Date post: | 02-Jan-2016 |
Category: |
Documents |
Upload: | burke-osborne |
View: | 52 times |
Download: | 1 times |
Central Dogma of Molecular Biology
1. Talk with your table partner about answers to these: What is
DNA’s job in a cell? What does it do?
2. What is a “trait”? Name as many different traits that you can think
of for a human being.
HomeworkEnergy Test+ due Thursday
Objective & Central Question
How do you get from a string of 6 chemicals to all your physical characteristics, or all of a bacterium’s or all of a plant’s etc.
Today is to get a broad overview of the process. Protein synthesis = getting from DNA to a trait.
Protein Synthesis
SynthesisWhat does it mean to synthesize something?
TranscriptionWhat does it mean to transcribe something?
TranslationWhat does it mean to translate something?
Central Dogma = Protein Synthesis
DNA ---> ______ ---> _________ ---> Trait
Central Dogma = Protein Synthesis
DNA ---> RNA ---> Protein ---> Trait
Tra
nscr
iptio
n Tra
nsla
tion
Protein Synthesis
Protein synthesis is also called getting “from genotype to phenotype.”Genotype = your DNA sequencePhenotype = the physical trait you have because of that DNA sequence
RNA
RNA = Ribonucleic acidMolecule made of nucleotides that assist DNA in giving orders.
QuickTime™ and a decompressor
are needed to see this picture.
QuickTime™ and a decompressor
are needed to see this picture.
Compare & ContrastDNA RNA
Macromolecules & Cell PartsName Shape Biochemistry Types Key Locations Functions/Uses
Nucleic acid
Ca
rbon
, Nitr
og
en,
Hyd
rog
en
Geneticmaterial: “Blueprint”for cell
Is it DNA or RNA?
ATTCGCGTGTAAGCGCAC
GCCUAUGCGGGA
CCATCGGGCAAC
Transcription
Starting from the beginning…http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html
Transcription
Transcription = a strand of mRNA is made using a strand of DNA as a template. It happens in the nucleus.The RNA strand is made by matching free-floating RNA nucleotides to the DNA strand sequence, making an RNA strand that’s perfectly complementary.
Which process that we’ve already learned does this remind you of?
mRNA = “Messenger RNA.”
Transcription
Say that this is my DNA molecule.
AATGCGATGCATGCTAAAGCTAGATTACGCTACGTACGATTTCGATCT
During transcription, the two strands will unzip.The strand that RNA is NOT made from = “gene strand.”
The strand that RNA IS made from = “template strand.”
TranscriptionWhat will the mRNA sequence be if the top strand is the template strand?
AATGCGATGCATGCTAAAGCTAGATTACGCTACGTACGATTTCGATCT
Which strand, gene or template, does the base sequence of the mRNA come out identical to? (Except that T = U)
mRNA then leaves the nucleus, and goes to the ribosome. The rest of protein synthesis happens in the ribosome.
Can you complete these questions?
____ -> _____ -> ________ -> _______Also label the first two arrows.
Where does transcription take place in the cell?
If this DNA molecule undergoes transcription, write the RNA molecule that results, and label which strand of DNA you used for the template and which is the gene strand. Lastly, what KIND of RNA did you make?
CGTTCGACTGATCGTGCAAGCTGACTAGCA
VocabularyProtein synthesisGenotypePhenotypeTraitTranscriptionRNAmRNAGene strandTemplate strand