al.,

1998). To investigate if the TUNEL staining observed in caspase-

3�/� mice is due to activation of endonucleases, DNAwas isolated

from injured hippocampus of wild-type and caspase-3�/� mice at

24 h post-H–I. DNA laddering was qualitatively observed in DNA

isolated from the injured hippocampus of wild-type, caspase-3+/�,

and caspase-3�/� mice, Fig. 7C. DNA laddering, assessed

qualitatively, was found in hippocampus from 7 of 8 wild-type

mice, 4 of 6 caspase-3+/� mice, and 3 of 4 caspase-3�/� mice.

Thus, DNA laddering following neonatal H–I is not dependent on

activation of caspase-3. To our knowledge, this is the first report

that DNA laddering can occur in the nervous system in the absence

of caspase-3 activation.

Fig. 7. DNA damage in caspase-3�/� and wild-type mice following

neonatal H– I. DNA damage was assessed by TUNEL staining (A and B)

and DNA laddering (C). TUNEL labeling of DNA (red pseudocolor) can be

found in condensed nuclei of the injured hippocampus of both wild-type

(A) and caspase-3�/� (B) mice (scale bar in A is 25 Am). These sections

have been counterstained with bisbenzimide (green pseudocolor) to

visualize nuclear morphology. TUNEL staining is present in the hippo-

campus of both caspase-3�/� and wild-type mice, and the morphology of

the dying cells appears to be similar. DNA laddering was assessed in the

hippocampus of wild-type, caspase-3+/�, and caspase-3�/� mice at 24

h following neonatal H– I (C). Lane 1 and 2: non-injured hippocampus of

wild-type mice. Lane 3 and 4: injured hippocampus of wild-type mice. Lane

5 and 6 injured hippocampus of caspase-3+/� mice. Lane 7 and 8: injured

hippocampus of caspase-3�/� mice. Qualitatively, DNA laddering is

present in the injured hippocampus from mice of all three genotypes,

showing that following neonatal H– I DNA laddering is not dependent on

activation of caspase-3.

Fig. 8. Cleavage of spectrin and PARP-1. Pooled protein extracts from

injured (left, L) and non-injured (right, R) hippocampi from all 3

genotypes at 24 h post H–I was probed for presence of caspase-3 and

calpain cleavage products of PARP-1 and spectrin. Each lane contains

equal amounts of protein from 3 separate animals. Spectrin is cleaved by

calpain to generate the p150 and p145 cleavage products and by caspase-3

to generate the p120 fragment. The caspase-3 cleavage product of spectrin

is seen in both wild-type and caspase-3+/� mice but not in caspase-3�/�

mice. There is no change in calpain cleavage products between genotypes,

showing that there is no increase in calpain activation in the caspase-3�/�

mice, and that calpain activation is independent of caspase-3 activation.

PARP-1 is cleaved specifically by caspase-3 to generate cleaved PARP-1

(cPARP-1). PARP-1 cleavage is not as prominent in extracts from capase-

3+/� mice consistent with lower caspase-3 activity in these extracts.

Cleaved PARP is absent in caspase-3�/� extracts and the amount of

uncleaved PARP-1 in extracts from inured hippocampus of caspase-3�/�

mice is comparable to PARP-1 in extracts from the hippocampus of non-

injured wild-type. Tubulin was used as a protein loading control. Similar

results for both PARP-1 and spectrin cleavage were observed at 6

h following neonatal H– I.

T. West et al. / Neurobiology of Disease 22 (2006) 523–537532

PARP-1 and spectrin cleavage in caspase-3�/� mice

Both PARP-1 and spectrin are endogenous substrates for

caspase-3 and are cleaved upon caspase-3 activation following

neonatal H–I (Han et al., 2002). Spectrin is also a substrate for the

calcium activated protease calpain, thought to be involved in

necrotic cell death. There is a marked increase in calpain-cleaved

spectrin (p145 and p150) at 24 h following H–I in the injured

hippocampus of wild-type, caspase-3+/�, and caspase-3�/� mice,

Fig. 8. However, there is no obvious change in the amount of the

calpain cleavage product between the genotypes. To ensure that we

did not miss an early peak in calpain activation, tissue was assessed

6 h post-H–I and blotted for spectrin with the same results (data

not shown). Calpain cleavage of spectrin is not saturated since

there is still uncleaved spectrin present. Thus, increased calpain

activation is not likely to be responsible for the increase in tissue

loss observed in the caspase-3�/� mice.

As expected, the caspase-3 generated cleavage product of

PARP-1 is not observed in the hippocampus of caspase-3�/� mice

at 24 h post-injury, Fig. 8. Also, there is no increase in caspase-3-

cleaved spectrin (p120) in the injured hippocampus of caspase-

3�/� mice after H–I, proving that the presence of these cleavage

products is due to activation of caspase-3. The level of uncleaved

PARP-1 in injured caspase-3�/� mice is comparable to that of

non-injured wild-type mice and was not decreased as it was in

wild-type mice after H–I. Lack of PARP-1 cleavage in a setting

of damaged DNA could lead to overactivation of PARP-1, energy

depletion, and increase in necrotic cell death (Ha and Snyder,

1999). Alternatively PARP-1 in conjunction with apoptosis

inducing factor (AIF) can lead to caspase-independent cell death

(Yu et al., 2002). AIF-mediated cell death involves release of AIF

from mitochondria. To investigate if mitochondrial dysfunction is

present in caspase-3�/� mice, we looked at cytochrome c staining

in sections from wild-type and caspase-3�/� mice at 24 h post-

H–I, Fig. 9. Increase in cytochrome c staining, indicative of

cytochrome c release from mitochondria, is seen in the cortex of

both wild-type and caspase-3�/� mice, suggesting that both

genotypes undergo mitochondrial permeability transition pore

(mPTP) opening, and thus, it is possible that AIF release and a

pathway downstream of this could be involved in caspase-3�/�

mice.

Discussion

Increased injury but lack of caspase-3-like activity

Following neonatal H–I insult, neurons die due to energy

imbalance, generation of reactive oxygen species, and excitotox-

icity. Initial cell death is due to necrosis, while delayed cell death

Fig. 9. Cytochrome c release from mitochondria of caspase-3�/� and wild-type mice. Brain sections from caspase-3�/� and wild-type mice at 24 h post-H– I

were stained with antibodies against cytochrome c. Increased cytochrome c staining (red) was observed in the hippocampus and cortex of both caspase-3�/�

(A) and wild-type (B) mice. This increase in staining is limited to the injured areas of the brain, as defined by the presence of pyknotic nuclei. This signifies that

cytochrome c is released from the mitochondria most likely due to mitochondrial dysfunction. Model of how neonatal brain injury may lead to mitochondrial

dysfunction and cell death (C). Mitochondrial dysfunction can be inhibited by overexpression of Bcl-X or knockout of Bax. If blocked before mitochondrial

dysfunction, there is a decrease in tissue loss. Mitochondrial dysfunction leads to release of cytochrome c and AIF and other pro-apoptotic factors from the

mitochondria. Cytochrome c activates caspase-9 and -3 and leads to cell death, which can be prevented if caspase-3 is inhibited acutely. However, long-term

inhibition of caspase-3 may lead to upregulation of caspase-3-independent pathways which are more deleterious than the regulated process of apoptosis.

T. West et al. / Neurobiology of Disease 22 (2006) 523–537 533

has features of apoptosis. Inhibition of pathways leading to

apoptosis may prevent neuronal loss and has the potential to

improve outcome of neonatal H–I. However, most treatments that

improve the outcome of neonatal H–I reduce the amount of both

apoptosis and necrosis, suggesting that perturbing both cell death

pathways will provide a better outcome (Gibson et al., 2001; Arvin

et al., 2002). Specific pharmacological inhibition of caspase-3,

following neonatal H–I has been used in rats with some reports

showing a benefit and others showing no significant effect (Cheng

et al., 1998; Adachi et al., 2001; Zhu et al., 2003; Joly et al., 2004).

To investigate the specific role of caspase-3 in the neuronal cell

death that follows neonatal H–I, we subjected caspase-3�/� mice

on a C57BL/6 background to neonatal H–I at P7 and measured

tissue loss at 7 days post-injury. Surprisingly, we found that

caspase-3-deficient mice have a significant increase in tissue loss

as compared to wild-type and heterozygous mice. This suggests

that the lack of caspase-3 throughout development leads to an

increase in other types of cell death, that in the setting of H–I can

be more deleterious.

Caspase-3�/� mice on a mixed background have severe brain

abnormalities (Kuida et al., 1996). To determine if the brain of

caspase-3�/� mice on the pure C57BL/6 background is grossly

normal, we measured hippocampal volumes and counted neurons in

the CA1 and CA3 regions of the hippocampus. In accordance with

previous studies of caspase-3�/� mice, we found no gross

difference in brain size or morphology (Le et al., 2002). Two

studies have counted neurons in the brain of caspase-3�/� mice.

One study found increased neuronal density in the cortex of adult

caspase-3�/� mice (Le et al., 2002). Another study used stereolog-

ical methods to count neurons in the anterodorsal thalamus and

found no difference between P21 caspase-3�/� and wild-type mice

(Young et al., 2005). In accordance with the latter study, we did not

to find an increase in neuronal numbers in the hippocampus in the

caspase-3�/� mice. In fact, caspase-3�/� mice have slightly fewer

neurons in the hippocampus, although this may be linked with the

slightly smaller size of the caspase-3�/� mice that were used for the

counting study. Thus, at the light microscopic level, neonatal

caspase-3�/� mice appear to have a structurally normal brain.

T. West et al. / Neurobiology of Disease 22 (2006) 523–537534

To compare the lack of caspase-3 during brain development to

acute caspase-3 inhibition, we tested the effect of the highly potent

caspase-3 inhibitor M826 in wild-type mice. This inhibitor has

been found to protect the neonatal rat brain against H–I (Han et al.,

2002) and the adult rat brain in malonate model of Huntington’s

disease (Toulmond et al., 2004). We found that M826 is able to

inhibit caspase-3 activity in the neonatal mouse following H–I.

Interestingly, as in rats, acute inhibition of caspase-3 preserves

tissue in the hippocampus of mice. Thus, acute inhibition of

caspase-3 is clearly different than the long-term absence of

caspase-3 during development as in the caspase-3�/� mice.

Caspase inhibitors can have non-specific actions (Schotte et al.,

1999; Foghsgaard et al., 2001); however, M826 has been shown to

be highly specific for caspase-3 (Han et al., 2002). Overexpression

of the X-linked inhibitor of apoptosis protein (XIAP) has been

shown to protect the adult and neonatal brain from injury (Trapp et

al., 2003; Wang et al., 2004). However, caspase-3 activity is not

completely abolished in these mice, suggesting that caspase-3-

dependent pathways are still active during development in XIAP

overexpressing mice (Wang et al., 2004). The fact that caspase-3�/�

mice have a different response to injury compared to acute

inhibition of caspase-3 suggests that long-term deficiency of

caspase-3 during development or lack of caspase-3 at specific

developmental stages can lead to upregulation of caspase-3-

independent pathways. The process of apoptosis is regulated at

several points to make sure that cell death does not get out of

control; however, caspase-3-independent cell death pathways may

not be as finely tuned as the caspase-3-dependent pathways and thus

lead to rampant cell death in the setting of injury. This has

implications for therapeutic strategies, since the caspase-3-inde-

pendent pathways appear to exacerbate the injury in response to a

specific insult.

Caspase-7 has the same substrate specificity as caspase-3 and is

responsible for apoptotic cell death and DEVD cleavage activity

during forebrain development of caspase-3�/� mice on C57BL/6

background (Houde et al., 2004). To investigate if caspase-7 is

involved in neuronal death in caspase-3�/� mice and to confirm the

absence of caspase-3 activity, we measured DEVD cleavage

activity in the injured and non-injured hippocampus of wild-type,

caspase-3+/�, and caspase-3�/� mice at 6 and 24 h post-H–I.

DEVD cleavage activity is absent in injured tissue from caspase-

3�/� mice showing that caspase-7 is not activated following

neonatal H–I. Compensatory activation of both caspase-6 and -7

has been observed in the liver of caspase-3�/� mice (Zheng et al.,

2000). To determine if there is activation of other caspases in the

brain following H–I, we measured the activity of caspases 1

through 9. In wild-type mice, we only found increases in caspase-3

and -9 activity following H–I. Caspase-3�/� mice lack caspase-3

activation but have caspase-9 activation, although at lower levels

than wild-type mice. The reason for lower caspase-9 activity in

caspase-3�/� mice is likely to be a lack of feedback activation of

caspase-9 by caspase-3 (Fujita et al., 2001). Besides activity

assays, we looked at caspases-2, -6, -7, -8, -12, and -14 by Western

blot but did not detect the active form of any of these caspases.

This demonstrates that the increase in tissue loss following

neonatal H–I in caspase-3�/� mice is unlikely to be due to

activation of other caspases.

The effect of caspase-3 deficiency was tested in an adult model

of stroke and in vitro using oxygen glucose deprivation (OGD)

using caspase-3�/� mice (Le et al., 2002). This study found a

decrease in infarct volume of adult caspase-3�/� mice compared to

wild-type mice and that caspase-3�/� neurons in culture were

protected against OGD. This is intriguing, since there does not

appear to be a large amount of caspase-3 activation following adult

stroke (Gill et al., 2002; Manabat et al., 2003). In another study of

brain injury in caspase-3�/� mice, Young et al. found that neurons

in the thalamus die to the same extent in response to ethanol

exposure (Young et al., 2005). In addition to injury, neurons die

during development in response to lack of growth factor signaling

to allow neurons to form the appropriate connections. In the spinal

cord of developing caspase-3�/� mice, neurons die via non-

apoptotic mechanisms (Oppenheim et al., 2001), and in the brain,

caspase-7 may play a role in developmental neuronal cell death

(Houde et al., 2004). Thus, caspase-3-independent cell death

pathways are active during development of caspase-3�/� mice. The

fact that adult caspase-3�/� mice are protected against brain injury

suggests that these caspase-3-independent cell death pathways are

inactivated or downregulated in adult caspase-3�/� mice.

Interestingly, caspase-3+/� mice have lower DEVD cleavage

activity than wild-type mice. This does not appear to be due to

lower number of neurons containing active caspase-3 but rather

that caspase-3+/� mice have a lower amount of pro-caspase-3

protein per cell and thus a lower capacity for caspase-3 activation

on a per cell basis. This suggests that during neonatal H–I injury,

caspase-3 activation may be an all-or-nothing event at the cellular

level.

DNA fragmentation and DNA laddering in caspase-3�/� mice

By fluorescence microscopy, dying neurons in caspase-3�/�

mice have a similar nuclear morphology to that of dying neurons in

wild-type mice. Since cell death following H–I in neonates is a

mixture of necrosis and apoptosis, it is hard to distinguish the type

of cell death based on nuclear morphology (Portera-Cailliau et al.,

1997; Ishimaru et al., 1999). By co-staining for active caspase-3 in

wild-type mice, we confirm that the pyknotic nuclear phenotype

can be independent of active caspase-3. In caspase-3�/� mice

exposed to ethanol at P7, the nuclear morphology of dying cells

was studied by electron microscopy and found to be different from

that of wild-type mice exposed to ethanol (Young et al., 2005). Cell

death following ethanol exposure involves different cell death

pathways than excitotoxicity (Goodlett and Horn, 2001; Maas et

al., 2005). However, it is possible that there could be a difference in

nuclear morphology between caspase-3�/� and wild-type mice at

the ultrastructural level.

The pyknotic nuclear morphology suggests that dying neurons

have damaged DNA. Following neonatal H–I, hippocampal

neurons of caspase-3�/� mice show signs of DNA damage both

by TUNEL staining and DNA laddering. The TUNEL procedure

labels nuclei of cells with random DNA fragmentation and specific

DNA laddering. While random DNA fragmentation can have many

causes, DNA laddering is caused by activation of endonucleases

which cleave genomic DNA into nucleosomal units (reviewed in

Robertson et al., 2000). In a normal cell, these endonucleases are

bound to inhibitors and thus inactivated. Recently, it has been

found that cleavage of the inhibitor of caspase activated DNase is

not restricted to caspase-3, suggesting that proteases can cause

disinhibition of endonucleases, and thus DNA laddering (Houde et

al., 2004).

The existence of TUNEL labeling and DNA laddering in the

absence of caspase-3 is controversial and depends on the cell line

and apoptotic stimuli used. Cell lines used to study the

T. West et al. / Neurobiology of Disease 22 (2006) 523–537 535

involvement of caspase-3 in DNA damage are derived from

caspase-3-deficient mice or from the MCF-7 human breast

carcinoma cell line, which is naturally deficient in caspase-3

(Janicke et al., 1998). Studies have not observed DNA laddering in

ES cells, T cells, mouse embryonic fibroblasts (Woo et al., 1998),

or cerebellar granule neurons from caspase-3�/� mice (D’Mello et

al., 2000). Also, caspase-3 activity has been found to be necessary

for DNA laddering in MCF-7 cells in response to TNF and

staurosporine (Janicke et al., 1998) although these cells have DNA

fragmentation by both TUNEL and fluorescence activated cell

sorting assays (Mc Gee et al., 2002). Conversely, hepatocytes from

caspase-3�/� mice have DNA laddering in response to Fas ligand,

although this is delayed as compared to DNA laddering in wild-

type hepatocytes (Zheng et al., 1998). DNA laddering can be

detected as early as 6 h and peaking at 24 h following neonatal H–

I, in rats (Cheng et al., 1998; Parsadanian et al., 1998). In caspase-

3�/� mice undergoing H–I, both TUNEL staining and DNA

laddering were observed at 24 h post-H–I. Since we did not find

evidence of compensatory caspase activation, this suggests that

other enzymes can result in endonuclease activation and DNA

laddering in the developing brain.

Caspase-3-independent cell death pathways

Calpain is a calcium activated protease thought to be involved

in executing necrotic cell death following excitotoxicity (Vanderkl-

ish and Bahr, 2000). Upon activation, calpain cleaves the structural

protein spectrin (Han et al., 2002). We show that at 6 and 24 h post-

H–I, there is no difference in the calpain cleavage product of

spectrin between caspase-3�/� and wild-type mice, suggesting that

an increase in calpain mediated necrosis is not causing the

increased tissue loss of caspase-3�/� mice.

PARP-1 is a poly-ADP-ribose (PAR) polymerase involved in

DNA repair, which uses NAD for its PAR polymerase reaction

(reviewed in Diefenbach and Burkle, 2005). In the setting of injury

and DNA damage, overactivation of PARP-1 can lead to depletion

of cellular energy stores and necrotic cell death (Ha and Snyder,

1999). During apoptosis caspase-3 cleaves PARP-1 and makes it

insensitive to DNA damage to prevent energy loss (Soldani et al.,

2001). Recently, mice deficient in PARP-1 have been found to be

mildly protected against brain injury following neonatal H–I,

suggesting that PARP-1 is involved in neuronal cell death in this

model (Hagberg et al., 2004). In adult ischemia, where necrosis is

more prominent, PARP-1 deficiency or inhibition of PARP-1 leads

to 50% reduction in infarct volume and decreases NAD depletion

following ischemia (Eliasson et al., 1997; Endres et al., 1997).

Lack of cleavage of PARP-1 along with the DNA damage we

observed in the injured hippocampus of caspase-3�/� mice

suggests that overactivation of PARP-1 could cause increased

necrotic cell death in these mice.

Besides necrosis, PARP-1 has been shown to be involved in

AIF induced caspase-independent cell death (Yu et al., 2002).

AIF is released from the mitochondria in response to apoptotic

stimuli and causes apoptotic changes (reviewed in Penninger and

Kroemer, 2003). Thus, AIF is classified as an executioner of

caspase-independent apoptotic cell death and could contribute to

neuronal loss following H–I in caspase-3�/� mice. Release of

AIF shortly precedes release of cytochrome c from the

mitochondria (Daugas et al., 2000) and is caspase-3-independent

(Susin et al., 2000). AIF translocation from mitochondria to the

nucleus following neonatal H–I have been observed in both rats

(Zhu et al., 2003) and wild-type mice (our unpublished

observation). Since the events leading up to caspase-3 activation,

such as mitochondrial dysfunction and mPTP opening, are

present in caspase-3�/� mice, it is possible that AIF induced

apoptosis could play an important role in enhancing injury in

caspase-3�/� mice.

The mPTP can be opened is through the activation of pro-

apoptotic Bcl-2 homology proteins, such as Bax. Previous studies

have found that overexpression of the anti-apoptotic protein Bcl-xL

and knockout of the pro-apoptotic protein Bax protects against

tissue loss and caspase-3 activation following neonatal H–I

(Parsadanian et al., 1998; Gibson et al., 2001). This suggests that

the opening of the mPTP following neonatal H–I leading to

mitochondrial dysfunction has a prominent role in apoptotic cell

death following neonatal H–I. Thus, inhibition of this event would

be a good target for preventing injury following neonatal H–I,

while long-term but not acute inhibition of caspase-3 appears to

lead to upregulation of caspase-3-independent pathways.

Acknowledgments

We would like to thank Pingping Li and Kelly Simmons for

their expert help with animal care and Kevin Roth for the caspase-

3�/� mice. This research was supported by NIH NS35902.

References

Adachi, M., Sohma, O., Tsuneishi, S., Takada, S., Nakamura, H., 2001.

Combination effect of systemic hypothermia and caspase inhibitor

administration against hypoxic– ischemic brain damage in neonatal rats.

Pediatr. Res. 50, 590–595.

Arvin, K.L., Han, B.H., Du, Y., Lin, S.Z., Paul, S.M., Holtzman, D.M.,

2002. Minocycline markedly protects the neonatal brain against

hypoxic– ischemic injury. Ann. Neurol. 52, 54–61.

Ashwal, S., Pearce, W.J., 2001. Animal models of neonatal stroke. Curr.

Opin. Pediatr. 13, 506–516.

Cheng, Y., Gidday, J.M., Yan, Q., Shah, A.R., Holtzman, D.M., 1997.

Marked age-dependent neuroprotection by brain-derived neurotrophic

factor against neonatal hypoxic– ischemic brain injury. Ann. Neurol. 41,

521–529.

Cheng, Y., Deshmukh, M., D’Costa, A., Demaro, J.A., Gidday, J.M., Shah,

A., Sun, Y., Jacquin, M.F., Johnson, E.M., Holtzman, D.M., 1998.

Caspase inhibitor affords neuroprotection with delayed administration

in a rat model of neonatal hypoxic– ischemic brain injury. J. Clin.

Invest. 101, 1992–1999.

Collins, R.J., Harmon, B.V., Gobe, G.C., Kerr, J.F., 1992. Internucleosomal

DNA cleavage should not be the sole criterion for identifying apoptosis.

Int. J. Radiat. Biol. 61, 451–453.

Cowell, R.M., Plane, J.M., Silverstein, F.S., 2003. Complement

activation contributes to hypoxic– ischemic brain injury in neonatal

rats. J. Neurosci. 23, 9459–9468.

D’Arceuil, H.E., Crespigny, A.J., Rother, J., Moseley, M., Rhine, W., 1999.

Serial magnetic resonance diffusion and hemodynamic imaging in a

neonatal rabbit model of hypoxic– ischemic encephalopathy. NMR

Biomed. 12, 505–514.

Daugas, E., Susin, S.A., Zamzami, N., Ferri, K.F., Irinopoulou, T.,

Larochette, N., Prevost, M.C., Leber, B., Andrews, D., Penninger, J.,

Kroemer, G., 2000. Mitochondrio-nuclear translocation of AIF in

apoptosis and necrosis. FASEB J. 14, 729–739.

Diefenbach, J., Burkle, A., 2005. Introduction to poly(ADP-ribose)

metabolism. Cell. Mol. Life Sci. 62, 721–730.

D’Mello, S.R., Kuan, C.Y., Flavell, R.A., Rakic, P., 2000. Caspase-3 is

T. West et al. / Neurobiology of Disease 22 (2006) 523–537536

required for apoptosis-associated DNA fragmentation but not for cell

death in neurons deprived of potassium. J. Neurosci. Res. 59, 24–31.

du Plessis, A.J., Volpe, J.J., 2002. Perinatal brain injury in the preterm and

term newborn. Curr. Opin. Neurol. 15, 151–157.

Eliasson, M.J., Sampei, K., Mandir, A.S., Hurn, P.D., Traystman, R.J., Bao,

J., Pieper, A., Wang, Z.Q., Dawson, T.M., Snyder, S.H., Dawson, V.L.,

1997. Poly(ADP-ribose) polymerase gene disruption renders mice

resistant to cerebral ischemia. Nat. Med. 3, 1089–1095.

Endres, M., Wang, Z.Q., Namura, S., Waeber, C., Moskowitz, M.A., 1997.

Ischemic brain injury is mediated by the activation of poly(ADP-

ribose)polymerase. J. Cereb. Blood Flow Metab. 17, 1143–1151.

Ferriero, D.M., Holtzman, D.M., Black, S.M., Sheldon, R.A., 1996.

Neonatal mice lacking neuronal nitric oxide synthase are less vulnerable

to hypoxic– ischemic injury. Neurobiol. Dis. 3, 64–71.

Foghsgaard, L., Wissing, D., Mauch, D., Lademann, U., Bastholm, L.,

Boes, M., Elling, F., Leist, M., Jaattela, M., 2001. Cathepsin B acts as a

dominant execution protease in tumor cell apoptosis induced by tumor

necrosis factor. J. Cell Biol. 153, 999–1010.

Fujita, E., Egashira, J., Urase, K., Kuida, K., Momoi, T., 2001. Caspase-9

processing by caspase-3 via a feedback amplification loop in vivo. Cell

Death Differ. 8, 335–344.

Gavrieli, Y., Sherman, Y., Ben-Sasson, S.A., 1992. Identification of

programmed cell death in situ via specific labeling of nuclear DNA

fragmentation. J. Cell Biol. 119, 493–501.

Gibson, M.E., Han, B.H., Choi, J., Knudson, C.M., Korsmeyer, S.J.,

Parsadanian, M., Holtzman, D.M., 2001. BAX contributes to apoptotic-

like death following neonatal hypoxia– ischemia: evidence for distinct

apoptosis pathways. Mol. Med. 7, 644–655.

Gill, R., Soriano, M., Blomgren, K., Hagberg, H., Wybrecht, R., Miss,

M.T., Hoefer, S., Adam, G., Niederhauser, O., Kemp, J.A., Loetscher,

H., 2002. Role of caspase-3 activation in cerebral ischemia-induced

neurodegeneration in adult and neonatal brain. J. Cereb. Blood Flow

Metab. 22, 420–430.

Goodlett, C.R., Horn, K.H., 2001. Mechanisms of alcohol-induced damage

to the developing nervous system. Alcohol Res. Health 25, 175–184.

Ha, H.C., Snyder, S.H., 1999. Poly(ADP-ribose) polymerase is a mediator

of necrotic cell death by ATP depletion. Proc. Natl. Acad. Sci. U. S. A.

96, 13978–13982.

Hagberg, H., Bona, E., Gilland, E., Puka-Sundvall, M., 1997. Hypoxia-

ischaemia model in the 7-day-old rat: possibilities and shortcomings.

Acta Paediatr., Suppl. 422, 85–88.

Hagberg, H., Wilson, M.A., Matsushita, H., Zhu, C., Lange, M.,

Gustavsson, M., Poitras, M.F., Dawson, T.M., Dawson, V.L., North-

ington, F., Johnston, M.V., 2004. PARP-1 gene disruption in mice

preferentially protects males from perinatal brain injury. J. Neurochem.

90, 1068–1075.

Hamrick, S.E., Ferriero, D.M., 2003. The injury response in the term

newborn brain: can we neuroprotect? Curr. Opin. Neurol. 16, 147–154.

Han, B.H., DeMattos, R.B., Dugan, L.L., Kim-Han, J.S., Brendza, R.P.,

Fryer, J.D., Kierson, M., Cirrito, J., Quick, K., Harmony, J.A., Aronow,

B.J., Holtzman, D.M., 2001. Clusterin contributes to caspase-3-

independent brain injury following neonatal hypoxia– ischemia. Nat.

Med. 7, 338–343.

Han, B.H., Xu, D., Choi, J., Han, Y., Xanthoudakis, S., Roy, S., Tam, J.,

Vaillancourt, J., Colucci, J., Siman, R., Giroux, A., Robertson, G.S.,

Zamboni, R., Nicholson, D.W., Holtzman, D.M., 2002. Selective,

reversible caspase-3 inhibitor is neuroprotective and reveals distinct

pathways of cell death after neonatal hypoxic– ischemic brain injury. J.

Biol. Chem. 277, 30128–30136.

Honig, L.S., Rosenberg, R.N., 2000. Apoptosis and neurologic disease.

Am. J. Med. 108, 317–330.

Houde, C., Banks, K.G., Coulombe, N., Rasper, D., Grimm, E., Roy, S.,

Simpson, E.M., Nicholson, D.W., 2004. Caspase-7 expanded function

and intrinsic expression level underlies strain-specific brain phenotype

of caspase-3-null mice. J. Neurosci. 24, 9977–9984.

Ishimaru, M.J., Ikonomidou, C., Tenkova, T.I., Der, T.C., Dikranian, K.,

Sesma, M.A., Olney, J.W., 1999. Distinguishing excitotoxic from

apoptotic neurodegeneration in the developing rat brain. J. Comp.

Neurol. 408, 461–476.

Janicke, R.U., Sprengart, M.L., Wati, M.R., Porter, A.G., 1998. Caspase-3

is required for DNA fragmentation and morphological changes

associated with apoptosis. J. Biol. Chem. 273, 9357–9360.

Johnson, J.D., Ahmed, N.T., Luciani, D.S., Han, Z., Tran, H., Fujita, J.,

Misler, S., Edlund, H., Polonsky, K.S., 2003. Increased islet apoptosis

in Pdx1+/� mice. J. Clin. Invest. 111, 1147–1160.

Joly, L.M., Mucignat, V., Mariani, J., Plotkine, M., Charriaut-Marlangue,

C., 2004. Caspase inhibition after neonatal ischemia in the rat brain.

J. Cereb. Blood Flow Metab. 24, 124–131.

Kerr, J.F., Wyllie, A.H., Currie, A.R., 1972. Apoptosis: a basic biological

phenomenon with wide-ranging implications in tissue kinetics. Br. J.

Cancer 26, 239–257.

Kuida, K., Zheng, T.S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic,

P., Flavell, R.A., 1996. Decreased apoptosis in the brain and premature

lethality in CPP32-deficient mice. Nature 384, 368–372.

Le, D.A., Wu, Y., Huang, Z., Matsushita, K., Plesnila, N., Augustinack,

J.C., Hyman, B.T., Yuan, J., Kuida, K., Flavell, R.A., Moskowitz, M.A.,

2002. Caspase activation and neuroprotection in caspase-3-deficient

mice after in vivo cerebral ischemia and in vitro oxygen glucose

deprivation. Proc. Natl. Acad. Sci. U. S. A. 99, 15188–15193.

Leonard, J.R., Klocke, B.J., D’Sa, C., Flavell, R.A., Roth, K.A., 2002.

Strain-dependent neurodevelopmental abnormalities in caspase-3-defi-

cient mice. J. Neuropathol. Exp. Neurol. 61, 673–677.

Levine, S., 1960. Anoxic– ischemic encephalopathy in rats. Am. J. Pathol.

36, 1–16.

Maas Jr., J.W., Indacochea, R.A., Muglia, L.M., Tran, T.T., Vogt, S.K.,

West, T., Benz, A., Shute, A.A., Holtzman, D.M., Mennerick, S., Olney,

J.W., Muglia, L.J., 2005. Calcium-stimulated adenylyl cyclases

modulate ethanol-induced neurodegeneration in the neonatal brain.

J. Neurosci. 25, 2376–2385.

Manabat, C., Han, B.H., Wendland, M., Derugin, N., Fox, C.K., Choi, J.,

Holtzman, D.M., Ferriero, D.M., Vexler, Z.S., 2003. Reperfusion

differentially induces caspase-3 activation in ischemic core and

penumbra after stroke in immature brain. Stroke 34, 207–213.

Mc Gee, M.M., Hyland, E., Campiani, G., Ramunno, A., Nacci, V.,

Zisterer, D.M., 2002. Caspase-3 is not essential for DNA fragmentation

in MCF-7 cells during apoptosis induced by the pyrrolo-1,5-benzox-

azepine, PBOX-6. FEBS Lett. 515, 66–70.

Nakajima, W., Ishida, A., Lange, M.S., Gabrielson, K.L., Wilson, M.A.,

Martin, L.J., Blue, M.E., Johnston, M.V., 2000. Apoptosis has a

prolonged role in the neurodegeneration after hypoxic ischemia in the

newborn rat. J. Neurosci. 20, 7994–8004.

Northington, F.J., Ferriero, D.M., Graham, E.M., Traystman, R.J., Martin,

L.J., 2001. Early neurodegeneration after hypoxia– ischemia in neonatal

rat is necrosis while delayed neuronal death is apoptosis. Neurobiol.

Dis. 8, 207–219.

Olney, J.W., Tenkova, T., Dikranian, K., Muglia, L.J., Jermakowicz, W.J.,

D’Sa, C., Roth, K.A., 2002. Ethanol-induced caspase-3 activation in the

in vivo developing mouse brain. Neurobiol. Dis. 9, 205–219.

Oppenheim, R.W., Flavell, R.A., Vinsant, S., Prevette, D., Kuan, C.Y.,

Rakic, P., 2001. Programmed cell death of developing mammalian

neurons after genetic deletion of caspases. J. Neurosci. 21, 4752–4760.

Parsadanian, A.S., Cheng, Y., Keller-Peck, C.R., Holtzman, D.M., Snider,

W.D., 1998. Bcl-xL is an antiapoptotic regulator for postnatal CNS

neurons. J. Neurosci. 18, 1009–1019.

Penninger, J.M., Kroemer, G., 2003. Mitochondria, AIF and caspases-

rivaling for cell death execution. Nat. Cell Biol. 5, 97–99.

Portera-Cailliau, C., Price, D.L., Martin, L.J., 1997. Excitotoxic neuronal

death in the immature brain is an apoptosis-necrosis morphological

continuum. J. Comp. Neurol. 378, 70–87.

Rees, S., Mallard, C., Breen, S., Stringer, M., Cock, M., Harding, R., 1998.

Fetal brain injury following prolonged hypoxemia and placental

insufficiency: a review. Comp. Biochem. Physiol., A Mol. Integr.

Physiol. 119, 653–660.

Rice III, J.E., Vannucci, R.C., Brierley, J.B., 1981. The influence of

T. West et al. / Neurobiology of Disease 22 (2006) 523–537 537

immaturity on hypoxic– ischemic brain damage in the rat. Ann. Neurol.

9, 131–141.

Robertson, J.D., Orrenius, S., Zhivotovsky, B., 2000. Review: nuclear

events in apoptosis. J. Struct. Biol. 129, 346–358.

Roth, K.A., D’Sa, C., 2001. Apoptosis and brain development. Ment.

Retard. Dev. Disabil. Res. Rev. 7, 261–266.

Schotte, P., Declercq, W., Van Huffel, S., Vandenabeele, P., Beyaert, R.,

1999. Non-specific effects of methyl ketone peptide inhibitors of

caspases. FEBS Lett. 442, 117–121.

Soldani, C., Lazze, M.C., Bottone, M.G., Tognon, G., Biggiogera, M.,

Pellicciari, C.E., Scovassi, A.I., 2001. Poly(ADP-ribose) polymerase

cleavage during apoptosis: when and where? Exp. Cell Res. 269,

193–201.

Susin, S.A., Daugas, E., Ravagnan, L., Samejima, K., Zamzami, N.,

Loeffler, M., Costantini, P., Ferri, K.F., Irinopoulou, T., Prevost, M.C.,

Brothers, G., Mak, T.W., Penninger, J., Earnshaw, W.C., Kroemer, G.,

2000. Two distinct pathways leading to nuclear apoptosis. J. Exp. Med.

192, 571–580.

Talanian, R.V., Quinlan, C., Trautz, S., Hackett, M.C., Mankovich,

J.A., Banach, D., Ghayur, T., Brady, K.D., Wong, W.W., 1997.

Substrate specificities of caspase family proteases. J. Biol. Chem.

272, 9677–9682.

Thornberry, N.A., Rano, T.A., Peterson, E.P., Rasper, D.M., Timkey, T.,

Garcia-Calvo, M., Houtzager, V.M., Nordstrom, P.A., Roy, S., Vaillan-

court, J.P., Chapman, K.T., Nicholson, D.W., 1997. A combinatorial

approach defines specificities of members of the caspase family and

granzyme B. J. Biol. Chem. 272, 17907–17911.

Toulmond, S., Tang, K., Bureau, Y., Ashdown, H., Degen, S., O’Donnell,

R., Tam, J., Han, Y., Colucci, J., Giroux, A., Zhu, Y., Boucher, M.,

Pikounis, B., Xanthoudakis, S., Roy, S., Rigby, M., Zamboni, R.,

Robertson, G.S., Ng, G.Y., Nicholson, D.W., Fluckiger, J.P., 2004.

Neuroprotective effects of M826, a reversible caspase-3 inhibitor, in the

rat malonate model of Huntington’s disease. Br. J. Pharmacol. 141,

689–697.

Trapp, T., Korhonen, L., Besselmann, M., Martinez, R., Mercer, E.A.,

Lindholm, D., 2003. Transgenic mice overexpressing XIAP in neurons

show better outcome after transient cerebral ischemia. Mol. Cell.

Neurosci. 23, 302–313.

Vanderklish, P.W., Bahr, B.A., 2000. The pathogenic activation of calpain: a

marker and mediator of cellular toxicity and disease states. Int. J. Exp

Pathol. 81, 323–339.

Vannucci, R.C., 1990. Experimental biology of cerebral hypoxia– ischemia:

relation to perinatal brain damage. Pediatr. Res. 27, 317–326.

Vannucci, S.J., Hagberg, H., 2004. Hypoxia– ischemia in the immature

brain. J. Exp. Biol. 207, 3149–3154.

Vannucci, R.C., Lyons, D.T., Vasta, F., 1988. Regional cerebral blood flow

during hypoxia– ischemia in immature rats. Stroke 19, 245–250.

Wang, X., Zhu, C., Hagberg, H., Korhonen, L., Sandberg, M., Lindholm,

D., Blomgren, K., 2004. X-linked inhibitor of apoptosis (XIAP) protein

protects against caspase activation and tissue loss after neonatal

hypoxia– ischemia. Neurobiol. Dis. 16, 179–189.

Woo, M., Hakem, R., Soengas, M.S., Duncan, G.S., Shahinian, A., Kagi,

D., Hakem, A., McCurrach, M., Khoo, W., Kaufman, S.A., Senaldi, G.,

Howard, T., Lowe, S.W., Mak, T.W., 1998. Essential contribution of

caspase 3/CPP32 to apoptosis and its associated nuclear changes. Genes

Dev. 12, 806–819.

Young, C., Roth, K.A., Klocke, B.J., West, T., Holtzman, D.M.,

Labruyere, J., Qin, Y.Q., Dikranian, K., Olney, J.W., 2005. Role of

caspase-3 in ethanol-induced developmental neurodegeneration. Neu-

robiol. Dis 20, 608–614.

Yu, S.W., Wang, H., Poitras, M.F., Coombs, C., Bowers, W.J., Federoff,

H.J., Poirier, G.G., Dawson, T.M., Dawson, V.L., 2002. Mediation of

poly(ADP-ribose) polymerase-1-dependent cell death by apoptosis-

inducing factor. Science 297, 259–263.

Yuan, J., Yankner, B.A., 2000. Apoptosis in the nervous system. Nature

407, 802–809.

Zheng, T.S., Schlosser, S.F., Dao, T., Hingorani, R., Crispe, I.N., Boyer,

J.L., Flavell, R.A., 1998. Caspase-3 controls both cytoplasmic and

nuclear events associated with Fas-mediated apoptosis in vivo. Proc.

Natl. Acad. Sci. U. S. A. 95, 13618–13623.

Zheng, T.S., Hunot, S., Kuida, K., Momoi, T., Srinivasan, A., Nicholson,

D.W., Lazebnik, Y., Flavell, R.A., 2000. Deficiency in caspase-9 or

caspase-3 induces compensatory caspase activation. Nat. Med. 6,

1241–1247.

Zhu, C., Qiu, L., Wang, X., Hallin, U., Cande, C., Kroemer, G., Hagberg,

H., Blomgren, K., 2003. Involvement of apoptosis-inducing factor in

neuronal death after hypoxia– ischemia in the neonatal rat brain. J.

Neurochem. 86, 306–317.