Chapter 12Chapter 12

Expression and RegulationExpression and Regulation

Comparative GenomicsComparative GenomicsNCBINCBICMRCMR

GC content – low of 29% for GC content – low of 29% for B. burdorferi B. burdorferi to a to a high of 68% forhigh of 68% for M. tubercuolosis M. tubercuolosis

The difference in GC content affects the codon The difference in GC content affects the codon usage and amino acid composition for a speciesusage and amino acid composition for a species

Glycine, alanine, proline, and arginine are Glycine, alanine, proline, and arginine are represented by GC rich genomes.represented by GC rich genomes.

Isoleucine, phenylalnine, tyrosine, and Isoleucine, phenylalnine, tyrosine, and methionine are represented by AT rich codonsmethionine are represented by AT rich codons

Shared genesShared genes

½ of all genes are similar or ½ of all genes are similar or homologous in bacterial specieshomologous in bacterial species

The number of genes involved in The number of genes involved in processes like transcription and processes like transcription and translation are similar even when translation are similar even when there is a vast difference in the size there is a vast difference in the size of genomesof genomes

Suggestive of a basic number for all Suggestive of a basic number for all processes in the cell processes in the cell

Transport GenesTransport Genes

A high number of transport genes A high number of transport genes required to move molecules across a required to move molecules across a membranemembrane

Genome size and the different Genome size and the different transport mechanisms are relatedtransport mechanisms are related

Many transport systems are based Many transport systems are based on the life style, for instance on the life style, for instance heterotrophyheterotrophy

Unique genesUnique genes

¼ of all genes are unique to a ¼ of all genes are unique to a particular organismparticular organism

EvolutionEvolution

Vertical transmissionVertical transmission Duplication of genes after vertical Duplication of genes after vertical

transmissiontransmission Horizontal or lateral transmission of unique Horizontal or lateral transmission of unique

genesgenes

Conjugation, transformation, and Conjugation, transformation, and transduction( phages) transduction( phages)

Pathogenicity islands – blocks of pathogenic Pathogenicity islands – blocks of pathogenic genes transferred with selective advantagegenes transferred with selective advantage

Molecular evidenceMolecular evidence

BLAST – similarity in genes by BLAST – similarity in genes by homology and alignmenthomology and alignment

COG – Clusters of orthologous COG – Clusters of orthologous groups, classifies genes on the basis groups, classifies genes on the basis of similar functionof similar function

Ribosomal genes and small RNA’sRibosomal genes and small RNA’s Whole genome analysisWhole genome analysis

Gene expressionGene expression

TranscriptionTranscription TranslationTranslation Protein foldingProtein folding Genes and gene regulationGenes and gene regulation OperonsOperons Small RNAsSmall RNAs

Prokaryote mRNAProkaryote mRNA

Ss RNA( 5’ ---------3’)Ss RNA( 5’ ---------3’) Directions for one or more polypeptidesDirections for one or more polypeptides Non translated leader sequence of 24 to 150 Non translated leader sequence of 24 to 150

bases at the 5’ endbases at the 5’ end Polygenic RNAs that code for more than one Polygenic RNAs that code for more than one

polypeptide have spacerspolypeptide have spacers At the 3’ end following the termination codon At the 3’ end following the termination codon

there is a non translated trailer .there is a non translated trailer .

RNA PolymeraseRNA Polymerase

RNA is synthesized under the direction of RNA RNA is synthesized under the direction of RNA polymerasepolymerase

The synthesis is similar to that of DNAThe synthesis is similar to that of DNA

Nucleotide tri-phosphatesNucleotide tri-phosphates

n[ ATP,GTP,CTP,UTP] RNA+ nPPin[ ATP,GTP,CTP,UTP] RNA+ nPPi

Pyrophosphate( PPi )Pyrophosphate( PPi )

Pyrophosphate is produced in both DNA and RNA Pyrophosphate is produced in both DNA and RNA Polymerase reactionsPolymerase reactions

Pyrophosphate is then removed by hydrolysis to Pyrophosphate is then removed by hydrolysis to orthophosphate in a reaction catalyzed by the orthophosphate in a reaction catalyzed by the phosphatase enzymephosphatase enzyme

The reaction is irreversibleThe reaction is irreversible

RNA polymeraseRNA polymerase The RNA polymerase of E. coli is an extremely large The RNA polymerase of E. coli is an extremely large

enzymeenzyme It contains four polypeptide chainsIt contains four polypeptide chains The RNA polymerase opens or unwinds the double helix to The RNA polymerase opens or unwinds the double helix to

form a transcription bubble about 12 – 20 base pairs in form a transcription bubble about 12 – 20 base pairs in lengthlength

It transcribes the mRNA from 5’ to 3’It transcribes the mRNA from 5’ to 3’ It produces mRNA at about 40 nucleotides/second at 37oC.It produces mRNA at about 40 nucleotides/second at 37oC.

Core enzyme componentCore enzyme component Catalytic activityCatalytic activity Composed of four chainsComposed of four chains The The SigmaSigma factor has no catalytic activity but assists in the factor has no catalytic activity but assists in the

recognition of genes. Once transcription begins this factor recognition of genes. Once transcription begins this factor dissociates from the core enzyme complexdissociates from the core enzyme complex

The The Beta and Beta primeBeta and Beta prime polypeptides are involved with the polypeptides are involved with the ginding of DNA and regulation. Rifampin which is a ginding of DNA and regulation. Rifampin which is a polymerase inhibitor binds to the B’polymerase inhibitor binds to the B’

The function of the The function of the AlphaAlpha subunit is involved in the subunit is involved in the recognition of the promotersrecognition of the promoters

RNA PolymeraseRNA Polymerase

These are the different These are the different views of the core RNA views of the core RNA polymerase molecules as polymerase molecules as they observed on the they observed on the surface of a lipid bilayer surface of a lipid bilayer tube.tube.

Each picture shows three Each picture shows three molecules which appear molecules which appear linked. It happens because linked. It happens because negative stain does not negative stain does not penetrate between the penetrate between the molecules due to their molecules due to their

tight packingtight packing within a within a helical crystal. helical crystal.

The most striking feature The most striking feature of the core structure is a of the core structure is a thumb-like projection thumb-like projection surrounding a channel. The surrounding a channel. The channel is 25 Å in diameter channel is 25 Å in diameter and can easily and can easily accommodate double accommodate double stranded DNA. For more stranded DNA. For more information on this information on this

Core Enzyme

Holoenzyme

Sigma FactorsSigma FactorsSigma70Sigma70 Primary sigma factor, or Primary sigma factor, or

housekeeping sigma housekeeping sigma factor. factor.

Encoded by Encoded by rpoDrpoD . . When bound to RNAP Core When bound to RNAP Core

allows recognition of -35 allows recognition of -35 and -10 promoters. and -10 promoters.

No other factors required No other factors required for RNAP binding and for RNAP binding and transcription initiation. transcription initiation.

Sigma54Sigma54 alternative sigma factor alternative sigma factor

involved in transcribing involved in transcribing nitrogen-regulated genes nitrogen-regulated genes (among others). (among others).

Encoded by Encoded by rpoNrpoN ( (ntrAntrA ). ). When bound to When bound to RNAP CoreRNAP Core

allows recognition of allows recognition of different -26 and -12 different -26 and -12 promoters. promoters.

Requires an additional Requires an additional activator to allow open activator to allow open complex formation for complex formation for transcription. transcription.

Sigma factorsSigma factorsSigma32Sigma32

heat shock factor involved heat shock factor involved in activation of genes after in activation of genes after heat shock. heat shock.

Encoded by Encoded by rpoHrpoH ( (htpRhtpR ). ). Turned on by heat shock Turned on by heat shock

(either at the transcription (either at the transcription or protein level). or protein level).

Activates multiple genes Activates multiple genes involved in the heat shock involved in the heat shock response. response.

SigmaS (sigma38)SigmaS (sigma38)

Stationary phase sigma Stationary phase sigma factor. factor.

Encoded by Encoded by rpoSrpoS . .

Turned on in stationary Turned on in stationary phase. phase.

Activates genes involved Activates genes involved in long term survival, in long term survival, peroxidase. peroxidase.

RNA BindingRNA Binding Binding occurs with the aid of the Binding occurs with the aid of the Sigma factorSigma factor Recognition site is TTGACA about 35 bases upstream of the Recognition site is TTGACA about 35 bases upstream of the

genegene The TATAAT sequence or The TATAAT sequence or PribnowPribnow box lies within the box lies within the

promoter about 10 base pairs before the starting point of promoter about 10 base pairs before the starting point of transcription.transcription.

RNA polymerase recognizes these sequencesRNA polymerase recognizes these sequences The DNA begins to unwind near the Pribnow boxThe DNA begins to unwind near the Pribnow box Transcription begins about 6 or 7 base pairs from the 3’ Transcription begins about 6 or 7 base pairs from the 3’

end of the promoterend of the promoter

Thermus aquaticusThermus aquaticus – RNA – RNA polymerasepolymerase

The enzyme is composed of four subunits and is The enzyme is composed of four subunits and is complexed with the sigma factorcomplexed with the sigma factor

The structure is claw shaped. Has an internal The structure is claw shaped. Has an internal channel that contains Mg++channel that contains Mg++

This may provide an entry point for DNAThis may provide an entry point for DNA The sigma unit binds to the -10 and -35 elements The sigma unit binds to the -10 and -35 elements

of the promoterof the promoter

TerminationTermination There should be a stop codonThere should be a stop codon And there must also be signals for terminationAnd there must also be signals for termination Terminator often contain a sequence coding for Terminator often contain a sequence coding for

an RNA stretch that can form a hair pin with an RNA stretch that can form a hair pin with complementary base pairingcomplementary base pairing

This works as a signal for RNA polymerase to stop This works as a signal for RNA polymerase to stop transcriptiontranscription

Prokaryote Transcription

Eukaryote Transcription

Protein SynthesisProtein Synthesis The mRNA is translated into the amino acid The mRNA is translated into the amino acid

sequence of a proteinsequence of a protein In E. coli protein synthesis is rapid and accurate.In E. coli protein synthesis is rapid and accurate. It occurs at a rate of 900 residues per minuteIt occurs at a rate of 900 residues per minute The synthesis of a polypeptide chain begins at he The synthesis of a polypeptide chain begins at he

free amino group end( N- terminus) and free amino group end( N- terminus) and concludes with the carboxyl group at the end( the concludes with the carboxyl group at the end( the C- terminus )C- terminus )

Bacterial translationBacterial translation

To account for the rapid growth of bacteria, m To account for the rapid growth of bacteria, m RNAs must be used efficientlyRNAs must be used efficiently

They can complex with several ribosomes at a They can complex with several ribosomes at a timetime

There may be a ribosome every 80 nucleotides on There may be a ribosome every 80 nucleotides on the mRNA and as many as 20 ribosomes reading the mRNA and as many as 20 ribosomes reading the mRNA transcriptthe mRNA transcript

These complexes are called polyribosomesThese complexes are called polyribosomes

Polysomes or polyribosomesPolysomes or polyribosomes

While RNA polymerase is synthesizing mRNA, the While RNA polymerase is synthesizing mRNA, the mRNA can already be attached to a ribosomemRNA can already be attached to a ribosome

Protein synthesis can be initiated Protein synthesis can be initiated

tRNA – Clover leaf – loops tRNA – Clover leaf – loops and stemand stem

CCA terminus( 3’ ) attachment for amino acidCCA terminus( 3’ ) attachment for amino acid Anticodon at the base 3’-----5’ Three letters Anticodon at the base 3’-----5’ Three letters

complementary to mRNA sequencecomplementary to mRNA sequence There are two large arms : the D arm has a There are two large arms : the D arm has a

substitution of a pyrimidine nucleotide – substitution of a pyrimidine nucleotide – dihydrouridinedihydrouridine

tRNA is folded into an L-shaped structure. The tRNA is folded into an L-shaped structure. The amino acid is held on one end of the Lamino acid is held on one end of the L

Attachment of an amino Attachment of an amino acid to a tRNAacid to a tRNA

This is called Amino Acid activationThis is called Amino Acid activation The tRNAs are approximately 73-93 nucleotides in The tRNAs are approximately 73-93 nucleotides in

lengthlength The acceptor end of the tRNA ends in C-C- A. ( 3’ The acceptor end of the tRNA ends in C-C- A. ( 3’

end)end) The amino acid attaches to the terminal adenylic The amino acid attaches to the terminal adenylic

acidacid

Attachment of an amino Attachment of an amino acid to a tRNAacid to a tRNA

The attachment of an amino acid to a The attachment of an amino acid to a tRNA is catalyzed by an enzyme tRNA is catalyzed by an enzyme called aino-acyl-tRNA synthetasecalled aino-acyl-tRNA synthetase

The association of the amino acid The association of the amino acid and the tRNA requires the use of ATP and the tRNA requires the use of ATP in the presence of a Mg++in the presence of a Mg++

There are at least 20 amino acyl There are at least 20 amino acyl tRNA synthetasestRNA synthetases

Site for attachment of the Site for attachment of the amino acid to the t- RNAamino acid to the t- RNA

3’ CCA – attaches 3’ CCA – attaches to the terminal Ato the terminal A

Amino acyl tRNA synthetaseAmino acyl tRNA synthetase

Amino acyl tRNA Amino acyl tRNA synthetase has two synthetase has two sites – one for the sites – one for the binding of the binding of the amino acid and a amino acid and a tRNAtRNA

Prokaryote ribosomeProkaryote ribosome

Prokaryote ribosomes consist of a 30 s and a 50 s Prokaryote ribosomes consist of a 30 s and a 50 s subunitsubunit

Each subunit is composed of one or two rRNA Each subunit is composed of one or two rRNA molecules and many proteinsmolecules and many proteins

The total complex is 70sThe total complex is 70s

Prokaryote RibosomesProkaryote Ribosomes

Ribosomal RNA has Ribosomal RNA has three rolesthree roles

The 16 s rRNA of the The 16 s rRNA of the 30 s portion of the 30 s portion of the ribosomes may aid in ribosomes may aid in the initiation of the initiation of protein synthesisprotein synthesis

It can bind to the It can bind to the initiation factorsinitiation factors

It may also have a It may also have a catalytic functioncatalytic function

16s rRNA16s rRNA

E. coliE. coli ribosome ribosome

Figure 12.13

Ribosomal binding sitesRibosomal binding sites

P site or Donor siteP site or Donor site A site or Acceptor siteA site or Acceptor site E site or Exit siteE site or Exit site

InitiationInitiation Initiation in Initiation in

prokaryotes( Domain prokaryotes( Domain Bacteria) begins with a Bacteria) begins with a specially modified N- specially modified N- formylmeththionyl-tRNAformylmeththionyl-tRNA

This molecule binds to the This molecule binds to the 30s sub unit of the 30s sub unit of the ribosome and is ribosome and is possitioned with both the possitioned with both the 3’ end and the 16srRNA 3’ end and the 16srRNA and the anticodon of the and the anticodon of the fMet-tRNAfMet-tRNA

Messengers have a special Messengers have a special initiator codon 5’ AUG or initiator codon 5’ AUG or GUG that specifically binds GUG that specifically binds with the fMet- tRNAwith the fMet- tRNA

Initiation Factors( associated Initiation Factors( associated with the 30s subunit)with the 30s subunit)

Three initiation factors are requiredThree initiation factors are required IF-3 promotes the binding of the mRNA to IF-3 promotes the binding of the mRNA to

the 30s unit( also stabilizes the binding)the 30s unit( also stabilizes the binding) IF-2 binds GTP and fMet-tRNA and the 30s IF-2 binds GTP and fMet-tRNA and the 30s

unitunit IF-1 is needed for the release of IF-2 and IF-1 is needed for the release of IF-2 and

GDP from the reaction which requires the GDP from the reaction which requires the use of a phosphate for energyuse of a phosphate for energy

IF3IF3

IF3 recognizes the sequence of the IF3 recognizes the sequence of the ribosome ribosome binding sitebinding site on the bacterial m on the bacterial m RNA.RNA.

This is called the Shine-Dalgarno This is called the Shine-Dalgarno sequence.sequence.

AGGAGGU) is the signal for initiation of AGGAGGU) is the signal for initiation of protein biosynthesisprotein biosynthesis in in bacterialbacterial mRNAmRNA. It . It is located 5' of the first coding AUG, and is located 5' of the first coding AUG, and consists primarily, but not exclusively, of consists primarily, but not exclusively, of purines. purines.

Shine-DalgarnoShine-Dalgarno The requirement for a Shine-Dalgarno The requirement for a Shine-Dalgarno

sequence in addition to AUG for proper sequence in addition to AUG for proper initiation allows the AUG to be chosen from initiation allows the AUG to be chosen from among multiple AUG trinucleotides in among multiple AUG trinucleotides in mRNA, most coding for internal methionines mRNA, most coding for internal methionines or representing out of phase codons. or representing out of phase codons.

Binding of mRNA to rRNA via the Shine Binding of mRNA to rRNA via the Shine Dalgarno sequence may stimulate initiation Dalgarno sequence may stimulate initiation by increasing the local concentration of AUG by increasing the local concentration of AUG near the correct site on the ribosome. near the correct site on the ribosome.

Other sequences, in addition to the AUG Other sequences, in addition to the AUG and Shine-Dalgarno sequence, are also and Shine-Dalgarno sequence, are also important.important.

Initiation codonInitiation codon

AUGAUG GUGGUG UUGUUG In bacteria the initiator tRNA carries a In bacteria the initiator tRNA carries a

methionine residue that has been methionine residue that has been formylated on its amino group forming a formylated on its amino group forming a molecule of N-formyl-methionyl-tRNAmolecule of N-formyl-methionyl-tRNA

The tRNA that matches this is for initiation The tRNA that matches this is for initiation only tRNAonly tRNAmetmet

mm

InitiationInitiation

The AUG at the start position in The AUG at the start position in mRNA codes for formyl methioninemRNA codes for formyl methionine

The AUG in other positions codes for The AUG in other positions codes for methioninemethionine

The translation of AUG and GUG The translation of AUG and GUG depends upon the contextdepends upon the context

TranslationTranslation

In bacteria and mitochondria,the In bacteria and mitochondria,the formyl residue is removed by a formyl residue is removed by a specific deformylase enzyme to specific deformylase enzyme to generate a normal NH2 terminus. generate a normal NH2 terminus.

If methionine is to be the NH2 If methionine is to be the NH2 terminal amino acid this is the only terminal amino acid this is the only step. step.

In about ½ of the proteins In about ½ of the proteins aminopeptidase removes the aminopeptidase removes the methionine creating a new terminus.methionine creating a new terminus.

Elongation of the Elongation of the Polypeptide ChainPolypeptide Chain

Every amino acid added to the Every amino acid added to the growing polypeptide chain is the growing polypeptide chain is the result of three phasesresult of three phases

a.a. Amino acyl- tRNA bindingAmino acyl- tRNA binding

b.b. Transpeptidation reactionTranspeptidation reaction

c.c. TranslocationTranslocation

Elongation factorsElongation factors

GTP and the elongation factor EF-Tu are GTP and the elongation factor EF-Tu are required for the insertion of the first t-RNA required for the insertion of the first t-RNA into the A site( EF-Tu is associated with the into the A site( EF-Tu is associated with the ribosome.ribosome.

This is followed by GTP hydrolysis and the This is followed by GTP hydrolysis and the GDPTu complex leaves the ribosomeGDPTu complex leaves the ribosome

EF-Tu.GDP is converted to EF-Tu.GTP with EF-Tu.GDP is converted to EF-Tu.GTP with the aid of a second elongation factorthe aid of a second elongation factor

EF-Ts.EF-Ts.

GTP – The entry of the amino acyl t- GTP – The entry of the amino acyl t- RNA to the A site is dependent upon a RNA to the A site is dependent upon a

guanine nucleotideguanine nucleotide When GTP is present, the factor is in its active When GTP is present, the factor is in its active

statestate When the GTP is hydrolyzed to GDP, the factor When the GTP is hydrolyzed to GDP, the factor

becomes inactivebecomes inactive Activity is restored when the GDP is replaced by Activity is restored when the GDP is replaced by

GTPGTP

Elongation cycleElongation cycle

At the beginning of the elongation At the beginning of the elongation cycle the peptidyl site is filld with cycle the peptidyl site is filld with either N-formylmethionyl-tRNAor either N-formylmethionyl-tRNAor peptidyl-t-RNA and the A and E sites peptidyl-t-RNA and the A and E sites are emptyare empty

The second amino acyl-tRNA is The second amino acyl-tRNA is inserted into the A siteinserted into the A site

TranspeptidationTranspeptidation

Occurs between amino acidsOccurs between amino acids This is catalyzed by peptidly This is catalyzed by peptidly

transferase located on the 50s transferase located on the 50s subunitsubunit

The two amino acids are joined by a The two amino acids are joined by a peptide bondpeptide bond

No extra energy source is requiredNo extra energy source is required

Transpeptidation reactionTranspeptidation reaction

Figure 12.16

catalyzed by peptidyl transferase

Transpeptidation factorsTranspeptidation factors Transcription elongation Transcription elongation

factors stimulate the factors stimulate the activity of the RNA activity of the RNA polymerase by increasing polymerase by increasing the overall elongation rate the overall elongation rate and the completion of RNA and the completion of RNA chains. chains.

E. coliE. coli GreA is one such GreA is one such factor. It acts by inducing factor. It acts by inducing cleavage of the transcript cleavage of the transcript within the RNA within the RNA polymerase, followed by polymerase, followed by release of the RNA 3'-release of the RNA 3'-terminal fragment. terminal fragment.

TranslocationTranslocation The final stage of the elongation process of The final stage of the elongation process of

protein synthesisprotein synthesis The peptidyl – tRNA moves about 20 Angstroms The peptidyl – tRNA moves about 20 Angstroms

from the A to the P sitefrom the A to the P site The ribosome moves one codon along the mRNA The ribosome moves one codon along the mRNA

so that a new codon is positioned on the A siteso that a new codon is positioned on the A site The empty rRNA leaves the ribosomeThe empty rRNA leaves the ribosome Ribosomal proteins are involved in this movementRibosomal proteins are involved in this movement

Translocation the final step Translocation the final step in elongationin elongation

The three aspects The three aspects of this process of this process occur occur simultaneouslysimultaneously

Translation and Moving Translation and Moving MoleculesMolecules

faculty.smu.edufaculty.smu.edu/ svik/5304/molecules.html/ svik/5304/molecules.html

Termination of Translation Termination of Translation in Prokaryotein Prokaryote

Protein synthesis stops Protein synthesis stops when a nonsense codon. when a nonsense codon. UAA, UGA, UAG reaches UAA, UGA, UAG reaches the ribosomethe ribosome

Three release factors are Three release factors are requiredrequired

GTP hydrolysis is requiredGTP hydrolysis is required The ribosomal subunits The ribosomal subunits

dissociate from each other dissociate from each other and the mRNA is releasedand the mRNA is released

Antibiotics that affect the Antibiotics that affect the process of translationprocess of translation

Kirromycin inhibits the function of EF-Kirromycin inhibits the function of EF-TuTu

Puromycin mimics amino acyl t RNAPuromycin mimics amino acyl t RNA Erythromycin blocks peptidyl Erythromycin blocks peptidyl

transferasetransferase Streptomycin blocks initiationStreptomycin blocks initiation

Protein folding and chaperonesProtein folding and chaperones

Molecules called chaperone Molecules called chaperone recognize only unfolded polypeptides recognize only unfolded polypeptides or partially denatured proteinsor partially denatured proteins

They suppress incorrect folding and They suppress incorrect folding and promote correct folding to achieve promote correct folding to achieve the conformation of the tertiary the conformation of the tertiary structure and shape of the proteinstructure and shape of the protein

Bacterial ChaperonesBacterial Chaperones

Best studied in Best studied in E. coliE. coli Four chaperons are invovlvedFour chaperons are invovlved

a.a. DnaK, DnaJ,GroEL, and GroESDnaK, DnaJ,GroEL, and GroES

b.b. Also the stress protein GrpEAlso the stress protein GrpE

Protein splicing in Protein splicing in prokaryotesprokaryotes

Some microbial proteins are spliced after Some microbial proteins are spliced after translationtranslation

In microbial splicing a part of the polypeptide is In microbial splicing a part of the polypeptide is removed before it folds into its final shaperemoved before it folds into its final shape

Self-splicing proteins are large and have internal Self-splicing proteins are large and have internal intervening sequences called intervening sequences called inteinsinteins ( 130-600 ( 130-600 bases in length) flanked by external sequences bases in length) flanked by external sequences exteinsexteins..

InteinsInteins are removed by an autocatalytic process. are removed by an autocatalytic process.

Protein splicing in Protein splicing in prokaryotesprokaryotes

RemovalRemoval of part of of part of polypeptide before polypeptide before foldingfolding

InteinsInteins – removed – removed portionportion

ExteinsExteins – portions – portions that remain in that remain in proteinprotein

Prokaryote vs. Eukaryote Prokaryote vs. Eukaryote foldingfolding

DomainsDomains– structurally independent regions of polypeptidestructurally independent regions of polypeptide– separated from each other by less structured portions of separated from each other by less structured portions of

polypeptidepolypeptide In eucaryotesIn eucaryotes

– domains fold independently right after being domains fold independently right after being synthesizedsynthesized

– molecular chaperones not as importantmolecular chaperones not as important In procaryotesIn procaryotes

– polypeptide does not fold until after synthesis of entire polypeptide does not fold until after synthesis of entire polypeptidepolypeptide

– molecular chaperones play important rolemolecular chaperones play important role

Chaperone ActionChaperone Action DnaJDnaJ binds to the unfolded chain binds to the unfolded chain DnaKDnaK is complexed with ATP and attaches to the is complexed with ATP and attaches to the

polypeptide to prevent improper folding as it is polypeptide to prevent improper folding as it is synthesizedsynthesized

The ATP is hydrolyzed after bindingThe ATP is hydrolyzed after binding GrpE GrpE binds to the chaperone-polypeptide complex binds to the chaperone-polypeptide complex

and causes the release of ADP and DnaJ and K are and causes the release of ADP and DnaJ and K are also released from the polypeptidealso released from the polypeptide

Often Often GrolEl abd GroEsGrolEl abd GroEs will be involved in the will be involved in the final foldingfinal folding

They receive the protein from They receive the protein from DnaJDnaJ and and DnaKDnaK This process also requires the hydrolysis of ATPThis process also requires the hydrolysis of ATP

Prokaryote folding and splicingProkaryote folding and splicing

A part of the protein is removed before foldingA part of the protein is removed before folding Inteins are about 130-600 amino acids in length Inteins are about 130-600 amino acids in length

are removed in an autocatalytic processare removed in an autocatalytic process This is a relatively new discovery – examples This is a relatively new discovery – examples

include the RecA protein in Mycobacterium include the RecA protein in Mycobacterium tuberculosis ( Bacteria)and the DNA polymerase tuberculosis ( Bacteria)and the DNA polymerase in Pyrococcus( Archaea). in Pyrococcus( Archaea).

The presence of these self splicing proteins in The presence of these self splicing proteins in Bacteria and Archaea suggest that this principle Bacteria and Archaea suggest that this principle is wide spread.is wide spread.

Chaperone activityChaperone activity

Regulation of mRNA Regulation of mRNA synthesissynthesis

The control of metabolism by the The control of metabolism by the regulation of enzyme activity is a regulation of enzyme activity is a necessary means of control in a unicellular necessary means of control in a unicellular entity.entity.

The need to control gene expression is The need to control gene expression is vital to their ability to adjust to changing vital to their ability to adjust to changing environmental conditions environmental conditions

It is also necessary to conserve energy by It is also necessary to conserve energy by only expressing those genes that are only expressing those genes that are necessary at any moment in time for necessary at any moment in time for survival under a set of conditions.survival under a set of conditions.

Induction and repressionInduction and repression Inducible enzymes are those that are Inducible enzymes are those that are

produced as a result of the presence of a produced as a result of the presence of a small molecule called an inducersmall molecule called an inducer

They are used only in the presence of their They are used only in the presence of their substratesubstrate

Repressible enzymes are those that are Repressible enzymes are those that are regulated by the end product of the regulated by the end product of the reaction.reaction.

Repressible enzymes are regulated by the Repressible enzymes are regulated by the formation of their product which acts to formation of their product which acts to slow their productionslow their production

ControlControl

Negative control – A controlling factor can Negative control – A controlling factor can either inhibit or activate transcription. either inhibit or activate transcription.

Both induction and repression are forms Both induction and repression are forms of negative control. of negative control.

mRNA synthesis proceeds more rapidly in mRNA synthesis proceeds more rapidly in the absence of the controlling factor.the absence of the controlling factor.

Control IIControl II The rate of mRNA synthesis is controlled by The rate of mRNA synthesis is controlled by

special special repressor repressor proteins that are synthesized proteins that are synthesized under the direction of regulator genes.under the direction of regulator genes.

The The repressorrepressor binds to a special site on the DNA binds to a special site on the DNA called the operator.called the operator.

The inactivation of the regulatory gene produces The inactivation of the regulatory gene produces a constitutive mutant – in which mRNA synthesis a constitutive mutant – in which mRNA synthesis occurs whether the repressor is present or absentoccurs whether the repressor is present or absent

Inducible systemsInducible systems

The regulator gene directs the The regulator gene directs the synthesis of an active repressorsynthesis of an active repressor

The inducer stimulates transcription The inducer stimulates transcription by binding to the repressor causing it by binding to the repressor causing it to change to an inactive shape.to change to an inactive shape.

Repressible systemsRepressible systems The repressor is initially in an inactive form called The repressor is initially in an inactive form called

the aporepressor.the aporepressor. The aporepressor becomes active only when a The aporepressor becomes active only when a

corepressor binds to itcorepressor binds to it The corepressor inhibits transcription by The corepressor inhibits transcription by

activating the aporepressoractivating the aporepressor

Regulation of biosynthesisRegulation of biosynthesis

The synthesis of genes for a pathway can The synthesis of genes for a pathway can be sequentially arranged in the DNAbe sequentially arranged in the DNA

There may be only one repressor to There may be only one repressor to regulate the action of the structural genes regulate the action of the structural genes coding for a polypeptide.coding for a polypeptide.

A single messenger RNA will contain the A single messenger RNA will contain the genetic code for all the proteins in the genetic code for all the proteins in the pathwaypathway

OperonOperon

The sequence of bases coding for The sequence of bases coding for one or more polypeptides together one or more polypeptides together with the operator that controls its with the operator that controls its expression is called an operonexpression is called an operon

Lac OperonLac Operon

Works by negative controlWorks by negative control Contains three structural genesContains three structural genes Controlled by the lac repressorControlled by the lac repressor Beta galactosidaseBeta galactosidase Beta galactoside permeaseBeta galactoside permease Beta galactoside transacetylaseBeta galactoside transacetylase

Beta galactosidase ReactionBeta galactosidase Reaction

The lac operon The lac operon is necessary for is necessary for the metabolism the metabolism of the sugar, of the sugar, lactoselactose

Negative controlNegative control

The inducer can bond The inducer can bond to the repressor and to the repressor and inactivate itinactivate it

When this occurs the When this occurs the genes are transcribedgenes are transcribed

an operon

promoter operator

negative control ofcatabolic pathwayusually substrate of

pathway

structural gene = gene coding for polypeptide

Lactose repressorLactose repressor

The lactose The lactose repressor binds to repressor binds to the DNA and the DNA and prevents the prevents the transcription of the transcription of the three structural three structural genesgenes

The lac Operon is also under The lac Operon is also under postive controlpostive control

It is regulated by CAP or It is regulated by CAP or catabolite activator protein catabolite activator protein or cyclic AMP receptor or cyclic AMP receptor protein and the small protein and the small cyclic nucleotidecyclic nucleotide

3’,5’- cyclic adenosine 3’,5’- cyclic adenosine monophosphatemonophosphate

cAMP or cyclic AMPcAMP or cyclic AMP

CAPCAP

recognizeand bindregulatoryregion of lactoseoperon

Repressor and CAP bound to Repressor and CAP bound to the lac operonthe lac operon

The lac operator is violetThe lac operator is violet The operators are redThe operators are red The promoters are green, The promoters are green, CAP is blueCAP is blue In this conformation there In this conformation there

is no transcriptionis no transcription

CAPCAP Absence of the lac repressor is essential but Absence of the lac repressor is essential but

not sufficient for effective transcription of not sufficient for effective transcription of the lac operon. the lac operon.

The activity of RNA polymerase also The activity of RNA polymerase also depends on the presence of another DNA-depends on the presence of another DNA-binding protein called binding protein called catabolite activator catabolite activator proteinprotein or or CAPCAP. Like the lac repressor, CAP . Like the lac repressor, CAP has two types of binding sites: has two types of binding sites:

One binds the nucleotide One binds the nucleotide cyclic AMPcyclic AMP; the ; the other other

binds a sequence of 16 base pairs upstream binds a sequence of 16 base pairs upstream of the promoter of the promoter

CAPCAP

However, CAP can bind to DNA only However, CAP can bind to DNA only when cAMP is bound to CAP. so when when cAMP is bound to CAP. so when cAMP levels in the cell are low, CAP cAMP levels in the cell are low, CAP fails to bind DNA and thus RNA fails to bind DNA and thus RNA polymerase cannot begin its work, polymerase cannot begin its work, even in the absence of the repressor. even in the absence of the repressor.

Structure of CAPStructure of CAP

Two recognition Two recognition sequencessequences

Recognition Recognition sequences are 34 A sequences are 34 A apartapart

CAP bindingCAP binding

CAP strategyCAP strategy

They usually contain two subunits. They usually contain two subunits. Therefore, they are Therefore, they are dimersdimers. .

They recognize and bind to DNA They recognize and bind to DNA sequences with sequences with inverted repeatsinverted repeats. .

In prokaryotes, recognition and In prokaryotes, recognition and binding to a particular sequence of binding to a particular sequence of DNA is accomplished by a segment of DNA is accomplished by a segment of alpha helix. Hence these proteins are alpha helix. Hence these proteins are often described as often described as helix-turn-helixhelix-turn-helix proteins proteins

Catabolite repressionCatabolite repression

Catabolite repression of lactose and other Catabolite repression of lactose and other operons by glucoseoperons by glucose– glucose decreases cAMP levels, thereby glucose decreases cAMP levels, thereby

blocking CAP binding and decreasing mRNA blocking CAP binding and decreasing mRNA synthesissynthesis

– When glucose is present, the cAMP level When glucose is present, the cAMP level decreases and the lac operon is inhibiteddecreases and the lac operon is inhibited

– The decrease in cAMP may be due to the effect The decrease in cAMP may be due to the effect of the PTS system on the activity of adenyl of the PTS system on the activity of adenyl cylase, the enzyme that sytnesizes cAMPcylase, the enzyme that sytnesizes cAMP

AttenuationAttenuation

Bacteria can regulated transcription Bacteria can regulated transcription in an alternative mannerin an alternative manner

An example of this is the tryptophan An example of this is the tryptophan operon in E. coli.operon in E. coli.

The operon which contains the code The operon which contains the code for five structural genes is under the for five structural genes is under the control of a repressor protein control of a repressor protein

TrpR geneTrpR gene

The trp gene codes for the repressor The trp gene codes for the repressor proteinprotein

Excess tryptophan inhibits Excess tryptophan inhibits transcription of the operon genes by transcription of the operon genes by acting as a corepressor and acting as a corepressor and activating the repressor protein.activating the repressor protein.

AttenuationAttenuation A leader region lies between the operator and the A leader region lies between the operator and the

first structural gene in the operonfirst structural gene in the operon The The trptrp gene is responsible for controlling the gene is responsible for controlling the

continuation of transcription after the RNA continuation of transcription after the RNA polymerase has bound to the promoterpolymerase has bound to the promoter

The leader region contains an attenuator and a The leader region contains an attenuator and a sequence that codes for the leader peptidesequence that codes for the leader peptide

The attenuator is a The attenuator is a rho rho independent termination independent termination site – It is GC rich followed by eight uridine site – It is GC rich followed by eight uridine residuesresidues

The residues can pair with each other to form The residues can pair with each other to form hairpin loops.hairpin loops.

In the absence of a ribosome, the loops are In the absence of a ribosome, the loops are formed and transcription will terminateformed and transcription will terminate

Tryptophan operonTryptophan operon

http://science.nhmccd.edu/biol/operohttp://science.nhmccd.edu/biol/operon/toff.htmln/toff.html

Attenuation continuedAttenuation continued If When tryptophan is present, there is sufficient If When tryptophan is present, there is sufficient

tryptophanyl-tRNA for protein synthesis – tryptophanyl-tRNA for protein synthesis – therefore the leader peptide will continue moving therefore the leader peptide will continue moving along the mRNA until it reaches a UGA stop along the mRNA until it reaches a UGA stop codon, at which time will form hairpin loops with codon, at which time will form hairpin loops with complementary base pairingcomplementary base pairing

Ribosome behavior influences translation of the Ribosome behavior influences translation of the mRNA as it regulates the RNA polymerase mRNA as it regulates the RNA polymerase activity.activity.

Five other amino acid pathways have similar Five other amino acid pathways have similar means of regulationmeans of regulation

Please refer to diagram in bookletPlease refer to diagram in booklet

Attenuation IAttenuation I A leader region lies between the operator and the first A leader region lies between the operator and the first

structural gene in the operon the trpE. It is responsible structural gene in the operon the trpE. It is responsible for controlling the continuation of transcription after the for controlling the continuation of transcription after the RNA polymerase has bound to the promoterRNA polymerase has bound to the promoter

the tryptophan operonthe tryptophan operon

leader ofoperon

High and Low Tryptophan High and Low Tryptophan levelslevels

Tryptophan OperonTryptophan Operon

Arabinose operonArabinose operon

Arabinose productsArabinose products The The araara operon codes for three enzymes that are required operon codes for three enzymes that are required

to catalyze the metabolism of arabinose.to catalyze the metabolism of arabinose. Arabinose isomerase - encoded by Arabinose isomerase - encoded by araAaraA - coverts arabinose - coverts arabinose

to ribuloseto ribulose

Ribulokinase - encoded by Ribulokinase - encoded by araB -araB -- phosphorylates ribulose- phosphorylates ribulose

Ribulose-5-phosphate epimerase - encoded by Ribulose-5-phosphate epimerase - encoded by araD -araD -- - converts ribulose-5-phosphate to xylulose-5-phosphate converts ribulose-5-phosphate to xylulose-5-phosphate which can then be metabolized via the pentose phosphate which can then be metabolized via the pentose phosphate pathway.pathway.

Arabinose operonArabinose operon araO1araO1 is an operator site. is an operator site. AraCAraC binds to this site and binds to this site and

represses its own transcription from the represses its own transcription from the PCPC promoter. In promoter. In the presence of arabinose, however, the presence of arabinose, however, AraCAraC bound at this bound at this site helps to activate expression of the site helps to activate expression of the PBAD PBAD promoter.promoter.

araO2araO2 is also an operator site. is also an operator site. AraCAraC bound at this site can bound at this site can simultaneously bind to the simultaneously bind to the araIaraI site to repress transcription site to repress transcription from the from the PBADPBAD promoter promoter

araI araI is also the inducer site. is also the inducer site. AraCAraC bound at this site can bound at this site can simultaneously bind to the simultaneously bind to the araO2araO2 site to repress site to repress transcription from the transcription from the PBADPBAD promoter. In the presence of promoter. In the presence of arabinose, however, arabinose, however, AraCAraC bound at this site helps to bound at this site helps to activate expression of the activate expression of the PBADPBAD promoter. promoter.

CRP binding siteCRP binding site

CRPCRP binds to the binds to the CRPCRP binding site. It does binding site. It does not directly assist RNA polymerase to bind not directly assist RNA polymerase to bind to the promoter in this case. Instead, in to the promoter in this case. Instead, in the presence of arabinose, it promotes the the presence of arabinose, it promotes the rearrangement of rearrangement of AraCAraC when arabinose is when arabinose is present from a state in which it represses present from a state in which it represses transcription of the transcription of the PBADPBAD promoter to one promoter to one in which it activates transcription of the in which it activates transcription of the PBADPBAD promoter. promoter.

Arabinose absentArabinose absent When arabinose is absent, there is no need to express When arabinose is absent, there is no need to express

the structural genes. the structural genes. AraCAraC does this by binding does this by binding simultaneously to simultaneously to araIaraI and and araO2araO2. As a result the . As a result the intervening DNA is intervening DNA is loopedlooped. These two events block . These two events block access to the access to the PBADPBAD promoter which is, in any case, a promoter which is, in any case, a very weak promoter (unlike the very weak promoter (unlike the laclac promoter): promoter):

Arabinose presentArabinose present When arabinose is present, it binds to When arabinose is present, it binds to AraCAraC and and

allosterically induces it to bind to allosterically induces it to bind to araIaraI instead instead araO2araO2. If . If glucoseglucose is also absent, then the is also absent, then the presence of presence of CRPCRP bound to its site between bound to its site between araO1araO1 and and araIaraI helps to break the DNA loop and also helps to break the DNA loop and also helps helps AraCAraC to bind to to bind to araIaraI::

Global Regulatory SystemsGlobal Regulatory Systems

Affect many genes and pathways simultaneouslyAffect many genes and pathways simultaneously RegulonRegulon

– collection of genes or operons controlled by a collection of genes or operons controlled by a common regulatory proteincommon regulatory protein

– This enhances the cells ability to coordinate This enhances the cells ability to coordinate cellular processescellular processes

Asn C transcriptional regulatorAsn C transcriptional regulator

ATGGAAAATT ATCTGATCGA CAATCTGGAC CGTGGCATCC TGGAAGCATT AATGGGCAATATGGAAAATT ATCTGATCGA CAATCTGGAC CGTGGCATCC TGGAAGCATT AATGGGCAATGCGCGCACCG CTTACGCCGA ACTGGCGAAA CAATTTGGCG TCAGTCCGGG GCGCGCACCG CTTACGCCGA ACTGGCGAAA CAATTTGGCG TCAGTCCGGG GACGATTCACGACGATTCACGTTCGAGTAG AGAAAATGAA GCAGGCGGGG ATCATTACCG GGGCGCGTAT GTTCGAGTAG AGAAAATGAA GCAGGCGGGG ATCATTACCG GGGCGCGTAT TGATGTCAGCTGATGTCAGCCCGAAGCAGC TCGGTTATGA CGTAGGCTGC TTTATCGGCA TTATATTAAA GAGCGCCAAACCGAAGCAGC TCGGTTATGA CGTAGGCTGC TTTATCGGCA TTATATTAAA GAGCGCCAAAGACTACCCTT CCGCGCTGGC AAAGCTGGAA AGCCTTGATG AAGTCACTGA AGCCTATTACGACTACCCTT CCGCGCTGGC AAAGCTGGAA AGCCTTGATG AAGTCACTGA AGCCTATTACACAACCGGCC ACTACAGCAT CTTTATAAAA GTGATGTGCC GTTCGATCGA CGCTCTCCAGACAACCGGCC ACTACAGCAT CTTTATAAAA GTGATGTGCC GTTCGATCGA CGCTCTCCAGCATGTACTTA TCAACAAGAT CCAAACAATT GATGAAATTC AGTCCACCGA GACATTGATCCATGTACTTA TCAACAAGAT CCAAACAATT GATGAAATTC AGTCCACCGA GACATTGATCGTCCTGCAAA ACCCGATCAT GCGTACCATC AAGCCCTGA GTCCTGCAAA ACCCGATCAT GCGTACCATC AAGCCCTGA

Global regulatoryGlobal regulatory

Heat shock – chaperones that respond to Heat shock – chaperones that respond to elevations in temperature – If the cell elevations in temperature – If the cell temperature is too high- the amount of heat temperature is too high- the amount of heat shock proteins increasesshock proteins increases

SOS repair system – in which the damage to DNA SOS repair system – in which the damage to DNA is so extreme that it utilizes ( Rec system)is so extreme that it utilizes ( Rec system)

Catabolite RepressionCatabolite Repression

Occurs when operon is under control of Occurs when operon is under control of catabolite other than initial substrate of catabolite other than initial substrate of pathwaypathway

Allows preferential use of one carbon Allows preferential use of one carbon source over another when both are source over another when both are available in environmentavailable in environment

E. coli preferentialloy uses glucose – E. coli preferentialloy uses glucose – when the glucose supply is exhausted, when the glucose supply is exhausted, the bacterium can switch to lactosethe bacterium can switch to lactose

Regulation by Sigma Regulation by Sigma Factors and Control of Factors and Control of

SporulationSporulation Different sigma factors recognize different Different sigma factors recognize different promoterspromoters

Substitution of sigma factors changes gene Substitution of sigma factors changes gene expression of many genes and operonsexpression of many genes and operons

Bacillus subtilisBacillus subtilis sporulation sporulation sigma factorssigma factors

Synthesized only as cell switches from vegetative Synthesized only as cell switches from vegetative growth to sporulationgrowth to sporulation

Lead to transcription of sporulation-related genesLead to transcription of sporulation-related genes

Small RNAs (sRNAs) and Small RNAs (sRNAs) and RegulationRegulation

Also called noncoding (nc)RNAsAlso called noncoding (nc)RNAs Do not function as mRNA or rRNADo not function as mRNA or rRNA There are between 50 and 200 of theseThere are between 50 and 200 of these In In E. coli there may be as many as 50-400 nucleotides in E. coli there may be as many as 50-400 nucleotides in

lengthlength . Appear to regulate genes by three different . Appear to regulate genes by three different

mechanismsmechanisms– Pair directly with other RNAs via RNA-protein Pair directly with other RNAs via RNA-protein

interactions (e.g., OxyS RNA)interactions (e.g., OxyS RNA)– Intrinsic activities (e.g., RNase P RNA and tmRNA)Intrinsic activities (e.g., RNase P RNA and tmRNA)– Antisense RNA has a base sequence complementary Antisense RNA has a base sequence complementary

to a segment of another RNA and preferentially binds to a segment of another RNA and preferentially binds to this, inactivating itto this, inactivating it

OxyS RNA of OxyS RNA of E. coliE. coli Made in response to hydrogen peroxide exposureMade in response to hydrogen peroxide exposure Can act as an Can act as an antisense RNAantisense RNA

– binds directly to mRNA and blocks translationbinds directly to mRNA and blocks translation Can also block translation by binding a protein required for Can also block translation by binding a protein required for

translation of a target mRNAtranslation of a target mRNA

micF RNA of micF RNA of E. coliE. coli

Regulates synthesis of OmpF porin proteinRegulates synthesis of OmpF porin protein– porin proteins are outer membrane proteinsporin proteins are outer membrane proteins– different porins produced under different different porins produced under different

conditionsconditions OmpC porin made when in intestineOmpC porin made when in intestine OmpF porin made when in dilute OmpF porin made when in dilute

environmentenvironment MicF antisense RNA binds OmpF RNA and MicF antisense RNA binds OmpF RNA and

blocks its translation when bacterium in blocks its translation when bacterium in intestinesintestines

RNase P RNARNase P RNA

the RNA component of RNase Pthe RNA component of RNase P has catalytic activity responsible for has catalytic activity responsible for

tRNA processingtRNA processing

tmRNA of tmRNA of E. coliE. coli

Helps repair problems caused by defective Helps repair problems caused by defective mRNAs that lack stop codonsmRNAs that lack stop codons

Acts as both alanyl-tRNA and mRNA when Acts as both alanyl-tRNA and mRNA when ribosome stalls at end of defective mRNAribosome stalls at end of defective mRNA

Two functionsTwo functions– releases ribosome from defective mRNAreleases ribosome from defective mRNA– adds carboxy-terminal polypeptide tag to adds carboxy-terminal polypeptide tag to

protein, marking it for degradationprotein, marking it for degradation

Two-Component Two-Component Phosphorelay SystemsPhosphorelay Systems

Transfer of phosphoryl groups- control Transfer of phosphoryl groups- control gene transcription and protein activitygene transcription and protein activity

Signal transduction situationSignal transduction situation Consists of a sensor kinase Consists of a sensor kinase

AndAnd A response regulatorA response regulator

Two examples sporulation and chemotaxisTwo examples sporulation and chemotaxis

Sporulation continuedSporulation continued

SpoOF donates the phosphoryl group to a SpoOF donates the phosphoryl group to a histidine on SpoOB.histidine on SpoOB.

SpoOA is a response regulatorSpoOA is a response regulator It has a receive domain aspartate and picks up It has a receive domain aspartate and picks up

the phosphoryl group from SpoOB to become an the phosphoryl group from SpoOB to become an active transcription regulator.active transcription regulator.

Figure 12.33

Sporulation in Sporulation in B. subtilisB. subtilis

Figure 12.34

Chemotaxis in Chemotaxis in E. coliE. coli

Control of the Cell CycleControl of the Cell Cycle

Cell cycleCell cycle– complete sequence of events extending complete sequence of events extending

from formation of a new cell through from formation of a new cell through next divisionnext division

– requires that DNA replication and cell requires that DNA replication and cell division be tightly coordinateddivision be tightly coordinated

Precise mechanisms of control are Precise mechanisms of control are not knownnot known

Cell cycle control in Cell cycle control in E. coliE. coli

two separate control pathwaystwo separate control pathways– sensitive to cell masssensitive to cell mass– sensitive to cell lengthsensitive to cell length

Figure 12.36

Effect of growth rateEffect of growth rate slow growth rateslow growth rate

– DNA replicated then DNA replicated then septation beginsseptation begins

rapid growth raterapid growth rate– DNA replicated and DNA replicated and

new round of DNA new round of DNA replication begins replication begins before septation before septation beginsbegins

Figure 12.35