Date post: | 31-Dec-2015 |
Category: |
Documents |
Upload: | martin-howard |
View: | 217 times |
Download: | 0 times |
CENTRAL DOGMAOF BIOLOGY
Transcription & TranslationHow do we make sense of the DNA message? Genotype to Phenotype
Central Dogma of Cell BiologyDNA codes for DNA = REPLICATION
DNA codes for RNA = TRANSCRIPTION
RNA codes for protein = TRANSLATION
Replication vs. TranscriptionDNA-DNAStarts at replication originsUnwinds with Helicase
DNA polymeraseProofreadsStart with 1 DNAEnd with 2 DNA: new, old
DNA-RNAStarts at promoter regionsDoes not need Helicase to unwindRNA polymeraseNo proofreadingStart with 1 DNAEnd with same DNA and 1 RNA
TranscriptionProcess of converting DNA to mRNATakes place in the nucleus3 main steps: INITIATION RNA pol binds to the DNAELONGATION nucleotide chain is built, complementary to the DNA messageTERMINATION RNA pol stops transcribing
How do we know what to transcribe?PromoterCharacteristic region of DNA that signals the start of a gene. A sequence of letters that signals gene ahead!TATA box and enhancers
How do we know what to transcribe?Start and stop codonsWhat are codons?
Each 3 bases form a codon that codes for a particular amino acid
AUG methionine amino acid, but also STARTUAA, UGA, UAG STOP
Transcription - Step One:
RNA Polymerase unwinds and unzips the DNA double helix.
Transcription: Step Two:RNA polymerase adds on free-floating nucleotidesA, G, C, UWhat does each bind with?
Stops at STOP codonReleases RNA polymerasereleases mRNA
mRNA
How do we know what to translate?Before the mRNA message leaves the nucleus, RNA editing & modifications occur
DNA & RNA contain sequences that do not code for proteins = INTRONSINTRONS = IN (BETWEEN) RONSSequences that code for proteins are expressed = EXONSEXONS = EX (PRESSED SEQUENCE) ONS
RNA EditingWhile still in the nucleus:
INTRONS are cut out, and
EXONS are spliced together
before the RNA sequence is sent to the cytoplasm for translation
http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html
Transcription animation
Transcription Translation
TranslationThe mRNA leaves the nucleus cytoplasmMessage is read at the ribosome1 Codon (3 letter message) is translated into 1 amino acidtRNA molecule has one end (anticodon) that matches the mRNA . Each anticodon specifies an amino acid.The amino acids are bonded together as peptide chainswhich fold into proteins
The Genetic Code:3 letters = 1 codon 1 amino acid
http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html
Animation of translation
Practice with this sequenceDNA: TCGATGTTCCGCCGTACGTCGTAACCG AGCTACAAGGCGGCATGCAGCATTGGC Use the bottom strand as the complement to the mRNA. Whats that mean? Hint: Look for where it starts. How do you know?Once youve found the reading frame, write in tripletsmRNA Use your genetic code wheel to write the amino acid sequence. How will you know when to stop?
Try again without helpDNA: CCGTCATGTTCGCGCTACAAATGAAATGA GGCAGTACAAGCGCGATGTTTACTTTACT
mRNA:
Polypeptide: