40

CHAPTER- 3

MATERIAL AND METHOD

SOURCE OF DATA

Present study of “On dermatoglyphics and molecular cytogenetic

characterization of varicose veins” has been conducted on patients of varicose veins

from Pandit Bhagwat Dayal Sharma University of Health Sciences, Rohtak. In the

present study patients admitted in outpatient‟s basis with varicose veins of lower limb

in the Department of Surgery, were subjected to detail analysis.

SAMPLE SIZE AND COLLECTION OF DATA

The study has been conducted on Two hundred sixteen patients of varicose

veins admitted from the year 2010 to 2013. All the patients presenting with varicose

veins of lower limb, which met the inclusion and exclusion criteria were selected for

the present study. Consent from the parents/guardian was taken. Institutional human

ethical committee permission was taken to conduct the present research.

INCLUSION CRITERIA

The inclusion criteria, being, patients presenting with symptomatic varicose

veins, those patients presenting with complications of the disease such as

pigmentation, eczema, ulceration, superficial thrombophlebitis, etc. and patients with

cosmetic concern. The most specific criteria was patients with primary varicose veins

of lower limb.

EXCLUSION CRITERIA

Patients who were not diagnosed with Colour Dopler Ultrasonography were

excluded from this study. More ever patients who were not willing to participate were

also excluded from the study.

Two hundred sixteen patients of varicose veins were selected for this study. All

the patients were subjected to detailed Morphogenetic, Dermatoglyphic, Molecular

cytogenetic analysis. In present study detailed history of patients was taken which

included, Age of diagnosis, types of varicose veins (Bulging, Rope like, Twisted and

change to Ulcer), occupation of patients, life style, age of diagnosis and nutrition etc.

Clinical history was also taken with the help of clinician. Role of risk factors in

41

patients of varicose veins was statistically analysed. Various dermatoglyphic patterns

like digital patterns and palm area were carefully studied for dermatoglyphic analysis.

Karyotyping of varicose veins patients was done to detect any chromosomal

abnormality. These patients were further evaluated for molecular cytogenetic detection

of FOXC2 gene.

3.1. QUESTIONNAIRE

Structured questionnaire was developed to collect the specific information

about risk factors of varicose veins. Varicose veins was defined in the questionnaire as

being “clearly visible, dilated, tortuous and possibly prominent subcutaneous veins of

lower extremites”, adopted from definition in the literature (Laurikka et al. 1994).

General assessment of patients including age of diagnosis, sex ratio, symptoms, types

of varicose veins, limb involvement, occupational status, posture in occupation, other

possible risk factors of varicose veins people as well as associated complications were

recorded to get better insight of the cause of the impairment in the patients of varicose

veins. The overall participation rate in the questionnaire survey was 96%. The status of

the superficial veins in lower limb was examined with the help of clinicians. The

questionnaire data and the data from the clinical examination were cross-tabulated. In

all patients the legs were already studied by Doppler Ultrasound and clinical test to

detect reflux in the veins. The information was recorded carefully on patient‟s

Performa after the consent of parents and guardians.

All the patients were divided into three groups based on the types of work.

Group I -consisted of office workers or those who do less work or live

in same position for long time.

Group II -consisted of light physical laborers mainly including arm and

leg movement, no weight lifting, and no whole body movements.

Group III -consisted of heavier physical laborers including walking,

whole body movement and heavy load handling.

42

3.1.1. ASSESSMENT OF RISK FACTORS

Occupation, pregnancy in female, deep vein thrombosis, alcohol consumption,

smoking and positive family history of varicose veins were the variables studied as

potential risk factors of varicose veins in this study. Based on self-reported data on risk

factors and from the questionnaires the patients were categorized into two sections i.e

having and not having particular risk factors.

Subjects/patients were defined as alcohol users if they reported weekly alcohol

consumption. Those using alcohol “not at all or occasionally” were defined as non-

users. Subjects were classified as smokers if they had ever smoked cigarettes, cigars or

pipes for longer than one year, including also ex-smokers. Family history of varicose

veins was used as an indicator of heredity. This was elicited regarding close relatives

including parents, grandparents and siblings. Family history was considered positive if

at least one parent or sibling was affected. There was a response option “I do not

know” and those subjects were regarded as uncertain.

3.2. DERMATOGLYPHICS

Dermatoglyphics of 216 varicose veins patients and normal individuals of

different age group and sex was analyzed in the present study. There are several print

taking techniques, the ink method is followed by in the study. Prints of digits of hand,

palm and hallucal region were taken by black inkpad method (Cotterman 1951 and

Smith et al. 1966). Other methods include an inkless method using sensitizing fluid,

adhesive tape, powder and carbon paper.

Dermatoglyphic prints were taken in two steps:

1. Finger printing

2. Palm printing

Prints also showed the flexion creases, which were used for dermatoglyphic

analysis.

43

3.2.1. FINGERPRINTING OF DIGITS USING INK PAD METHOD

(a) ROLLING THEM ACROSS THE INKPAD

One finger was inked at one time. Finger was rolled across the inkpad in one

continuous motion. Entire area was carefully covered with ink and pattern was

transferred to strip of paper.

(b) TAKING IMPRESSION

This was done in two ways (a) paper was placed on the edge of a flat surface and

finger was rolled across it. (b) Strip paper was rolled across the person‟s suspended

finger. Similarly prints of all the digits were obtained.

(c) LABELLING

(1) Strip was labelled side by side and digits were labelled using Roman numerals

(thumb-1 and little finger-V).

(2) Digital print strips were stored along with palmer print of same individual.

Fingerprint thus obtained were carefully studied for the presence of different

configurations i.e. arch (no triradius and simplest pattern), loop (one triradius and one

core, ridges opened away from the triradius towards the right or left). Whorl (two or

rarely three triradii, ridges forming concentric circle or loop like arrangement (Figure-

4). Percentage frequency of arch, loop and whorl pattern was calculated in both

varicose veins and control group. Chi-square test was applied to know the significant

difference among these groups.

3.2.2. PALM PRINTS

Entire palm was inked including wrist creases and hypothenar border. Sheet of

paper was placed on foam rubber pad on a flat stable surface. This foam pad was used

to fill the concavity of the palm, when pressure was applied to the back of hand.

Otherwise blank areas or white space will appear in the center of the palm. Wrist of

the person was placed on the bottom of paper and then the rest of the palm was pressed

on the paper. Back of the hand was pressed down firmly for printing the center. These

palm prints were carefully observed for atd angle. The atd angle formed between lines

44

drawn from the triradii at the base of the index and little finger to the axial triradius

was measured (Figure- 5). Axial triradius was designated as t and „t‟ or “t” depending

on its proximity to the lower margins of the palm (Mavalwala 1963). The values of

angle of less than 45 corresponding to position of the axial triradius was designated as

t, values intermediate to 45 and 56 as „t‟ and values above 56 was “t” (Penrose 1954)

(Table- 4). Heavy and dark lines on palm were also studied for simian creases with the

help of magnifying lens. The student „t‟ test was used for statistical analysis and to

find out any correlation between axial triradius and varicose veins.

Table 4: Range of atd angle

Atd angle value Position of axial triradius

<45 t

45-56 ‗t‘

>56 ―t‘‘

Figure 4: Different finger tip patterns of left hand: (a) Radial loop, (b) Ulnar

loop, (c) Whorl, (d) Tented arch, (e) Simple arch.

45

Figure 5: Palm print and atd angle (t and t‘‘).

3.3. CYTOGENETIC ANALYSIS

For analyzing the patient cytogenetically, the left out peripheral blood sample

(left after routine clinical testing) of varicose veins patients and control group was

taken in Sodium Heparin Vaccutainer (green top) (with the help of technician) after

the consent of patient/ guardian. The blood sample was subjected to culture the

lymphocytes. Chromosome harvesting was done after proper incubation. Any

structural and numerical anomaly was noted down (Moorhead, 1960).

46

Chromosomes are dynamic entities, continuously changing in appearance and

carrying out inherent activities. For their physical examination, the highly dividing

cells were arrested at metaphase stage. Different steps of culturing were as follows:

3.3.1 GLASSWARE / CHEMICALS / EQUIPMENTS

All Laboratory glassware and plasticware used in the research work was of

Borosil and Tarson respectively. Various glassware, chemicals and equipments used in

the present study were listed in (Table- 5).

3.3.2. CLEANING OF GLASSWARE

All the glasswares were washed properly with the detergent before the use for

culture techniques. These were soaked in acidic solution (K2Cr2O7 + Conc. H2SO4 +

D.W.) for one day and in running water for two days. After washing, glassware was

kept in oven.

3.3.3. PREPARATION OF MEDIA

RPMI-1640 media was used to culture lymphocytes. In the preparation of liquid

culture media, required amount of powdered RPMI was added to sterilize triple

distilled water. Various other constituents like Phytohaemagglutin (10mg/10ml) and

antibiotics (10mg streptomycin, penicillin 10,000u) were added. pH was adjusted to

6.8-7.2 slowly by adding either 1N HCl or 1N NaOH dropwise. Media was then

filtered through Millipore filter assembly of size 0.2µm under vacuum pump.

Subsequently 20% foetal calf serum was added to the media. 6 ml of media was

aliquoted into sterile glass bottles and was stored at 4C in refrigerator.

3.3.4. PLANTING AND INCUBATION OF CULTURE

Peripheral blood sample (left out) of varicose veins patients was collected in

heparianised vacutainer and cultured in RPMI-1640 media supplemented with foetal

calf serum (20%). Whole blood culture was established and grown at 37.5±0.5°C for

72 hrs (Figure- 6).

3.3.5. ARRESTING THE CELLS

After incubation at 37°C for 72 hrs., colchicine was added for 50-55 minutes to

arrest the cells at metaphase stage.

47

3.3.6. HARVESTING

Cells were harvested in a conical 15ml graduated centrifuge tube and centrifuged

at 800 rpm for 13-15 minutes. Excessive speed was avoided. Then supernatant was

decanted off by inverting tube and the cells were resuspended in 7-8ml (0.075 KCl)

hypotonic solution for 10-15 minutes. Then they were centrifuged at 1000 rpm for 15

mintues. Supernatant was again decanted off and 5ml of cold fresh fixative (1part

glacial acetic acid: 3 parts methanol) was added without disturbing the cell pellet and

cells were washed at least three four times. Every time 5ml fixative was added,

centrifuged at 1000 rpm, supernatant was discarded and at the end whitish suspension

was left behind in the centrifuge tube (Figure- 7).

3.3.7. SLIDE PREPARATION BEFORE MAKING A CHROMOSOME

PREPARATION

Slides were prepared by soaking at least overnight in cleansing solution (95

alochol+5ml) in covered container to prevent evaporation and were dried. Heavy

(turbid) cell suspension was used for chromosome preparation. Pasteur pipette was

used to draw the cell suspension on slides. Slides were held at 60 to 80 angles down

from horizontal position and drop of cell suspension was allowed to run down the slide

quickly. Excess liquid was removed from the end of the slide by touching quickly with

blotting paper and slides were allowed to dry completely in the slanted position.

3.3.8. GIEMSA BANDING (G-BANDING)

G-banding pattern was used after trypsin treatment.Trypsin was prepared by

diluting 3.15 ml stock solution with 70 ml Hank‟s salt solution. 3-7 old days slides

were treated with working solution for 15 min. at 37°C, rinsed with distilled water and

stained with 2% Giemsa for 2 minute (Seabright 1971). Slides were now ready for

karyotyping.

3.3.9. KARYOTYPING

The slides with metaphase spreads were visualized and appropriate spreads

were focused and photographed. High contrast photographs of the chromosome

spreads were viewed under 10X, 40X using Zeiss photomicroscope (Figure 8).

Metaphase spreads were examined in detail under 100X oil objective lens. Twenty to

thirty metaphases in one slide were studied and searched for chromosomal anomalies.

The karyotypes were then analyzed for any numerical and structural anomalies using

48

software cytovision ®. Laminar hood, Microscope, Division of a cell into segments for

counting metaphase and Metaphase Spread (Figure- 10a, 10b, 10c and 10d

respectively

Figure 6: Blood collection, planting and incubation of culture.

49

Figure 7: Harvesting, slide preparation and banding.

50

Figure 8 : Karyotype preparation.

51

Table 5: Requirement for culture of blood lymphocytes.

Chemical/Solutions Glassware/Plastic wares Equipments

RPMI-1640 Filtration assembly Microscope with CCD

camera

Antibiotics(Streptomycin and

Penicillin)

Media bottles Laminar flow hood

Phytohaemagglutin Conical flasks Incubator

Foetal calf serum Slides, cover slip Oven

Heparin Couplin Jar Water bath

HCL, NaOH Disposable syringes and

needles

Shaker

Triple distilled water Bunsen burner Autoclave

Methanol, Acetic acid Sterilized gloves Distillation Plant

Trypsin solution Thermometer pH meter

Phosphate buffer Pasteur pipettes Refrigerator

Potassium chloride Droppers etc. Centrifuge machine

Oil immersion

Giemsa solution, Spirit etc.

3.4. MOLECULAR ANALYSIS:

DNA of patients of varicose veins was subjected to molecular cytogenetic

analysis to identify the FOXC2 gene mutation. Blood samples of normal persons were

also subjected to molecular cytogenetic analysis of FOXC2 gene mutation. Out of 216

patients of varicose veins 190 patients were analyzed for mutation detection.

Remaining 26 patients were not available during the period of sample collection.

Following characteristics were used to select the varicose patients: 1) patients

presenting with symptomatic varicose veins, 2) patients presenting with complications

of the disease and 3) finally those who were diagnosed by Doppler ultrasound.

3.4.1 COLLECTION OF PERIPHERAL BLOOD SAMPLES:

Peripheral blood sample was collected using needle and syringe by a trained

lab technician after the consent of ptients. After a sufficient amount of blood i.e. about

2ml was withdrawn from the patient in the syringe, the needle was mutilated using a

needle burner. The mutilated needle was then re-capped and removed from the

52

syringe. The venous blood was transferred to the BD Vacutainer® EDTA tube (purple

top, 3ml). The proper concentration of 0.5 M EDTA vacutainer allowed the blood

sample to be available in usable form with no clots. The blood may be stored for

several days at 0°C or indefinitely at -70°C before the DNA is prepared. Blood should

not be collected into heparin tube for PCR, which is an inhibitor of the polymerase

chain reaction.

3.4.2. DNA ISOLATION:

In order to isolate the required amount of DNA various methods were tested

and two methods were standardized finally for isolation of DNA from peripheral blood

samples.

3.4.3. AUTOMATIC METHOD FOR DNA ISOLATION:

GenProTM

3-in-1 DNA isolation kit was used to get the desired amount of DNA.

The GenProTM

3-in-1 DNA isolation kit from Blood was used for DNA

extraction. GenPro™ DNA isolation kit provides a rapid and easy method for the

simultaneous extraction of total genomic DNA from a single sample using spin

column technology. The total genomic DNA is purified in less than 1 hour. GenPro™

DNA isolation kit provides 10X Lysis Buffers, Proteinase K, Nuclease Free water,

GeneiPure™ DNA Columns and Collection Tubes and elution buffer for storing of

DNA. This quick, reliable and consistent technique provides a simple and effective

way to study nucleic acids from blood and other biological samples without affecting

yield and quality. This isolation kit is suitable for macromolecules from the precious

samples without fractionating the samples. The obtained DNA has been tested for

relevant downstream applications. However all the samples could not be extracted by

this method as this was not a cost effective method.Gghifff-in-1 Isolation ™

3.4.4. RAPID ISOLATION OF DNA:

DNA preparation from whole blood using a rapid improvised isolation of

mammalian DNA technique was used (Sambrook 2002). Optimization of the protocol

resulted in 80ng to 100ng of DNA. Purity of DNA sample was checked at the OD

260/OD 280. All the samples were found to be in desirable reference ratio of 1.65 to

53

1.85. The samples which were found to fluctuate from the reference range were

purified again by RNAse and Protienase K treatment. It was 20-50 kb in size suitable

for use as a template in PCRs. Its purity was checked spectrophotometrically (Figure-

9a) as well as electrophoretically. The purified DNA was stored in the TE buffer (pH

7.6) at -20ºC. The procedure was divided into following steps.

3.4.5. DNA EXTRACTION

1. About 300-μl aliquots of whole blood was taken in two separate microfuge

tubes. Then 900 μl of 20 mM Tris-Cl (pH 7.6) was added to each tube and the

capped tubes were inverted to mix the contents.

2. The solution was incubated at room temperature for 10 minutes and

occasionally inverting of the tubes was done. The tubes were centrifudged at

4800 rpm speed for 20 seconds at 37 degree temperature in a microfuge. The

supernatant thus obtained was discarded. keeping 20 μl of solution in tube.

3. The resuspended white blood cell pellets were added to a microfuge tube

containing 600 μl of ice-cold cell lysis buffer. The suspension was

homogenized quickly.

4. Three microliter of proteinase K solution was added to the lysate to increase

the yield of genomic DNA.

5. The solution was incubated for 15 hours at 55°C. The digest was allowed to

cool at room temperature and then about 3 μl of 4 mg/ml DNase-free RNase

was added.

6. This digest was again incubated for 15-60 minutes at 37°C. The sample was

allowed to cool to room temperature for about 30 mins. Then 200 μl of

potassium acetate solution was added.

7. The contents of the tube were mixed by vortexing for 20 seconds. The pellet of

the protein was precipitated by centrifugation at maximum speed for 3 minutes

at 4°C in a microfuge.

8. The supernatant was transferred to a fresh microfuge tube containing 600 μl of

isopropanol and were mixed to get well the precipitate of DNA.

54

9. Lastly very carefully supernatant was removed by aspiration and 600 μl of 70%

ethanol was added to the DNA pellet. Carefully the supernatant was separated

by aspiration and the DNA pellet was allowed to dry in air for 15 minutes.

10. The dry pellet of DNA was redisovled in 100 μl of TE (pH 7.6) and stored at -

20º C. For long term storage the DNA was stored at temperature of -80 º C.

The best procedure for breaking cells and obtaining intact DNA is through

application of detergents and enzymatic procedures. DNases is able to break proteins,

thereby removing cell cover of proteins but may denaturate the desired DNA fragment

.In the present study therefore lysis of blood cells was performed using anionic

detergents such as SDS (sodium deodecyl sulphate). The second step in purification

involves removing contaminants like proteins, from the cell lysate. This procedure is

known as deproteinization. Removal of proteins from the DNA solution can be done

easily by Protienase K. Optimum temperature for its best reaction is (50–67°C).

Protienase K can digest intact (globular) and denatured (polypeptide chain) proteins

and do not need any co-factors for their activities. In the present study Proteinase K

was therefore used in DNA purification procedures at final concentrations of 0.1–

0.8mg/ml-1. The removal of RNA from DNA preparations is usually carried out using

an enzymatic procedure. Two ribonucleases that can be easily and cheaply prepared

free of DNAse contamination are used like ribonuclease A and ribonuclease T1.

Ribonuclease A (RNAse A) is an endo ribonuclease that cleaves RNA after C and U

residues. The reaction generates 2‟:3‟cyclic phosphate which is hydrolyzed to

3‟nucleoside phosphate producing oligonucleotides ending with 3‟phosphorylated

pyrimidine nucleotide. In the present study it was found that ribonuclease A at

0.4mg/ml to be best concentration for obtaining DNA.

Precipitating DNA with alcohol is a crucial step performed for concentration of

DNA from the aqueous phase. Alcohol precipitation is based on the phenomenon of

decreasing the solubility of nucleic acids in water. Polar water molecules surround the

DNA molecules in aqueous solutions. The positively charged dipoles of water interact

strongly with the negative charges on the phosphodiester groups of DNA. This

interaction promotes the solubility of DNA in water. Ethanol is completely miscible

with water, yet it is far less polar than water. Ethanol molecules cannot interact with

the polar groups of nucleic acids as strongly as water, making ethanol a very poor

55

solvent for nucleic acids. Therefore on addition of these alcohols the DNA precipitates

out in concentrated from. Two alcohols are used for DNA precipitation: ethanol and

isopropanol.

3.4.6. CHECKING OF DNA PURITY:

The UV Spectrophotometer (Shimadzu®) was turned on. The monitor

screen and printer were also switched on. The lid on the top of the machine was

opened. Then UV was turned on. It takes about a minute for the UV lamp to warm

up. After cleaning the surfaces of the cuvette and the cuvette chamber with 70%

ethanol, 100µl sample of blank was placed in the cuvette chamber. On a click

reading of blank was taken. Then preparing a dilution of 1:100 the DNA was

prepared. The blanking solution was removed from the cuvette. It was rinsed and

dried diluted sample was placed in it. Readings of the samples was noted down at

260nm and 280nm. Spectrophotometer was turned off. Concentration DNA sample

were calculated at the OD 260/OD 280. The ratio of the absorbance at 260 nm/

absorbance at 280 nm is a measure of the purity of a DNA sample; it should be

between 1.65 and 1.85.A ratio lower than 1.8 indicates the presence of proteins

and/or other UV absorbers. A ratio higher than 2.0 indicated the contamination due

to chemicals. In case any kind of interference DNA was reprecipitated.

3.4.7. AGAROSE GEL ELECTROPHORESIS:

TAE buffer was prepared at concentration of 50X and further diluted to 1X

TBE. One gram of agarose was dissolved in 100 ml of 1X TAE. The solution of

agarose was allowed to melt for about 5 mins and continuous checking of solution was

done so as to dissolve the agarose fully without spillage or over boiling. Then this

solution was allowed to cool down. A horizontal gel tray appropriate for the number of

samples to be analyzed was set with a comb. The tray and the comb were cleaned and

washed properly before pouring of the gel solution. The agarose was let to set and

solidify for at least 15 mins. About 5ul of samples were put on a parafilm or

hydrophobic surface and 5ul of BMB solution was mixed. In case of a ready to use

loading dye 1ul of loading dye and 5ul of DNA sample was mixed for loading. A gel

tank was filled with chilled TAE buffer. The wells were placed with the black

56

electrode. Now the samples were loaded onto the gel wells. A marker was also loaded

on a separate well. A lid was placed over the tank to avoid spillage of the buffer. The

leads of the tank were put on appropriate terminals as matching black and red colours

respectively. The power supply was adjusted with 100 to 150 volts. The rate of

migration of the fragment depends on the gel concentration, size of gel and DNA

fragment length. Most of the gel were made in and run with 1X TAE buffer. On

successful run of the agarose gel (Figure- 9b). The power pack was switched off and

the gel was removed for visualization. The gel image was captured in Alphainnotech

gel documentation system (Figure- 9c).

3.4.8. POLYMERISED CHAIN REACTION PROCEDURE FOR FOXC2 GENE

(Region I):

Amplification of 5‟ UTR region of FOXC2 gene was carried out using 5 µl of

DNA in 50 µl reaction using 3 pairs of primers, for amplification of FOXC2 CG

repeat.

F1: 5' CCGATTCGCTGGGGGCTTGGAG 3'

R1: 5' GCGGGCTGGTGGTGGTGGTAGG 3‟,

F2: 5' CCTACCTGAGCGAGCAGAATTACTA 3'

R2: 5' GAAGCGGTCCATGATGAACTG 3'

F3 5' ACCTGGTGAAGCCGCCCTACAG 3‟,

R3: 5' ACGCCGCCTCGCTCTTGA 3'

The volume of each reagent is as given in (Table 6). PCR reactions were

carried out to amplify -413 bp of the 5‟ regions to +655bp of exon 1 of FOXC2 gene

using PCR machine (Figure 9d). The primers used to amplify the three regions were

synthesized based on the complementarities with the normal sequence of the FOXC2

gene. The PCR conditions were as follows: for the first set of primer that amplified the

-413 bp to +194 bp, an initial denaturation at 94°C for five minutes, followed by 35

cycles of 94°C for two min, 65°C for 2min, 72°C for 2 minutes. A final extension step

was carried out at 72°C for five minutes. For the second set that amplified the region

from +50bp to +318 bp, an initial denaturation at 94°C for five min, followed by 35

cycles of 94°C for one min, 63°C for one min, 72°C for one min. A final extension

57

step was carried out at 72°C for five min and for the third set that amplified the region

from +206 bp to +655 bp, an initial denaturation at 94°C for five min, followed by 35

cycles of 94°C for one min, 65°C for one min, 72°C for one min. A final extension

was carried out at 72°C for 5 min.

For all PCR reactions negative controls were run by applying all reaction

mixture except for the template DNA to ensure the amplification quality. Six µl of

PCR products with 2 µl (6X) loading dye and 2 µl TBE buffer was loaded on 2%

agarose gel and run at 75 V for two and half hours. The Gel was then stained with

ethidium bromide (0.5 µg/mL) and visualized by UV transiluminar (Alphainnotech gel

documentation system). The PCR products were analysed by using 100 bp leader or 1

Kb DNA leader (Merck Biosciences, Banaglore). For the confirmation of above

mentioned SNPs, further sequencing was performed using the corresponding primers.

58

a) b)

c) d)

Figure 9: Instrument used in Molecular analysis. a) Spectrophotometer

b) Electrophoresis chamber

c) Gel documentation

d) PCR machine

59

3.4.9. OPTIMISATION OF PCR:

The designing of the protocol was obtained with certain modifications in

standard PCR. PCR was used with certain modifications like adding enhancers (8%

DMSO and glycerol) in the reaction buffer to get the amplification in the normal

subjects. Such readily available systems would be cost effective as compared to the

conventional cytogenetic methods and would reduce the cost of diagnosis in full

mutation individuals which would give no amplification due to GC rich sequence

present in FOXC2 gene. Several additives were tried, such as formamide and betaine

which had been reported to improve PCRs of GC rich structures. However, these did

not improve the results. Therefore known enhancer DMSO, as well as PCR master mix

from Bio Basic having 0.1mg/ml BSA, used for PCR optimization. 15 µl PCR master

mix with 3 µl DMSO was used to give a positive amplification. DMSO and BSA are

adjuvants that make the DNA more accessible to the enzyme for amplification. DMSO

improves strand separation in GC rich regions. BSA also improves specificity in

amplification of regions with secondary structures.

Table 6: Reagents used in setting PCR.

SNO. Reagents Volume

1 DNA 5 µl

2 DMSO 3 µl

3 Reverse primers 10 µl

4 Forward primers 10 µl

5 PCR Master Mix (Bio Basic) 15 µl

6 DNA Pol (5u/ul) 2 µl

7 Dd milli Q 5 µl

Total 50µl

60

3.5. DNA SEQUENCING FOR ANOTHER MUTATIONS ON FOXC2 GENE

The present study was performed to finding the genetics of varicose veins

disease. For this, screened 78 severe cases (having more than two critical symptoms of

varicose veins) for mutations in genes causing disorders with varicose veins as a

primary symptom. All patients had been personally examined and diagnosed by a

clinician.

3.5.1. DNA ISOLATION AND PCR

DNA was isolated from patient blood sample and further analysed for PCR.

Since the FOXC2 gene has >60% GC content, all PCR reactions were performed using

the GC-rich PCR kit for the 5‟ and 3‟-UTR of the gene

(FOXC2F 5‟-TGGCTCTCTCGCGCTCTCTC-3‟,

FOXC2R 5‟-CGTCTCTGCAGCCCCTTAATTG-3‟).

3.5.2. MUTATION ANALYSIS

FOXC2 (GenBank NG_012025.1) sequence analysis was performed on

genomic DNA. Sequences were analyzed using the Phred/Phrap/Consed software

package (Ewing and Green, 1998; Ewing, et al., 1998; Gordon, et al., 1998). All novel

mutations were checked in unrelated healthy controls.

3.6. Questionnaire (APPENDIX- I).

3.7. Precautions (APPENDIX- II).

3.8. Pedigree symbols (APPENDIX- III).

3.9. Requirement (APPENDIX- IV).

3.10. Reagent preparation (APPENDIX- V).

3.11. Statistically analysis (APPENDIX- VI, VII and VIII)

61

a) b)

c) d)

Figure 10: Instrument used in cytogenetic analysis.

a) Laminar hood

b) Microscope

c) Metaphase Spread

d) Division of cell into segment for counting chromosome in metaphase spread.