+ All Categories
Home > Documents > Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it...

Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it...

Date post: 01-Jan-2016
Category:
Upload: hannah-robbins
View: 220 times
Download: 0 times
Share this document with a friend
Popular Tags:
93
Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community College
Transcript
Page 1: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Chapter 5: DNA, Gene Expression, and Biotechnology

What is the genetic code, and how is it harnessed?

Lectures by Mark Manteuffel, St. Louis Community College

Page 2: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Learning Objectives

Describe what DNA is and what it does. Explain the process of gene expression

and the collaboration of nature and nurture.

Explain the causes and effects of damage to the genetic code.

Discuss biotechnology in agriculture. Describe biotechnology and its

implications for human health.

Page 3: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.1–5.5

DNA: what is it, and

what does it do?

Page 4: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.1 “The DNA 200”

Knowledge about DNA is increasing justice in the world.

Page 5: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.1

DNA is a molecule that all living organisms carry in every cell in their body.

Page 6: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.1

Unique in virtually every person, DNA can serve as an individual identifier, left behind us as we go about our lives.

This is a fact that is used increasingly to ensure greater justice in our society, such as through establishing the innocence of individuals wrongly convicted of crimes.

Page 7: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.2 The DNA molecule contains instructions for the development and functioning of all living organisms.

Page 8: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 9: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

DNA “Double Helix”

Nucleic acids and nucleotides

Page 10: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Sugars, Phosphates, and Bases

A, T, C, and GBase pairs

Page 11: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Which component of a DNA macromolecule will dictate instructions to the cell?

1. The order of sugars (ribose) in the DNA.

2. The order of phosphates in the DNA.3. The order of bases (A,G,T,C) in a DNA.4. All of the above

Page 12: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Which answer below will base pair with the DNA sequence below?TATTAGTAGGTTA

1. ATAATCATCCAAT2. AUAAUCAUCCAAU3. ATTGGATGATTAT4. TATTAGTAGGTTA

Page 13: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.2

DNA is a nucleic acid, a macromolecule that stores information.

It consists of individual units called nucleotides: a sugar, a phosphate group, and a nitrogen-containing base.

Page 14: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.2

DNA’s structure resembles a twisted ladder, with the sugar and phosphate groups serving as the backbones of the molecule and base pairs serving as the rungs.

Page 15: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.3 Genes are sections of DNA that contain instructions for making proteins.

Why is DNA considered the universal code for all

life on earth?

Page 16: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 17: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 18: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Genes

A sequence of bases in a DNA molecule that carries the information necessary for producing a functional product, usually a protein molecule or RNA

Page 19: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.3

DNA is a universal language that provides the instructions for building all the structures of all living organisms.

The full set of DNA an organism carries is called its genome.

Page 20: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.3

In prokaryotes, the DNA occurs in circular pieces.

In eukaryotes, the genome is divided among smaller, linear strands of DNA called chromosomes.

Page 21: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.3

A gene is a sequence of bases in a DNA molecule that carries the information necessary for producing a functional product, usually a protein molecule or RNA.

Page 22: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.4 Not all DNA contains instructions for making proteins.

Insert figure 5-8

Page 23: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

An onion has five times as much DNA as a human.

Why doesn’t that make them more complex than us?

Page 24: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

The proportion of the DNA that codes for genes

Page 25: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 26: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Introns

Non-coding regions of DNA

May take the form of short (or long) sequences that are repeated thousands of times

May also consist of gene fragments, duplicate versions of genes, and pseudogenes

Page 27: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.4

Only a small fraction of the DNA in eukaryotic species codes for genes.

• The function of the rest is still a mystery, although it may play a role in gene regulation.

Page 28: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.5 How do genes work?

An overview

Page 29: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Genotype•all of the genes contained in an

organism

Phenotype•the physical manifestations of the

instructions

Page 30: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 31: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.5

The genes in strands of DNA are a storehouse of information, an instruction book.

Page 32: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.5

The process by which this information is used to build an organism occurs in two main steps:

transcription, in which a copy of the gene’s base sequence is made, and

translation, in which that copy is used to direct the production of a protein.

Page 33: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.6–5.8

Building organisms:

information in DNA

directs the production of

the molecules that make

up an organism.

Page 34: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.6 Transcription: Reading the information coded in DNA

Page 35: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 36: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Which answer below represents the mRNA strand copied from the DNA strand below?TATTAGTAGGTTA

1. UAUUACUACCUUA2. AUAAUCAUCCAAU3. ATTGGATGATTAT4. ATAATCATCCAAT

Page 37: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.6

Transcription is the first step in the two-step process by which DNA directs the synthesis of proteins.

In transcription, a single copy of one specific gene within the DNA is made, in the form of a molecule of mRNA, which moves where it can be translated into a protein.

Page 38: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.7 In translation, the mRNA copy of the information from DNA is used to build functional molecules.

Page 39: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Several ingredients must be present in the cytoplasm for translation to occur.

Free amino acids

Ribosomal units

Transfer RNA

Page 40: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 41: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

The Genetic Code

Insert figure 5-14

Page 42: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-15

Page 43: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Translate the following mRNA sequence using the codon table from your book. AGGGAUGGCGAAACAACCA

1. Arginine-aspartate-glycine-glutamate-threonine -threonine

2. Methionine-alanine-lysine-glutamine-proline3. Threonine-asparigine-lysine-alanine-valine-

glycine4. Methionine-alanine-lysine-histidine-proline

Page 44: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.7

Translation is the second step in the two-step process by which DNA directs the synthesis of proteins.

In translation, the information from a gene that has been carried by the nucleotide sequence of an mRNA is read, and ingredients present in the cell’s cytoplasm are used to produce a protein.

Page 45: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert section 5.11-5.13 opener photo

5.11–5.13

Biotechnology is

producing

improvements in

agriculture.

Page 46: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Genetic Engineering

Adding, deleting, or transplanting genes from one organism to another, to alter the organisms in useful ways

5.11 What is biotechnology?

Page 47: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-24

Page 48: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-25

Page 49: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-26

Page 50: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-27

Page 51: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-28

Page 52: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-29

Page 53: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Which DNA probe below could be used for isolating bacteria that carry the following gene from a gene library?TTGACGTATTGCCTTGGAAGCGTA

1. TGCCTT2. ATGCGA3. ACTGCA4. TGACGT

Page 54: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.11

Biotechnology is the use of technology to modify organisms, cells, and their molecules to achieve practical benefits.

Page 55: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.11

Modern molecular methods make it possible to cut and copy DNA from one organism and deliver it to another.

Page 56: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.11

The methods rely on naturally occurring restriction enzymes for cutting DNA, the polymerase chain reaction for amplifying small amounts of DNA, inserting the DNA into bacterial or viral vectors, and cloning and identifying the cells with the transferred DNA of interest.

Page 57: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.12 Biotechnology can improve food nutrition and make farming more efficient and eco-friendly.

Insert figure 5-30

Page 58: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

How might a genetically modified plant help 500 million malnourished people?

Nutrient-rich “golden rice”

Page 59: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 60: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Almost everyone in the United States consumes genetically modified foods regularly without knowing it.

What foods are responsible for this?

Page 61: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Is there more genetically modified corn or genetically modified cotton produced in the United States?1. There is more genetically

modified cotton grown in the United States.

2. There is more genetically modified corn grown in the United States.

3. I don’t know the absolute amount of corn and cotton grown in the United States.

4. I don’t know because it is not clear how they calculated the percentages in the graph.

Page 62: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insect Resistance

Insert figure 5-33

Page 63: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

How can genetically modified plants lead to reduced pesticide use by farmers?

Page 64: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 65: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Herbicide Resistance

Page 66: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Faster Growth and Bigger Bodies

Page 67: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

When making Bt corn, the scientists inserted the Bt gene from ________ into the corn plant’s _______.

1. carrots……cells2. bacteria….genome3. carrots…..genome4. bacteria….cells

Page 68: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.12

Biotechnology has led to important improvements in agriculture by using transgenic plants and animals to produce more nutritious food.

Page 69: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.12

Even more significant is the extent to which biotechnology has reduced the environmental and financial costs of producing food through the creation of herbicide-

resistant and insect-resistant crops

Page 70: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.12

The ecological and health risks of such widespread use of transgenic species are not fully understood and are potentially great.

Page 71: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.13 Fears and risks: Are genetically modified foods safe?

Page 72: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Fear #1: Organisms that we want to kill may become invincible.

Fear #2: Organisms that we don’t want to kill may be killed inadvertently.

Fear #3: Genetically modified crops are not tested or regulated adequately.

Page 73: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Fear #4: Eating genetically modified foods is dangerous.

Fear #5: Loss of genetic diversity among crop plants is risky.

Fear #6: Hidden costs may reduce the financial advantages of genetically modified crops.

Page 74: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

We should continue to develop genetically modified organisms.1. Strongly agree2. Agree3. Neutral4. Disagree5. Strongly

disagree

Page 75: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.13 More and more genetically modified foods

are being created using modern methods of recombinant DNA technology.

Some legitimate fears among the public remain, however, about the safety of these foods given that their development relies on such new technology and about the long-term financial advantages they offer.

Page 76: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.14–5.17

Biotechnology

has the potential

for improving human

health (and criminal

justice)

Page 77: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.14 The treatment of diseases and production of medicines are improved with biotechnology

Prevent diseases

Cure diseases

Treating diseases

• The treatment of diabetes

Page 78: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-39

Page 79: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Why do some bacteria produce human insulin?

Recombinant DNA technology

Page 80: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.14

Biotechnology has led to some notable successes in treating diseases, usually by producing medicines more efficiently and more effectively than they can be produced with traditional methods.

Page 81: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.16 Cloning—ranging from genes to organs to individuals—offers both promise and perils

Page 82: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 83: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.
Page 84: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Are there any medical justifications for cloning?

Page 85: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

We should pursue cloning in animals but not humans.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80

81 82 83 84 85 86 87

1. Strongly agree2. Agree3. Neutral4. Disagree5. Strongly

disagree

Page 86: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

We should pursue cloning in humans for the purpose of developing or performing medical treatments.1. Strongly agree2. Agree3. Neutral4. Disagree5. Strongly disagree

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80

81 82 83 84 85 86 87 88

Page 87: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.16

Cloning of individuals has potential benefits in agriculture and medicine, but ethical questions linger.

Page 88: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

5.17 DNA as an individual identifier: the uses and abuses of DNA fingerprinting

Page 89: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-45c

Page 90: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Insert figure 5-46

Page 91: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

DNA samples were collected from a crime scene and from three suspects. DNA fragments were analyzed using electrophoresis. Using the DNA fingerprint information below, determine which suspect was present at the crime scene.

1. Suspect #12. Suspect #23. Suspect #34. All of the

above.

CrimeScene

Suspect #1

Suspect #2

Suspect #3

Page 92: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

What is a DNA fingerprint?

Page 93: Chapter 5: DNA, Gene Expression, and Biotechnology What is the genetic code, and how is it harnessed? Lectures by Mark Manteuffel, St. Louis Community.

Take-home message 5.17

Comparisons of highly variable DNA regions have forensic value in identifying tissue specimens and determining the individual from whom they came.


Recommended