Chapter: 4 Results - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/75359/15/15...61 4.1.1.2....

52

Chapter: 4 Results

4.1. Phytochemical evaluation

4.1.1. Phytoconstituent analysis

4.1.1.1. Analysis of essential oil

Alpinia galanga

The essential oils extracted from the leaves and rhizomes of Alpinia galanga by hydro

distillation gave light yellowish oil with a yield of 0.2 % and 0.13% respectively. The

essential oils were analyzed by gas chromatography and mass spectrometry (GC-MS)

for their possible chemical constituents. GC-MS analysis of leaf and rhizome essential

oil revealed the presence of 22 and 14 identified components accounting for 85.8% and

95.44% of the total peak area respectively (Fig: 4.1.1 and 4.1.2). Eucalyptol was the

major constituent in both the leaf (31.10±0.4%) and rhizome essential oil (36.04±0.5%).

β-pinene (14.41±0.3%), camphor (12.48±0.3%), cinnamic acid (9.58±0.3%) were found

to be the other major constituents of the leaf oil whereas rhizome essential oil contained

fenchyl acetate (19.03±0.4%), α-terpineol (7.94±0.2%), camphor (7.73±0.2%) as the

main constituents (Table: 4.1.1 and 4.1.2).

Table-4.1.1: Chemical composition of leaf essential oil of Alpinia galanga.

No Compound name Area (%) Mean ± SD Retention time

1 β-Pinene 14.41±0.3 4.594

2 Eucalyptol 31.10±0.4 5.990

3 3-Carene 0.53±0.2 8.159

4 Camphor 12.48±0.3 9.639

5 Boneol 2.47±0.3 10.400

6 4-Terpinenol 0.71±0.2 10.823

7 α-Terpinenol 1.33±0.2 11.356

8 Myrtenal 1.04±0.1 11.538

9 Bornyl ester 1.19±0.1 15.048

10 Methyl cinnamate 1.23±0.1 15.902

11 Cinnamic acid 9.58±0.3 19.044

12 β-gurjurene 0.97±0.2 20.058

13 Caryophyllene 1.17±0.2 20.219

14 α-Bergamotene 0.29±0.1 20.976

15 trans-β-Farnesene 0.82±0.1 21.936

53


16 Curcumene 0.85±0.1 22.858

17 γ-Selinene 0.76±0.1 23.289

18 β-Bisabolene 1.73±0.2 23.847

19 β-Sesquiphellandrene 0.43±0.1 24.431

20 α-Farnesene 0.83±0.1 26.076

21 Caryophyllene oxide 1.20±0.1 26.494

22 Alloaromadendrene 0.68±0.1 28.482

Table-4.1.2: Chemical composition of rhizome essential oil of Alpinia galanga.

Compound name Area (%)

Mean±SD

Retention

time

1 β-Pinene 6.29±0.2 4.366

2 Eucalyptol 36.04±0.5 5.770

3 Camphor 7.73±0.2 9.119

4 Borneol 4.20±0.3 9.897

5 α –Terpineol 7.94±0.2 10.967

6 Fenchyl acetate 19.03±0.4 12.092

7 Bornyl acetate 1.22±0.1 14.371

8 (+)- 4-Carene 0.69±0.1 16.900

9 Methyl cinnamate 2.58±0.2 18.312

10 Valencen 0.69±0.1 22.338


12 Carotol 5.34±0.3 26.317

13 Humulene epoxide 2 0.92±0.1 26.689

14 Daucol 1.54±0.1 27.881

Alpinia malaccensis

The fresh leaves of Alpinia malaccensis yielded 0.2% of essential oil. The analysis of

oil was performed using gas chromatography-mass spectrometry (GC-MS). In total, 10

volatile constituents, representing 92.62% of the peak area, were identified in the leaf

oil (Table: 4.1.3). The most abundant components found in the leaf oil were α-

phellandrene (43.90± 0.5%) followed by β-cymene (31.71±0.4%), β-pinene (4.6±0.2%)

(Fig: 4.1.3). Likewise the rhizomes of A.malaccensis yielded 0.1% of essential oil.

Quantitative analysis of rhizome essential oil by GC-MS analysis resulted in 11

components amounting to 99.99% (Fig: 4.1.4).α-phellandrene (26.59±0.5%), benzene

(26.14±0.3%), geraniol (9.15±0.2%) were the major constituents in the rhizome oil

(Table: 4.1.4).

54

Fig. 4.1.1: GC MS Chromatogram of Alpinia galanga leaf oil

Fig. 4.1.2: GC MS Chromatogram of Alpinia galanga rhizome oil

55

Table-4.1.3: Chemical composition of leaf essential oil of Alpinia malaccensis.

No Compound name Area (%)

Mean±SD

Retention time

1 β-Pinene 4.6 ± 0.2 4.916

2 α-Phellandrene 43.9 ± 0.5 5.246

3 β-cymene 31.7 ± 0.4 5.880

4 α –pinene 1.5 ±0.1 8.180

5 α –terpineol 2.2 ±0.2 11.377

6 Trans-pinocarveol 2.2 ±0.1 11.804

7 β Caryophyllene 3.3 ±0.2 20.236

8 α –selinene 0.7 ±0.2 22.845


10 δ-cadinene 0.82 ±0.2 27.019

Table-4.1.4: Chemical composition of rhizome essential oil of Alpinia malaccensis.


1 α-Phellandrene 26.59±0.5 4.937

2 β-cymene 7.40±0.3 5.351

3 Benzene 26.14±0.3 5.440

4 Linalool 4.71±0.1 7.635

5 α –terpineol 8.25±0.2 10.747

6 Benzyl ether 3.83±0.2 11.136

7 Geraniol 9.15±0.2 13.364

8 Phenol 4.50±0.2 15.162

9 Caryophyllene 3.86±0.4 19.399


11 Geraniol 3.17±0.1 44.090

Alpinia nigra

Hydrodisitillation of fresh leaves and rhizomes of Alpinia nigra yielded 0.21% and

0.18% of essential oil. The essential oils were analyzed by gas chromatography and

mass spectrometry for their possible chemical constituents. GC-MS analysis of leaf and

rhizome essential oil revealed the presence of 9 and 15 identified components

accounting for 96.5% and 97.63% of the peak area respectively (Fig:4.1.5 and 4.1.6). β-

pinene (56.27±2.5%), α-caryophyllene (13.70±1.55%), α-farnesene (7.92±0.23%),

caryophyllene (6.46± 0.57%) were found to be the major constituents of the leaf oil

whereas rhizome essential oil contained β-pinene (38.03± 0.25%), myrtenol

(9.35±0.3%), β-maaliene (7.82±0.2%), humulene epoxide 2 (6.00±0.13%) as the main

compounds. β-pinene had the highest area % in both leaf and rhizome oil (Table:4.1.5

and 4.1.6).

56

Fig. 4.1.3: GCMS Chromatogram of Alpinia malaccensis leaf oil

Fig. 4.1.4: GC MS Chromatogram of Alpinia malaccensis rhizome oil

57

Fig. 4.1.5: GC MS Chromatogram of Alpinia nigra leaf oil

Fig. 4.1.6: GC MS Chromatogram of Alpinia nigra rhizome oil

58

Table-4.1.5: Chemical composition of leaf essential oil of Alpinia nigra.


Mean±SD

Retention

time

1 β-Pinene 56.27 ± 2.5 4.611

2 Borneol 1.9 ± 0.2 10.413

3 Caryophyllene 6.46 ± 0.57 20.253

4 α –caryophyllene 13.70 ±1.55 21.610


6 Butylphen 1.99 ±0.07 26.955

7 Humulene epoxide 2 3.81 ±0.25 27.518

8 Isolimonene 1.16 ±0.16 27.814

9 α –Farnesene 7.92 ±0.23 28.410

Table-4.1.6: Chemical composition of rhizome essential oil of Alpinia nigra.


Mean±SD

Retention

time

1 β-Pinene 38.03±0.25 4.379

2 O-Xylene 0.91±0.11 5.347

3 Benzene 4.76±0.2 5.440

4 Pinocarveol 4.76±0.2 8.865

5 Pinocarvone 2.37±0.1 9.686

6 Isoborneol 2.89±0.12 9.766

7 L-4-terineol 5.05±0.22 10.273

8 Myrtenol 9.35±0.3 11.026

9 Υ-Selinene 4.15±0.14 21.987

10 Valencene 4.12±0.23 22.380

11 β-Cubebene 1.57±0.15 23.213

12 trans- Nerolidol 1.72±0.05 25.340


14 Humulene epoxide 2 6.00±0.13 26.752

15 β-Maaliene 7.82±0.2 28.537

Alpinia calcarata

The leaves and rhizomes of Alpinia calcarata yielded no essential oil after

hydrodistillation of the samples.

Kaempferia galanga

The steam distillation of rhizomes of Kaempferia galanga yielded yellowish essential

oils, which possessed the characteristic spicy-campherous odour and the leaves yielded

no essential oil. Rhizomes yielded 0.6% essential oil. To determine detailed chemical

composition, the essential oil was assessed by GC-MS analysis. From the

chromatogram of essential oil sample of rhizomes, it was discernible that 6 major

identified components, accounting for 97.9% of the total peak area (Fig: 4.1.7) were

59

recorded. The result demonstrated the presence of ethyl p-methoxy cinnamate (EPMC)

with the maximum peak area (82.01±0.25%) followed by 5 chemicals, ethyl cinnamate

(9.69±0.10%), 3-carene (3.41±0.10%), eucalyptol (1.60±0.05%), borneol (0.62±0.02%),

pentadecane (0.57±0.07%) (Table: 4.1.7).

Table-4.1.7: Chemical composition of rhizome essential oil of Kaempferia galanga.

No Compound name Area (%) Mean ± SD Retention

time

1 3-Carene 3.41±0.10 5.100

2 Eucalyptol 1.60±0.05 5.616

3 Ethyl cinnamate 9.69±0.10 21.917

4 Borneol 0.62±0.02 22.972

5 Pentadecane 0.57±0.07 29.618

6 Ethyl p-methoxy

cinnamate

82.01±0.25 34.056

Kaempferia rotunda

The steam distillation of fresh rhizomes of Kaempferia rotunda yielded 0.15% essential

oils and the leaves did not contain essential oil. GC-MS analysis was performed to

determine detailed chemical composition of the rhizome essential oil revealing 9 major

identified components, accounting for 96.81% of the total peak area (Fig: 4.1.8). The

result demonstrated the presence of benzoic acid with the maximum peak area

(58.27±0.45%) followed by bornyl ester (14.66±0.36%), zingiberene (5.74±0.35%), β –

myrcene (3.89±0.15%) etc (Table: 4.1.8).

Table-4.1.8: Chemical composition of rhizome essential oil Kaempferia rotunda.

SL.No Compound name Area %

Mean±SD

Retention

Time

1 β –Myrcene 3.89±0.15 4.658

2 Camphor 3.82±0.2 9.026

3 Bornyl ester 14.66±0.36 14.489

4 Curcumene 1.80±0.29 22.139

5 Zingiberene 5.74±0.35 22.701

6 Pentadecane 2.00±0.26 22.976

7 Amorphene 3.85±0.21 23.234

8 β –Sesquiphellandrene 2.78±0.2 23.716

9 Benzoic acid 58.27±0.45 32.939

Kaempferia parishii

The leaves and rhizomes of Kaempferia parishii yielded no essential oil after

hydrodistillation of the samples.

60

Fig. 4.1.7: GC MS Chromatogram of Kaempferia galanga rhizome oil

Fig. 4.1.8: GC MS Chromatogram of Kaempferia rotunda rhizome oil

61

4.1.1.2. Analysis of extract

4.1.1.2.1. Phytochemical screening

Alpinia galanga

Preliminary phytochemical screening of the leaf and rhizome extract of Alpinia galanga

revealed the presence of different phytoconstituents which are shown in table (4.1.9). In

leaf extract alkaloids, flavonoids, steroids, triterpenoids, tanins and saponins were found

positive and carbohydrates aminoacids and glycosides were found negative. Similarly in

case of rhizome extract all the above phytoconstituents were present except

carbohydrates, saponins and glycosides.

Table-4.1.9: Preliminary phytochemical screening of leaf and rhizome extract of

Alpinia galanga.

Phytoconstituents Test performed AG

leaf

AG rhizome

Alkaloids Dragendroff‟s test -ve -ve

Mayer‟s test, Wagner‟s test, Hager‟s test +ve +ve

Steroids Libermann Burchard test, Salkowski test +ve +ve

Flavonoids Alkaline reagent test, Shinoda test +ve +ve

Triterpenoids Libermann Burchard test, Salkowski test +ve +ve

Carbohydrates Molisch‟s test, Fehling‟s test -ve -ve

Barfoed‟s test, Benedict‟s test -ve -ve

Tanins FeCl2 test +ve +ve

Saponins Foam test +ve -ve

Aminoacids Millon‟s test, Ninhydrin test -ve +ve

Glycosides Killer-Kiliani test -ve -ve

Brontrager‟s test -ve -ve (+): Indicates the presence of chemical constituents, (-): Indicates the absence of chemical constituents

Alpinia malaccensis

Preliminary phytochemical screening of the leaf and rhizome extract of Alpinia

malaccensis revealed the presence of different phytoconstituents which are described in

table (4.1.10). In leaf extract alkaloids, flavonoids, steroids, tanins, carbohydrates and

saponins were found positive and triterpenoids, aminoacids and glycosides were found

negative. Similarly in case of rhizome extract alkaloids, flavonoids, steroids and

triterpenoids were found positive and carbohydrates, aminoacids, saponins, tanins and

glycosides were found negative.

62

Fig. 4.1.9: Gallic acid calibration curve for total phenolic contents.

Fig. 4.1.10: Quercetin calibration curve for total flavonoid contents.

y = 0.004x + 0.036R² = 0.998

0

0.5

1

1.5

2

2.5

3

3.5

0 200 400 600 800

Ab

sorb

an

ce

Concentration (μg/ml)

Gallic acid standard curve

Gallic acid absorbance

Linear (Gallic acid absorbance)

y = 0.013x + 0.487R² = 0.886

0

0.5

1

1.5

2

2.5

3

3.5

0 50 100 150 200 250

Ab

sorb

an

ce

Concentration (µg/ml)

Quercetin standard curve

Quercetin absorbance

Linear (Quercetin absorbance)

63


Alpinia malaccensis.

Phytoconstituents Test performed AM

leaf

AM

rhizome

Alkaloids Dragendroff‟s test -ve +ve




Triterpenoids Libermann Burchard test, Salkowski test -ve +ve

Carbohydrates Molisch‟s test, Fehling‟s test +ve -ve

Barfoed‟s test, Benedict‟s test +ve -ve

Tanins FeCl2 test +ve -ve


Aminoacids Millon‟s test, Ninhydrin test -ve -ve


Brontrager‟s test -ve -ve

(+): Indicates the presence of chemical constituents, (-): Indicates the absence of chemical constituents

Alpinia nigra

As revealed from preliminary phytochemical screening, the leaf and rhizome extract of

Alpinia nigra contained different phytoconstituents which are represented in table

(4.1.11). In leaf extract alkaloids, flavonoids, steroids, triterpenoids, aminoacids and

tanins were found positive and carbohydrates, saponins and glycosides were found

negative. Similarly in case of rhizome extract all the above phytoconstituents were

present except triterpenoids, carbohydrates, saponins and glycosides.

Alpinia calcarata

It was seen after preliminary phytochemical screening of the leaf and rhizome extract of

Alpinia calcarata, different phytoconstituents were present which are represented in

table (4.1.12). In leaf extract alkaloids, flavonoids, steroids, triterpenoids, and

aminoacids were found positive and carbohydrates, saponins, tanins and glycosides

were found negative. Similarly in case of rhizome extract all the above

phytoconstituents were present except triterpenoids, carbohydrates, saponins and tanins.

64


Alpinia nigra.


Kaempferia galanga

As revealed from preliminary phytochemical screening, the leaf and rhizome extract of

Kaempferia galanga contained different phytoconstituents which are represented in

table (4.1.13). In leaf extract alkaloids, flavonoids, steroids, saponins and tanins were

found positive and carbohydrates, aminoacids, triterpenoids, saponins and glycosides

were found negative. Similarly rhizome extract was found to contain alkaloids,

flavonoids, steroids, triterpenoids, saponins and tanins.

Kaempferia rotunda

Preliminary phytochemical screening of the leaf and rhizome extract of Kaempferia

rotunda revealed the presence of different phytoconstituents which are described in

table (4.1.14). In leaf extract alkaloids, flavonoids, steroids, triterpenoids and tanins

were found positive and carbohydrates, aminoacids, saponins and glycosides were

found negative. Similarly in case of rhizome extract all the above phytoconstituents

were present except triterpenoids, carbohydrates and aminoacids.

Phytoconstituents Test performed AN

leaf

AN

rhizome

Alkaloids Dragendroff‟s test -ve -ve




Triterpenoids Libermann Burchard test, Salkowski test +ve -ve


Barfoed‟s test, Benedict‟s test +ve -ve


Saponins Foam test -ve -ve

Aminoacids Millon‟s test, Ninhydrin test +ve +ve



65


Alpinia calcarata.

(+): Indicates the presence of chemical constituents, (-): Indicates the absence of chemical

constituents


Kaempferia galanga.

Phytoconstituents Test performed K.G

Leaf

K.G

Rhizome

Alkaloids Dragendroff‟s test +ve +ve





Carbohydrates Molisch‟s test, Fehling‟s test -ve +ve



Phytoconstituents Test performed

AC leaf

AC

rhizome

Alkaloids Dragendroff‟s test -ve +ve







Tanins FeCl2 test -ve -ve

Saponins Foam test -ve -ve

Aminoacids Millon‟s test, Ninhydrin test +ve +ve

Glycosides Killer-Kiliani test -ve +ve

Brontrager‟s test -ve +ve

66

Phytoconstituents Test performed K.P

leaf

K.P

Rhizome

Saponins Foam test +ve +ve






Kaempferia rotunda.

Phytoconstituents Test performed K.R

leaf

K.R

Rhizome

Alkaloids Dragendroff‟s test +ve -ve








Saponins Foam test -ve +ve



Brontrager‟s test -ve +ve


Kaempferia parishii

Preliminary phytochemical screening of the leaf and rhizome extract of Kaempferia

parishii revealed the presence of different phytoconstituents which are represented in

table (4.1.15). It was seen that leaf extract contained alkaloids, flavonoids, saponins and

glycosides whereas rhizome extract was found to contain alkaloids, steroids,

triterpenoids.

67


Kaempferia parishii.


4.1.1.2.2. Evaluation of total phenolic and total flavonoid contents

In our study, Total Phenolic Content (TPC) of leaf and rhizome extracts of Alpinia and

Kaempferia species was estimated by using modified Folin-Ciocalteu calorimetric

method and represented in terms of GAE/g of the extract. It was calculated using the

standard curve of Gallic acid as shown in Fig: (4.1.9) (Standard curve equation: Y =

0.004x+0.063, R2 = 0.998). TPC of the leaf and rhizome extract of Alpinia galanga

were found to be 77.25±1.56 and 32.44±1.35 mg GAE/g of the extract respectively

(Table: 4.1.16).

Total Flavonoid Content (TFC) of leaf and rhizome extract of Alpinia and Kaempferia

species was calculated using the standard curve of Quercetin (standard curve equation:

Y= 0.013x+0.487, R2=0.886) (Fig: 4.1.10) and represented in terms of Quercetin

equivalent/g of the extract. Alpinia galanga leaf extract possessed high flavonoid

Phytoconstituents Test performed K.P

leaf

K.P

Rhizome

Alkaloids Dragendroff‟s test +ve -ve


Steroids Libermann Burchard test, Salkowski test -ve +ve

Flavonoids Alkaline reagent test, Shinoda test +ve -ve




Tanins FeCl2 test -ve -ve



Glycosides Killer-Kiliani test +ve -ve

Brontrager‟s test +ve -ve

68

contents (64.69±1.12 mg Quercetin equivalent/ g of extract) in compared to rhizome

extract (39.46±1.05 mg Quercetin equivalent/ g of extract) (Table: 4.1.17).

TPC of the leaf and rhizome extracts of Alpinia malaccensis was found to be

76.25±0.83 mg GAE/g and 45.75±0.51 mg GAE/g of the extract (Table: 4.1.16). Total

Flavonoid Content (TFC) of Alpinia malaccensis leaf and rhizome extract was found to

be (72.61±0.48 and 40.92±0.26 mg Quercetin equivalent/ g of extract) (Table: 4.1.17) as

calculated from the standard curve of Quercetin (standard curve equation: Y=

0.013x+0.487, R2=0.886) (Fig: 4.1.10).

In the present study, Alpinia nigra leaf extract possessed high phenolic contents

(68.5±1.05 mg GAE/g of extract) as compared to the rhizome extract (48.75±1.52 mg

GAE/g of extract) (Table: 4.1.16). TFC of Alpinia nigra leaf and rhizome extract was

found to be 78.84±0.81 and 35.30±0.97 mg Quercetin equivalent/ g of extract (Table:

4.1.17).

TPC of the leaf and rhizome extracts of Alpinia calcarata was found to be 59.25±0.92

mg GAE/g and 37.75±0.95 mg GAE/g of the extract (Table: 4.1.16). TFC of Alpinia

calcarata leaf and rhizome extract was found to be 38.38±0.56 and 36.92±0.24 mg

Quercetin equivalent/ g of extract (Table: 4.1.17).

TPC of the leaf and rhizome extracts of Kaempferia galanga was found to be 51.5±0.67

mg GAE/g and 33.5±0.84 mg GAE/g of the extract (Table: 4.1.16). As calculated from

the standard curve of Quercetin (Fig: 4.1.10), Total flavonoid content (TFC) of

Kaempferia galanga leaf and rhizome extract was found to be 47±0.21 and 39.38±0.75

mg Quercetin equivalent/ g of extract (Table: 4.1.17).

As calculated from the standard curve of Gallic acid (Fig: 4.1.9) TPC of Kaempferia

rotunda leaf and rhizome extracts was found to be 48.25±0.55mg GAE/g and 30.5±0.23

mg GAE/g of the extract respectively (Table: 4.1.16). TFC of Kaempferia rotunda leaf

and rhizome extract was found to be 58.69±0.66 and 32.15±0.82 mg Quercetin

equivalent/ g of extract (Table: 4.1.17).

Similarly TPC of Kaempferia parishii extracts was determined and represented in terms

of GAE. TPC of the leaf and rhizome extracts of Kaempferia parishii was found to be

31.75±0.44 mg GAE/g and 27±0.36 mg GAE/g of the extract (Table: 4.1.16). TFC of

Kaempferia parishii leaf and rhizome extract was found to be 39.46±0.1 and 27.30±0.43

mg Quercetin equivalent/g of extract (Table: 4.1.17).

69

Table-4.1.16: Total Phenolic Content (TPC) of methanolic extracts of Alpinia and

Kaempferia species

Sl no Sample Name TPC (mg Gallic acid

equivalent)

1 Alpinia galanga leaf 77.25±1.56

2 Alpinia galanga rhizome 32.44±1.35

3 Alpinia malaccensis leaf 76.25±0.83

4 Alpinia malaccensis rhizome 45.75±0.51

5 Alpinia nigra leaf 68.5±1.05

6 Alpinia nigra rhizome 48.75±1.52

7 Alpinia calcarata leaf 59.25±0.92

8 Alpinia calcarata rhizome 37.75±0.95

9 Kaempferia galanga leaf 51.5±0.67

10 Kaempferia galanga rhizome 33.5±0.84

11 Kaempferia rotunda leaf 48.25±0.55

12 Kaempferia rotunda rhizome 30.5±0.23

13 Kaempferia parishii leaf 31.75±0.44

14 Kaempferia parishii rhizome 27±0.36

Table-4.1.17: Total Flavonoid Content (TFC) of methanolic extracts of Alpinia and

Kaempferia species

Sl no Sample Name TFC (mg Quercetin

equivalent)

1 Alpinia galanga leaf 64.69±1.12

2 Alpinia galanga rhizome 39.46±1.05

3 Alpinia malaccensis leaf 72.61±0.48

4 Alpinia malaccensis rhizome 40.92±0.26

5 Alpinia nigra leaf 78.84±0.81

6 Alpinia nigra rhizome 35.30±0.97

7 Alpinia calcarata leaf 38.38±0.56

8 Alpinia calcarata rhizome 36.92±0.24

9 Kaempferia galanga leaf 47±0.21

10 Kaempferia galanga rhizome 39.38±0.75

11 Kaempferia rotunda leaf 58.69±0.66

12 Kaempferia rotunda rhizome 32.15±0.82

13 Kaempferia parishii leaf 39.46±1

14 Kaempferia parishii rhizome 27.30±0.43

4.1.1.2.3. Chemical constituents of extracts

Alpinia galanga

Gas chromatography and mass spectrometry analysis of the leaf and rhizome extracts of

Alpinia galanga revealed the presence of 2 and 8 identified chemical constituents

accounting for 57.84% and 72.96% of the total peak area respectively (Fig:4.1.11 and

70

4.1.12). Detailed list of all the detected compounds was given in Table (4.1.18 and

4.1.19). Benzenepropanal (37.35±0.5%) and 3-phenyl-2-butanone (20.49±0.6%) were

found to be the constituents of the leaf extract whereas rhizome extract was found to

contain carotol (17.44±0.3%), eucalyptol (13.89±0.2%), 5-hydroxymethylfurfural

(11.28±0.3%) as major constituents.

Table-4.1.18: Chemical composition of leaf extract of Alpinia galanga.


Mean±SD

Retention

Time

1 Benzenepropanal 37.35±0.5 9.051

2 3-phenyl-2-butanone 20.49±0.6 11.880

Table-4.1.19: Chemical composition of rhizome extract of Alpinia galanga.


Mean±SD

Retention

Time

1 Eucalyptol 13.89±0.2 5.470

2 Pyranone 7.74±0.3 9.174

3 α-Terpineol 9.09±0.3 10.519

4 Fenchyl acetate 5.44±0.1 11.508

5 5-Hydroxymethylfurfural 11.28±0.3 12.840

6 Cinnamic acid 3.82±0.1 17.957

7 Carotol 17.44±0.3 25.894

8 Palmitic acid 4.26±0.1 39.062

Alpinia malaccensis

The leaf and rhizome extracts of Alpinia malaccensis were analyzed by GC-MS for

determining their volatile chemical constituents and it revealed the presence of 14 and 8

identified components accounting for 37.47% and 78.25% of the peak area respectively

(Fig: 4.1.13 and 4.1.14). All the detected compounds with their chemical names, area

percentages and retention times (RT) of each were given in Table (4.1.20 and

4.1.21).The major identified constituents of the leaf extract were acetylcyclopentanone

(9.86±0.3%), glycerin (8.92±0.2%) whereas in case of rhizome extract 5-

hydroxymethylfurfural (36.11±0.4%), pyranone (24.86±0.3%), trioxsalen (6.05±0.3%)

were the major constituents.

71

Fig. 4.1.11: GC MS Chromatogram of Alpinia galanga leaf extract

Fig. 4.1.12: GC MS Chromatogram of Alpinia galanga rhizome extract

72

Fig. 4.1.13: GC MS Chromatogram of Alpinia malaccensis leaf extract

Fig. 4.1.14: GC MS Chromatogram of Alpinia malaccensis rhizome extract

73

Table-4.1.20: Chemical composition of leaf extract of Alpinia malaccensis.


Mean±SD

Retention

time

1 Glycerin 8.92±0.2 9.098

2 Acetylcyclopentanone 9.86±0.3 15.542


4 Ethyl p-methoxycinnamate 0.96±0.2 32.220

5 Hexahydrofarnesyl acetone 0.24±0.2 35.007

6 Methyl isohexadecanoate 0.70±0.1 37.696

7 Phthalic acid 0.26±0.1 38.707

8 Palmitic acid 0.63±0.1 39.087

9 α –Octadecene 0.18±0.1 42.491

10 Phytol 2.02±0.1 43.333

11 Totarol 0.42±0.1 48.813

12 Trioxsalen 6.39±0.4 49.490

13 Cedrediprenone 6.40±0.3 50.809

14 Ethyl linoleate 0.30±0.1 52.027

Table-4.1.21: Chemical composition of rhizome extract of Alpinia malaccensis.


Mean±SD

Retention

time

1 5-Methyl-2-furaldehyde 4.44±0.2 4.345

2 O-Cymene 2.55±0.2 5.385

3 4-Pyridinol 1.55±0.1 7.466

4 Pyranone 24.86±0.3 10.455

5 Benzylphenylcarbinol 1.54±0.1 11.051

6 5-Hydroxymethylfurfural 36.11±0.4 15.876

7 Palmitic acid 1.15±0.2 39.079

8 Trioxsalen 6.05±0.3 49.600

Alpinia nigra

The leaf and rhizome extracts of Alpinia nigra were analyzed by GC-MS for

determining their volatile chemical constituents and it revealed the presence of 4 and 7

identified components accounting for 57.06% and 77.61% of the leaf and rhizome

http://www.chemindustry.com/chemicals/025606022.html

http://www.chemindustry.com/chemicals/04478467.html

74

extract respectively (Fig: 4.1.15 and 4.1.16). Detailed list of all the detected compounds

with their chemical names and area percentages of each was given in Table (4.1.22 and

4.1.23). α-caryophyllene(16.75±0.3%), 2-bromoethanol (17.22±0.4%), 3,5-

dimethylamphetamine (12.83±0.35%) were found to be the major constituents of the

leaf extract whereas rhizome extract was found to contain pyranone (24.35±0.4%),

caryophyllene oxide (14.75±0.3%), hydroxytoluene (12.54±0.2%) as major

constituents.

Table-4.1.22: Chemical composition of leaf extract of Alpinia nigra.


Mean±SD

Retention

time

1 α-Caryophyllene 16.75±0.3 20.473

2 3,5-Dimethylamphetamine 12.83±0.35 27.281

3 2,4-Dimethylamphetamine 10.26±0.34 27.420

4 2-Bromoethanol 17.22±0.4 34.918

Table-4.1.23: Chemical composition of rhizome extract of Alpinia nigra.


Mean±SD

Retention time

1 Cyclohexanone 7.32±0.5 4.928

2 2-Hexyl-1-ol 4.07±0.2 8.557

3 Pyranone 24.35±0.4 9.905

4 Hydroxytoluene 12.54±0.2 10.675

5 Mayurone 7.01±0.2 28.042

6 Cis-Limonene 7.57±0.2 30.486


Alpinia calcarata

Gas chromatography and mass spectrometry analysis of Alpinia calcarata leaf and

rhizome extracts revealed the presence of 6 and 3 identified components accounting for

99.97% and 50.7% of the leaf and rhizome extract respectively (Fig: 4.1.17 and 4.1.18).

Detailed list of all the detected compounds with their chemical names, area percentages

and retention time of each was given in Table (4.1.24 and 4.1.25). The major

constituents of the leaf extract were olealdehyde (32.41±0.95%), hexadecanal

(31.84±0.34%), phytol (11±0.52%), 9-hexadecenal (10.06±0.12%) whereas rhizome

extract was found to contain hydroquinone (44.17±0.36%) and pyranone (6.19±0.35%)

as major constituents.

75

Fig. 4.1.15: GC MS Chromatogram of Alpinia nigra leaf extract

Fig. 4.1.16: GC MS Chromatogram of Alpinia nigra rhizome extract

76

Fig. 4.1.17: GC MS Chromatogram of Alpinia calcarata leaf extract

Fig. 4.1.18: GC MS Chromatogram of Alpinia calcarata rhizome extract

77

Table-4.1.24: Chemical composition of leaf extract of Alpinia calcarata.


Mean±SD

Retention

Time

1 9-Hexadecenal 10.06±0.12 31.899

2 Hexadecanal 31.84±0.34 32.694

3 9,12-Octadecadienal 6.67±0.42 38.089

4 Olealdehyde 32.41±0.95 38.487

5 Octadecanal 7.99±0.63 39.155

6 Phytol 11.00±0.52 41.904

Table-4.1.25: Chemical composition of rhizome extract of Alpinia calcarata.


Mean±SD

Retention

Time

1 Pyranone 6.19±0.35 9.876

2 Hydroquinone 44.17±0.36 15.001

3 2-Deoxy-D-ribose 0.34±0.18 31.471

Kaempferia galanga

Gas chromatography and mass spectrometry analysis was conducted for determining

volatile chemical constituents of the leaf and rhizome extract of Kaempferia galanga

and it revealed the presence of 8 and 10 identified components accounting for 61.44%

and 96.97% of the leaf and rhizome extract respectively (Fig: 4.1.19 and 4.1.20). 2-(3,4-

dimethoxyphenyl)-7-hydroxy-3-methoxy-4H-chromen-4-one (18.26±0.35%), 2-(3-

hydroxy-4-methoxyphenyl)-3,7-dimethoxy-4H-chromen-4-one(14.01±0.3%),

octamethylcyclotetrasiloxane (11.79±0.2%) were found to be the major constituents of

the leaf extract. Rhizome extract contained ethyl p-methoxycinnamate (80.39±0.85%),

ethyl cinnamate (9.61±0.45%), pentadecane (3.12±0.2%) as major constituents (Table:

4.1.26 and 4.1.27).

Table-4.1.26: Chemical composition of leaf extract of Kaempferia galanga.


Mean±SD

Retention

Time

1 Octamethyl cyclotetrasiloxane 11.79±0.2 15.703

2 Diethyl Phthalate 6.85±0.2 23.987

3 Hexadecanal 2.47±0.24 32.710


5 Hexadecanoic acid, methyl ester 2.38±0.28 36.364

6 Phytol 1.73±0.12 41.937

7 2-(3,4-Dimethoxyphenyl)-7-hydroxy-3-

methoxy-4H-chromen-4-one

18.26±0.35 49.955

8 2-(3-Hydroxy-4-methoxyphenyl)-3,7-

dimethoxy-4H-chromen-4-one

14.01±0.3 50.682

78

Fig. 4.1.19: GC MS Chromatogram of Kaempferia galanga leaf extract

Fig. 4.1.20: GC MS Chromatogram of Kaempferia galanga rhizome extract

79

Kaempferia rotunda

GC-MS analysis of leaf and rhizome extracts of Kaempferia rotunda shown the

presence of 2 and 5 identified volatile chemical constituents accounting for 99.99% and

66.13% of the leaf and rhizome extract respectively (Fig: 4.1.21 and 4.1.22). All the

detected compounds with their chemical names, area percentages and retention time of

each were given in Table (4.1.28 and 4.1.29).

Table-4.1.27: Chemical composition of rhizome extract of Kaempferia galanga.


Mean±SD

Retention

Time

1 Borneol 0.40±0.12 9.732

2 Ethyl cinnamate 9.61±0.45 21.631

3 Pentadecane 3.13±0.2 22.891

4 γ-Muurolene 0.43±0.28 23.056

5 8-Heptadecene 0.56±0.25 29.251

6 4-Tetradecyne 1.21±0.23 29.454

7 Heptadecene 0.35±0.11 30.122

8 2-Pentadecanol 0.22±0.12 30.317


10 Hexadecanoic acid 0.67±0.12 39.277

In the leaf extract phytol (93.32±0.75%) and hexadecanoic acid, methyl ester

(6.67±0.2%) were found, whereas rhizome extract was found to contain vinylacetic acid

(52.40±0.56%), ethyl p-methoxycinnamate (4.68±0.21%), erythritol (3.45±0.21%) as

major constituents.

Table-4.1.28: Chemical composition of leaf extract of Kaempferia rotunda.


Mean±SD

Retention

Time

1 Hexadecanoic acid, methyl ester 6.67±0.2 40.280

2 Phytol 93.32±0.75 45.942

Table-4.1.29: Chemical composition of rhizome extract of Kaempferia rotunda.


Mean±SD

Retention

Time

1 Dimethylformamide 2.08±0.22 9.652

2 Erythritol 3.45±0.21 9.770

3 Vinylacetic acid 52.40±0.56 25.746


5 Phenylephrine 3.52±0.2 44.585

80

Fig. 4.1.21: GC MS Chromatogram of Kaempferia rotunda leaf extract

Fig. 4.1.22: GC MS Chromatogram of Kaempferia rotunda rhizome extract

81

Kaempferia parishii

The leaf and rhizome extracts of Kaempferia parishii were analyzed by GC-MS for

determining their chemical constituents and it revealed the presence of 7 and 8

identified components accounting for 92.1% and 82.86% of the leaf and rhizome extract

respectively (Fig: 4.1.23 and 4.1.24). In leaf extract phytol (72.55±0.5%), hexadecanoic

acid methyl ester (4.94±0.2%), hexahydrofarnesyl acetone (3.78±0.2%), dibutyl

phthalate (3.31±0.2%) were found to be the major constituents and in case of rhizome

extract totarol (74.96±0.86%), cembrene (2.83±0.2%), borneol (1.23±0.15) were the

major constituents (Table: 4.1.30 and 4.1.31).

Table-4.1.30: Chemical composition of leaf extract of Kaempferia parishii.


Mean±SD

Retention

Time

1 β-Farnesene 1.04±0.1 22.748


3 Hexadecanoic acid methyl ester 4.94±0.2 40.280

4 Dibutyl phthalate 3.31±0.2 41.202

5 9,12-Octadecenoic acid, methyl ester 3.48±0.3 45.489

6 Methyl linolenate 3.00±0.4 45.663

7 Phytol 72.55±0.5 45.942

Table-4.1.31: Chemical composition of rhizome extract of Kaempferia parishii


Mean±SD

Retention

Time

1 Borneol 1.23±0.15 9.715

2 L-bornyl acetate 0.60±0.03 14.202

3 Aromadendrene 0.72±0.1 20.862

4 Ledol 0.24±0.08 26.232

5 Dehydrobietan 1.37±0.1 41.197

6 Cembrene 2.83±0.2 41.912

7 Totarol 74.96±0.86 49.498

8 Longipinocarveol, trans- 0.91±0.1 50.407

82

Fig. 4.1.23: GC MS Chromatogram of Kaempferia parishii leaf extract

Fig. 4.1.24: GC MS Chromatogram of Kaempferia parishii rhizome extract

83

4.1.2. Bioactivity study

4.1.2.1. Evaluation of antioxidant activity

Alpinia galanga

Essential oils and methanolic extracts of A.galanga leaf and rhizome showed good

DPPH radical-scavenging activity (Fig: 4.1.25 A &B). As can be seen from the graph,

activity was increased with the increasing concentration of the samples. The

concentration that led to 50% inhibition (IC50) is given in the table (4.1.32). Lower IC50

value indicates higher antioxidant activity. Here ascorbic acid was used as positive

control. Both leaf and rhizome essential oil possessed high radical scavenging activity

almost equivalent to the standard ascorbic acid. But the methanolic extracts were found

less effective in compared to the oils.

Alpinia malaccensis

The antioxidant activity of the essential oils and extracts obtained from Alpinia

malaccensis leaf and rhizomes were evaluated using DPPH radical assay. In the present

study, the samples (oils & extracts) showed significant DPPH radical inhibiting activity

at a concentration of 100μg/ml. (Fig: 4.1.26 A & B) showed the dose response curve of

DPPH radical scavenging activity of A. malaccensis compared with standard ascorbic

acid.

It was observed that the rhizome oil had highest activity with lowest IC50 value (16

μg/ml) and rhizome extract had lowest DPPH scavenging activity with IC50 value of

32.5 μg/ml while the IC50 value of the standard antioxidant ascorbic acid was 6.58μg/ml

(Table: 4.1.32). Lower IC50 value indicates higher antioxidant activity. As can be seen

from the graph, activity was increased with the increasing concentration of the samples.

The result showed that, the inhibition on DPPH radical scavenging assay of the essential

oils was higher as compared to the methanolic extracts of Alpinia malaccensis.

Alpinia nigra

Essential oils and methanolic extracts of A.nigra leaf and rhizome showed good DPPH

radical-scavenging activity (Fig: 4.1.27 A & B). As can be seen from the graph, activity

was increased with the increasing concentration of the samples. The IC50 values

(concentration that led to 50% inhibition) are given in the Table (4.1.32). Lower IC50

value indicates higher antioxidant activity. Here ascorbic acid was used as positive

control. Leaf essential oil with radical scavenging activity more than that of ascorbic

acid, was particularly effective and proved superior to methanolic extract.

84

Fig. 4.1.25: DPPH radical scavenging activity of essential oils (A) and methanolic

extracts (B) of Alpinia galanga.


extracts (B) of Alpinia malaccensis.


extracts (B) of Alpinia nigra.

85

Alpinia calcarata

The antioxidant activity of the methanolic extracts of Alpinia calcarata leaf and

rhizomes were evaluated using DPPH radical assay. The samples showed moderate

DPPH radical inhibiting activity at a concentration of 100 μg/ml. (Fig: 4.1.28) showed

the dose response curve of DPPH radical scavenging activity of A. calcarata compared

with standard ascorbic acid. It was observed that the leaf extract had higher activity with

IC50 value (83.6μg/ml) than rhizome extract (IC50 value-103.4 μg/ml) while the IC50

value of the standard antioxidant ascorbic acid was 6.58μg/ml (Table: 4.1.32). As can

be seen from the graph, both the extracts of Alpinia calcarata had poor to moderate

DPPH radical scavenging activity.

Kaempferia galanga

It was evident that increased antioxidant activity in DPPH free radical scavenging assay

was seen with increasing concentrations of oil and extract samples of Kaempferia

galanga rhizomes (Fig: 4.1.29). Lower IC50 value indicates higher antioxidant activity.

The DPPH scavenging activity of the samples indicated a concentration dependent

antioxidant activity against the radical, with IC50 values of 6.58, 26.5, 26.7 and 49.9

μg/mL for ascorbic acid, rhizome oil, rhizome extract and leaf extract of Kaempferia

galanga respectively (Table: 4.1.32).

Kaempferia rotunda

DPPH radical scavenging assay of Kaempferia rotunda rhizome essential oils and leaf

and rhizome extracts showed significant DPPH radical inhibiting activity at a

concentration of 100μg/ml. Fig (4.1.30) showed the dose response curve of DPPH

radical scavenging activity of Kaempferia rotunda samples compared with standard

ascorbic acid. It was observed that the rhizome oil and rhizome extract had better

activity in compared to leaf extract. Assessed essential oils and methanolic extracts

were able to reduce the stable violet DPPH radical to the yellow DPPH-H, reaching

50% of reduction with IC50 values (Table: 4.1.32). As can be seen from the graph,

activity was increased with the increasing concentration of the samples.

Kaempferia parishii

The antioxidant activity of the methanolic extracts obtained from Kaempferia parishii

leaves and rhizomes were evaluated using DPPH free radical scavenging assay. In the

present study, the samples (oils & extracts) showed moderate DPPH radical inhibiting

activity at a concentration of 100μg/ml. As can be seen from the graph (Fig: 4.1.31),

86

Fig. 4.1.28: DPPH radical scavenging activity of methanolic extracts of Alpinia

calcarata.

Fig. 4.1.29: DPPH radical scavenging activity of essential oil (A) and methanolic

extracts (B) of Kaempferia galanga.

0

20

40

60

80

100

0 20 40 60 80 100 120

%In

hib

itio

n


Alpinia calcarata Extract

Ascorbic acid

Leaf extract

Rhizome extract

87

Fig. 4.1.30: DPPH radical scavenging activity of essential oil (A) and methanolic

extracts (B) of Kaempferia rotunda.

Fig. 4.1.31: DPPH radical scavenging activity of methanolic extracts of

Kaempferia parishii

0

20

40

60

80

100

0 20 40 60 80 100 120

%In

hib

itio

n


Kaempferia parishii Extract

ascorbic acid

Leaf extract

Rhizome extract

88

activity was increased with the increasing concentration of the samples. But when

compared with standard ascorbic acid, it was seen that the extracts of Kaempferia

parishii exhibited very low DPPH radical inhibiting activity. Higher IC50 values of the

extracts indicate its less inhibition capacity against the radical (Table: 4.1.32).

Table-4.1.32: IC50 values of essential oils and extracts of Alpinia and Kaempferia

species.

Sl.No Samples DPPH IC50 (μg/ml)

1 Control (Ascorbic acid) 6.58

2 Alpinia galanga LO 18

LE 20

RO 16

RE 25

3 Alpinia malaccensis LO 17

LE 22

RO 15

RE 32

4 Alpinia nigra LO 4

LE 15

RO 13

RE 15

5 Alpinia calcarata LE 83

RE 103

6 Kaempferia galanga LE 49.9

RO 26.5

RE 26.7

7 Kaempferia rotunda LE 47

RO 25

RE 29

8 Kaempferia parishii LE 99.9

RE 64

LO: Leaf Oil; LE: Leaf Extract; RO: Rhizome Oil; RE: Rhizome Extract

4.1.2.2. Evaluation of antimicrobial activity

The in vitro antimicrobial activity of the essential oils and extracts were carried out by

the agar disc diffusion method and minimum inhibitory concentration (MIC) and

minimum bactericidal concentration (MBC) values. This resulted in a range of growth

inhibition pattern against pathogenic microorganisms.

89

Alpinia galanga

The essential oils and extracts of Alpinia galanga were found to have good to moderate

antimicrobial activities against all microorganisms tested. The MIC of the oil and

extract were ranged between 0.75-4.99 mg/ml and 0.65-5.77 mg/ml respectively. The

zone of inhibition was highest in A.galanga leaf extract (21±0.24 mm). The standard

positive control (Gentamycin 5 μg) showed inhibition diameter ranging from 9-35 mm

and 17-25.67 mm against the tested organisms. The assay results showed that pathogens

like S. aureus, E. faecalis, E.coli were more sensitive towards both the essential oils and

extracts than the remaining microbes as seen in Table (4.1.33 and 4.1.34).

Alpinia malaccensis

Preliminary screening by disc diffusion method revealed that the test pathogens were

susceptible to both oils and extracts. However differences in the zone sizes were

observed with different pathogens. Here the methanolic extracts of A.malaccensis

showed better activity against all organisms than its oils. The MIC of the oils and

extracts were ranged between 3.51-9.63 mg/ml and 0.55-5.07 mg/ml respectively while

the MBC of the oils and extracts were ranged between 4.27-14.67 mg/ml and 3.54-9.63

mg/ml respectively (Table: 4.1.35 & 4.1.36). A variance was observed in the zones of

inhibition and the MIC and MBC values. The zone of inhibition was highest in leaf

extract (21.91±0.24 mm) and it is also higher than the standard gentamycin (17±1 mm).

The results indicated that S. aureus was more sensitive towards the essential oils and

extracts than the remaining microbes as seen in Table (4.1.35 & 4.1.36).

Table-4.1.33: Antimicrobial activity of leaf and rhizome oil of Alpinia galanga.

Micro-

Organism

AGL oil

(mg/ml)

AGR oil

(mg/ml)

IZD of

gentamycin

at 5 mg in

in mm

IZD of

AGL oil at

5 mg in

mm

IZD of

AGR oil at

5 mg in

mm

MIC MBC MIC MBC

E. faecalis 1.91 3.41 1.51 3.16 19.38 ±0.13 16.45±0.2 18.78±0.23

S. aureus 1.65 2.51 0.75 2.53 17±1 17.56±0.14 15.54±0.13

A.

baumannii

4.27 8.73 4.78 9.67 24.67±0.57 14.88±0.22 14.09±0.37

E.coli 3.41 9.63 4.12 9.63 24.8±0.25 15.94±0.35 13.62±0.23

C. albicans 4.36 7.58 4.18 8.35 25.67±0.59 14.99±0.38 12.17±0.25

A. niger 4.99 8.36 4.11 7.98 25±1 12.48±0.32 13.77±0.36 AGL: Alpinia galanga Leaf; AGR: Alpinia galanga Rhizome; IZD: Inhibition Zone Diametre

90

Table-4.1.34: Antimicrobial activity of leaf and rhizome extract of Alpinia galanga.

Micro-

Organism

AGL

extract

(mg/ml)

AGR extract

(mg/ml)

IZD of

gentamycin

at 5 mg in

in mm

IZD of

AGL

extract at 5

mg in mm

IZD of

AGR

extract at 5

mg in mm

MIC MBC MIC MBC

E. faecalis 1.51 3.11 1.33 3.43 19.38 ±0.13 19±0.52 17±0.21

S. aureus 0.65 1.54 0.65 1.51 17±1 21±0.24 19±0.12

A.

baumannii

4.07 7.64 4.27 9.63 24.67±0.57 16±0.32 14±0.31

E.coli 3.41 8.65 4.27 9.63 24.8±0.25 19±0.42 18±0.24

C. albicans 4.02 8.98 4.12 7.58 25.67±0.59 19±0.25 18±0.32

A. niger 5.77 8.67 4.01 7.49 25±1 18±0.26 16±0.29 AGL: Alpinia galanga Leaf; AGR: Alpinia galanga Rhizome; IZD: Inhibition Zone Diametre

Table-4.1.35: Antimicrobial activity of leaf and rhizome oil of Alpinia malaccensis.

Micro-

Organism

AML oil

(mg/ml)

AMR oil

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

AML oil at

5 mg in

mm

IZD of

AMR oil at

5 mg in

mm

MIC MBC MIC MBC

E. faecalis 5.63 9.38 4.76 9.63 19.38 ±0.13 13.85±0.2 15.81±0.28

S. aureus 3.51 4.27 4.18 7.39 17±1 18.59±0.16 17.94±0.17

A.

baumannii

9.63 11.72 9.63 14.67 24.67±0.57 12.48±0.22 11.09±0.35

E.coli 4.27 9.63 4.27 9.63 24.8±0.25 14.74±0.35 13.62±0.23

C. albicans 4.36 7.58 5.18 8.35 25.67±0.59 14.69±0.31 12.74±0.45

A. niger 4.99 8.86 5.21 7.98 25±1 13.46±0.34 11.87±0.33 AML: Alpinia malaccensis Leaf; AGR: Alpinia malaccensis Rhizome; IZD: Inhibition Zone Diametre

Table4.1.36: Antimicrobial activity of leaf and rhizome extract of Alpinia

malaccensis.

Micro-

Organism

AML

extract

(mg/ml)

AMR

extract

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

AML

extract at 5

mg in mm

IZD of

AMR

extract at 5

mg in mm

MIC MBC MIC MBC

E. faecalis 2.51 5.71 4.33 5.43 19.38 ±0.13 19.38±0.43 17.33±0.21

S. aureus 0.55 3.54 1.65 6.11 17±1 21.91±0.24 19.49±0.16

A.

baumannii

5.07 7.64 4.27 9.63 24.67±0.57 16.35±0.32 14.89±0.33

E.coli 3.41 6.65 3.27 5.68 24.8±0.25 20.47±0.12 19.95±0.26

C. albicans 4.02 8.98 4.12 7.58 25.67±0.59 18.72±0.35 18.63±0.39

A. niger 4.77 8.67 4.01 7.49 25±1 18.56±0.36 16.25±0.29 AML: Alpinia malaccensis Leaf; AGR: Alpinia malaccensis Rhizome; IZD: Inhibition Zone Diametre

91

Alpinia nigra

The essential oils and methanolic extracts of Alpinia nigra were tested for their in vitro

antimicrobial activity using disc diffusion method, MIC and MBC assay. Two Gram (+)

and two Gram (-) pathogenic bacteria, and two fungus were challenged against the

essential oils and extracts with antimicrobial standard agents for comparison. The assay

results showed that pathogen E.coli, C. albicans and S. aureus was more sensitive

towards the essential oil, than the remaining as seen in Table: (4.1.37). The MIC of the

oils and extracts were ranged between 4.26-9.63 mg/ml and 4.07-9 mg/ml respectively

whereas the MBC values of the oils and extracts were ranged between 11.67-21.67

mg/ml and 14.18-19.67 mg/ml respectively. The zone of inhibition was highest in

A.nigra leaf extract (25.63 ±0.72 mm) against C. albicans (Table: 4.1.38). The overall

results suggest that the essential oils and extracts are moderate in antimicrobial

activities.

Table-4.1.37: Antimicrobial activity of leaf and rhizome oil of Alpinia nigra.

Micro-

Organism

ANL oil

(mg/ml)

ANR oil

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

ANL oil at

5 mg in

mm

IZD of

ANR oil at

5 mg in

mm

MIC MBC MIC MBC

E. faecalis 9.63 19.67 5.12 11.67 19.38 ±0.13 14.55±0.2 15.81±0.28

S. aureus 4.27 18.83 4.89 15.45 17±1 18.3 ± 0.13 17.94±0.17

A.

baumannii

9.38 21.67 8.52 18.62 24.67±0.57 20.73 ± 0.5

11.89±0.35

E.coli 4.26 20.72 6.51 19.27 24.8±0.25 22.91±0.36 19.62±0.23

C. albicans 4.5 17.58 8.18 15.35 25.67±0.59 21.59 ± 0.4 16.74±0.45

A. niger 7.0 18.63 9.21 17.98 25±1 18.36 ±0.52 11.87±0.33

ANL: Alpinia nigra Leaf; ANR: Alpinia nigra Rhizome; IZD: Inhibition Zone Diametre

Alpinia calcarata

The methanolic extracts of Alpinia calcarata were investigated for their in vitro

antimicrobial activity using disc diffusion method, MIC and MBC assay against two

Gram (+) and two Gram (-) pathogenic bacteria, and two fungus. As can be seen in

Table: 4.1.39, the methanolic extracts had shown weak antimicrobial activities against

all microorganisms tested. The MIC values of the extracts were ranged between 15.92-

19.82 mg/ml whereas the MBC values of the extracts were ranged between 19.29-27.98

mg/ml. The zone of inhibition was highest in A.calcarata rhizome extract (12.07±0.3

mm) against A. baumannii.

92

Table-4.1.38: Antimicrobial activity of leaf and rhizome extract of Alpinia nigra.

Micro-

Organism

ANL extract

(mg/ml)

ANR extract

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

ANL

extract at 5

mg in mm

IZD of

ANR

extract at 5

mg in mm

MIC MBC MIC MBC

E. faecalis 8.83 17.67 5.22 14.67 19.38 ±0.13 16.59±0.31 15.81±0.28

S. aureus 4.07 18.99 4.61 14.18 17±1 21.1 ± 0.3 19.93±0.13

A.

baumannii

8.38 19.67 7.65 19.29 24.67±0.57 19.43 ± 0.5

13.07±0.35

E.coli 6.74 19.12 7.11 19.27 24.8±0.25 18.25±0.68 16.24±0.68

C. albicans 6.9 16.87 7.23 15.35 25.67±0.59 25.63 ±0.72 24.38 ±0.72

A. niger 9.0 19.33 8.25 17.98 25±1 11.31 ±0.57 10.18 ±0.57

ANL: Alpinia nigra Leaf; ANR: Alpinia nigra Rhizome; IZD: Inhibition Zone Diametre

Table-4.1.39: Antimicrobial activity of leaf and rhizome extract of Alpinia

calcarata.

Micro-

Organism

ACL extract

(mg/ml)

ACR extract

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

ACL

extract at 5

mg in mm

IZD of

ACR

extract at 5

mg in mm

MIC MBC MIC MBC

E. faecalis 16.34 23.88 15.92 24.79 19.38 ±0.13 6.59±0.15 9.81±0.25

S. aureus 16.07 21.69 17.86 24.18 17±1 11.51 ± 0.3 11.93±0.23

A.

baumannii

19.82 25.74 17.65 19.29 24.67±0.57 10.35 ± 0.5

12.07±0.3

E.coli 17.4 21.2 16.11 26.74 24.8±0.25 9.55±0.4 11.24±0.5

C. albicans - - 19.72 25.54 25.67±0.59 5.3 ±0.62 10.38 ± 0.2

A. niger - - 18.58 27.98 25±1 4.5 ± 0.44 9.18 ± 0.5 ACL: Alpinia calcarata Leaf; ACR: Alpinia calcarata Rhizome; IZD: Inhibition Zone Diametre

Kaempferia galanga

The antimicrobial activity of the essential oil and methanolic extracts of Kaempferia

galanga was evaluated using disc diffusion method, MIC and MBC assay against two

Gram (+) and two Gram (-) pathogenic bacteria, and two fungus. From the disc

diffusion method, it was observed that the test pathogens were susceptible to both oil

and extracts. However the differences in the zone sizes were observed with different

pathogens. Here the rhizome extract of K.galanga showed better activity against all

organisms than the rhizome oil and leaf extract. The MIC and MBC values of the

rhizome oil were ranged between 4.78-7.34 mg/ml and 10.58-14.72 mg/ml respectively

(Table: 4.1.40).

93

The MIC and MBC values of the extracts were ranged between 4.15-20.45 mg/ml and

10.5-28.35 mg/ml respectively. (Table: 4.1.41). The zone of inhibition was highest in

rhizome extract (17.98±0.23 mm) against E.coli. Almost all the test pathogens were

sensitive to the rhizome extracts tested.

Table-4.1.40: Antimicrobial activity of rhizome oil of Kaempferia galanga.

Micro- Organism KGR oil (mg/ml) IZD of gentamycin

at 5 mg in mm

IZD of KGR oil at

5 mg in mm

MIC MBC

E. faecalis 7.34 12.27 19.38 ±0.13 14.51±0.2

S. aureus 4.78 11.83 17±1 16.94±0.2

A. baumannii 6.85 13.79 24.67±0.57 15.29±0.3

E.coli 5.96 14.72 24.8±0.25 17.62±0.23

C. albicans 5 10.58 25.67±0.59 16.76±0.4

A. niger 7.1 12.35 25±1 15.87±0.31 KGR: Kaempferia galanga Rhizome; IZD: Inhibition Zone Diametre

Table-4.1.41: Antimicrobial activity of leaf and rhizome extract of Kaempferia

galanga.

Micro-

Organism

KGL extract

(mg/ml)

KGR extract

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

KGL

extract at 5

mg in mm

IZD of

KGR

extract at 5

mg in mm

MIC MBC MIC MBC

E. faecalis 11.34 21.17 6.48 11.25 19.38 ±0.13 7.55±0.12 15.52±0.2

S. aureus 15.78 22.88 4.47 10.36 17±1 6.3 ± 0.3 17.46±0.2

A.

baumannii

16.85 23.79 5.55 12.65 24.67±0.57

9.7 ± 0.5

16.25±0.3

E.coli 15.96 24.68 4.36 14.28 24.8±0.25 9.95±0.66 17.98±0.23

C. albicans 20.45 27.84 4.15 10.5 25.67±0.59 7.5 ± 0.4 16.96±0.4

A. niger 20.13 28.35 5.11 10.95 25±1 8.6 ± 0.5 15.77±0.31

KGL: Kaempferia galanga Leaf; KGR: Kaempferia galanga Rhizome; IZD: Inhibition Zone Diametre

Kaempferia rotunda

The essential oil and methanolic extracts of Kaempferia rotunda was found to have

good to moderate antimicrobial activities against two Gram (+) and two Gram (-)

pathogenic bacteria and two fungus as determined from disc diffusion method, MIC and

94

MBC assay. Here the rhizome extract of K.rotunda showed better activity against some

microorganisms than the rhizome oil and leaf extract. The MIC and MBC values of the

rhizome oil were ranged between 8.34-10.91mg/ml and 19.65-22.58 mg/ml respectively

(Table: 4.1.42). Similarly the MIC and MBC values of the extracts were ranged

between 6.86-15.54 mg/ml and 10.63-27.83 mg/ml respectively. (Table: 4.1.43). The

zone of inhibition was highest in rhizome extract (16.69±0.2 mm) against S. aureus.

The assay results showed that pathogens like E.coli and A. baumannii were more

sensitive towards the essential oil than the remaining microbes as seen in Table (

4.1.42), whereas the extract of K.rotunda showed good activity against S. aureus and

E.coli.

Table-4.1.42: Antimicrobial activity of rhizome oil of Kaempferia rotunda.

Micro- Organism KRR oil (mg/ml) IZD of gentamycin

at 5 mg in mm

IZD of KRR oil at

5 mg in mm

MIC MBC

E. faecalis 9.63 20.23 19.38 ±0.13 11.51±0.4

S. aureus 8.75 21.87 17±1 12.59±0.2

A. baumannii 9.52 19.65 24.67±0.57 14.94±0.3

E.coli 8.34 20.12 24.8±0.25 15.72±0.23

C. albicans 10.5 22.58 25.67±0.59 14.87±0.25

A. niger 10.91 21.35 25±1 13.73±0.34

KRR: Kaempferia rotunda Rhizome; IZD: Inhibition Zone Diametre

Table-4.1.43: Antimicrobial activity leaf and rhizome extract of Kaempferia

rotunda.

Micro-

Organism

KRL extract

(mg/ml)

KRR extract

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

KRL

extract at 5

mg in mm

IZD of

KRR

extract at 5

mg in mm

MIC MBC MIC MBC

E. faecalis 15.54 26.72 9.64 15.56 19.38 ±0.13 6.5±0.12 10.52±0.2

S. aureus 14.66 25.28 7.47 10.63 17±1 5.3 ± 0.3 16.69±0.2

A.

baumannii

- - 8.54 13.75 24.67±0.57 4.7 ± 0.5

15.25±0.3

E.coli 14.62 27.83 6.86 14.86 24.8±0.25 5.95±0.6 14.9±0.23

C. albicans - - 7.71 15.55 25.67±0.59 2.5 ± 0.4 15.9±0.44

A. niger - - 8.18 16.53 25±1 2.6 ± 0.5 14.7±0.31 KRL: Kaempferia rotunda Leaf; KRR: Kaempferia rotunda Rhizome; IZD: Inhibition Zone Diametre

95

Kaempferia parishii

The methanolic extracts of Kaempferia parishii were examined for their in vitro

antimicrobial activity using disc diffusion method, MIC and MBC assay against two

Gram (+) and two Gram (-) pathogenic bacteria, and two fungus. As can be seen in

Table: 4.1.44, the methanolic extracts possess very weak antimicrobial activities against

some microorganisms tested while the extracts had no activity against some

microorganisms. The MIC values of the extracts were ranged between 14.44-21.96

mg/ml whereas the MBC values of the extracts were ranged between 25.66-27.83

mg/ml. The zone of inhibition was highest in K.parishii rhizome extract (7.9±0.23 mm)

against A. baumannii.

Table-4.1.44: Antimicrobial activity of leaf and rhizome extract of Kaempferia

parishii.

Micro-

Organism

KPL extract

(mg/ml)

KPR extract

(mg/ml)

IZD of

gentamycin

at 5 mg in

mm

IZD of

KPL

extract at 5

mg in mm

IZD of

KPR

extract at 5

mg in mm

MIC MBC MIC MBC

E. faecalis - - 14.73 25.66 19.38 ±0.13 - 5.52±0.2

S. aureus 19.78 - 15.89 27.83 17±1 3.3 ± 0.3 7.46±0.2

A.

baumannii

- - - - 24.67±0.57 1.7 ± 0.5

6.25±0.3

E.coli 21.96 - 14.44 26.78 24.8±0.25 2.9±0.66 7.9±0.23

C. albicans - - - - 25.67±0.59 - 6.36±0.4

A. niger - - - - 25±1 - 5.7±0.31 KPL: Kaempferia parishii Leaf; KPR: Kaempferia parishii Rhizome; IZD: Inhibition Zone Diametre

4.1.2.3. Evaluation of anticancerous activity

Alpinia galanga

The essential oils of Alpinia galanga were exhibited moderate anticancerous activity

against two cell lines i.e. HeLa and MCF7 as evaluated by MTT assay. The rhizome

essential of Alpinia galanga showed high inhibition percent (62 ± 1.30) than leaf oil (45

± 1.11) at 20µg/ml on HeLa cell line (Table: 4.1.45). In case of MCF7 cell line, the

rhizome oil (27.15 ± 2.2) also showed better activity than the leaf oil (15.15 ± 0.54) at

20µg/ml (Table: 4.1.45). The inhibition percent slightly increases with increasing the

concentration of both leaf and rhizome oil of Alpinia galanga (Fig: 4.1.32).

96

Alpinia malaccensis

The anticancerous activity of essential oils of Alpinia malaccensis were evaluated

against two cell lines i.e. HeLa and MCF7 by MTT assay. The result showed that the

oils exhibited poor activity as the oils displayed weak inhibitions. The percentage

cancer cell inhibition profiles were found to be concentration dependent (Fig: 4.1.33).

The inhibition percent slightly increases with increasing the concentration of both leaf

and rhizome oil of Alpinia malaccensis. The rhizome essential of Alpinia malaccensis

showed high inhibition percent (28.60 ± 0.64) than leaf oil (14.55 ± 0.52) at 20µg/ml

against HeLa cell line (Table: 4.1.45). In case of MCF7 cell line, the rhizome oil (24.54

± 0.34) also showed better activity than the leaf oil (15.60 ± 0.64) at 20µg/ml (Table:

4.1.45)

Alpinia nigra

Screening of essential oils of Alpinia nigra resulted in significant anticancer activities

against HeLa and MCF-7 cell lines as evaluated by MTT assay. The percentage of cell

inhibition values at 10 and 20μg/ml concentrations were given in the table (4.1.45). The

inhibition percent increases with increasing the concentration of both leaf and rhizome

oil (Fig: 4.1.34). The rhizome essential of Alpinia nigra showed high inhibition percent

than leaf oil against both HeLa and MCF7 cell line (Table: 4.1.45). The inhibition

percent of leaf and rhizome oil against HeLa cell line at 20µg/ml was found be 60 ±

3.33 and 79 ± 2.6 respectively. Whereas in case of MCF7 cell line, the rhizome oil

resulted in 70.9% ± 5.34 inhibition which was also higher than that of the leaf oil (50 ±

3.5) at 20µg/ml (Table: 4.1.45).

Kaempferia galanga

The anticancerous activity of rhizome essential oils of Kaempferia galanga was

evaluated against two cell lines i.e. HeLa and MCF7 by MTT assay. The result showed

that the rhizome oil exhibited strong activity. The percentage of cell inhibition values at

10 and 20μg/ml concentrations were given in the table (4.1.45). The inhibition percent

increases with increase in the concentration rhizome oil (Fig: 4.1.35). At 20µg/ml

concentration, the rhizome essential of Kaempferia galanga displayed 82.33% ± 3.76

inhibition against HeLa cell line whereas that of MCF7 cell line was found to be 78.4 ±

4.35 (Table: 4.1.45).

97

Fig. 4.1.32: Anticancerous activity of essential oils of Alpinia galanga on HeLa (A)

and MCF7 (B) cell line

Fig. 4.1.33: Anticancerous activity of essential oils of Alpinia malaccensis on HeLa

(A) and MCF7 (B) cell line

98

Fig. 4.1.34: Anticancerous activity of essential oils of Alpinia nigra on HeLa (A)

and MCF7 (B) cell line

Fig. 4.1.35: Anticancerous activity of essential oils of Kaempferia galanga on

HeLa (A) and MCF7 (B) cell line

Fig. 4.1.36: Anticancerous activity of essential oils of Kaempferia rotunda on

HeLa (A) and MCF7 (B) cell line

99

Kaempferia rotunda

The rhizome essential oils of Kaempferia rotunda was evaluated for its anticancerous

activity against two cell lines i.e. HeLa and MCF7 by MTT assay. The result showed

that the inhibition percentage increases with increase in the concentration (Fig:

4.1.36).The percentage of cell inhibition values at 10 and 20μg/ml concentrations were

given in the table (4.1.45). At 20µg/ml concentration, the rhizome essential of

Kaempferia rotunda displayed 75.63%±5.66 inhibition against HeLa cell line whereas

that of MCF7 cell line was found to be 68.44± 2.51 (Table: 4.1.45).

Table-4.1.45: Percentage (%) of cell inhibition of essential oils of Alpinia and

Kaempferia species on HeLa and MCF-7 cell line.

Sample Name HeLa

10 µg/ml 20 µg/ml

MCF7

10 µg/ml 20 µg/ml

AG (L) 30 ± 0.82 45 ± 1.11 13.1 ± 0.54 15.15 ± 0.54

AG (R) 45± 2.33 62 ± 1.30 20.11 ± 0.52 27.15 ± 2.2

AM (L) 6.92 ± 0.33 14.55 ± 0.52 9.55 ± 0.52 15.60 ± 0.64

AM (R) 17.38 ± 0.29 28.60 ± 0.64 19.34 ± 0.74 24.54 ± 0.34

AN (L) 33 ± 1.57 60 ± 3.33 27 ± 5.56 50 ± 3.5

AN (R) 47± 2.10 79 ± 2.6 56± 4.10 70.9 ± 5.34

KG (R) 41.58 ± 1.81 82.33 ± 3.76 37.19 ± 0.42 78.4 ± 4.35

KR (R) 31.83± 2.43 75.63± 5.66 26.95± 1.36 68.44± 2.51 AG (L): Alpinia galanga leaf, AG (R): Alpinia galanga rhizome, AM (L): Alpinia malaccensis leaf, AM

(R): Alpinia malaccensis rhizome, AN (L): Alpinia nigra leaf, AN (R): Alpinia nigra rhizome, KG (R):

Kaempferia galanga rhizome, KR (R): Kaempferia rotunda rhizome

4.2. Molecular characterisation

The present study was carried out for molecular profiling of four species of Alpinia and

three species of Kaemferia collected from different regions of Odisha using molecular

markers with the objective of analyzing the banding pattern and developing DNA

fingerprints of all species. For this purpose, four different types of molecular markers

like random amplified polymorphic DNA (RAPD), inter simple sequence repeat

(ISSR), simple sequence repeat (SSR) and other sequenced based markers were used.

The results obtained with respect to different markers for all species of Alpinia and

Kaemferia are described below.

4.2.1. RAPD Analysis

All twenty one DNA samples of seven species produced reproducible bands with nine

selected RAPD primers out of 30 primers tried. The banding pattern of all species with

respect to different primer was analyzed and selected gel pictures were represented

100

below (Fig 4.2.1). A total of 91 numbers of loci were amplified and all were found to be

polymorphic in nature. The highest number of (14) loci were amplified with the primer

D18 and lowest numbers of loci (07) were observed in the primer A18 and no unique

bands were found. The percentage of polymorphic loci (PPL) found here hundred

percent in all nine primers. The total number of fragment amplified also varies from 41

to 105 in A18 and D18 respectively. The range of resolving power (Rp) found over here

is 4.56 to 10.06 in A11 and D18 respectively. The polymorphic information content of

nine primers studied here gives no such big differences. Polymorphic information

content (PIC) values found lowest in A10 that is 0.8 and highest in A11 that is 0.93.

Detail data of other primers also mentioned in Table (4.2.1).

4.2.2. ISSR Analysis

All twenty one DNA samples of seven species produced reproducible bands with 13

selected ISSR primers out of 40 primers tried. The banding pattern of all species with

respect to different primer was analyzed and selected gel pictures were represented

(Fig. 4.2.2). A total of 118 numbers of loci were amplified and all were found to be

polymorphic in nature. The highest number of (14) loci were amplified with the primer

(GA)9T and lowest numbers of loci (05) were observed in the primer (CAA)5 and no

unique bands were found. The percentage of polymorphic loci (PPL) found here

hundred percent in all 13 primers. The total number of fragment amplified also varied

from 24 to 98 in ISSR15 and (GA)9T respectively. The range of resolving power (Rp)

found over here is 2.56 to 9.36 in ISSR 16 and (GA)9T respectively. The polymorphic

information content of 13 primers studied here revealed not much differences.

Polymorphic information content (PIC) values found lowest in (GA)9T that is 0.85 and

highest in ISSR 15 that is 0.97. Detail data of other primers also mentioned in the Table

(4.2.2).

4.2.3. SSR Analysis


selected ISSR primers out of 35 primers tried. The banding pattern of all species with

respect to different primer has been analyzed and some selected gel pictures were

represented below (Fig. 4.2.3).

101

Fig. 4.2.1: RAPD profiling of Alpinia and Kaempferia species with primers D20

(A), D18 (B), D8 (C). (M- gene ruler100bp ladder plus, Lane 1-3 represents

A. malacencis, lane 4-6 A. nigra, lane7-9 A. galanga, lane 10-12 A.

Calcarata, lane 13-15 K. galanga, lane 16-18 K. rotunda, lane 19-21 K.

parishii.

102

A total of 201 numbers of loci were amplified and all were found to be polymorphic in

nature. The highest number of (34) loci were amplified with the primer SSR 14 and

lowest numbers of loci (05) were observed in the primer SSR 13 and no unique bands

were found. The percentage of polymorphic loci (PPL) found here hundred percent in

all 11 primers. The total number of fragment amplified also varied from 33 to 188 in

SSR13 and SSR 14 respectively. The range of resolving power (Rp) found over here is

3.12 to 17.86 in SSR 13 and SSR 14 respectively. The polymorphic information content

of 11 primers studied here showed no such big differences. Polymorphic information

content (PIC) value was found lowest (0.78) in SSR 13 and highest (0.97) in SSR 11.

Detail data of other primers also mentioned in Table (4.2.3).

4.2.4. Sequence based marker analysis


selected sequence based primers (rbcL, rpoC1, rpoB, matK, atpF-atpH, psbK-psbl,

trnH-psbA) out of 20 primers tried. The banding pattern of all species with respect to

different primer was analyzed and selected gel pictures were represented (Fig. 4.2.4). A

total of 29 numbers of loci were amplified out of which 20 no. of loci are polymorphic

in nature. The highest number of (6) loci were amplified with the primer rbcL and

lowest numbers of loci (02) were observed in the primer rpoC1. The range of

percentage of polymorphic loci (PPL) was found 83.33% to 25% in matK and trnH-

psbA primers respectivelly. The total number of fragment amplified also varies from 24

to 108 in rpoC1and rbcL respectively. The range of resolving power (Rp) found over

here is 2.28 to 10.28 in rpoC1and rbcL respectively. The polymorphic information

content of 7 primers studied here revealed remarkable differences. Polymorphic

information content (PIC) values found lowest (0.16) in rpoC1and highest (0.74) in

atpF-atpH. Detail data of other primers also mentioned in Table (4.2.4). We also found

unique specific fragment of ~800 bp by rbcL primer and ~400 bp by rpoB primer

amplified only in Alpinia nigra and not in other six species undertaken here.(Fig.

4.2.4a,b). Similarly in each of three Alpinia calcarata sample ~380 bp unique fragment

was amplified while remaining absent in all other six species (Fig. 4.2.4c).

103

Fig. 4.2.2: ISSR profiling of Alpinia and Kaempferia species with primers ISSR 17

(A), (GA) 9T (B), (GTGC)4 (C). (M- gene ruler100bp ladder plus, Lane 1-

3 represents A. malacencis, lane 4-6 A. nigra, lane7-9 A. galanga, lane 10-

12 A. Calcarata, lane 13-15 K. galanga, lane 16-18 K. rotunda, lane 19-21

K. parishii.

104

Fig. 4.2.3: SSR profiling of Alpinia and Kaempferia species with primers SSR 14

(A), SSR 1 (B). (M- gene ruler100bp ladder plus, Lane 1-3 represents A.

malacencis, lane 4-6 A. nigra, lane7-9 A. galanga, lane 10-12 A. Calcarata,

lane 13-15 K. galanga, lane 16-18 K. rotunda, lane 19-21 K. parishii.

105

Fig. 4.2.4: Profiling of Alpinia and Kaempferia species with sequence based marker

with primers rbcL (A) rpoB (B) trnH-psbA (C) (M-gene ruler100bp ladder

plus (A,C) and 50 bp ladder (B), Lane 1-3 represents A. malacencis, lane 4-

6 A. nigra, lane7-9 A. galanga, lane 10-12 A. Calcarata, lane 13-15 K.

galanga, lane 16-18 K. rotunda, lane 19-21 K. parishi.

106

Table-4.2.1: List of primers used for RAPD amplification, GC content, total number of loci, the level of polymorphism,

resolving power and PIC value.

Primer Primer sequence % GC content

Annealing

Temperature

(in 0 C)

TNL NPL (%)

PPL

TNF

A Rp PIC

A10 GTGATCGCAG 50 37 11 11 100 93 8.9 0.8

A11 CAATCGCCGT 60 37 10 10 100 48 4.56 0.93

A18 AGGTGACCGT 60 37 7 7 100 41 6.57 0.91

D8 GTGTGCCCCA 70 37 12 12 100 103 9.8 0.8

A20 GTTGCGATCC 60 37 10 10 100 75 7.18 0.83

D18 GAGAGCCAAC 60 37 14 14 100 105 10.06 0.86

D20 ACCCGGTCAC 70 37 8 8 100 63 6.04 0.82

N6 GAGACGCACA 60 37 10 10 100 60 5.7 0.89

N16 AAGCGACCTG 60 37 9 9 100 51 4.88 0.92

TNL: Total no. of loci, NPL: No. of polymorphic loci, PPL: Percentage of polymorphic loci, TNFA: Total no. of fragments amplified, RP:

Resolving power, PIC: Polymorphic information content.

107

Table-4.2.2: List of primers used for ISSR amplification, GC content, total number of loci, the level of polymorphism,


Primer Primer sequence % GC

content

Annealing

Temperature

(in 0 C)

TNL NPL (%)

PPL TNFA Rp PIC

(CAA)5 CAA CAA CAA CAA CAA 33.3 35 5 5 100 26 2.48 0.93

(GGA)4 GGA GGA GGA GGA 66.6 35 8 8 100 36 3.46 0.95

(GA)9T GAGAGAGAGAGAGAGAGAT 42.8 51 14 14 100 98 9.36 0.85

(GTGC)4 GTGC GTGC GTGC GTGC 75 51 12 12 100 78 7.44 0.88

(GTG)5 GTG GTG GTG GTG GTG 66.6 45 7 7 100 39 3.7 0.9

(GAC)5 GAC GAC GAC GAC GAC 66.6 45 10 10 100 63 6.04 0.9

(AGG)6 AGG AGG AGGAGGAGGAGG 66 55 7 7 100 41 3.94 0.92

(GACA)4 GACA GACA GACA GACA 50 43 9 9 100 51 3.74 0.89

(TA)8G TA TA TA TA TA TA TA TA G 6.25 36 7 7 100 24 2.26 0.97

(AG)8T AG AG AG AG AG AGAGAGT 47.05 50 7 7 100 27 2.56 0.96

(GA)8T GA GA GA GA GA GAGAGAT 47.05 50 14 14 100 85 8.06 0.89

(GT)8T GT GT GT GT GT GT GT GT T 47.05 50 8 8 100 45 3.16 0.87

T(GA)9 TGAGAGAGAGAGAGAGAGA 47.4 51 10 10 100 64 6.1 0.86

TNL: Total no. of loci, NPL: No. of polymorphic loci, PPL: Percentage of polymorphic loci, TNFA: Total no. of fragments amplified, RP:

Resolving power, PIC: Polymorphic information content.

108

Table 4.2.3: List of primers used for SSR amplification, GC content, total number of loci, the level of polymorphism, resolving power and PIC value.


content

Annealing

Temperature

(in 0 C)

TNL NPL (%) PPL TNFA Rp PIC

SSR1 F: ATG AAC CCC TTC GGT CAC C

R: TGT AAC TCC TCT CGC CGT ATG 55 50 15 15 100 90 8.6 0.88

SSR2 F: CCA AGT GCC CTA TCC TAA CA

R: CCT GGA AAC CTG AAT CCA TTA 46.3 50 27 27 100 153 14.6 0.91

SSR5 F: ACA GCA CTC AAC AAC AGG AGA

R:CCT GGA AAC CTG AAT CCA TTA 45.2 50 21 21 100 101 9.66 0.94

SSR7 F: GTA GCT CAC CTC TGC AAT CCT

R:CTG CCT CCT CCA GTG TTC CTA 54.7 51 22 22 100 99 9.44 0.95

SSR9 F: TCT GGT GCG GAA AGT TAG GAT

R: GGA GGC ACA TAA ACC AGT TCT 47.6 50 21 21 100 77 7.28 0.97

SSR10 F: ACT GTC GAA GCG TAC ATC CC

R: CTT GAA CTC GCT GAA GTC CAC 53.6 51 20 20 100 127 12.1 0.88

SSR11 F: TTA ATC AAC CTG TAG CCG CC

R:TAC CAA AAT GGA AGG AGT GGA 46.3 50 12 12 100 42 3.96 0.97

SSR12 F: AGC AAG GAC CAA ACC ACT CTC

R: CGC GCT CTA GGA CGA GTT AAT 52.3 51 14 14 100 58 5.52 0.95

SSR13 F: TGC AGT CAA CTT TTA CAA CAC

R:GAC CCA ACT CAA GAA GGA AAT 40.4 50 5 5 100 33 3.12 0.78

SSR14 F: CTG CGG TCC AAG TAC AAG ATC

R:CTA GCT GGT GGC GGT GGT 61.5 54 34 34 100 188 17.86 0.91

SSR 18 F: CTT TTG GCT GAT AAA TGG AAG G

R: AAG AAA GAA CTG ACA TCC TCC G 44.1 49 10 10 100 59 5.6 0.9

TNL: Total no. of loci, NPL: No. of polymorphic loci, PPL: Percentage of polymorphic loci, TNFA: Total no. of fragments amplified, RP: Resolving power,

PIC: Polymorphic information content.

109

Table 4.2.4: List of primers used for sequence based marker amplification, GC content, total number of loci, the level of polymorphism,



content

Annealing

Temperature

(in 0 C)

TNL NPL (%) PPL TNFA Rp PIC

rbcL F: GGCAAAGAGGGAAGATTTCG

R: CCATAAGCATATCTTGAGTTGG 45.23 49 6 5 83.3 108 10.28 0.16

rpoC1 F: ATGCAACGTCAAGCAGTTCC

R: CCGTATGTGAAAAGAAGTATA 41.46 49 2 1 50 24 2.28 0.49

rpoB F: GTTCTAGCACAAGAAAGTCG

R: TAATTTACGATCAATTCATTC 34.14 49 3 2 66.6 30 2.86 0.63

matK F: ACTCGCACACACTCCCTTTCC

R: GCTTTTATGGAAGCTTTAACAAT 43.18 53 6 5 83.33 66 6.28 0.65

atpF-atpH F: TTAGCCTTTGTTTGGCAAG

R: AGAGTTTGAGAGTAAGCAT 39.47 49 4 4 100 42 4 0.74

psbK-pgbl F: GTAAAATCAAGTCCACCRCG

R: ATGTCACCACAAACAGAGACTAAAGC 43.47 53 4 2 50 57 5.42 0.41

trnH-psbA F: GTTATGCATGAACGTAATGCTC

R: CGCGCATGGTGGATTCACAATCC 48.88 53 4 1 25 66 6.28 0.24

TNL: Total no. of loci, NPL: No. of polymorphic loci, PPL: Percentage of polymorphic loci, TNFA: Total no. of fragments amplified, RP: Resolving

power, PIC: Polymorphic information conte

110

4.3. In vitro studies of target taxa

4.3.1. Establishment of tissue culture

Tissue culture is a potent method for multiplication and conservation of various

medicinal plant species and is considered as an alternative to conventional method of

conservation. Selected species of Alpinia and Kaempferia with high drug yielding

potential were established in culture for conservation and future improvement. Four

plant species, such as Alpinia galanga, Alpinia malaccensis, Kaempferia galanga and

Kaempferia rotunda have been successfully established in culture. The in vitro

responses of all species towards optimum requirements of growth regulators for shoot

multiplication are given in table (4.3.5).

4.3.1.1. Alpinia galanga

The axillary buds from unsprouted rhizomes were used as explants (Fig:4.3.1a) and

these were surface sterilised and inoculated on MS media containing different

combinations of BA (1-3 mg/L), Kin (2-3 mg/L), IAA (0.5-1.0 mg/L) and NAA (0.5-1.0

mg/L) (Table: 4.3.1). Effect of various plant growth regulators on the initiation of

shoots was observed (Fig: 4.3.1a &b). Of the various media tried, percentage of shoot

initiation was highest i.e., 82.5±1.03 in media containing only BA (3 mg/L) and NAA

(0.5 mg/L) (Table: 4.3.1). Explants sprouted on this medium within 7 days of

inoculation. Proliferations of shoots were observed in different growth regulators as

mentioned in Table: 4.3.1. Among the different media tried, percentage of shoot

multiplication from the explants was highest i.e., 86.2±0.32 in MS media containing BA

(3 mg/L) in combination with Kn (3 mg/L) and NAA (1 mg/L) (Table: 4.3.1).

Maximum number of shoots (12.4±0.50) and maximum number of roots (11.2±0.37)

(Fig: 4.3.1c&d) were also found in the same media (Table: 4.3.1). Percentage of shoot

initiation increased with increased concentration of BA. Addition of IBA and NAA had

not given better response. Multiplication of shoots (Fig: 4.3.1e) was more in media with

BA and kinetin as compared to that with only BA. Development of root was seen in the

same media. After 90 days of culture, micropropagated plantlets with shoots and roots

were potted in sterilized soil, cow dung and sand at 1:1:1 proportion. Then the plants

were kept in a greenhouse for a month for acclimatization. After being transferred to

field conditions, about 85% of plants survived effectively (Fig: 4.3.1f &g).

111

Fig. 4.3.1: Establishment of tissue culture in Alpinia galanga: a) & (b) Explants

showing shoot initiation from rhizome bud in A.galanga (c) & (d)

Regenerated plants of A.galanga with shoots and roots (e) In vitro

multiplication of plantlets. (f) Micropropagated plants of A.galanga

growing under field conditions (g) Flowering in micropropagated

plants.

112

Table 4.3.1: Effect of different growth regulators on in vitro shoot initiation and

shoot multiplication of Alpinia galanga on MS medium.

Sl

no

MS medium +

growth regulator

(mg/L)

% of shoot

initiation

(Mean ± SE)

% of shoot

multiplication

(Mean ± SE)

No of shoots/

explants

(Mean ± SE)

No of roots/

explants

(Mean±SE)

1 BA(1) 22.2±0.8 - - -

2 BA(2) 23.9±1.0 - - -

3 BA(2),IAA(0.5) 25.8±0.48 25.0±0.31 4.3±0.27 5.5±0.32

4 BA(2),IAA(1) 26.2±0.38 26.0±0.31 4.8±0.36 6.8±0.37

5 BA(3) 32.8±0.9 30.8±0.33 5.2±0.37 6.4±0.6

6 BA(3),NAA(0.5) 82.5±1.03 29.6±1.53 6±0.31 7.4±0.24

7 BA(3),NAA(1) 74.4±1.1 27.0±0.3 5.6±0.4 8.4±0.4

8 Kn(2) 44.4±1.0 10.5±0.64 4±0.31 5.6±0.24

9 Kn(3) 45.9±1.0 24.4±0.2 6.4±0.6 6.2±0.58

10 Kn(3),NAA(0.5) 50.36±0.8 35.2±0.3 7.4±0.24 9.2±0.2

11 Kn(3),NAA(1) 51.5±0.8 41.0±0.3 6.8±0.41 9.4±0.24

12 BA(3),Kn(3),

IAA(0.5) - 44.6±0.2 8±0.31 9.8±0.37

13 BA(3),Kn(3),

IAA(1) - 52.5±0.24 8.8±0.37 10.8±0.37

14 BA(3),Kn(3),

NAA(0.5) - 78.6±0.31 10.8±0.58 10.4±0.50

15 BA(3),Kn(3),

NAA(1)

- 86.2±0.32 12.4±0.50 11.2±0.37

4.3.1.2. Alpinia malaccensis

After surface sterilization, the axillary buds from unsprouted rhizomes of

conventionally grown Alpinia malaccensis were cultured as explants (Fig: 4.3.2a) on

MS media containing varying combinations of BA (1-4 mg/l), Kin (1-3 mg/l), IAA (0.5-

1.0 mg/l), IBA (0.5-1.0 mg/l) NAA (0.5-1.0 mg/l) and Ads (50-100 mg/l). Out of

various media used percentage of shoot initiation (Fig: 4.3.2a&b) was maximum i.e.,

84.8±0.62 in MS media containing BA (2 mg/l) in combination with Kn(1 mg/l) and

IBA (0.5 mg/l) (Table: 4.3.2). Explants sprouted on this medium within 20 days of

inoculation. Higher concentration of BA showed less response towards in vitro shoot

113

Fig. 4.3.2: Establishment of tissue culture in Alpinia malaccensis. (a) & (b)

Explants showing shoot initiation from rhizome bud. (c) Regenerated

plants of A.malaccensis with shoots and roots. (d) In vitro multiplication

of plantlets. (e) Potted plants. (f) Micropropagated plants growing

under field conditions (g) Flowering in micropropagated Plants.

114

initiation. Propagation of shoots was seen in various growth regulators as mentioned in

Table (4.3.2). Of the various combinations tried percentage of shoot multiplication from

the explants was highest i.e., 79.54±0.34 in MS liquid media containing BA (3 mg/l) in

with Kn (3 mg/l) and NAA (1 mg/l) (Table: 4.3.2). Maximum number of shoots

(9±0.31) was also found in the same media (Table: 4.3.2). Number of roots were highest

i.e. 6.92±0.86 in the media containing BA (3 mg/l) with IAA (1 mg/l) and Ads (50

mg/l). Percent of shoot initiation increased with addition of Kn and IBA. But addition of

more concentration of IBA beyond 0.5 mg/l did not give better response. Multiplication

of shoots (Fig: 4.3.2d) was more in liquid media as compared to solid media. Number of

roots was less as compared to number of shoots. In vitro grown plantlets (Fig: 4.3.2c)

with shoots and roots were potted in sterilized soil, cow dung and sand at 1:1:1

proportion after 90 days of culture (Fig: 4.3.2e). For acclimatization, the plants were

kept in a greenhouse for a month. After transferred to field conditions, about 95% of

plants survived successfully (Fig: 4.3.2f&g).

4.3.1.3. Kaempferia galanga

The rhizome buds of normally grown plants of Kaempferia galanga were used as

explants (Fig: 4.3.3a) and was inoculated on MS media with varying combinations of

BA (1-3 mg/l), IAA (0.5-1.0 mg/l), NAA (0.5 mg/l) and Ads (50-100 mg/l). Effect of

various hormones on the shoot initiation (Fig: 4.3.3b) from the rhizome bud was

observed. % of shoot initiation was highest i.e. 96.33±0.51 in media combination of BA

(1 mg/l) and IAA (0.5 mg/l) (Table: 4.3.3). The multiplication of shoot buds (Fig:

4.3.3d) was seen in almost all media given in the Table (4.3.3), but the rate of

multiplication was found maximum in BA (1 mg/l) and IAA (0.5 mg/l) combination

(Table: 4.3.3). Highest number of shoots i.e., 12.38±0.52 was found in same media with

BA (1 mg/l) and IAA (0.5 mg/l) and the shoots were rooted (Fig: 4.3.3c) on the same

media and the maximum number of roots was 9.98±0.35 (Table: 4.3.3). After

transferred to field conditions, about 95% of plants survived successfully (Fig:

4.3.2f&g). After 90 days of culture, micropropagated Kaempferia galanga plantlets

were potted in sterilized soil, cow dung and sand at 1:1:1 proportion (Fig: 4.3.3e). For

acclimatization, the plants were first kept in a greenhouse for a month and then in field

condition with 96% of survival rate (Fig: 4.3.3f&g).

115

Fig. 4.3.3: Establishment of tissue culture in Kaempferia galanga: (a) & (b)

Explants showing shoot initiation from rhizome bud in K.galanga (c)

Regenerated plants of K.galanga with shoots and roots (d) In vitro

multiplication of plantlets (e) Potted plants (f) Micropropagated plants

of K.galanga growing under field conditions (g) Flowering in

micropropagated plants.

116


shoot multiplication of Alpinia malaccensis on MS medium.

Sl

no

MS medium +

growth regulator

(mg/L)

% of shoot

initiation

(Mean ±SE)

% of shoot

multiplication

(Mean ± SE)

No of shoots/

explants

(Mean ± SE)

No of roots/

explants

(Mean±SE)

1 BA(1) 5.6±0.09 - - -

2 BA(2) 6.4±0.14 - - -

3 BA(3) 14.5±0.23 - - -

4 BA(4) 5.5±0.5 - - -

5 BA(2)IAA(0.5) 12.7±0.35 15.4±0.42 2.4±0.1 0±0.00

6 BA(2)IAA(1) 26.2±0.41 16.2±0.8 4.25±0.13 1±0.11

7 BA(2)IBA(0.5) 53.9±0.7 21.8±0.66 3.22±0.23 4.12±0.2

8 BA(2)IBA(1) 63.6±0.3 24.8±0.43 3.66±0.5 6.4±0.43

9 BA(2)Kn(1)IBA

(0.5) 84.8±0.62 27.0±0.13

5.8±0.33 5.2±0.15

10 BA(2)Kn(1)IBA

(1) 47.2±0.44 30.4±0.21

5.21±0.23 5.63±0.73

11 BA(3)IAA(1)Ads

(50) 54.5±0.37 31.2±0.31

7.87±0.34 6.92±0.86

12 BA(3)IAA(1)Ads

(100) 56.02±0.5 36.2±0.3

8.2±0.13 4.88±0.22

13 BA(3)Kn(3)IBA

(0.5) 64.58±0.52 50.6±0.62

7.4±0.4 5.69±0.35

14 BA(3)Kn(3)IBA (1) 67.2±0.64 56.2±0.73

8.2±0.13 4.88±0.22

15 BA(3)Kn(3)NAA

(0.5)

- 64.6±0.25

7.4±0.4 5.69±0.35

16 BA(3)Kn(3)NAA

(1)

- 79.54±0.34

9±0.31 6.18±0.5


shoot multiplication of Kaempferia galanga on MS medium

Sl

no

MS medium +

growth regulator

(mg/L)

% of shoot

initiation

(Mean ± SE)

% of shoot

multiplication

(Mean ± SE)

No of shoots/

explants

(Mean ± SE)

No of roots/

explants

(Mean±SE)

1 BA(1) 53.6±0.35 23.6±0.5 6.5±0.2 5.63±0.22

2 BA(2) 70.97±0.43 16.0±0.3 7.66±0.37 6.66±0.57

3 BA(3) 76.52±0.44 76.8±0.3 5.33±0.52 6.93±0.14

4 BA(1)IAA(0.5) 96.33±0.51 83.0±0.3 12.38±0.52 9.98±0.35

5 BA(3)IAA(0.5) 82.8±0.38 67.0±0.3 9.75±0.23 5.36±0.15

6 BA(3)IAA(1) 76.91±0.66 34.4±0.2 6.94±0.43 5.93±0.19

7 BA(3)IAA(0.5)

Ads(50) 71.57±0.37 35.2±0.3

5.86±0.32 6.66±0.56

8 BA(3)IAA(0.5)

Ads(100) 65.85±0.53 44.0±0.3

7.66±0.21 7.39±0.17

9 BA(3)IAA(1)

Ads(100) 63.46±0.71 40.6±0.2

8.54±0.2 5.44±0.15

10 BA(3)NAA(0.5) 74.97±0.26 46.2±0.3 7.33±1.52 6.83±1

117

Fig. 4.3.4: Establishment of tissue culture in Kaempferia rotunda: (a) & (b)

Explants showing shoot initiation from rhizome bud in K.rotunda. (c) &

(d) Regenerated plants of K.rotunda with shoots and roots. (e) In vitro

multiplication of plantlets. (f) Potted plants. (g) Micropropagated plants

of K.rotunda growing under field conditions

118

4.3.1.4. Kaempferia rotunda

Sprouted rhizome buds of Kaempferia rotunda were cultured as explants (Fig: 4.3.4a)

on MS media with different combinations of BA(1-3mg/l), IAA(0.5-1mg/l), NAA(0.5-

1mg/l) Kn (3mg/l) and Ads (50-100 mg/l) (Table: 4.3.4). Percentage of explants

forming shoot (Fig: 4.3.4b&c) was maximum in media with BA (3mg/l) and IAA

(0.5mg/l) i.e. 95.82±0.35 (Table: 4.3.4). Media with BA (3mg/l) and IAA (1 mg/l) was

optimum for in vitro shoot multiplication (Fig: 4.3.4e) with 84.4±0.35 percentage

(Table: 4.3.4). This medium was also found optimum for highest number of shoots

(15.3±0.23). Maximum number of roots (11.4±0.32) was found in media containing Kn

(3mg/l) and NAA (1 mg/l) (Table: 4.3.4). Media with Kn and NAA also effective for

shoot initiation and multiplication. Addition of Ads had not given better response. 90%

of plants survived on multiplication media resuming normal growth. Plantlets with well

developed shoot and roots (Fig: 4.3.4d) were then transferred to pots (Fig: 4.3.4f) and

grown in green house for one month to acclimatize the plants. After one month the

acclimatized plants were transferred to field and were established showing 90% of

survival rate (Fig: 4.3.4g).


shoot multiplication of Kaempferia rotunda on MS medium.

Sl

no

MS medium +

growth regulator

(mg/L)

% of shoot

initiation

(Mean ± SE)

% of shoot

multiplication

(Mean ± SE)

No of shoots/

explants

(Mean ± SE)

No of roots/

explants

(Mean±SE)

1 BA(1) 53.6±0.45 15.6±0.5 6.3±0.2 5.2±0.22

2 BA(1)IAA(0.5) 70.78±0.37 16.5±0.4 6.8±0.2 7.6±0.27

3 BA(2)IAA(0.5) 61.53±0.46 30.6±0.16 8.74±0.24 7.9±0.25

4 BA(3) 76.13±0.52 73.22±0.47 10.11±0.42 6.6±0.32

5 BA(3)IAA(0.5) 95.82±0.35 77.0±0.36 10.5±0.52 8.8±0.52

6 BA(3)IAA(1) 86.91±0.66 84.4±0.35 15.3±0.23 10.5±0.26

7 Kn(3)NAA(0.5) 71.87±0.57 35.2±0.38 8.8±0.35 7.7±0.28

8 Kn(3)NAA(1) 74.78±0.65 47.0±0.43 7.9±0.45 11.4±0.32

9 BA(3)Kn(3)NAA

(1) 63.84±0.72 49.6±0.52

10.7±0.25 10.5±0.5

10 BA(3)Kn(3)IAA

(1) 64.97±0.66 56.2±0.54

10.2±0.32 9.66±0.6

11 BA(3)IAA(1)Ads

(50) 74.55±0.95 51.4±0.72

9.1±0.21 5.74±0.43

12 BA(3)IAA(1)Ads

(100) 73.84±0.42 45.2±0.66

12.7±0.23 9.55±0.32

119

Table-4.3.5: Optimum requirement of growth regulators in MS media for shoot

multiplication in Alpinia and Kaempferia species.

Species Name Growth regulators

mg/L

Maximum number of shoots

per explants

(Mean ± SE)

A.galanga BA(3)+Kn(3)+NAA(1) 12.4±0.50

A.malaccensis BA(3)+Kn(3)+NAA(1) 9±0.31

K.galanga BA(1)+IAA(0.5) 12.38±0.52

K.rotunda BA(3)+IAA(1) 15.3±0.23

4.3.2. Assessment of genetic stability of regenerants

In the present study RAPD and ISSR analysis were used for evaluation of genetic

stability of in vitro grown plantlets of target species of Alpinia and two Kaempferia

analysed up to 3 years of culture at yearly interval.

4.3.2.1. Alpinia galanga

In Alpinia galanga, a total of 65 micropropagated plantlets (Fig: 4.3.5A)were analyzed

over a period of 3 years at 12 months intervals taking a minimum of 20 plants randomly

at each time. From total 15 ISSR primers, 10 primers produced 60 scorable bands

ranging from 300-1950 with an average of 6 bands per primer (Table: 4.3.6A). Total

number of 3900 bands [(number of plantlets analyzed) x (number of bands with all

primers)] were generated by the ISSR analysis and all were monomorphic in nature.

The number of bands varies from 4-8; highest i.e. 8 in primer (GA)9T ranging from

(300-1950 bp) and (GAC)5 ranging from (400-1550 bp) and lowest 4 in (GTG)5 (450-

1200 bp) and (GGA)4 (400-1050bp). ISSR analysis revealed that there was no

polymorphism among the tissue cultured plants (Fig: 4.3.5B). 9 selected RAPD primers

produced 44 scorable bands, ranging from 300 bp to 1800 bp in size (Table: 4.3.6B).

The number of bands for each primer varied from 1 to 9, with an average of 4.8 bands

per primer. Total number of 2860 bands [(number of plantlets analyzed) x (number of

bands with all primers)] produced by the RAPD techniques were shown monomorphic

patterns among all 65 plantlets analyzed. Number of monomorphic bands was highest

i.e. 8 in case of primer N16 (ranging from 400-1200 bp) and lowest i.e. 1 in case of

primer D20 (450 bp). There was no polymorphism among micropropagated plants in

this RAPD analysis (Fig. 4.3.5C).

120

Fig. 4.3.5: Micropropagated plantlets of Alpinia galanga(A) ISSR banding

pattern with primer T(GA)9 (B) RAPD banding pattern with primer

D20 (C) (M:Marker, C:Control, Lane 1-23:micropropagated plants)

121

4.3.2.2. Alpinia malaccensis

In Alpinia malaccensis, out of 15 ISSR primers 10 primers gave a total of 58 bands (ranging

from 200-2000 bp) which are all monomorphic in nature. Number of bands varied from 3-

10 bands with an average of.5.8 bands per primer. All the bands were monomorphic

showing no polymorphism (Fig: 4.3.6B) among 70 micropropagated plants (Fig: 4.3.6A)

analyzed up to 3 years of culture taken at yearly interval. Overall 4060 bands [(number of

plantlets analyzed) x (number of bands with all primers)] were produced by the ISSR

primers. Highest number of bands i.e. 10 in primer (GACA)4 (ranging from 400-1800 bp)

and lowest number of bands i.e. 3 in primers (AGG)6 (350-850 bp) and (GTG)5 (450-1200

bp) were amplified by ISSR analysis (Table: 4.3.7A). Out of 15 RAPD primers 9 selected

primers gave a total of 43 bands ranging from 300-2250 bp. Number of bands in all primers

varied from 1-9 with an average of 4.7 bands per primer. All the bands were monomorphic

showing no polymorphism among 70 plants analyzed (Fig: 4.3.6C). Number of

monomorphic band was highest i.e. 9 in primer N16 (ranging from 900-2250 bp) and lowest

i.e. 1 in primer A18 (1050 bp). Overall 3010 bands [(number of plantlets analyzed) x

(number of bands with all primers)] were produced by the RAPD analysis (Table: 4.3.7B).

Table 4.3.6 (A): ISSR banding pattern of micropropagated and field-grown

mother plants of Alpinia galanga

Primer Sequence Total no of

loci

Range of

amplicons [bp]

(CAA)5 CAACAACAACAACAA 7 350-1100

(GGA)4 GGAGGAGGAGGA 4 400-1050

(GA)9T GAGAGAGAGAGAGAGAGAT 8 300-1950

(GTGC)4 GTGCGTGCGTGCGTGC 6 350-875

(GTG)5 GTGGTGGTGGTGGTG 4 450-1200

(GAC)5 GACGACGACGACGAC 8 400-1550

(AGG)6 AGGAGGAGGAGGAGGAGG 5 350-950

(GACA)4 GACAGACAGACAGACA 7 400-1800

T(GA)9 TGAGAGAGAGAGAGAGAGA 6 450-1100

ISSR 15 TATATATATATATATAG 5 350-1050

Total 60

122

Table 4.3.6 (B): RAPD banding pattern of micropropagated and field-grown

mother plants of Alpinia galanga

Table-4.3.7 (A): ISSR banding pattern of micropropagated and field-grown

mother plants of Alpinia malaccensis.

Table-4.3.7(B): RAPD banding pattern of micropropagated and field-grown

mother plants of Alpinia malaccensis.

Primer Sequence Total no of loci Range of amplicons

[bp]

A10 GTGATCGCAG 5 600-1100

A11 CAATCGCCGT 7 300-1250

A18 AGGTGACCGT 3 350-1050

D8 GTGTGCCCCA 4 450-1600

A20 GTTGCGATCC 6 550-1500

D18 GAGAGCCAAC 6 400-1800

D20 ACCCGGTCAC 1 450

N6 GAGACGCACA 3 500-1050

N16 AAGCGACCTG 8 400-1200

Total 44

Primer Sequence Total bands Range of

amplicons [bp]











Total 58

Primer Sequence Total no of loci Range of amplicons

[bp]



A18 AGGTGACCGT 1 1050




D20 ACCCGGTCAC 2 800-1200



Total 43

123

Fig. 4.3.6 Micropropagated plantlets of Alpinia malaccensis (A), ISSR banding

pattern with primer (GA)9T (B), RAPD banding pattern with primer

D20 (C) (M:Marker, C:Control, Lane 1-23:micropropagated plants).

124

4.3.2.3. Kaempferia galanga

In Kaempferia galanga, in order to verify the genetic stability, total number of 68

micropropagated plantlets (Fig: 4.3.7A) were analyzed taking at least 20 plants at a

time. Both ISSR and RAPD analysis was carried out up to 3years with 12 months

interval. ISSR analysis generated 61 scorable bands by 9 primers ranging from 4-10

numbers of bands. Average bands per primer was 6.7, highest 10 in primer (GACA)4

(ranging from 400-1800 bp) and lowest 3 in primer T(GA)9 (ranging from 350-1000

bp) (Table: 4.3.8A). Overall, 4148 bands [(number of plantlets analyzed) x (number of

bands with all primers)] were produced by ISSR primers and all were monomorphic in

nature (Fig: 4.3.7B). In case of RAPD analysis, 9 out of 15 primers were amplified with

total 47 bands (Table: 4.3.8B). All generated bands i.e. 3196 [(number of plantlets

analyzed) x (number of bands with all primers)] were found monomorphic (Fig:

4.3.7C). The number of bands for each primer varies form 1-9, highest number of band

9 found in primers A11 (ranging from 300-1970 bp) and N16 (ranging from 600-2100

bp) and lowest as 1 in primer A18 (950 bp) (Table: 4.3.8B).


mother plants of K.galanga


amplicons [bp]











Total 61

125

Fig. 4.3.7 Micropropagated plantlets of Kaempferia galanga (A), ISSR banding

pattern with primer (GA) 9T (B), RAPD banding pattern with primer

D20(C) (M: Marker, C: Control, Lane 1-23: micropropagated plants)

126

Table 4.3.8 (B): RAPD banding pattern of micropropagated and field-grown

mother plants of K.galanga

4.3.2.4. Kaempferia rotunda

In Kaempferia rotunda, ISSR and RAPD analysis were carried out to test the genetic

integrity of micropropagated plants (Fig: 4.3.8A) at yearly interval up to 3 years. 66

regenerants were analysed taking minimum 20 plants each time. Out of 15 ISSR

primers 10 were amplified and gave 62 bands ranging from 3-10 with an average of 6.2

bands per primer (Table: 4.3.9A). Total 4092 bands [(number of plantlets analyzed) x

(number of bands with all primers)], produced by the ISSR analysis, were found

monomorphic in nature among all 66 plantlets analyzed. Number of monomorphic

bands was highest i.e. 10 in case of primers (GACA)4 (ranging from 400-800 bp in

size) and lowest i.e. 3 in case of primer (GTGC)4 (ranging from 380-1250 bp in size)

and primer (AGG)6 (350-850bp). All plantlets were found to be genetically uniform

showing absence of polymorphism (Fig: 4.3.8B).From 15 RAPD primers 9 primers

gave 47 scorable bands ranging from 300-1900 bp with an average of 5.2 per primers

(Table: 4.3.9B). Overall 3102 bands [(number of plantlets analyzed) x (number of bands

with all primers)] were generated. Highest number of bands was 8 in primer A10

(ranging from 480-1400 bp) and lowest 1 in primer N6 (900 bp). No RAPD

polymorphism was detected (Fig: 4.3.8C).

Primer Sequence Total bands Range of amplicons

[bp]










Total 47

127

Fig. 4.3.8 Micropropagated plantlets of Kaempferia rotunda (A), ISSR banding

pattern with primer T(GA)9 (B), RAPD banding pattern with primer

D20 (C) (M:Marker, C:Control, Lane 1-23:micropropagated plants)

128


mother plants of K.rotunda

Table4.3.9 (B): RAPD banding pattern of micropropagated and field-grown mother

plants of K.rotunda.


amplicons [bp]











Total 62

Primer Sequence Total bands Range of amplicons

[bp]








N6 GAGACGCACA 1 900


Total 47

Date post:	04-Mar-2020
Category:	Documents
Upload:	others
View:	10 times
Download:	1 times

Chapter: 4 Results - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/75359/15/15...61 4.1.1.2....

Documents