Chapter4 ROLE OF GLYCOSYLATION IN THE ACTIVITY OF...

Chapter4

ROLE OF GLYCOSYLATION IN THE ACTIVITY OF HUMAN

PANCREATIC RIBONUCLEASE

uman pancreatic ribonuclease (HPR), is a glycosylated

protein and has three Asn-X-Thr/Ser carbohydrate !

~ ..-:_attachment sites (Asn 34, Asn 76 and Asn 88) that present a

different glycosylation pattern depending on the organ or fluid analyzed. Pancreatic

type RNase from urine has each of the three sites glycosylated with complex type

oligosaccharide chains (Beintema, et a!., 1988), whereas HPR purified from pancreas

has carbohydrates attached to Asn 34 and is only partially glycosylated at the other

two positions. A significant degree of microheterogeneity in the carbohydrate moiety

is observed among the glycosylated ribonucleases (Ribo, et al., 1994). Differences are

also observed in RNases from pancreatic juice (Thomas, eta!., 1984), seminal plasma

(De Prisco, et al., 1984) and kidney (Mizuta, et al., 1990).

The heterologous expression of HPR using recombinant methods has been

reported by different groups using prokaryotic or eukaryotic systems. Futami, et al.,

Expression of glycosylated HP R

(1995) described the expression of HPR in E. coli and its purification with a yield of

1.2 mg/L culture and a purity of 95 .5%. Boix, eta!., (1996) reported the expression of

HPR and its N-terminal variants together with onconase with recoveries of 10-50 mg

recombinant protein per liter of culture. A comparison of the expression of

recombinant HPR between Saccharomyces cerevisiae and E. coli was reported by

Ribo, et al., (1996). They obtained 5-10 fold more protein with the latter than the

former expression system. The E. coli system allowed the production of about lmg of

protein per liter of culture. Finally, our laboratory has reported a yield for HPR of 30-

50 mg/L culture using an E. coli expression system (Bal and Batra, 1997). The

expression of HPR in an eukaryotic expression system was done by Russo, et al.,

(1993). They reported the stable expression of an HPR variant lacking the last C

terminal amino acid (Thr), in chinese hamster ovary (CHO) cells. After its purification

they obtained a yield of 3-5 mg of a mixture of glycosylated and non-glycosylated

HPR per litre of culture. It is quite apparent that the yields of the recombinant proteins

expressed in the prokaryotic expression system are much higher than that obtained

from eukaryotic expression systems. However, the proteins expressed in the

prokaryotes are non-glycosylated.

The aim of this project was to study the effect of carbohydrate moieties on the

ribonucleolytic activity of HPR. In order to obtain the glycosylated form of HPR, the

baculovirus expression system was chosen. Baculoviruses are a diverse group of

viruses found mostly in insects. They are not known to have any non-arthropod hosts.

The baculo portion of the name refers to the rod shaped capsids of the virus particles.

Baculovirus capsids are usually 40-50 nm in diameter and 200-400 nm in length

(Harrap, 1972). The length of the capsids cari extend to accommodate larger DNA

genomes such as those of recombinant viruses carrying large inserts (Fraser, 1986).

Within the capsid, the DNA is condensed into a nucleoprotein structure known as the

core (Tweeten, et al., 1980). The capsid plus the core are collectively referred to as the

nucleocapsid. The DNA genome of a baculovirus is double stranded, covalently

closed and circular (Summers and Anderson, 1972). The two baculoviruses commonly

used for expression vector work are Autographa californica nuclear polyhedrosis

virus (AcMNPV) and the silkworm virus, Bombyx mori nuclear polyhedrosis virus

(BmNPV). The DNA ofboth the viruses are approximately 130 Kbp long.

The biology of the infection process in insect larvae underlies the utility of

91


baculoviruses as expression vectors (Miller, 1981). During normal infection the virus

produces nuclear inclusion bodies which consists of virus particles embedded in a

protein matrix, the major component of which is a virus encoded protein called

polyhedrin. Large amounts of virus and polyhedrin are produced. Transcription of the

polyhedrin gene is driven by an extremely active promoter, which is therefore ideally

suited for driving expression of foreign genes. This is all the more attractive because

the polyhedrin gene product is not essential for viral replication. However, even in cell

· culture, the polyhedrin gene (polh) is expressed at very high levels during a separate

and final phase of infection. Thus, the basic design of the first baculovirus gene

expression vectors was replacement of polh with the heterologous gene under

polyhedrin promoter control (Miller, et al., 1983; Smith, et al., 1983). One advantage

of substituting the heterologous gene in place of polh is that such recombinant viruses

replicate normally as wild type baculovirus in cell culture and can be distinguished

visually from wild type virus by their occlusion negative (occ-) phenotype. Such occ

recombinant viruses are not efficient at infecting larvae by the natural oral route of

infection and do not persist in the environment. These features have some benefits

from environmental and recombinant DNA safety perspectives (Miller, 1981 ).

Using a eukaryotic system for expressing a gene can be particularly important

in obtaining biologically active proteins. The insect baculovirus expression system

provides a eukaryotic environment that is generally conducive to proper folding,

disulfide bond formation, oligomerisation, and/or other post translational

modifications required for the biological activity of some eukaryotic proteins. The

post-translational modifications that have been reported to occur in baculovirus

infected insect cells include signal cleavage, proteolytic cleavage, N-glycosylation, 0-

glycosylation, acylation, amidation, phosphorylation, prenylation, and

carboxymethylation. The sites of such modifications are usually at identical positions

on the proteins produced in mammalian cells. In general, the insect baculovirus

expression system mimics a vertebrate cell system quite remarkably with regard to

protein post-translational modifications.

The most distinguishing feature of the baculovirus expression vectors is the

potential for a very strong expression of a heterologous gene. The highest expression

levels reported using the baculovirus expression vectors is 25-50% of the total cellular

protein. Such levels are equivalent to polh expression and correspond to

92


approximately 1 gram of protein product per liter culture. All heterologous proteins

however are not produced at the same level as polyhedrin and levels approaching 25%

of the total cellular protein have been achieved in few cases. Most of these cases

involved expression of structural genes of other virus families, the products of which

are quite stable. On comparing different eukaryotic expression systems, the

baculovirus system has usually outperformed the other expression systems in overall

protein production. Yields of a heterologous gene product must be determined

empirically as it is difficult to provide any guidelines for how a gene will behave in

the expression system unless similar genes have been expressed previously. In this

study, an attempt has been made to express the glycosylated form of HPR using the

baculovirus expression system, in order to elucidate the effect of sugar moieties on the

structure and function of the human ribonuclease.

Experimental Procedures

Construction of the recombinant baculovirus

The AcMNPV genome is a double stranded circular DNA of 128 kb. The size

of the viral DNA makes it difficult to manipulate directly, so the recombinant

baculovirus expression vectors was constructed in two steps. The target DNA

encoding HPR was first cloned into the modified viral polyhedrin locus of the

baculoviral transfer vector BacPak8 (Figure 4.1A). In order to do so, the BamHI and

EcoRI sites in the MCS of the BacPak8 vector were used. A BamHI site was

introduced at the 5' end of HPR gene by PCR using the forward primer JKB7,

5'GAAGGAGATATAGGATCCATGAAGGAATCCCGGGCCAAG3', the reverse

primer ERP, 5'TTATGCTAGTTATTGCTCAG3', and pHPR plasmid as template.

The amplified HPR fragment, having recognition sites for BamHI at the 5' end and

EcoRI at the 3' end, was digested with BamHI and EcoRI, purified by gel

electrophoresis, and cloned into BacPak8 vector restricted with the same enzymes.

The putative clones were confirmed by restriction analysis and DNA sequencing

(Sanger, 1977). The DNA was purified by using the Qiagen column kit (Qiagen Inc.,

USA).

In the second step, 2 x 106 exponentially growing Spodoptera frugiperda (Sf9)

insect cells were seeded in a volume of 2 ml of complete Grace's insect medium in

93

Figure 4.1

A. pBacPak8 transfer vector used for introducing HPR DNA in the viral genome

B. pBacPak6 viral DNA

BacPak6 137 kb

pBacPak8 5.5kb

Bsu36 I

PPolyhedrin

Stu I BstBI

Xbal Bg/11

Kpnl

Sac I £coR!

C. pBacPak-HPR

BacPak HPR

BamHI

£coR!

The target HPR gene was inserted in the BamH I and EcoRI sites in the MCS placed between the polyhedrin promoter and polyadenylation signals in BacPak8 transfer vector (A). The BacPak6 vector(B) is a specially engineered virus, which facilitates the construction and selection of recombinant expression vectors. pBacPak-HPR (C) represents the recombinant viral vector containing HPR DNA.


two 35 mm tissue culture dishes and incubated at 27°C for 1 hour. The medium was

replaced with 2 ml of Grace's insect cell medium (without serum) and further

incubated for 30 minutes at room temperature. The modified transfer vector BacPak8

containing the HPR gene and Bsu36I-digested linearized BacPak6 viral DNA (Figure

4.1B) were then cotransfected into Sf9 cells using Bacfectin. The BacPak6 is a

specially engineered virus, which facilitates the construction and selection of

recombinant expression vectors.

The transfection mixture was prepared as follows:

Sterile water

BacPak8 transfer vector (20 ng/j.tl)

BacPak6 viral DNA(Bsu36I digest)

Bacfectin

Total

66 j.tl

25 j.tl

', 5 j.tl

4 j.tl

100 j.tl

A control transfection was also done in which BacPak6 viral DNA was not

added. The cells were incubated with the Bacfectin-DNA mixture at 27°C for 5 hours

after which complete medium was added to the dish and further incubation was done

at 27°C for 72 hours. The recombinant HPR baculovirus with the HPR DNA inserted

in its genome is named as pBacPak-HPR (Figure 4.1C). After 72 hours, the medium

containing pBacPak-HPR viruses produced by the transfected cells was transferred to

a sterile container and stored at 4°C. In order to obtain more pBacPak-HPR virus, 1.5

ml of complete insect cell medium was added to each dish, incubated at 27°C for 48

hours and medium was harvested as mentioned above.

Plaque Purification of recombinant pBacPak-HPR virus

Spodoptera frugiperda (Sf9) insect cells were seeded in 35 mm tissue culture

dishes at a density of 2x 106 exponentially growing cells in a volume of 2 ml and

incubated at 27°C for 1 hour. Several dilutions, ranging from 10-1 to 10-7 of the

pBacPak-HPR stocks were prepared in the Grace's insect cell medium, added to the

cell monolayers and incubated at room temperature for 90 minutes. After incubation,

the cells were overlayed with 2 ml of agarose, which was prepared by mixing equal

94


volume of 3% LGT agarose and complete Grace's insect cell medium at 45°C. The

agarose was allowed to cool after which 1ml of insect cell medium was added on top.

The cells were further incubated at 27°C for 72 hours. After incubation, the liquid

medium was removed from top of the agarose overlay and petridish was dried by

placing it in an inverted position on a paper towel. After drying, 2 ml of neutral red

staining solution (1.2 ml of neutral red in 20 ml plaque assay buffer) was added in the·

petridishes and incubated for 2 hours at room temperature. Thereafter the stain was

drained off and the petridishes were kept inverted overnight for the plaques to become

well formed. The recombinant plaques were scored on the basis of differential

refraction (due to occ- phenotype) by placing it on top of an illuminated box. The

plaques were observed under the light microscope. The occ- plaques appear clear with

some cell debris, while the occ + plaques show polyhedrin that becomes apparent due

to their bright and shiny appearance. The plaques were picked by gentle suction using

a pipet. The agarose plugs picked were placed in 1ml of Grace's insect cell medium

and vortexed well to release the budded virus particles from the plug. These isolates .

were further screened by DNA hybridization analysis.

Identification of recombinant pBacPak-HPR virus by DNA hybridization

The DNA hybridization identifies virus isolates that contain the heterologous

gene integrated into their genomes. A 96 well plate was seeded with 1.5 x 106 Sf9

cells/ well. The cells were infected in duplicate with the putative recombinant

pBacPak-HPR viruses identified by visual screening in the plaque assay and incubated

at 27°C for 72 hours. This time period allowed sufficient viral replication to give rise

to a strong hybridization signal without allowing the infection to proceed to the point

where all the cells lyse and the DNA is lost in the tissue culture fluid. The pBacPak

HPR viral supernatants were removed and stored. The infected cells were lysed and

the DNA was denatured by adding 200 Ill of 0.5 M NaOH and 20 Ill of 10 M

ammonium acetate. The celllysates containing the viral and chromosomal DNA were

applied to the nylon membrane using a dot blot apparatus. The membrane was then

rinsed in 2X SSC for several minutes, air dried and baked under vacuum at 80°C for 2

hours.

The radioactive probe for detecting the HPR DNA in the genome of the

recombinant pBacPak-HPR virus was prepared by random primer labeling, using the

95


Rediprime DNA labeling system (Amersham Pharmacia Biotech, U.K). This kit

includes reaction tubes consisting of a pre-mix of the nucleotide stocks, random

primers, and Klenow fragment of E.coli DNA polymerase I. The HPR DNA obtained

by restriction digestion of the pHPR plasmid with Nhel and EcoRI was used for

preparing the DNA probe. [a-32P]deTP (NEN) was used to label the probe. The

labeling reaction was set up by dissolving 25 ng of HPR DNA in 45 J.!l Tris-EDTA

buffer, pH 7.5, and further denaturing it by boiling for 5 minutes. The denatured DNA

was immediately cooled on ice for five minutes and centrifuged briefly. The DNA was

added to the pre-mix reaction tube. Further, 5 J.!l of 32P-deTP was added to the

reaction mix and incubated at 37°e for 10 minutes. The labeling reaction was stopped

by adding 5 J.!l of 0.20 M EDT A.

The nylon membrane with the transferred viral DNA was prehybridised for 1

hour at 42°e in a heat sealable plastic bag, to reduce the spurious background signals.

The probe was denatured and added to the bag containing the filter and hybridization

solution and further incubated at 42°e overnight. After incubation, the filter was

washed twice at 55°e with 2X sse, 0.1% SDS for 15-20 minutes and then with O.lX

sse, 0.1% SDS. The filter was dried and exposed to X ray film.

Amplification of the recombinant pBacPak-HPR virus

In order to generate large stocks of the potential recombinant pBacPak:-HPR

virus, viral infections were set up with a large number of cells in tissue culture flasks.

Sf9 cells were grown in 25 cm2 flasks to a confluency of 70% and the monolayer was

infected with 0.5 ml inoculum of the recombinant pBacPak-HPR virus purified by the

plaque assay and identified by DNA hybridization. The cells were incubated at room

temperature for one hour with gentle rocking. 5 ml of Grace's insect cell complete

medium was added to the cells and further incubation was done at 27°e for 5 days.

After incubation, the culture medium was collected and centrifuged at 1 OOOx g for 5

minutes at 4°e to remove cell debris. The supernatant containing the pBacPak-HPR

virus was stored at 4°e.

Characterization of recombinant HPR expression

The expression of recombinant HPR in the infected Sf9 cells was analyzed by

SDS-PAGE and Western blotting. Sf9 cells were seeded in 24 well plate and infected

96


with 100 J..Ll inoculum of the recombinant pBacPak-HPR as mentioned earlier. The

medium was aspirated and cells were harvested 24, 48 and 72 hours post-infection.

The harvested cells were lysed in 50 J..Ll of IX SDS gel-loading buffer. Uninfected Sf9

cells were used as a control and were processed similarly. Equal volume of each

sample was loaded on a 12.5% polyacrylamide gel and the proteins were visualized by

Coomassie blue staining. The expression of HPR protein was further analyzed by

Western blotting using anti-HPR antibody.

The HPR protein was localised in the virally infected Sf9 cells to check

whether the protein was being expressed in the soluble or insoluble form. The cells

· were harvested after infection and resuspended in 4 ml PBS. The cell suspension was

sonicated and centrifuged at 1 OO,OOOxg for 30 minutes. The supernatant was removed

and the pellet obtained was resuspended in 4 ml of 20 mM Tris-HCl buffer, pH 7.5,

containing O.lmM PMSF, 2% deoxycholate and 5 mM P-mercaptoethanol. The

suspension was further centrifuged at 1 OO,OOOxg for 30 minutes. The supernatant was

removed and the pellet was stored at -70 °C. At each stage, appropriate samples were

taken of both pellet and supernatant for SDS-PAGE and Western blot analysis.

In another experiment, the pellet was resuspended in 4 ml of 20 mM Tris-HCl

buffer, pH 7.5, containing 0.1mM PMSF and 2% deoxycholate (without 5mM P

mercaptoethanol). The suspension was centrifuged at 1 OO,OOOxg for 30 minutes. The

supernatant was removed and the pellet was solubilised in 2 ml of 6 M guanidine

hydrochloride (GnHCl) using a homogeniser. The pellet in GnHCl was further

incubated at room temperature for 2 hours with vigorous shaking and centrifuged at

1 OO,OOOx g for 30 minutes. The supernatant was removed and the pellet was stored at

-70 °C. The GnHCl supernatant was precipitated with TCA and resuspended in IX

SDS-gel loading buffer. At each stage, appropriate samples were taken of both pellet

and supernatant for SDS-PAGE and Western blot analysis.

Propagation of Sf9 cells in suspension culture

The Sf9 cells were grown in suspension in specially designed spinner flasks,

containing a teflon coated magnetic stir bar suspended from a glass. or stainless steel

rod that is driven from below by a magnetic stirrer. The suspension culture was set up

by adding 200 ml of Grace's insect cell complete medium to the spinner flask. The

medium was inoculated with Sf9 cells from two 70% confluent 75 cm2 flasks such

97


that the starting density was 3-4 x 105 cells/mi. It 'was further incubated at 27°C with

constant stirring at 60-80 RPM for 72 hours. Sf9 cells were pelleted and resuspended

in culture medium at a cell density of 106 cells/mi. The cells were infected with the

recombinant pBacPak-HPR at an MOl of 20 pfulcell and incubated at room

temperature for 1 hour with gentle shaking. The infected cells were returned to the

spinner flask and the volume was made up to 200 ml with Grace's insect cell

complete medium. The flask was incubated at 27°C with stirring for 72 hours. The

cells were harvested by centrifugation. The supernatant was filtered and stored as

working stock for the recombinant virus whereas the pelleted cells were further

processed for isolation of the recombinant HPR protein.

Isolation of the recombinant HPR protein

The cell pellet obtained on harvesting the infected Sf9 insect cells in the spinner

cultures was resuspended in PBS. The cell suspension was sonicated and centrifuged at

1 OO,OOOxg for 30 minutes. The supernatant was removed and the pellet obtained was

· dissolved in 6 M guanidine hydrochloride and incubated for 2 hours at room

temperature followed by centrifugation at 50,000 gat 4°C, for 30 min. The supernatant

containing the denatured protein was collected and the protein concentration was

adjusted to 10 mg/ml with 6 M guanidine hydrochloride. The denatured protein was

reduced by adding 65 mM dithioerythritol and incubated at room temperature for 2 hrs.

Renaturation was done by diluting the denatured and reduced protein 100-fold in the

refolding buffer. After incubating at l0°C for 36 hrs, the renatured material was

dialyzed against 20 mM Tris-HCl buffer (pH 7.4) containing 100 mM urea. The

renatured material was loaded on a 6 ml S-Sepharose column, and eluted using 70 ml

NaCl gradient 0-1 M in 20 mM Tris-HCl buffer (pH 7.4) using an FPLC system.

Relevant fractions were pooled, concentrated and purified to homogeneity by gel

filtration chromatography on a TSK 3000 column (LKB) in 50 mM PBS (pH 7.4).

Detection of carbohydrate moieties present in the baculovirus expressed HPR

The estimation of total carbohydrate content in the baculovirus expressed HPR

protein was performed by the phenol-sulfuric acid method. 200J.!l of phenol, 5%

wt/vol in water, was added to the sample protein or glucose standard. Concentrated

sulfuric acid, lml, was then added rapidly and directly to the solution surface without

98


touching sides of the tube. The solution was left undisturbed for 10 minutes at room

temperature after which it was vortexed vigorously. The sample was incubated at

room temperature for additional 30 minutes. The absorbance was measured at 490 nm.

The glycosylated protein phCG was used as a positive control in the assay, whereas

the E. coli expressed HPR protein was taken as negative control.

Results

Construction of the recombinant pBacPak-HPR baculovirus

The baculovirus genome is large (1 00-200 kbp) and usually contains one or

more recognition sites for known restriction endonucleases. When AcMNPV was

being developed as an expression vector, there were no restriction endonucleases that

lacked several recognition sites in this genome, so allelic replacement was adopted to

insert foreign genes in to the genome (Smith, et al., 1984; Pennock, et al., 1984;

Maeda, et al., 1985). Allelic replacement still remains the preferred method for

homologous gene insertion. Following the allelic replacement strategy, we inserted

DNA encoding HPR into a transfer plasmid BacPak8, so that it is downstream of the

required viral promoter and flanked on both sides by viral sequences that will target

the gene and promoter to the desired region in the viral genome. The BacPak8 transfer

vector contains a plasmid origin of replication and an antibiotic resistance gene for

propagation in E. coli (Figure 4.1A), but it is unable to replicate in insect cells. The

viral segment cloned into the transfer vector includes the entire polyhedrin locus with

flanking sequences, but the polyhedrin coding sequence has been deleted and replaced

with a polylinker containing multiple cloning site, MCS (Figure 4.1A). The target

HPR DNA was inserted in the MCS placed between the polyhedrin promoter and

polyadenylation signals.

The modified BacPak8 plasmid and the parental linearized BacPak6 viral

DNA were co-transfected into the Sf9 insect cells. The enzymes in the cells recombine

the DNAs. This primarily involves the homologous recombination and results in the

formation of the recombinant pBacPak-HPR baculovirus with the HPR DNA inserted

in the baculovirus genome (Figure 4.1C). The restriction ofBakPak6 viral DNA with

Bsu36I removes a fragment that includes a part of the essential gene, ORF 1629

99


(Figure 4.1B). The double recombination events restore the integrity of the essential

gene. The unrecombined large Bsu361 fragment of BacPak6 is unable to produce

viable viruses. This selection results in viral plaques containing recombinant

pBacPak-HPR viruses that have acquired the HPR DNA. The viral stocks, obtained

from the cotransfection experiment, contain the required recombinant virus mixed

with a large excess of non-recombinant and single crossover recombinant viruses. The

pBacPak-HPR virus was purified from cotransfection stocks by plaque purification.

The recombinant pBacPak-HPR virus· are identified based on the plaque phenotype,

occlusion body formation. This screening method is based on the fact that viruses that

lack a polyhedrin gene (polh) are incapable of forming occlusion bodies and,

therefore, form plaques that are visually distinguishable from wt ( occ +) virus plaques.

After repeated plaque assays, we picked sixteen plaques that on the basis of the

phenotype of occlusion body formation appeared to contain recombinant virus.

The presence of the HPR DNA in the genome of the recombinant pBacPak

HPR was confirmed by DNA hybridization. Out of the 16 recombinant viruses picked

on the basis of the occ- phenotype in the plaque assay, 11 were found to possess the

HPR DNA in their viral genome (Figure 4.2). Very high intensity signals were

observed for the viral DNA in lanes 15 and 16 (Figure 4.2), as these recombinant

viruses had undergone one round of amplification compared to the other positive

recombinant viruses shown in lanes 1, 2, 6, 7, 8, 10, 11, 12 and 13 (Figure 4.2). No

signal was observed in case of the uninfected Sf9 cells (Figure 4.2). Similarly, a very

weak signal was observed for the wild type baculovirus infected Sf9 cells (Figure 4.2).

The recombinant pBacPak-HPR viruses were amplified and stored as stocks at 4°C.

Expression and localization of HPR protein in virally infected Sf9 cells

The expression of the HPR was studied by infecting the Sf9 insect cells with

recombinant pBacPak-HPR at various time intervals. The total cell proteins were

isolated from the infected Sf9 cells 24, 48 and 72 hours post-infection and analyzed by

SDS-PAGE and subsequent Western blotting. As seen in Figure 4.3, the expression of

the HPR protein was found to gradually increase with time and was maximum at 72

hours post infection.

To localize the expressed recombinant protein in the virally infected Sf9 cells,

the total cell homogenate was fractionated into membrane and cytosolic fractions. The

100

1

Figure 4.2

Screening of putative recombinant baculovirus by DNA hybridization

2 3 4

Control (Sf9 cells)

5 6 7 8 9 10 11 12

"" duplicates

/

Control (wild type AcMnPV)

Sf9 cells were infected in duplicate ( 1-13) with the putative recombinant viruses, pBacPak-HPR, identified by visual screening in the plaque assay and incubated at 27°C for 72 hours. The infections set up in lanes 14-16 were done with recombinant viruses obtained after one round of amplification. The celllysates were applied to the nylon membrane using a dot blot apparatus and probed with labeled HPR DNA. The membrane was dried and exposed to X ray film.

Figure 4.3

Expression of the HPR in virally infected Sf9 cells at varying time intervals

66.2

40.0

31.0

21.5

14.4

HPR (E. coil)

24 hrs 48 hrs 72 hrs

Sf9 cells were seeded in 24 well plate and infected with 1 00~1 of the recombinant pBacPak-HPR virus. The medium was aspirated and cells were harvested 24, 48 and 72 hours post-infection. The expression ofHPR protein was analyzed by Western blotting using anti-HPR antibody.


protein was only found to be associated with the membrane fraction (Figure 4.4). To

solubilize the HPR protein, different agents such as 2% deoxycholate (DOC) with or

without P-mercaptoethanol CP-MSH) and 6 M GnHCl were used. As seen in Figure

4.4, the recombinant protein was not soluble in 2% DOC with or without P-MSH and

the protein remained in the pellet (Figure 4.4). However, the HPR protein was soluble

in 6 M GnHCI.

Preparation of HPR protein

To purify HPR protein in a significant amount, Sf9 insect cells were grown in

suspension spinner cultures and infected with HPR recombinant baculovirus at a MOl

of 20 pfulcell. The cells were harvested 72 hours post infection.

The total cell pellet from five spinner cultures (200ml each) was resuspended

in PBS with a tissue homogeniser. The cell suspension was centrifuged and the pellet

was solubilised in 6 M GnHCI. The solubilised protein was refolded by diluting the

protein 1:100 in L-Arginine rich buffer. Oxidized glutathione and dithioerythreitol

were added to help create a redox condition, to facilitate the disulfide bond formation.

The refolded protein after dialysis was purified by cation exchange chromatography

using S-Sepharose column. The fractions (2-1 0) eluted from the S-Sepharose cation

exchange column contained HPR protein, however the protein was not completely

pure and contained other contaminating proteins as shown in the Western blot in

Figure 4.5. The protein pool from S-Sepharose was further purified by gel filtration

chromatography. As can be seen in Figure 4.6, fractions 3-9 from the gel filtration

column contained HPR protein in a pure and homogenous form. The final yield of the

pure protein was low, and 470 f.lg of pure HPR protein was obtained from lliter of

spinner culture.

Structural characterization of the purified HPR protein

I. Secondary structure estimation of HPR using circular dichroism

The structural conformation of the HPR protein expressed in baculovirus

expression system was investigated by CD-spectral analysis. The CD-spectrum of the

baculovirus expressed protein in the far-UV region was compared with that of the

native protein expressed in E. coli. As shown in Figure 4.7, the HPR protein from

101

66.2

40.0

31.0

21.5

14.4

Figure 4.4

Localization of the expressed HPR protein in virally infected Sf9 cells

,-.._

::r:: r/l

:E ,-.._ I

::r:: co.. r/l + ,-.._ ~ u u Q

0 I 0 c:::l.. Q u ~ 0 0 ::r:: .9 ,-.._ + u

~ ..... - ~ u '<f. u '<f. ::r:: 0 ~ (.) Q ~ .9 0 N 0 N ~ - Q) rJ:: - 0

.._, 0

.._, 0 .._, c ll.. (.) - - -(.) G) ~

';f!. ~

';f!. ~ :E ~ - ~ rJ:: ~ ~ ~

~ Q) - - 1;j ~

0 N ~ N ~ \0 u .... .._, E

.._, E

.._, E

~ .0 "' - - .....

til 8 0 ~ G) ~ G) ~ G)

ll.. ..... G) - Q) 0.. Q) 0.. Q) 0.. ::r:: 0 :E

>. :::: :::: :::: E-< u ll.. r/l ll.. r/l ll.. r/l

..

~ +-HPR

The expressed HPR protein was localised in the virally infected Sf9 cells by fractionating total cell extracts into membrane and cytosolic fractions. Membrane fraction was further solubilised in various buffers as indicated.

Figure 4.5

Purification of HPR on S-Sepharose column

-~

~ -...._ (!)

0 0.. ~ --kj (!) Fraction number

'-" (.)

KDa

0::: -· ro 0... -0 1 2 3 4 5 6 7 ::c: E-<

66.2

40.0

31.0

21.5 +- HPR

14.4

Fraction number

KDa 8 9 10 11 12 13 14 15

66.2

40.0

31.0

21.5 +- HPR

14.4

The solubilized HPR protein after renaturation and dialysis was loaded on a cation exchange column, and eluted using a salt gradient. The fractions obtained were analyzed by Western blotting using an anti-HPR antibody.

Figure 4.6

Purification of HPR by gel filtration chromatography

K.Da

66.2

40.0

31.0

21.5

14.4

.KDa

66.2

40.0

31.0

21.5

14.4

HPR E. coli 1

7

Fraction number

2 3 4 5 6

..._ HPR

Fraction number

8 9 10 11

..._ HPR

The pool from ion-exchange chromatography was purified to homogeneity by gel filtration on a TSK gel filtration column. The fractions obtained were analyzed by Western blotting using an anti-HPR antibody.

Figure 4.7

Comparison of the CD Spectra ofHPR (E.colz) and HPR (Baculovirus)

2000~------------------~

0 0 ·-<.)

·~ :..::: ~ \

.§ ·-en

~ s:: ell (L)

~

HPR (E. coli)

HPR (Baculovirus)

-14000~--~--~--~--~--~ 200 210 220 230 240 250

Wavelength (nm)

Secondary structure estimation of HPR

Protein Helix Beta Turn Random

HPR (E.coli) 15.22 51.30 9.50 23.50

HPR (Baculovirus) 5.36 35.29 . 17.64 41.69

Far-UV spectra were acquired at a scan speed of 50 run/minute, with a sensitivity of 50 mdeg and a response time of 1 second. A cell of 1 em path was used to record the spectra of the dimer, which was averaged over 10 scans. The results are presented as mean residue ellipticity values.


E. coli appears to be compactly folded with an a+~ conformation, however, the

conformation of HPR protein expressed in baculovirus was found to be significantly

different. The secondary structure estimates, calculated using Yang's reference

parameters showed a dramatic decrease in the a-helical content of the HPR protein

expressed in baculovirus expression system (Figure 4. 7).

II. Detection of carbohydrate content in HPR

The total sugar present in the HPR protein expressed in the baculovirus

expression system was estimated using phenol-sulfuric acid method. Using glucose as

standard, the absorbance of varying concentrations of the test sample (5-50 j...Lg) and

controls was compared with that of the standard. The sugar content was 0.21 mg/mg

protein based on the glucose standard, which translates to 21% sugar in the

baculovirus expressed HPR. This is similar to the sugar content of 20% observed in

case of glycosylated ~hCG protein used as positive control. The E. coli expressed

HPR protein, used as negative control, showed no significant levels of sugar content.

Functional characterization of the purified HPR protein

The ribonuclease activity of the glycosylated HPR was assayed on four

different RNA substrates, poly(C), yeast tRNA, cCMP and poly(A):poly(U). The

glycosylated HPR was less active compared to the bacterially expressed enzyme on all

substrates. On the single stranded, pyrimidine homopolymer substrate, poly(C), the

HPR (baculovirus) displayed 18% activity compared to HPR (E. coli) (Table 4.1). On

yeast tRNA, the baculovirus HPR protein displayed 24% activity compared to HPR

(E. coli) (Table 4.1). The hydrolytic activity of HPR (baculovirus) was found to be

40% of that of HPR (E. coli) (Table 4.1 ). The ribonucleolytic activity of the HPR

(baculovirus) on the double stranded RNA substrate poly(A):poly(U) was only 12 %

activity of the HPR (E. coli) (Table 4.1 ).

Discussion

Human pancreatic ribonuclease, isolated from the human pancreas is a

glycosylated protein. Heterogeneity has been observed in the glycosylation pattern of

HPR. All human secretory RNases are products of the same gene, however they differ

in their post-translational processing. Several glycosylated forms of the human

102

Table 4.1

Catalytic activity of HPR expressed in baculovirus system

RNA substrate ~Absorbance/min./mg protein

HPR (E. colz) HPR (Baculovirus)

poly( C) 219166 (100) 40667 (18)

yeast tRNA 17750 (100) 4250 (24)

cCMP 0.41 (100) 0.17(41)

poly(A):poly(U) 413 (100) 48 (12)

Each substrate was incubated with different concentrations of baculovirus expressed HPR protein for 1 hour at 37°C. The undigested large molecular weight RNA was precipitated with perchloric acid and uranyl acetate on ice and removed by centrifugation. The acid soluble product was quantitated by measuring the absorbance at 260 nm.


ribonuclease with apparent molecular masses ranging from 14-40 kDa have been

isolated. The significance of glycosylation for the activity of the ribonuclease is not

well understood. Native HPR has been found to be a weaker enzyme compared to

RNase A. Since isolation of HPR from its native source has been a difficult issue,

detailed comparison of activity of recombinant HPR with that of native is not

available. It has been demonstrated that the non-glycosylated form of HPR, expressed

in E. coli, exhibits a very significant ribonucleolytic activity (Bal and Batra, 1997).

HPR exhibits a significant ribonuclease activity on double stranded RNA and it has

been speculated that the carbohydrate moieties may have a role in this activity on

double-stranded RNA (Libonati and Sorrentino, 1992). Extensively glycosylated

ribonucleases, like the enzymes from pig and horse pancreas, show a much higher

activity on double-stranded RNAs than similarly charged, carbohydrate-free RNases

under standard assay conditions of relatively high salt concentrations (Carsana, et al.,

1981). The glycosylated pig and horse pancreas RNases also show a larger

destabilizing effect on double-stranded-RNA, than that displayed by bovine RNase A

under these conditions (Carsana, et al., 1981). A partial enzymic removal of the

heterosaccharide side chains from pig and horse RNases reduces their degradative

activity on double-stranded RNA. These results are tentatively correlated with a

modification of the microenvironment of the enzyme protein caused by its extensive

glycosylation. The effect of sugar residues on the dsRNA cleavage activity of a

glycosylated ribonuclease is strictly dependent on the extent of glycosylation

(Carsana, et al., 1981 ). It was also demonstrated that the dsRNA cleavage activity of

the glycosylated form of human seminal RNase was greater than that of its non

glycosylated form (Sorrentino, et al., 1985). We used the baculovirus vector

expression system to produce the glycosylated form of HPR. The insect cell

baculovirus expression system is a popular means of expressing recombinant proteins.

The insect cell baculovirus system is also a promising tool for the expression of

heterologous glycoproteins because insect cells are capable of both N- and 0-linked

glycosylation. Proteins that are N-glycosylated in vertebrate cells are generally also

glycosylated in insect cells. The insect cell enzymes have the capacity to attach atleast

a Man9GlcNAc2 to the same sites recognized by vertebrate enzymes. Usually, the

Man9GlcNAc2 moiety is trimmed to shorter oligosaccharide structures, such as

Man3GlcNAc2, in both vertebrate and insect cells. In vertebrates, these shorter core

103


structures serve as the complex oligosaccharide synthesis involving further GlcNAc,

Gal, or sialic acid additions. In insect cells, this additional, complex oligosaccharide

synthesis does not appear to occur in many cases.

The expressed HPR protein could not be secreted and was localized in the

membrane fraction in an insoluble form. The insoluble protein was solubilised and

renatured in vitro. However, the yield of the glycosylated HPR protein was low. The

recombinant protein was found to be glycosylated and the sugar content was found to

be 21% on weight basis. This is similar to the carbohydrate content of HPR isolated

from human pancreas (Beintema, et al., 1984). The expressed glycosylated HPR

protein was significantly less active than the protein expressed in E. coli. This

difference in enzymatic activity appears to be the consequence of conformational

change in the glycosylated form of HPR, compared to the bacterially expressed

protein.

There have been similar reports of proteins such as calpain and thyroid

peroxidase, expressed in an insoluble form in the recombinant baculovirus infected

insect cells (Branca, et al., 1999; Gardas, et a!., 1999). Large amounts of human

muscle-specific calpain p94 protein has been reported to be produced in insect cells

psing recombinant baculovirus expression system, with most of the protein recovered

in an insoluble and catalytically inactive form (Branca, et a!., 1999). Similarly, the

high yield purification of full length recombinant human thyroid peroxidase (TPO)

was reported from baculovirus infected insect cells (Gardas, eta!., 1999). TPO is an

integral membrane protein that catalyses the biosynthesis of human thyroid hormone

from thyroglobulin. The recombinant TPO protein was also resistant to solubilization

in detergents and similar to baculovirus expressed HPR was found to be devoid of

enzymatic activity. The lack of enzymatic activity of TPO has been attributed to

structural changes in the protein backbone surrounding the haem. The human

eosinophil ribonucleases, ECP and EDN, have been expressed as active proteins using

the baculovirus expression system (Domachowske, et a!., 1998). Both these human

RNases were secreted in the culture medium.

104


The current study will be further extended to obtain a fully functional

glycosylated form of HPR, which should be useful in understanding the role of sugar

moieties in the catalytic activity of HPR.

105

Date post:	02-May-2019
Category:	Documents
Upload:	vankien
View:	216 times
Download:	0 times

Chapter4 ROLE OF GLYCOSYLATION IN THE ACTIVITY OF...

Documents