CHARACTERISATION OF THE ANF-Y FAMILY OF TRANSCRIPTION ... · Troy James Stephenson Bachelor of...

CHARACTERISATION OF THE TANF-Y

FAMILY OF TRANSCRIPTION FACTORS IN

WHEAT

Troy James Stephenson

Bachelor of Applied Science (Honours I)

Submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

Cell and Molecular Biosciences Discipline

Faculty of Science and Technology

Queensland University of Technology

2011

ii Characterisation of the TaNF-Y family of transcription factors in wheat

Keywords

Bread wheat, CCAAT-box, CCAAT-binding factor, Expression profile,

Flowering time, Gene regulation, Light response, Nuclear factor Y, Photosynthesis,

Phylogeny, Target gene, Transcriptional regulation, Triticum aestivum, Wheat.

iii Characterisation of the TaNF-Y family of transcription factors in wheat

Abstract

Light plays a unique role for plants as it is both a source of energy for growth

and a signal for development. Light captured by the pigments in the light harvesting

complexes is used to drive the synthesis of the chemical energy required for carbon

assimilation. The light perceived by photoreceptors activates effectors, such as

transcription factors (TFs), which modulate the expression of light-responsive genes.

Recently, it has been speculated that increasing the photosynthetic rate could further

improve the yield potential of three carbon (C3) crops such as wheat. However, little

is currently known about the transcriptional regulation of photosynthesis genes,

particularly in crop species. Nuclear factor Y (NF-Y) TF is a functionally diverse

regulator of growth and development in the model plant species, with demonstrated

roles in embryo development, stress response, flowering time and chloroplast

biogenesis. Furthermore, a light-responsive NF-Y binding site (CCAAT-box) is

present in the promoter of a spinach photosynthesis gene. As photosynthesis genes

are co-regulated by light and co-regulated genes typically have similar regulatory

elements in their promoters, it seems likely that other photosynthesis genes would

also have light-responsive CCAAT-boxes. This provided the impetus to investigate

the NF-Y TF in bread wheat. This thesis is focussed on wheat NF-Y members that

have roles in light-mediated gene regulation with an emphasis on their involvement

in the regulation of photosynthesis genes.

NF-Y is a heterotrimeric complex, comprised of the three subunits NF-YA,

NF-YB and NF-YC. Unlike the mammalian and yeast counterparts, each of the three

subunits is encoded by multiple genes in Arabidopsis. The initial step taken in this

study was the identification of the wheat NF-Y family (Chapter 3). A search of the

current wheat nucleotide sequence databases identified 37 NF-Y genes (10 NF-YA,

11 NF-YB, 14 NF-YC & 2 Dr1). Phylogenetic analysis revealed that each of the

three wheat NF-Y (TaNF-Y) subunit families could be divided into 4-5 clades based

on their conserved core regions. Outside of the core regions, eleven motifs were

identified to be conserved between Arabidopsis, rice and wheat NF-Y subunit

members. The expression profiles of TaNF-Y genes were constructed using

quantitative real-time polymerase chain reaction (RT-PCR). Some TaNF-Y subunit

iv Characterisation of the TaNF-Y family of transcription factors in wheat

members had little variation in their transcript levels among the organs, while others

displayed organ-predominant expression profiles, including those expressed mainly

in the photosynthetic organs.

To investigate their potential role in light-mediated gene regulation, the light

responsiveness of the TaNF-Y genes were examined (Chapters 4 and 5). Two TaNF-

YB and five TaNF-YC members were markedly upregulated by light in both the

wheat leaves and seedling shoots. To identify the potential target genes of the light-

upregulated NF-Y subunit members, a gene expression correlation analysis was

conducted using publically available Affymetrix Wheat Genome Array datasets. This

analysis revealed that the transcript expression levels of TaNF-YB3 and TaNF-YC11

were significantly correlated with those of photosynthesis genes. These correlated

express profiles were also observed in the quantitative RT-PCR dataset from wheat

plants grown under light and dark conditions. Sequence analysis of the promoters of

these wheat photosynthesis genes revealed that they were enriched with potential

NF-Y binding sites (CCAAT-box).

The potential role of TaNF-YB3 in the regulation of photosynthetic genes was

further investigated using a transgenic approach (Chapter 5). Transgenic wheat lines

constitutively expressing TaNF-YB3 were found to have significantly increased

expression levels of photosynthesis genes, including those encoding light harvesting

chlorophyll a/b-binding proteins, photosystem I reaction centre subunits, a

chloroplast ATP synthase subunit and glutamyl-tRNA reductase (GluTR). GluTR is

a rate-limiting enzyme in the chlorophyll biosynthesis pathway. In association with

the increased expression of the photosynthesis genes, the transgenic lines had a

higher leaf chlorophyll content, increased photosynthetic rate and had a more rapid

early growth rate compared to the wild-type wheat.

In addition to its role in the regulation of photosynthesis genes, TaNF-YB3

overexpression lines flower on average 2-days earlier than the wild-type (Chapter 6).

Quantitative RT-PCR analysis showed that there was a 13-fold increase in the

expression level of the floral integrator, TaFT. The transcript levels of other

downstream genes (TaFT2 and TaVRN1) were also increased in the transgenic lines.

Furthermore, the transcript levels of TaNF-YB3 were significantly correlated with

those of constans (CO), constans-like (COL) and timing of chlorophyll a/b-binding

v Characterisation of the TaNF-Y family of transcription factors in wheat

(CAB) expression 1 [TOC1; (CCT)] domain-containing proteins known to be

involved in the regulation of flowering time.

To summarise the key findings of this study, 37 NF-Y genes were identified in

the crop species wheat. An in depth analysis of TaNF-Y gene expression profiles

revealed that the potential role of some light-upregulated members was in the

regulation of photosynthetic genes. The involvement of TaNF-YB3 in the regulation

of photosynthesis genes was supported by data obtained from transgenic wheat lines

with increased constitutive expression of TaNF-YB3. The overexpression of TaNF-

YB3 in the transgenic lines revealed this NF-YB member is also involved in the fine-

tuning of flowering time. These data suggest that the NF-Y TF plays an important

role in light-mediated gene regulation in wheat.

vi Characterisation of the TaNF-Y family of transcription factors in wheat

List of Publications and Manuscripts

The following is a list of publications and manuscripts that have been prepared

in conjunction with this thesis.

Paper: 1

Authorship: Stephenson TJ, McIntyre CL, Collet C, Xue GP.

Year: 2007

Title: Genome-wide identification and expression analysis of the

NF-Y family of transcription factors in Triticum aestivum.

Journal: Plant Molecular Biology

Type: Research article

Volume: 65

Pages: 77-92

Paper: 2


Year: 2010

Title: TaNF-YC11, one of the light-upregulated NF-YC members in

Triticum aestivum, is co-regulated with photosynthesis-related

genes

Journal: Functional and Integrative Genomics


Volume: 10

Pages: 265-276

vii Characterisation of the TaNF-Y family of transcription factors in wheat

Paper: 3


Year: 2010

Title: TaNF-YB3 is involved in the regulation of photosynthesis

genes in Triticum aestivum

Journal: Functional and Integrative Genomics


Doi: 10.1007/s10142-011-0212-9

Paper: 4


Year: 2010

Title: TaNF-YB3 is involved in the regulation of flowering time

genes in Triticum aestivum


Status: Prepared

viii Characterisation of the TaNF-Y family of transcription factors in wheat

List of Abstracts and Presentations

Conference: 1

Name: AgriGenomics 2010

Location: Brussels, Belgium

Authorship: Stephenson TJ, McIntyre CL, Collet C, Xue GP

Abstract title: The role of a light-upregulated NF-YB member in

photosynthesis and development in Triticum aestivum

Type: Poster (Best poster award)

Conference: 2

Name: ComBio2009

Location: Christchurch, New Zealand


Abstract title: TaNF-YC members are potentially involved in the regulation

of photosynthesis-related genes in Triticum aestivum

Type: Oral

Conference: 3

Name: ComBio2008

Location: Canberra City, Australia


Abstract title: Genome-wide identification and expression analysis of the

NF-Y family of transcription factors in Triticum aestivum

Type: Poster

ix Characterisation of the TaNF-Y family of transcription factors in wheat

Table of Contents

Keywords ................................................................................................................................................... ii

Abstract ..................................................................................................................................................... iii

List of Publications and Manuscripts ........................................................................................................ vi

List of Abstracts and Presentations ........................................................................................................ viii

TABLE OF CONTENTS ...................................................................................................................... IX

List of Figures ......................................................................................................................................... xii

List of Tables ...........................................................................................................................................xiv

List of Abbreviations ................................................................................................................................ xv

Statement of Original Authorship ........................................................................................................ xxiv

Acknowledgments .................................................................................................................................. xxv

CHAPTER 1: AIMS AND OBJECTIVES ........................................................................................... 1

1.1 Description of scientific problem investigated .............................................................................. 1

1.2 Overall objectives of the study ....................................................................................................... 1

1.3 Specific aims of the study ............................................................................................................... 2

1.4 Account of scientific progress linking the scientific papers .......................................................... 2

1.5 References ....................................................................................................................................... 4

CHAPTER 2: LITERATURE REVIEW .............................................................................................. 7

2.1 Introduction ..................................................................................................................................... 7

2.2 Wheat yield and photosynthesis ..................................................................................................... 8 2.2.1 Triticum aestivum L. ........................................................................................................... 8 2.2.2 Yield limiting factors of photosynthesis ............................................................................. 9 2.2.3 The Photosynthetic Carbon Reduction Cycle ................................................................... 10

2.2.3.1 Ribulose-1,5-carboxylase/oxygenase ............................................................. 11 2.2.3.2 Sedoheptulose-1,7-bisphosphatase ................................................................. 12 2.2.3.3 Chloroplast fructose-1,6-bisphosphatase ....................................................... 13 2.2.3.4 Triose-phosphate utilisation ........................................................................... 13

2.2.4 The light reactions ............................................................................................................. 14 2.2.5 The xanthophyll cycle ....................................................................................................... 15

2.3 Light-regulated transcriptional networks ..................................................................................... 16 2.3.1 Photoreceptors ................................................................................................................... 17

2.3.1.1 Phytochromes .................................................................................................. 17 2.3.1.2 Cryptochromes ................................................................................................ 18 2.3.1.3 Phototropins .................................................................................................... 19 2.3.1.4 Zeitlupe ........................................................................................................... 20

2.3.2 Transcriptional regulation of photosynthesis genes ......................................................... 20 2.3.3 Flowering time genes and their regulation ....................................................................... 21 2.3.4 Transcription factors involved in light-mediated gene regulation ................................... 25

2.4 The NF-Y family .......................................................................................................................... 29 2.4.1 NF-Y transcription factor family in plants ....................................................................... 31 2.4.2 The NF-Y binding motif ................................................................................................... 31 2.4.3 Biological roles of NF-Y members in plants .................................................................... 32

2.5 References ..................................................................................................................................... 36

x Characterisation of the TaNF-Y family of transcription factors in wheat

CHAPTER 3: GENOME-WIDE IDENTIFICATION AND EXPRESSION ANALYSIS OF THE NF-Y FAMILY OF TRANSCRIPTION FACTORS IN TRITICUM AESTIVUM .............. 63

3.1 Statement of Joint Authorship ..................................................................................................... 63

3.2 Abstract ........................................................................................................................................ 64

3.3 Introduction .................................................................................................................................. 65

3.4 Materials and methods ................................................................................................................. 67 3.4.1 Database searches for TaNF-Y family members ............................................................. 67 3.4.2 Consensus logos ............................................................................................................... 68 3.4.3 Alignments and phylogenetic analysis ............................................................................. 68 3.4.4 Determination of conserved motifs .................................................................................. 69 3.4.5 Plant materials .................................................................................................................. 69 3.4.6 Preparation of total RNA and cDNA synthesis ............................................................... 69 3.4.7 Quantitative RT-PCR analysis ......................................................................................... 70 3.4.8 Statistical analysis ............................................................................................................ 71

3.5 Results .......................................................................................................................................... 71 3.5.1 Identification of NF-Y genes in Triticum aestivum ......................................................... 71 3.5.2 Conserved sequences in the NF-Y subunits..................................................................... 78 3.5.3 Phylogenetic analysis ....................................................................................................... 80 3.5.4 Expression profiles of the NF-Y gene family in wheat ................................................... 85 3.5.5 Correlation between the gene expression levels of TaNF-Y genes ................................. 89

3.6 Discussion .................................................................................................................................... 92

3.7 References .................................................................................................................................... 97

3.8 Supplementary Materials ........................................................................................................... 101

CHAPTER 4: TANF-YC11, ONE OF THE LIGHT-UPREGULATED NF-YC MEMBERS IN TRITICUM AESTIVUM, IS CO-REGULATED WITH PHOTOSYNTHESIS-RELATED GENES ...................................................................................................................................... 111

4.1 Statement of Joint Authorship ................................................................................................... 111

4.2 Abstract ...................................................................................................................................... 112

4.3 Introduction ................................................................................................................................ 113

4.4 Materials and methods ............................................................................................................... 115 4.4.1 Plant materials and treatments ........................................................................................ 115 4.4.2 Total RNA extraction and cDNA synthesis ................................................................... 115 4.4.3 Quantitative RT-PCR analysis ....................................................................................... 116 4.4.4 Identification of potential target genes using Affymetrix GeneChip® data

analysis and GO enrichment analysis ............................................................................ 116

4.5 Results ........................................................................................................................................ 117 4.5.1 Members of the TaNF-YC subunit family are upregulated by light ............................. 117 4.5.2 Genes that are correlated with TaNF-YC11 in Affymetrix datasets are enriched

with those involved in photosynthesis ........................................................................... 118 4.5.3 TaNF-YC11 co-expressed genes contain putative CCAAT motifs in the

promoters regions ........................................................................................................... 121 4.5.4 TaNF-YC11 co-expressed genes are upregulated by light in the leaf and seedling

shoot ................................................................................................................................ 125

4.6 Discussion .................................................................................................................................. 128

4.7 References .................................................................................................................................. 132

4.8 Supplementary Materials ........................................................................................................... 137

CHAPTER 5: TANF-YB3 IS INVOLVED IN THE REGULATION OF PHOTOSYNTHESIS GENES IN TRITICUM AESTIVUM ................................................................................................. 149

5.1 Statement of Joint Authorship ................................................................................................... 149

5.2 Abstract ...................................................................................................................................... 150

xi Characterisation of the TaNF-Y family of transcription factors in wheat

5.3 Introduction ................................................................................................................................. 151

5.4 Materials and methods ................................................................................................................ 153 5.4.1 Plant materials and treatments ........................................................................................ 153 5.4.2 Construction of TaNF-YB3 expression cassette ............................................................ 153 5.4.3 Wheat transformation ...................................................................................................... 154 5.4.4 Quantitative RT-PCR analysis ........................................................................................ 154 5.4.5 Identification of potential target genes Using Affymetrix GeneChip® data

analysis and Gene Ontology enrichment analysis .......................................................... 155 5.4.6 Chlorophyll content measurement .................................................................................. 155 5.4.7 Photosynthetic rate measurement ................................................................................... 156

5.5 Results ......................................................................................................................................... 156 5.5.1 Members of the TaNF-YB subunit family are upregulated by light .............................. 156 5.5.2 Genes that are correlated in expression with TaNF-YB3 in large scale expression

profiling datasets are enriched with those involved in photosynthesis .......................... 156 5.5.3 TaNF-YB3-coexpressed genes are upregulated by light in the leaf and seedling

shoots and their mRNA levels are positively correlated with TaNF-YB3 ..................... 161 5.5.4 Overexpression of TaNF-YB3 upregulates photosynthesis genes in Triticum

aestivum ........................................................................................................................... 165 5.5.5 Overexpression of TaNF-YB3 resulted in increased leaf chlorophyll content,

photosynthesis and early growth rate in Triticum aestivum ........................................... 167

5.6 Discussion ................................................................................................................................... 171

5.7 References ................................................................................................................................... 176

5.8 Supplementary Material ............................................................................................................. 181

CHAPTER 6: TANF-YB3 IS INVOLVED IN THE REGULATION OF FLOWERING TIME GENES IN TRITICUM AESTIVUM .................................................................................................. 185

6.1 Statement of Joint Authorship .................................................................................................... 185

6.2 Abstract ....................................................................................................................................... 186

6.3 Introduction ................................................................................................................................. 187

6.4 Materials and methods ................................................................................................................ 188 6.4.1 Plant materials and treatments ........................................................................................ 188 6.4.2 Quantitative RT-PCR analysis ........................................................................................ 188 6.4.3 Coexpression analysis using Affymetrix Wheat Genome Array datasets ..................... 189

6.5 Results ......................................................................................................................................... 189 6.5.1 Constitutive overexpression of TaNF-YB3 promoted early flowering in Triticum

aestivum ........................................................................................................................... 189 6.5.2 Overexpression of TaNF-YB3 increases flowering gene transcript levels in

Triticum aestivum ............................................................................................................ 190 6.5.3 TaNF-YB3 is significantly co-expressed with genes encoding CONSTANS and

CONSTANS-Like proteins ............................................................................................. 191

6.6 Discussion ................................................................................................................................... 193

6.7 References ................................................................................................................................... 195

CHAPTER 7: GENERAL DISCUSSION ......................................................................................... 199

7.1 Discussion ................................................................................................................................... 199

7.2 References ................................................................................................................................... 206

xii Characterisation of the TaNF-Y family of transcription factors in wheat

List of Figures

Figure 2.1. The Photosynthetic Carbon Reduction Cycle (PCRC) ....................................................... 10

Figure 2.2. The light reactions of photosynthesis .................................................................................. 15

Figure 2.3. The xanthophyll cycle .......................................................................................................... 17

Figure 2.4. Conserved domains of plant photoreceptors. ...................................................................... 19

Figure 2.5. Outline of flowering pathways in cereals ............................................................................ 25

Figure 2.6. A model of light-signalling during photomorphogenesis ................................................... 27

Figure 2.7. Superimposition of NF-YC/NF-YB (orange) and H2A/H2B (gray) histone pairs ............ 30

Figure 2.8. Leaves from OsHAP3A antisense and RNAi transgenic rice lines .................................... 33

Figure 3.1. Triticum aestivum TaNF-Y family protein sequence alignment ........................................ 74

Figure 3.2. Arabidopsis, rice, and wheat NF-Y subunit conserved core consensus sequence logos ........................................................................................................................................ 79

Figure 3.3. Motifs outside of the conserved NF-YA core domain ........................................................ 81

Figure 3.4. Motifs outside of the conserved NF-YB core domain ........................................................ 82

Figure 3.5. Motifs outside of the conserved NF-YC core domain ........................................................ 83

Figure 3.6. Phylogenetic trees of TaNF-Y subunit families .................................................................. 84

Figure 3.7. Expression profiles of NF-Y genes in wheat ...................................................................... 87

Figure 3.8. Changes in the mRNA levels of wheat NF-Y genes in the drought-stressed leaves .......... 90

Figure 3.9. Correlation in expression levels between TaNF-Y genes across six wheat organs ........... 91

Supplementary Figure 3.10. Phylogenetic trees of the NF-Y subunit families in Arabidopsis, rice and wheat ....................................................................................................................... 104

Figure 4.1. Changes in the mRNA levels of wheat NF-YC genes in the leaf and seedling shoot in response to dark and light growth-conditions ................................................................. 119

Figure 4.2. Plant light-responsive CCAAT-box in the promoters of photosynthetic genes and CCAAT-box in the promoters of TaNF-YC11-correlated genes ........................................ 124

Figure 4.3. Changes in the mRNA levels of TaNF-YC11 co-expressed genes in wheat leaves (A) and seedling shoots (B) in response to light ................................................................. 126

Supplementary Figure 4.4. Phylogenetic tree of the light-regulated NF-YC subunit members in wheat with the published NF-YC families in Arabidopsis and rice and two NF-YC members from tomato .................................................................................................... 147

Figure 5.2. Overexpression of TaNF-YB3 in transgenic wheat lines carrying the UbiNF-YB3 transgene ............................................................................................................................... 166

Figure 5.3. Expression levels of photosynthesis genes in Bobwhite controls and TaNF-YB3-overexpressing transgenic wheat lines ................................................................................. 168

Figure 5.4. The increased leaf chlorophyll content and photosynthetic rate in T2 TaNF-YB3 overexpressing transgenic wheat lines ................................................................................. 169

Figure 5.5. The increased early growth rate in T2 TaNF-YB3 overexpressing transgenic wheat lines ....................................................................................................................................... 170

Figure 6.1 Comparison in anthesis date between TaNF-YB3 overexpressing transgenic wheat lines at the T2 stage and non-transgenic wild-type control ................................................. 190

Figure 6.2 Expression levels of flowering time genes in transgenic wheat lines and wild-type controls ................................................................................................................................. 191

xiii Characterisation of the TaNF-Y family of transcription factors in wheat

Figure 6.3 Expression correlation chart between TaNF-YB3 and CO or COL genes (TaCO5, TaCOLa, and TaCOLb) in the Affymetrix Wheat Genome Array data sets ....................... 192

Figure 6.4. Multiple sequence alignment of the CCT domain regions from TaNF-YB3 co-regulated CO and COL proteins ........................................................................................... 192

xiv Characterisation of the TaNF-Y family of transcription factors in wheat

List of Tables

Table 3.1. Triticum aestivum NF-Y proteins identified in the sequence databases .............................. 73

Supplementary Table 3.2 Triticum aestivum NF-Y subunit gene-specific and reference gene primers .................................................................................................................................. 102

Supplementary Table 3.3 Ct values of TaNF-Y genes analysed by real-time PCR .......................... 103

Table 4.1 Enriched GO terms within TaNF-YC11-correlated probe sets ........................................... 121

Table 4.2 Photosynthesis-related transcripts correlated with the mRNA levels of TaNF-YC11 in Affymetrix genome arrays ............................................................................................... 122

Table 4.3 Expression correlations of potential TaNF-YC11 target genes with TaNF-YC11 in wheat leaves and seedling shoots with dark or light-treatment ........................................... 127

Supplementary Table 4.4 Real-Time PCR primers of Triticum aestivum NF-YC11 potential target genes and reference gene ........................................................................................... 138

Supplementary Table 4.5 TaNF-YC members in Affymetrix GeneChip® Wheat Genome Array ..................................................................................................................................... 139

Supplementary Table 4.6 TaNF-YC11-co-regulated genes in Affymetrix wheat genome array datasets.................................................................................................................................. 140

Supplementary Table 4.7 Transcripts correlated with the mRNA levels of TaNF-YC8 in Affymetrix genome array datasets ....................................................................................... 146

Table 5.1 Enriched GO terms within TaNF-YB3-correlated probe sets .............................................. 160

Table 5.2 Photosynthesis-related transcripts correlated with the mRNA levels of TaNF-YB3 in Affymetrix Wheat Genome Array datasets ......................................................................... 162

Table 5.3 Expression correlations of photosynthesis genes with TaNF-YB3 in wheat leaves and seedling shoots with dark or light-treatment ....................................................................... 165

Supplementary Table 5.4 Real-Time PCR primers of Triticum aestivum NF-YB3-correlated genes and reference genes .................................................................................................... 182

Supplementary Table 5.5 TaNF-YB members in Affymetrix GeneChip® Wheat Genome Array ..................................................................................................................................... 183

Table 6.1 Expression correlation between TaNF-YB3 and CO and COL genes in Affymetrix Wheat Genome Array datasets ............................................................................................. 192

xv Characterisation of the TaNF-Y family of transcription factors in wheat

List of Abbreviations

ABA Abscisic acid

ABI Applied Biosystems

ABI3 Abscisic acid insensitive 3

ADP Adenosine diphosphate

AEL Apparent expression level

ALA 5-aminolevulinic acid

AP1 APETALA1

APA Active phytochrome A-binding

APB Active phytochrome B-binding

ARNT Aryl hydrocarbon receptor nuclear translocator protein

Asat Light-saturated rate of photosynthesis

AscH Ascorbic acid

ASF-2 Activating sequence factor 2

At Arabidopsis thaliana

ATP Adenosine-5'-triphosphate

ATPa ATP synthase

AtpC Chloroplast ATP synthase

bHLH Basic helix-loop-helix

BNCBF Brassica napus CCAAT-binding factor

bp Base pair(s)

BW Bobwhite

bZIP Basic leucine zipper

ºC Degrees Celsius

C/EBP CCAAT-enhancer-binding protein

xvi Characterisation of the TaNF-Y family of transcription factors in wheat

C3 Three carbon

CAB Chlorophyll a/b-binding

CAL Cauliflower

CAO Chlorophyll a/b oxygenase

CBF CCAAT-binding factor

CCA1 Circadian clock associated 1

CCAAT Cytidine-cytidine-adenosine-adenosine-thymidine

CCF Chromosomal condensation factor

CCT CO, COL and TOC1

CDD COP10, DDB1, DET1

cDNA Complementary DNA

cFBPase Chloroplastic fructose-1,6-bisphosphatase

Chl(s) Chlorophyll(s)

CHLH Magnesium chelatase subunit H

CHS Chalcone synthase

CO (1) Constans (1)

CO2 Carbon dioxide

COL Constans-Like

COP Constitutive photomorphogenic

CP Crossing point

cpSRP43 Chloroplast signal recognition particle 43

Cry(1-3) Cryptochrome (1-3)

CSN COP9 signalsome

CTF CCAAT binding transcription factor

CV Coefficient of variation

CYC1 Cytochrome c1

xvii Characterisation of the TaNF-Y family of transcription factors in wheat

DAS DQXVP-acidic-STAES

DDB1 DNA damage-binding protein 1

DET1 De-etiolated 1

DFCI Dana-Farber Cancer Institute

DHA Dehydroascorbate

DHAP Dihydroxyacetone phosphate

DNA Deoxyribonucleic acid

DNase Deoxyribonuclease

Dr1 Down-regulator of transcription 1

Drap1 Dr1 associated protein 1

DREB1 Dehydration-responsive element binding protein 1

DRT112 DNA-damage-repair/toleration protein 112

E4P Erythrose 4-phosphate

EBI European Bioinformatics Institute

EMBL European Molecular Biology Laboratory

ER Endoplasmic reticulum

ERSE-I Endoplasmic reticulum stress-responsive element I

EST Expressed sequence tag

F6P Fructose-6-phosphate

FAD Flavin adenine dinucleotide

FAO Food and Agriculture Organization

FBP Fructose-1,6-bisphosphate

FBPase Fructose-1,6-bisphosphatase

FD Flowering locus D

FDL Flowering locus D-like

FDR False discovery rate

xviii Characterisation of the TaNF-Y family of transcription factors in wheat

FKF1 Flavin-binding, Kelch repeat, F-box

FLC Flowering locus C

FMN Flavin mononucleotide

FNR Ferredoxin-NADP(H) oxidoreductase

FT Flowering locus T

FUL Fruitfull

FUS3 Fusca3

G3P Glyceraldehyde 3-phosphate

GA Gibberellic acid

GAF cGMP-specific phosphodiesterases, adenylyl cyclases and

FhlA

GARP Golden2 ARR B-class proteins

GLK Golden2-Like

GluRS Glutamyl-tRNA synthetase

GluTR Glutamyl-tRNA reductase

GO Gene ontology

GSA-AT Glutamate-1-semialdehyde aminotransferase

H2O Dihydrogen monoxide

HAP Heme activator protein

HEM1 Heme biosynthesis 1

HFM Histone-fold motif

HFR1 Long hypocotyl in far-red 1

HI Harvest index

HK House-keeping

HKRD Histidine kinase-related domain

HY5 Hypocotyl 5

xix Characterisation of the TaNF-Y family of transcription factors in wheat

HYH Hypocotyl 5 homolog

ID Identifier

JTT Jones-Taylor-Thornton

kb Kilobase

kDa Kilodalton

L Litre(s)

L1L Leafy cotyledon 1-like

LAF1 Long after far-red-light

LD Long day

LEC Leafy cotyledon

LFY Leafy

Lhca Light harvesting complex a

Lhcb Light harvesting complex b

LHCI Light harvesting complex I

LHCII Light harvesting complex II

LHCP Light harvesting complex protein

LHY Late elongated hypocotyl

LI Light intercepted

LKP LOV kelch repeat protein

LOV Light, oxygen and voltage

MADS MCM1 agamous deficiens SRF

Mg2+ Magnesium

Mb Megabase(s)

MCM1 Minichromosome maintenance protein 1

MEME Multiple em for motif elicitation

mg Milligram(s)

xx Characterisation of the TaNF-Y family of transcription factors in wheat

mRNA Messenger RNA

MYB Myeloblastosis

NADP+ Nicotinamide adenine dinucleotide phosphate

NADPH Nicotinamide adenine dinucleotide phosphate reduced form

NC2 Negative cofactor 2

NCBI National Centre for Biotechnology Information

NF-I Nuclear factor I

NF-Y Nuclear factor Y

NJ Neighbor-joining

NOAA National Oceanic and Atmospheric Administration

O2 Oxygen

OEE Oxygen-evolving enhancer

OH Hydroxide

ORF Open reading frame

Os Oryza sativa

P Probability

pAAI1GUSR rice Act1 promoter Act1 intron 1 E. coli uidA rice rbcS 3

PAS PER ARNT SIM

PC Plastocyanin

Pchlide Protochlorophyllide

PCR Polymerase chain reaction

PCRC Photosynthetic carbon reduction cycle

PER Period circadian protein

PET E Plastocyanin

PetF Chloroplast ferredoxin

PEX11b Peroxisomal membrane protein 11B

xxi Characterisation of the TaNF-Y family of transcription factors in wheat

PGA Phosphoglycerate

PGM2 Phosphoglucomutase 2

pH Potential of hydrogen

PHR Photolyase homology region

PHY Phytochrome

PIF Phytochrome interacting factor

PIL1 Pif3-like

PlantGDB Plant Genome Database

POR Pchlide oxidoreductase

PPFD Photosynthetic photon flux densities

PQ(A) Plastoquinone (A)

PSAE Photosystem I subunit E

PSBL Photosystem II subunit L

PSI Photosystem I

PSII Photosystem II

PSIK Photosystem I reaction centre subunit K

PSIN Photosystem I reaction centre subunit N

qRT-PCR Quantitative real time PCR

R5P Ribulose-5-phosphate

RAF Rapidly accelerated fibrosarcoma

RBCS Ribulose-1,5-bisphosphate carboxylase/oxygenase small

subunit

Rht Reduced height

RiceTFDB Rice Transcription Factor Database

RING Really interesting new gene

RMA Robust multi-array average

xxii Characterisation of the TaNF-Y family of transcription factors in wheat

RNA Ribonucleic acid

RNAi Ribonucleic acid interference

RNase Ribonuclease

RP15 RNA polymerase 15 kDa subunit

RPII36 RNA polymerase II 36 kDa subunit

RuBisCO Ribulose-1,5-bisphosphate carboxylase oxygenase

RuBP Ribulose-1,5-bisphosphate

RUE Radiation use efficiency

S7P Sedoheptulose 7-phosphate

SAD Subunit association domain

SBP Sedoheptulose-1,7-bisphosphate

SBPase Sedoheptulose-1,7-bisphosphatase

SD Standard deviation

SIM Single-minded protein

SOC1 Suppressor of overexpression of CO 1

SRF Serum response factor

SSP Seed storage protein

Ta Triticum aestivum

TaGI Triticum aestivum gene indices

tAPX Thylakoid ascorbate peroxidase

TBLASTN Translated Basic Local Alignment Search Tool nucleotide

TBP TATA binding-protein

TC Tentative consensus

TCOL Tomato COL

T-DNA Transfer DNA

TF Transcription factor

xxiii Characterisation of the TaNF-Y family of transcription factors in wheat

THAP Tomato heme activator protein

TOC1 Timing of CAB expression 1

TPU Triose phosphate utilization

tRNA Transfer RNA

TRX Thioredoxin

TRXM Thioredoxin M-type

TSS Transcription start site

Ubi Ubiquitin

USA United States of America

UV Ultraviolet

VDE Violaxanthin de-epoxidase

VRN Vernalisation gene

WT Wild-type

X5P Xylulose 5-phosphate

XTR7 Xyloglucan endotransglycosylase 7

YP Yield potential

ZE Zeaxanthin epoxidase

ZTL Zeitlupe

xxiv Characterisation of the TaNF-Y family of transcription factors in wheat

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the

best of my knowledge and belief, the thesis contains no material previously

published or written by another person except where due reference is made.

Signature: _________________________

Date: _________________________

xxv Characterisation of the TaNF-Y family of transcription factors in wheat

Acknowledgments

I would like to express my gratitude and appreciation to everyone who assisted

in the completion of this thesis. For providing the opportunity to undertake my PhD,

I thank my supervisors Gang-Ping Xue, Chris Collet and Lynne McIntyre.

I am particularly grateful to Gang-Ping Xue for being an exceptional

supervisor and mentor. Gang-Ping always made time to discuss the project, to

provide technical advice and to assist with the preparation of manuscripts. I am

inspired by Gang-Pings’ enthusiasm and dedication to science.

I would like to thank Chris Collet for all the time and effort he put into

assisting me with the preparation of manuscripts. I have learned a great deal about

scientific writing from Chris.

I am also thankful to Lynne McIntyre for her input into my project. Lynne

provided me with advice and critical feedback on a number of pieces of work.

I am very grateful for the financial assistance I received from the Grains

Research and Development Corporation, by way of a Grains Research Scholarship. I

am also thankful for the financial assistance I received from the CSIRO Plant

Industry for conference costs and research expenses. Furthermore, I would like to

thank QUT for the additional funding provided for the write-up of this thesis.

I would like to thank all members of CSIRO Plant Industry at St. Lucia who

helped over the years. The research facilities at CSIRO PI at St. Lucia are excellent

and the working environment is pleasant.

I would like to thank BSES at Indooroopilly for allowing me to use their

facilities and Biolistic PDS-1000 / He Particle Delivery System (Bio-Rad) to

transform my wheat embryos.

Finally I would like to thank my family, particularly my parents, for their

support and encouragement.

Chapter 1: 1 Aims and Objectives

Chapter 1: Aims and Objectives

1.1 DESCRIPTION OF SCIENTIFIC PROBLEM INVESTIGATED

Photosynthesis is an important physiological process in plants and involves

multiple genes associated with the various photosynthetic components (e.g., proteins

associated with the thylakoid membrane bound complexes, enzymes involved in the

chlorophyll biosynthesis pathway and enzymes involved in the Calvin cycle). While

our knowledge of the photosynthetic pathway is well documented, the signalling

cascades and their associated transcription factors (TFs) are not.

Three studies have shown that some members from the nuclear factor Y (NF-

Y) TF family are likely involved in light-mediated gene regulation in plants

(Kusnetsov et al. 1999; Miyoshi et al. 2003; Warpeha et al. 2007). The expansion of

each of the three NF-Y subunit families and the differential expression patterns that

exist between members within each of these families (Thirumurugan et al. 2008;

Siefers et al. 2009) indicates that functional specialisation has occurred for NF-Y

subunit members in plants. This has been shown for a number of plant NF-Y

subunits, where they are reported to be involved in embryo development, chloroplast

biogenesis, flowering time and tolerance to stress (Miyoshi, et al. 2003; Kagaya et al.

2005; Santos Mendoza et al. 2005; Cai et al. 2007; Chen et al. 2007; Nelson et al.

2007; Li et al. 2008; Kumimoto et al. 2008, 2010; Liu and Howell 2010). To

understand the potential biological role of wheat NF-Y TFs in light-mediated gene

regulation they need to be molecularly characterised.

1.2 OVERALL OBJECTIVES OF THE STUDY

There is a substantial lack of knowledge regarding the NF-Y factor in wheat.

Furthermore, there are relatively few NF-Y members which have been molecularly

characterised in plants. The overall objective of this project was to improve the

understanding of the biological roles of the NF-Y factor and to molecularly

characterise members which are involved in light-mediated gene regulation in the

important cereal crop wheat. It was envisaged that the results from this investigation

would provide the information necessary to identify genes which should be further

investigated as potential targets in molecular breeding programs.

2 Chapter 1: Aims and Objectives

1.3 SPECIFIC AIMS OF THE STUDY

This study aims to characterise the NF-Y family in bread wheat (Triticum

aestivum) and to investigate their potential biological roles in light-mediated gene

regulation. The research chapters of this thesis address the following specific

objectives:

1. To identify and characterise the NF-Y subunit families TaNF-YA, TaNF-

YB and TaNF-YC by bioinformatic analysis of the nucleotide sequence

databases (Chapter 3).

2. To analyse the differential expression profiles (organ specificity and

responses to environmental stimuli, particularly light) of individual TaNF-

Y subunit members in wheat to identify their potential biological roles

(Chapters 3-5).

3. To identify the potential target genes of light-upregulated TaNF-Y subunit

members using a genome-wide gene expression correlation analysis

(Chapters 4-5).

4. To investigate the potential biological roles of the light-upregulated subunit

members using a transgenic approach (Chapters 5-6).

The knowledge generated in this study will provide the first analysis of the NF-

Y family in wheat and has the potential to point towards particular genes which

could be involved in light-mediated regulatory pathways in this important crop

species.

1.4 ACCOUNT OF SCIENTIFIC PROGRESS LINKING THE SCIENTIFIC PAPERS

This thesis contains three published chapters (Chapters 3-5) and one chapter

which has been prepared for publication (Chapter 6).

The first paper (Chapter 3) was focused on the identification and gene

expression analysis of the NF-Y family in wheat. The results from this chapter

helped identify potential candidate genes for further analysis. In particular it was

found that the wheat NF-YB and NF-YC families contained members which were

predominantly expressed in the photosynthetic organs.


In the second paper (Chapter 4) the light-responsive expression profiles were

investigated for the wheat NF-YC genes to identify members potentially involved in

light-mediated gene regulation. A genome-wide gene expression correlation analysis

was conducted to identify potential target genes of light-upregulated NF-YC

members. Results from this chapter identified one wheat NF-YC member (TaNF-

YC11) that is likely involved in the light-mediated gene regulation of photosynthesis

genes.

In the third paper (Chapter 5) the light-responsive expression profiles of the

wheat NF-YB members were identified and the potential target genes were

investigated. One member from the wheat NF-YB family (TaNF-YB3) was

functionally characterised in a transgenic study. The results from this paper revealed

that the light-upregulated TaNF-YB3 is involved in the regulation of photosynthesis

genes in wheat. The constitutive increased expression of TaNF-YB3 in transgenic

wheat led to increased chlorophyll content and photosynthetic rates in the leaves

compared to the wild-type. Furthermore, the transgenic lines had increased early

growth rates.

The final paper (Chapter 6) identified a second role for TaNF-YB3. Transgenic

wheat lines with constitutive increased expression levels of TaNF-YB3 displayed an

early flowering phenotype. The expression levels of a number of flowering time

genes were found to be significantly elevated in the transgenic wheat lines. The

results from this paper confirm previous reports of the involvement of NF-Y

members in the regulation of flowering time.


1.5 REFERENCES

Cai, X., Ballif, J., Endo, S., Davis, E., Liang, M., Chen, D., DeWald, D., Kreps, J., Zhu, T. and Wu, Y. (2007). A putative CCAAT-binding transcription factor is a regulator of flowering timing in Arabidopsis. Plant Physiology 145(1): 98-105.

Chen, N. Z., Zhang, X. Q., Wei, P. C., Chen, Q. J., Ren, F., Chen, J. and Wang, X. C. (2007). AtHAP3b plays a crucial role in the regulation of flowering time in Arabidopsis during osmotic stress. Journal of Biochemistry and Molecular Biology 40(6): 1083-1089.

Kagaya, Y., Toyoshima, R., Okuda, R., Usui, H., Yamamoto, A. and Hattori, T. (2005). LEAFY COTYLEDON1 controls seed storage protein genes through its regulation of FUSCA3 and ABSCISIC ACID INSENSITIVE3. Plant and Cell Physiology 46(3): 399-406.

Kumimoto, R. W., Adam, L., Hymus, G. J., Repetti, P. P., Reuber, T. L., Marion, C. M., Hempel, F. D. and Ratcliffe, O. J. (2008). The Nuclear factor Y subunits NF-YB2 and NF-YB3 play additive roles in the promotion of flowering by inductive long-day photoperiods in Arabidopsis. Planta 228(5): 709-723.

Kumimoto, R. W., Zhang, Y., Siefers, N. and Holt, B. F. (2010). NF–YC3, NF–YC4 and NF–YC9 are required for CONSTANS-mediated, photoperiod-dependent flowering in Arabidopsis thaliana. The Plant Journal 63(3): 379-391.

Kusnetsov, V., Landsberger, M., Meurer, J. and Oelmuller, R. (1999). The assembly of the CAAT-box binding complex at a photosynthesis gene promoter is regulated by light, cytokinin, and the stage of the plastids. Journal of Biological Chemistry 274(50): 36009-36014.

Li, W. X., Oono, Y., Zhu, J., He, X. J., Wu, J. M., Iida, K., Lu, X. Y., Cui, X., Jin, H. and Zhu, J. K. (2008). The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance. Plant Cell 20(8): 2238-2251.

Liu, J.-X. and Howell, S. H. (2010). bZIP28 and NF-Y transcription factors are activated by ER stress and assemble into a transcriptional complex to regulate stress response genes in Arabidopsis. Plant Cell 22(3): 782-796.

Miyoshi, K., Ito, Y., Serizawa, A. and Kurata, N. (2003). OsHAP3 genes regulate chloroplast biogenesis in rice. Plant Journal 36(4): 532-540.

Nelson, D. E., Repetti, P. P., Adams, T. R., Creelman, R. A., Wu, J., Warner, D. C., Anstrom, D. C., Bensen, R. J., Castiglioni, P. P., Donnarummo, M. G., Hinchey, B. S., Kumimoto, R. W., Maszle, D. R., Canales, R. D., Krolikowski, K. A., Dotson, S. B., Gutterson, N., Ratcliffe, O. J. and Heard, J. E. (2007). Plant nuclear factor Y (NF-Y) B subunits confer drought tolerance and lead to improved corn yields on water-limited acres. Proceedings of the National Academy of Sciences of the United States of America 104(42): 16450-16455.

Santos Mendoza, M., Dubreucq, B., Miquel, M., Caboche, M. and Lepiniec, L. (2005). LEAFY COTYLEDON 2 activation is sufficient to trigger the accumulation of oil and seed specific mRNAs in Arabidopsis leaves. FEBS Letters 579(21): 4666-4670.


Siefers, N., Dang, K. K., Kumimoto, R. W., Bynum, W. E. t., Tayrose, G. and Holt, B. F., 3rd (2009). Tissue-specific expression patterns of Arabidopsis NF-Y transcription factors suggest potential for extensive combinatorial complexity. Plant Physiology 149(2): 625-641.

Thirumurugan, T., Ito, Y., Kubo, T., Serizawa, A. and Kurata, N. (2008). Identification, characterization and interaction of HAP family genes in rice. Molecular Genetics and Genomics 279(3): 279-289.

Warpeha, K. M., Upadhyay, S., Yeh, J., Adamiak, J., Hawkins, S. I., Lapik, Y. R., Anderson, M. B. and Kaufman, L. S. (2007). The GCR1, GPA1, PRN1, NF-Y signal chain mediates both blue-light and abscisic acid responses in Arabidopsis. Plant Physiology 143(4): 1590-1600.


Chapter 2: 7 Literature Review

Chapter 2: Literature Review

2.1 INTRODUCTION

Wheat is one of the most important cereal crops, accounting for ~30 % of the

total yield of cereal crops worldwide (FAO 2008). With the world population

expected to reach 8-10 billion by 2050 (Lutz and Samir 2010) a doubling in food

production in the next 40 years is required to maintain an adequate food supply (von

Braun 2010). However, to achieve predicted food production requirements crop

yields need to be increased at a rate not seen since the Green Revolution (Khush

2001). The global demand for wheat is increasing more rapidly than the genetic gains

currently being realised (Rosegrant and Cline 2003; Fischer 2007; Miralles and

Slafer 2007) as conventional cereal breeding is time-consuming. The recent

integration of biotechnology, genomics, and molecular marker applications with

conventional plant breeding practices has created the foundation for molecular plant

breeding (Moose and Mumm 2008).

The rate of photosynthesis is a limiting factor of yield potential (Reynolds et al.

2010). Manipulating the expression levels of photosynthesis genes can influence the

photosynthetic rate in plants (Harrison et al. 1997; Lefebvre et al. 2005), indicating

the yield potential of wheat could be improved by targeting key genes encoding

components of the light harvesting systems, enzymes of the Calvin cycle or enzymes

in the chlorophyll biosynthetic pathways.

Light is an important environmental stimulus that triggers the reprogramming

of nuclear gene expression through complex biological pathways involving four

distinct families of photoreceptors: phytochromes, cryptochromes, phototropins and

zeitlupes (Christie 2007; Devlin et al. 2007; Li and Yang 2007; Bae and Choi 2008).

Effectors, such as transcription factors (TFs), kinases, phosphatases and degradation-

pathway proteins are triggered by these photoreceptors (Chen et al. 2004; Casal and

Yanovsky 2005). Of particular interest are the TFs, because they act as master-

controllers that are capable of regulating multiple genes within their transcriptional

networks. Three studies have indicated the Nuclear factor Y (NF-Y) family is

involved in light-mediated gene regulation in plants (Kusnetsov et al. 1999; Miyoshi

8 Chapter 2: Literature Review

et al. 2003; Warpeha et al. 2007). Members of the NF-Y TF family form a

heterotrimeric complex that targets a common cis-element (the CCAAT-box) present

in the promoters of genes from a diverse group of eukaryotes including mammals,

yeasts and plants (Mantovani 1998, 1999; Shahmuradov et al. 2003).

There is no information regarding the NF-Y family in wheat. This thesis aimed

to identify and characterise the NF-Y TF family in wheat and to examine its potential

involvement in light-regulated physiological processes. To provide an overview of

NF-Y TFs from plants and their association with light-mediated gene regulation, this

review will describe and discuss the knowledge and research progress on light-

mediated gene regulation, transcriptional control of photosynthetic and flowering

time genes, the molecular biology of NF-Y transcription factors and some general

aspects of wheat and photosynthesis.

2.2 WHEAT YIELD AND PHOTOSYNTHESIS

Some studies indicate wheat yield is correlated with the photosynthetic rate

(Blum 1990; Watanabe et al. 1994; Fischer et al. 1998). Furthermore, wheat typically

grows in environments where light is available in excess of its photosynthetic

capabilities (Sharkey 1985), indicating further improvements to yield could be

achieved by increasing the photosynthetic rates.

2.2.1 TRITICUM AESTIVUM L.

Triticum aestivum L. (bread wheat) is a member of the grass family Poaceae,

within the Triticeae tribe of the Pooideae subfamily (Watson et al. 1985; Kellogg

1998). Bread wheat is an allohexaploid, containing 21 chromosome pairs with seven

pairs belonging to each of the A, B and D genomes (2n = 6x = 42; genome

BBAADD) (Sears 1954; Okamoto 1962). The BBAADD genome was derived by

hybridisation of a female tetraploid (2n = 4x = 28; genome BBAA) and a male

diploid [Triticum tauschii L. (2n = 2x = 14; genome DD)] (Kihar 1944; McFadden

and Sears 1944, 1946a, b; Kimber and Feldman 1987; Kimber and Sears 1987;

Dvorak et al. 1998). The A genome originated from Triticum urartu L., while

Aegilops speltoides L. is reportedly the donor of the B genome for both tetraploid

and hexaploid wheats (Dvorak et al. 1988; Wang et al. 1997). Triticum aestivum L.

has the largest genome of all crop species, with a size of ~16000 megabases (Mb),


which is ~40-fold larger than rice and ~8-fold larger than maize (Arumuganathan and

Earle 1991).

2.2.2 YIELD LIMITING FACTORS OF PHOTOSYNTHESIS

The yield of a crop refers to the mass of product at final harvest. The yield

potential (YP) of a crop cultivar is achieved when it is grown under optimal growth

conditions (Evans 1993). YP in its simplest form can be expressed as a function of

the light intercepted (LI) and the radiation use efficiency (RUE), where the resulting

product is biomass and the partitioning of biomass to yield (i.e. harvest index [HI];

Reynolds et al. 2005). The genetic gains in yield during the 20th century were mostly

a consequence of increased HI, arising through the introgression of the Reduced

height (Rht) genes and the continued selection for yield after the Green Revolution

(Kulshrestha and Jain 1982; Gale and Youssefian 1985; Calderini et al. 1995; Sayre

et al. 1997). While the theoretical limit of HI is 0.6 for wheat (Austin et al. 1980), the

current HI (0.55) is only slightly higher than it was in the 1980s when it was 0.5

(Sayre et al. 1997; Calderini et al. 1999). In contrast to the situation for HI, the

theoretical limits of RUE indicate there is considerable potential for increases to be

made to raise the YP for C3 species (Loomis and Amthor 1999). One of the ways to

improve RUE is to increase the photosynthetic capacity (Murchie and Horton 2007;

Parry et al. 2007; Zhu et al. 2008). Photosynthetic capacity is defined as the

maximum photosynthetic rate per unit leaf mass measured under ambient carbon

dioxide (CO2) concentrations and saturating irradiance (Reich et al. 1997). The

theoretical maximum conversion of solar energy into biomass (4.6 % for C3 plants)

is not achieved by most plants (Zhu et al. 2008).

Crop yields could be increased by enhancing the photosynthetic capacity and

maximising the utilisation of assimilates (Reynolds et al. 2009). Net CO2

assimilation at the tissue level constitutes the basis of crop growth and development.

The quantum yield (efficiency) of CO2 uptake is determined by light intensity and

the rate of photosynthesis (Emerson 1958). At optimum temperatures, the maximum

light saturation rate of photosynthesis (Asat) in bread wheat is substantially lower

than its wild relatives (Austin 1989). Furthermore, wheat is typically grown in areas

where light intensities are in excess of its photosynthetic capabilities (Sharkey 1985).

In the current C3 photosynthesis biochemical models, Asat is determined by three

processes: Ribulose-1,5-carboxylase/oxygenase (RuBisCO) catalysed Ribulose-1,5-


bisphosphate (RuBP) carboxylation; RuBP regeneration; and triose phosphate

utilization (TPU; Farquhar et al. 1980; Harley and Sharkey 1991; von Caemmerer

2000). The slowest of these three processes under any given growing conditions

becomes rate-limiting and thus will determine maximum yield. All three of these

processes occur in the Photosynthetic Carbon Reduction Cycle (PCRC; also known

as The Calvin cycle; Figure 2.1).

Figure 2.1. The Photosynthetic Carbon Reduction Cycle (PCRC). The PCRC showing the intermediates from the first stable carbon compound, 3-PGA, to the carbon dioxide acceptor molecule, ribulose-1,5-bisphosphate and the exit points of the cycle into the pathways of sucrose, starch, isoprenoids and shikimic acid. The site of function of the enzymes (1) 3-phosphoglycerate kinase (2) triose phosphate isomerase (3) ribose-5-phosphate isomerase and (4) ribulose-5-phosphate epimerase are also indicated. Further description of individual reactions and enzyme abbreviations can be found in section 2.2.3. From Raines (2003).

2.2.3 THE PHOTOSYNTHETIC CARBON REDUCTION CYCLE

The PCRC is the primary pathway for carbon fixation in plants (Stiller 1962)

and utilises the products of the light reactions of photosynthesis, namely adenosine-

5'-triphosphate (ATP) and the reduced form of nicotinamide adenine dinucleotide

phosphate (NADPH), to fix atmospheric CO2 into carbon skeletons, which may be

used directly for starch or sucrose biosynthesis (Woodrow and Berry 1988; Geiger

and Servaites 1995; Quick and Neuhaus 1997). The PCRC is a complex series of 13

reactions catalysed by 11 enzymes (Bassham and Krause 1969; Leegood 1990),

which is divided into three phases: (1) carboxylation; (2) reduction; and (3)

regeneration (Losada et al. 1960).


In the first phase (carboxylation), RuBisCO fixes CO2 to RuBP forming an

unstable six carbon molecule (Siegel and Lane 1973), which rapidly breaks down

into two 3-phosphoglycerate (3-PGA) molecules (Jakoby et al. 1956; Weissbach et

al. 1956).

In the second stage (reduction), 3-PGA is phosphorylated by stromal

phosphoglycerate kinase yielding 1,3-bisphosphoglycerate, which is reduced by

glyceraldehyde 3-phosphate dehydrogenase to produce glyceraldehyde-3-phosphate

(G3P; Stiller 1962). Triose phosphate isomerase can interconvert G3P molecules

with dihydroxyacetone phosphate (DHAP; Trentham et al. 1969).

In the final phase (regeneration), transaldolase catalyses the reversible

condensation of DHAP with G3P to yield fructose-1,6-bisphosphate (FBP; Bassham

et al. 1954). Chloroplastic fructose-1,6-bisphosphatase (cFBPase) dephosphorylates

FBP producing fructose-6-phosphate (F6P; Preiss et al. 1967; Charles and Halliwell

1981). Transketolase catalyses a reversible reaction which transfers the ketol group

from F6P to G3P resulting in xylulose 5-phosphate (X5P) and erythrose 4-phosphate

(E4P; Lichtenthaler 1999). Transaldolase combines E4P with DHAP (Horecker et al.

1963) resulting in sedoheptulose-1,7-bisphosphate (SBP), which is dephosphorylated

by sedoheptulose-1,7-bisphosphatase (SBPase) to yield sedoheptulose-7-phosphate

(S7P; Traniello et al. 1971; Woodrow and Berry 1988). Transketolase converts S7P

and G3P into X5P and ribose-5-phosphate (R5P; Datta and Racker 1961). Ribulose-

5-phosphate epimerase and ribose-5-phosphate isomerase convert available X5Ps

into ribulose-5-phosphate (Horecker et al. 1956). Finally ribulose-5-phosphate kinase

phosphorylates available ribulose-5-phosphates to form RuBP (Hurwitz et al. 1956).

There are a number of rate-limiting enzymes in this pathway, including RuBisCO,

SBPase and FBPase (Portis et al. 1977; Woodrow and Berry 1988).

2.2.3.1 RIBULOSE-1,5-CARBOXYLASE/OXYGENASE

RuBisCO is one of the primary targets for the improvement of the

photosynthetic rate (Parry et al. 2007). Indeed, RuBisCO is the best studied plant

enzyme. It is the most abundant protein complex in the leaf and one of the most

abundant in the world (Ellis 1979). RuBisCO comprises two sizes of subunit, large

and small, each of which is present in eight copies (i.e. 8 large and 8 small;

Andersson et al. 1989; Knight et al. 1989). The enzyme is bifunctional, responsible

for the competitive reactions of carboxylation and oxygenation of RuBP (Laing et al.


1974). It is the ratio between the competitive reactions that largely determines the

efficiency of CO2 fixation, as photorespiration is responsible for losing over 30 % of

the CO2 that could potentially be fixed (Somerville and Ogren 1982). RuBisCO is

fully activated in the saturating light intensities that C3 plants typically grow under,

which substantially limits the rate of photosynthesis (Hudson et al. 1992; Spreitzer

1993; Hartman and Harpel 1994). Transgenic studies have shown that the

concentration of RuBisCO is directly correlated with the photosynthetic rate under

high light intensities (Quick et al. 1991). RuBisCO is understandably a primary

target for genetic manipulation for the improvement of plant yields (Spreitzer and

Salvucci 2002; Raines 2006).

2.2.3.2 SEDOHEPTULOSE-1,7-BISPHOSPHATASE

Measurements, which began in 1958 by Scripps [continued by the National

Oceanic and Atmospheric Administration (NOAA) from 1974], indicate the average

annual atmospheric CO2 concentration is currently around 390 ppm and is steadily

rising (www.esrl.noaa.gov/gmd/ccgg/trends/). While the increase in CO2

concentration positively affects RuBP carboxylation, for the maximal efficiency of

the conversion of solar energy to biomass to occur, the ratio between RuBP

carboxylation and regeneration need to be balanced so that neither RuBisCO nor the

enzymes required for regeneration become limiting (von Caemmerer and Farquhar

1981). When CO2 concentration rises to ~410 ppm, RuBP regeneration becomes a

rate-limiting factor for photosynthesis (Farquhar & von Caemmerer 1982). The rate

of RuBP regeneration is controlled by highly regulated enzymes such as

sedoheptulose-1,7-bisphosphatase (SBPase), which dephosphorylates sedoheptulose-

1,6-bisphosphate resulting in sedoheptulose-7-phosphate (Harrison et al. 2001;

Lefebvre et al. 2005). The SBPase enzyme complex is homodimeric, comprising

subunits of 35-38kDa. In the dark, SBPase has virtually no activity, but within 15

minutes of light, activity may increase 15- to 30-fold (Laing et al. 1981). The light

activation of SBPase occurs by at least two mechanisms. Firstly, ferredoxin is

reduced, followed by the reduction of thioredoxin f, which is catalysed by

ferredoxin/thioredoxin reductase. SBPase is activated by the reduction of its

disulphide bonds by thioredoxin f (Buchanan 1980). Secondly, SBPase is regulated

by the potential of hydrogen (pH)and magnesium (Mg2+) levels in the stroma, which

vary in response to light and dark conditions (Woodrow et al. 1984). Additionally,


SBPase activity can be controlled by the levels of its end products (Schimkat et al.

1990). SBPase functions at the branching point between the reduction and

regeneration phases of the PCRC, catalysing a non-reversible rate-limiting reaction

(Woodrow and Berry 1988). SBPase is an enzyme that has no cytosolic counterpart

and is only found in photosynthetic organisms. Some studies indicate SBPase levels

can impact on RuBP regeneration and plant biomass (Harrison et al. 2001; Lefebvre

et al. 2005).

2.2.3.3 CHLOROPLAST FRUCTOSE-1,6-BISPHOSPHATASE

Chloroplast FBPase is a key regulator in the CO2 assimilation pathway and has

a pivotal role in the starch biosynthesis pathway originating from the PCRC

(Thorbjornsen et al. 2001). The starch biosynthesis pathway originating from the

PCRC produces transient starch, which is stored and broken down at night to achieve

a constant supply of sucrose to non-photosynthetic organs (Buleon et al. 1998).

Excess G3P molecules not used for RuBP regeneration are used to synthesise

transient starch. The conversion of FBP to F6P by cFBPase has a high negative free

energy making it non reversible and it is therefore a rate-limiting stage in the PCRC

(Bassham and Krause 1969). cFBPase can be activated by reduction of its disulphide

bonds by thioredoxin (TRX), as well as by changes in pH and Mg2+ concentration,

which result from irradiation (Anderson et al. 1979; Buchanan et al. 1980). It has

been found that the concentration of cFBPase within plants positively correlates with

plant biomass (Koßmann et al. 1994; Tamoi et al. 2006).

2.2.3.4 TRIOSE-PHOSPHATE UTILISATION

The rate of photosynthesis can be limited by triose-phosphate utilisation

(TPU). When triose-phosphates are produced more rapidly than the end products

starch and sucrose, TPU limits the photosynthetic rate (Sharkey et al. 1986). Some

triose-phosphates are exported from the chloroplast via the phosphate translocator in

exchange for phosphate, and are used to synthesise sucrose in the cytosol (Stitt et al.

1987; Stitt and Quick 1989). When sucrose synthesis is inhibited, there is an

accumulation of phosphorylated metabolites in the cytosol and less phosphate is

recycled to the chloroplast, which leads to inhibition of photosynthesis (Herold

1980). If the TPU falls below one third of the rate of CO2 fixation, the

phosphorylated intermediates will accumulate and the levels of free phosphate will

decline in the cytosol and chloroplast, limiting the photosynthetic rate (Stitt and


Quick 1989). When photosynthesis is TPU limited, RuBisCO activity and RuBP

regeneration need to be reduced, resulting in wasted RuBisCO capacity and

increasing the potential of light damage to the electron transport components due to

reduced RuBP regeneration.

2.2.4 THE LIGHT REACTIONS

The enzymes within the PCRC have been the primary targets for the genetic

improvement of photosynthetic capacity, as they catalyse a number of rate-limiting

reactions within the pathway that affect the rate of CO2 assimilation (Raines 2003).

However, the energy requirements of PCRC are dependent on the light reactions of

photosynthesis (Figure 2.2). Furthermore, rate-limiting enzymes within the PCRC

are activated by the redox regulatory system, which has its origins within the light

reactions of photosynthesis. The principal converters of sunlight into chemical

energy are the four thylakoid membrane bound complexes, photosystem I (PSI),

photosystem II (PSII), cytochrome b6f, and ATP synthase (McCarty et al. 2000;

Scheller et al. 2001; Barber 2002; Baniulis et al. 2008). The first step in the light

dependent pathway involves PSII, which is a multimeric complex comprised of ~30

subunits, driving the oxidation of water during photosynthesis (Barber 2002).

Surrounding the PSII complex are light harvesting chlorophyll-a/b-binding proteins,

which harvest the energy contained in light. Photons from light activate the

chlorophyll molecules, which transfer the resonance between chlorophylls (Chls)

until they reach P680. Excited P680 reduces pheophytin, which then donates the

electron to plastoquinone A (PQA) leading to the reduction of plastoquinone (PQ).

The oxygen evolving complex oxidises water to replace the lost electrons from P680.

PQ requires two electrons to become fully reduced and mobile, therefore the process

needs to occur twice before PQ can transfer electrons to the Cytochrome b6f

complex. In addition to the two electrons, plastoquinone picks up two protons from

the stroma. Cytochrome b6f mediates electron transfer from PSII to PSI, which is

coupled with proton translocations across the membrane (proton motive force)

(Cramer et al. 2004; Baniulis et al. 2008). The proton gradient drives ATP synthesis

via ATP synthase, which phosphorylates adenosine diphosphate (ADP) releasing

ATP into the stroma. Cytochrome b6f reduces plastocyanin, which transfers the

electrons to PSI. PSI is a highly efficient photochemical system catalysing the light-

driven electron transfer from plastocyanin to ferredoxin (Fdx; Amunts et al. 2008).


PSI is composed of two parts, a reaction centre with at least 19 subunits and its light

harvesting complex I (LHCI; Nelson et al. 2004; Amunts et al. 2008). Chlorophyll

(Chl) associated with PSI antenna and LHCI absorb photons of light, which are

transferred to the primary electron donor P700. Like P680, P700 is a dimer of

distinct chlorophyll a pigments. Electrons from the excited P700 travel down an

electron transfer chain comprised of chlorophylls, phylloquinones, and iron sulphur

complexes (Brettel and Leibl 2001). Fdx accepts electrons from the terminal electron

acceptor in the Fe-S complex in PSI. Reduced ferredoxin is the source of electrons

for either, nicotinamide adenine dinucleotide phosphate (NADP+) reduction in the

linear electron flow or to create a proton motive force in the cyclic electron flow

back through cytochrome b6f (Sétif 2001; Munekage et al. 2004). Ferredoxin-

NADP+ reductase catalyses the reductions of NADP+ to NADPH using electrons

provided by reduced ferredoxin (Corrado et al. 1996). Ferredoxin-thioredoxin

reductase reduces thioredoxin using electrons from ferredoxin. Reduced thioredoxin

activates rate-limiting enzymes within the dark reactions (Knaff and Hirasawa 1991).

Figure 2.2. The light reactions of photosynthesis. Light excites the pigments within the light harvesting complexes providing the reducing energy to drive the electron transport chain. The result is the conversion of solar energy into chemical energy, which is required to drive the Photosynthetic Carbon Reduction Cycle. A full description of the light reaction and abbreviations can be found in section 2.2.4. This image has been released into the public domain and can be retrieved from http://en.wikipedia.org/wiki/File:Thylakoid_membrane.png.

2.2.5 THE XANTHOPHYLL CYCLE

One of the main limiting factors for the light reactions is the rate of recovery

from photoinhibition (Osmond 1994). C3 photosynthesis is saturated at

photosynthetic photon flux densities (PPFD) of about one quarter of that from full


sunlight (Sharkey 1985). When light exceeds the capacity of photosynthesis, the

photoprotective systems can become overwhelmed leading to the formation of

reactive oxygen species (Asada and Takahashi 1987; Havaux and Niyogi 1999). At

high PPFDs, the accumulation of excitation energy in the light harvesting complexes

can lead to the formation of triplet excited chlorophyll molecules that can interact

with singlet oxygen (Asada 1994). Photooxidative damage of PSII appears to be an

unavoidable consequence of photosynthetic activity and is a primary cause of

reduced photosynthetic efficiency (Barber and Andersson 1992; Aro et al. 1993).

Under excess light growth-conditions, violaxanthin de-epoxidase catalyses the

reversible conversion of the diepoxide xanthophyll and violaxanthin to the epoxide

free zeaxanthin via the intermediate antheraxanthin (Yamamoto 1979; Pfündel and

Bilger 1994; Eskling et al. 1997). This process, known as the xanthophyll cycle

(Figure 2.3), increases thermal dissipation of absorbed light energy and reduces

chlorophyll fluorescence emission within the light harvesting antenna systems

(Thayer and Björkman 1992; Horton et al. 1996). Increased thermal quenching has a

relatively small impact on CO2 uptake under high light intensities, but significantly

reduces CO2 uptake under low light intensities. Therefore, delay in reversal of the

photoprotection state will reduce carbon gain. Relaxation of the lag phase between

protected and non protected states can improve RUE. In rice, it has been found that

increased recovery rates from the photoprotected state improved yield (Wang et al.

2002).

2.3 LIGHT-REGULATED TRANSCRIPTIONAL NETWORKS

Light-signal transduction pathways are central to the regulation of plant

development. A variety of processes including germination, seedling de-etiolation,

shade avoidance and flowering response are modulated by light. The characteristics

of light, such as the intensity, wavelength, direction and duration are detected

through four distinct families of photoreceptors (Christie 2007; Devlin et al. 2007; Li

and Yang 2007; Bae and Choi 2008). These photoreceptors trigger effectors such as

TFs, kinases, phosphatases and degradation-pathway proteins (Chen et al. 2004). TFs

are of particular interest as they act as master-controllers, capable of regulating

multiple genes within their transcriptional networks. Light-signalling induces

differential expression of at least 20 % of all Arabidopsis and rice genes (Jiao et al.

2005). Numerous light-regulated TFs have been identified to date. Of 1363 TF genes,


26 % are differentially expressed in developing Arabidopsis seedlings in response to

blue-light (Jiao et al. 2003).

Figure 2.3. The xanthophyll cycle. Excess light is dissipated as heat to protect the photosystems. In higher plants there are three carotenoid pigments that are active in the xanthophyll cycle: violaxanthin, antheraxanthin and zeaxanthin. AscH (ascorbic acid), DHA (dehydroascorbate), H2O (dihydrogen monoxide), NADP+ (nicotinamide adenine dinucleotide phosphate), NADPH (nicotinamide adenine dinucleotide phosphate reduced form), O2 (oxygen), OH (hydroxide), VDE (violaxanthin de-epoxidase), ZE (zeaxanthin epoxidase). This image has been released into the public domain and can be retrieved from http://en.wikipedia.org/wiki/File:Violaxanthin_cycle.png.

2.3.1 PHOTORECEPTORS

Plants are most sensitive to UV-B, UV-A/blue-, red- and far-red-light. There

are at least four distinct families of photoreceptors: phytochromes; cryptochromes;

phototropins; and zeitlupes (Christie 2007; Devlin et al. 2007; Li and Yang 2007;

Bae and Choi 2008). These photoreceptors control photomorphogenesis through

transcriptional regulatory networks in response to blue-, red-, or far-red-light. Light

affects the physicochemical properties of the photoreceptors, which convert light-

signals into biochemical signals. Furthermore, light can influence the expression of

photoreceptor genes and their activity at the post-transcriptional level (Bae and Choi

2008).

2.3.1.1 PHYTOCHROMES

The first family of photoreceptor identified was the phytochrome family

(Butler et al. 1959; Lane et al. 1962). Phytochromes are photoreversible pigments

and are the most sensitive of the photoreceptors to red- and far-red-light (Kendrick

and Kronenberg 1986; Fankhauser 2001). In Arabidopsis, phytochromes are encoded


by a small gene family containing five members (phyA-phyE; Sharrock and Quail

1989). There are two classes of phytochromes, type I (phyA) which is photolabile

and type II (phyB-E) which are photostable (Furuya 1993). Type I is most abundant

in the dark and is degraded rapidly upon exposure to light. In contrast, type II

phytochromes are relatively stable in light. Phytochromes are homodimeric

complexes comprised of subunits with N-terminal photosensory domains and C-

terminal dimerisation/signaling regions (Figure 2.4; Quail 1997). The photosensory

domain covalently binds to a single bilin chromophore capable of absorbing red- and

far-red-light (Wu and Lagarias 2000; Montgomery and Lagarias 2002). The C-

terminal domain can be divided into two period circadian protein (Per), aryl

hydrocarbon receptor nuclear translocator protein (Arnt), single-minded protein [Sim

(PAS)] domains (Bolle et al. 2000) and a His kinase-related domain (Figure 2.4; Yeh

and Lagarias 1998), which combine to facilitate dimerisation and confer a nuclear

localisation signal. Phytochromes are synthesised in the inactive Pr form (λmax of 666

nm) and are primarily localised to the cytosol (Kircher et al. 1999). Once activated

by red-light, phytochromes are transformed to the active Pfr form (λmax of 730 nm).

When activated, Pfr dimers translocate to the nucleus and interact with TFs, such as

phytochrome interacting factors (PIFs; Ni et al 1998; Kircher et al. 1999), which are

capable of binding to light-responsive cis-acting elements in the promoters of light-

responsive genes (Martínez-García et al 2000).

2.3.1.2 CRYPTOCHROMES

Cryptochromes were the earliest blue-light photoreceptor to be identified at the

molecular level (Ahmad and Cashmore 1993). In Arabidopsis, cryptochromes are

encoded by at least three genes, cryptochrome 1-3 (cry1-3; Ahmad and Cashmore

1993; Lin et al. 1996; Kleine et al. 2003). Cryptochromes are structurally related to

DNA photolyases; however, cryptochromes do not have photolyase activity (Sancar

2003). Cryptochromes contain two domains, an N-terminal photolyase homology

region (PHR) domain, which binds to two chromophores, a flavin adenine

dinucleotide (FAD) and either a pterin or deazaflavin, which provide the light-

sensing capabilities (Figure 2.4; Lin et al. 1995; Sancar 2003). The C-terminal

regions of cryptochromes contain a DAS domain (not present in cry3), which has the

ability to transduce the signals perceived by the PHR domain and contains residues

necessary to nuclear localisation and protein interactions (Lin and Shalitin 2003).

Chapter 2: 19

Cry3 contains a unique C-terminal domain containing a transit peptide sequence,

which targets the protein to the chloroplast and mitochondria (Brudler et al. 2003;

Lin and Shalitin 2003). The nuclear localised cry2 is photolabile, showing rapid

blue-light induced degradation, functioning primarily at low light intensities (Lin et

al. 1998). In contrast, cry1 is photostable, mediating responses to higher fluencies of

blue-light (Lin et al. 1998). Cry1 is primarily localised to the cytoplasm, but is

translocated to the nucleus in the dark (Yang et al. 2000). Cry3 is distinct in its

localisation patterns, as it is present in both the mitochondria and chloroplasts

(Kleine et al. 2003). Both cry1 and cry2 can interact with the E3 ubiquitin ligase

constitutive photomorphogenic 1 (COP1; Wang et al. 2001). COP1 is involved in the

light-regulated degradation of TFs, including the basic leucine zipper (bZIP) TF

hypocotyl 5 (HY5; Osterlund et al. 2000; Holm et al. 2002; Seo et al. 2003).

Figure 2.4. Conserved domains of plant photoreceptors. Domain composition of Arabidopsis phytochrome (a), cryptochrome (b-c), phototropin (d) and zeitlupe (e). CCT (cryptochrome C-terminal domain), FAD (photolyase α domain), GAF (GAF domain), HKRD (histidine kinase-related domain), Kelch (Kelch repeat), LOV, (light, oxygen and voltage) PAS, [(Per (period circadian protein); Arnt (aryl hydrocarbon receptor nuclear translocator protein); Sim (single-minded protein)] Photly. (photolyase α/β domain), PHY (phytochrome), Ser/ThrK (serine/threonine kinase), F (F box). Adapted from Moglich et al. (2010).

2.3.1.3 PHOTOTROPINS

Phototropins are plant-specific photoreceptors which respond to blue-light

(Liscum and Briggs 1995; Christie et al. 1998). In Arabidopsis, there are two genes

which encode phototropins, phot1 and phot2 (Liscum and Briggs 1995; Briggs et al.

2001). Arabidopsis phototropins are plasma membrane-bound proteins (Sakamoto

and Briggs 2002; Harada et al. 2003). Phot1 is most sensitive to low blue-light

intensities, while phot2 is responsible for detection of higher intensities (Briggs and

Christie 2002). Phototropins have two distinct domains, the C-terminal regions

contains a Ser/Thr kinase domain, while the N-terminal region contains two light,

oxygen and voltage (LOV) subdomains (Figure 2.4; Briggs and Christie 2002). The

LOV domains within phototropins non-covalently bind the chromophore flavin

(a) (b) (c) (d) (e)


mononucleotide (FMN) and can undergo blue-light induced autophosphorylation

(Christie et al. 1999).

2.3.1.4 ZEITLUPE

In addition to phototropins, the zeitlupe family proteins, zeitlupe (ZTL), flavin-

binding, kelch repeat, F-box (FKF1) and LOV kelch repeat protein 2 (LKP2) also

contain the LOV domain in their N-terminal regions (Demarsy and Fankhauser

2009). Following the LOV domain, there is an F-box-binding motif and the kelch

domain (Figure 2.4), suggesting they may be involved in light-mediated protein

regulation (Nelson 2000; Somers 2000, 2001; Christie 2007). While little is known

about the zeitlupe family, like phototropins, light-regulated protein interactions are

crucial for signal transduction (Kim et al. 2007; Sawa et al. 2007).

2.3.2 TRANSCRIPTIONAL REGULATION OF PHOTOSYNTHESIS GENES

Numerous genes encode the various components of photosynthesis as

described earlier. While the photosynthetic process is well understood, the

transcriptional regulation of photosynthesis genes is not. Among the photosynthesis

genes, the light-mediated regulation of light harvesting chlorophyll a/b-binding

(CAB) genes is well documented. CAB expression is upregulated in response to light

(Apel and Kloppstech 1978, 1980; Tobin 1981). Two Arabidopsis Myb family TFs

circadian clock associated 1 and late elongated hypocotyl (CCA1 and LHY) were

identified to have roles in the regulation of CAB transcript levels (Wang et al. 1997;

Schaffer et al. 1998). Arabidopsis CCA1 binds to the Lhcb1*3 promoter in a

phytochrome response region (Wang et al. 1997). It has been suggested that LHY

may also bind to the Lhcb1*3 promoter (Schaffer et al. 1998). In Arabidopsis,

suppression of CCA1 expression reduces the induction of the Lhcb1*3 gene

expression, indicating that CCA1 can act as a transcriptional activator in vivo (Wang

et al. 1997). Two barley Myb-like TFs (HvMCB1 and HvMCB2) have roles in the

regulation of genes encoding CAB proteins (Churin et al. 2003). HvMCB1 and

HvMCB2 can bind to both barley and wheat CAB promoters (Churing et al. 2003). A

tobacco GATA family TF member activating sequence factor 2 (ASF-2) has been

identified to bind to conserved GATA motifs within CAB promoter regions (Lam and

Chua 1989).

Some TFs have been identified to be involved in the regulation of multiple

photosynthesis-related genes. Two Arabidopsis Golden 2-like myeloblastosis (MYB)


related GARP TFs (AtGLK1 and AtGLK2) are involved in the regulation of

chloroplast biogenesis and the transcriptional regulation of light harvesting complex

protein genes (LHCP1 and LHCP6) and a stromal factor gene chloroplast signal

recognition particle 43 (cpSRP43), which is necessary for the insertion of CAB

proteins into the thylakoid membrane (Klimyuk et al. 1999; Fitter et al. 2002).

Furthermore, Arabidopsis Atglk1/Atglk2 double mutants have reduced transcript

levels of the genes encoding the magnesium chelatase subunit H (CHLH; an enzyme

that functions early in chlorophyll biosynthesis) and a chlorophyll a/b oxygenase

(CAO; a key enzyme in the latter stages of chlorophyll biosynthesis; Fitter et al.

2002). Overexpression of two Brassica napus CCAAT-binding factors (BNCBF5

and BNCBF17) resulted in the upregulation of genes involved in photosynthesis and

chloroplast development including GLK1- and GLK2-like TFs, chloroplast stroma

cyclophilin ROC4, β-amylase and trios-P/Pi translocator genes (Savitch et al. 2005).

A bZIP transcription factor (HY5) is involved in the light-responsive regulation of

CAB gene expression. HY5 binds to the CAB upstream factor 1, which is required

for chlorophyll a/b-binding protein 2 (CAB2) expression (Maxwell et al. 2003).

Furthermore, it has been shown HY5 can bind to the promoter regions of other

photosynthesis genes including the ribulose bisphosphate carboxylase small subunit

gene RBCS-1A (Chattopadhyay et al. 1998; Lee et al. 2007).

2.3.3 FLOWERING TIME GENES AND THEIR REGULATION

The floral transition occurs when FLOWERING LOCUS T (FT), which is

synthesised in the leaves, is transported via the phloem to the shoot apical meristem

where it activates the expression of floral meristem identity genes (Evans 1971;

Yanovsky and Kay 2002; Searle and Coupland 2004). Flowering needs to be timed

to optimal environmental conditions for successful reproduction and it is the leaves

that act as the sensory organs for this process. The floral transition in wheat is

controlled by seasonal cues, such day-length and temperature (Davidson et al. 1985).

Although sensitivity to photoperiod differs among genotypes, many wheat varieties

flower in response to lengthening days (Manupeerapan et al. 1992). Additionally,

winter wheat varieties tend to have a vernalisation requirement (Gott 1957).

A central component of photoperiodic floral control is CONSTANS (CO),

which is B-box zinc finger CCT domain-containing TF (Putterill et al. 1995; Robson

2001). CO messenger ribonucleic acid (mRNA) expression oscillates following a


circadian rhythm and accumulates late in the day when plants are grown under long

days (Suarez-Lopez et al. 2001, Valverde et al. 2004). Constitutive overexpression of

CO promotes early flowering and induces the expression of the flowering pathway

integrator genes FT, SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1) and

LEAFY (LFY; Simon et al. 1996; Samach et al. 2000; An et al. 2004; Yoo et al.

2005). FLOWERING LOCUS C (FLC) encodes a minichromosome maintenance

protein 1 (MCM1), agamous deficiens, serum response factor (SRF; MADS) box

family member, which acts antagonistically with CO in the regulation of flowering

by acting as a negative regulator of FT and SOC1 (Hepworth et al. 2002; Helliwell et

al. 2006). This in turn delays the expression of the floral meristem identity genes

LFY and APETALA1 (AP1; Simon et al. 1996; Sessions et al. 2000). The inhibition

of FT and SOC1 by FLC can be reversed by either vernalisation or via the

autonomous pathway (Lee and Amasino 1995; Michaels and Amasino 2001; Dennis

and Peacock 2007).

The FT gene encodes a small transcription cofactor which functions as a strong

promoter of flowering (Kardailsky et al. 1999; Kobayashi et al. 1999).

Overexpression of FT promotes earlier flowering in a number of species including

Arabidopsis, Populus, rice, tomato and wheat (Kardailsky et al. 1999; Kobayashi et

al. 1999; Kojima et al. 2002; Bohlenius et al. 2006; Lifschitz et al. 2006; Yan et al.

2006; Lin et al. 2007). CO activates FT expression in the leaf vascular tissue (An et

al. 2004). In Arabidopsis, the FT protein then translocates via the phloem to the shoot

apical meristem where it interacts with a bZIP transcription factor FLOWERING

LOCUS D (FD) to activate the expression of the meristem identity genes (Abe et al.

2005; Wigge et al. 2005; Corbesier et al. 2007). The FD gene is predominantly

expressed in the shoot apical meristem indicating the FT-FD interaction is spatially

regulated, while FT is regulated by external stimuli also (Wigge et al. 2005). FD

confers the DNA-binding site specificity to the complex, targeting the promoters of

floral meristem identity genes (Wigge et al. 2005).

The SOC1 gene encodes a MADS-box family member that is conserved among

several plant species (Lee et al. 2000, 2004; Cseke et al. 2003; Nakamura et al.

2005). SOC1 is involved in the regulation of flowering time, floral patterning and

floral meristem determinacy (Liu et al. 2007, 2009; Melzer et al. 2008). SOC1 is

expressed predominantly in developing leaves and meristems and its transcript levels


accumulate according to developmental age (Samach et al. 2000). In rice, SOC1

overexpression and ribonucleic acid interference (RNAi) transgenic plants displayed

early and delayed flowering phenotypes respectively (Lee et al. 2004). In

Arabidopsis winter-annuals, overexpression of SOC1 suppressed the late flowering

phenotype that is caused by the high expression of FLC in these plants, indicating it

is a downstream target of FLC (Lee et al. 2000). It has been shown that CO and FLC

regulate SOC1 expression by binding to separate elements in its promoter (Hepworth

et al. 2002; Searle et al. 2006).

Floral meristem identity genes such as LFY, AP1, CAULIFLOWER (CAL) and

FRUITFULL (FUL) are TFs with roles in the determination of floral identity (Weigel

et al. 1992; Mandel and Yanofsky 1995; Ferrándiz et al. 2000). LFY is a novel plant-

specific transcription factor, whereas AP1, CAL and FUL are members of the

MADS-box family (Gramzow and Theissen 2010; Moyroud et al. 2010). LFY is a

key integrator of endogenous and environmental signals, being strongly upregulated

in young primordia for the promotion of floral identity (Blázquez et al. 1997). LFY,

FUL and AP1 expression increases just prior to the meristem identity transition

(Hempel et al. 1997). FUL expression parallels that of LFY, whereas AP1 and CAL

are activated several hours later (Hempel et al. 1997). LFY co-ordinately activates

the expression of floral homeotic genes (Weigel and Meyerowitz 1993; Nilsson et al.

1998; Blazquez and Weigel 2000). Furthermore, LFY is considered a master

regulator of meristem identity transition (Weigel et al. 1992).

In cereal crops, such as maize, rice and wheat, FLORICAULA/LFY

(FLO/LFY) homologs have diverged from monocotyledon species at the primary

sequence level (Shitsukawa et al. 2006). The mRNA expression profiles of rice

FLO/LFY (RFL) and wheat FLO/LFY (WFL) are unique from those in

monocotyledon species such as Arabidopsis. The wheat FLO/LFY orthologs (WFLa,

WFLb and WFLd, homoeologous copies from the A, B and D genomes respectively)

are predominantly expressed in young spikes when they are between 3 and 15mm in

length, which corresponds to the spikelet and floret differentiation stage of

development (Shitsukawa et al. 2006). RFL mRNA levels are highest in young

panicles and developing branches, which is at a developmental stage well before the

initiation of the floral meristem (Kyozuka et al. 1998). WFL and RFL are expressed

primarily in developing palea and differentiating floral primordia respectively


(Prasad et al. 2003; Shitsukawa et al. 2006). These expression profiles suggest that

wheat and rice FLO/LFY homologs are not regulators of floral meristem identity

genes. In contrast, maize zfl1/zfl2 double mutants exhibit disruptions to floral organ

identity and patterning, indicating maize FLO/LFY homologs share a similar role as

those from dicots (Bomblies et al. 2003).

Vernalisation is the process whereby flowering is promoted by a cold treatment

(Chouard 1960). Genetic studies of winter and spring wheat cultivars have identified

three vernalisation genes (VRN1, VRN2 and VRN3) that have roles in the

vernalisation response (Figure 2.5; Yan et al. 2003, 2004, 2006). VRN1 is similar to

the Arabidopsis AP1 MADS-box transcription factor which is involved in the

regulation of meristem identity (Trevaskis et al. 2003; Yan et al. 2003; Preston and

Kellogg 2006; Shitsukawa et al. 2007). VRN2 encodes a CCT domain protein that

does not appear to have a close homolog in Arabidopsis (Yan et al. 2004). VRN2

acts as a repressor of flowering by blocking the expression of VRN3 (Yan et al.

2006). VRN3 encodes a rapidly accelerated fibrosarcoma (RAF) kinase inhibitor like

protein, which is a homolog of the Arabidopsis FT protein (Yan et al. 2006).

Constitutive overexpression of a VRN3 transgene not subject to VRN2 mediated

repression bypasses the vernalisation requirement (Yan et al. 2006).

Allelic variation in the Photoperiod response (Ppd) genes defines the

photoperiod sensitivity of wheat. Many high yielding hexaploid wheat varieties are

photoperiod insensitive, where there is only a short delay in flowering when grown

under short days compared to long days (Worland et al. 1994; Law and Worland

1997). The primary source of the insensitivity to photoperiod comes from the semi-

dominant Photoperiod-D1a (Ppd-D1a) allele (Worland et al. 1998). In photoperiod

sensitive wheat, Ppd1 activates VRN3 when the plants are grown under long days

(Turner et al. 2005). VRN3 then activates the floral meristem identity gene VRN1 (Li

and Dubcovsky 2008). VRN2 represses VRN3 under LD, preventing its activation by

Ppd1 and as such establishes a vernalisation requirement under LD (Hemming et al.

2008). VRN2 expression is repressed by exposure to cold, similar to FLC in

Arabidopsis (Yan et al. 2004). VRN1 is involved in the cold induced repression of

VRN2 (Loukoianov et al. 2005, Trevaskis et al. 2006). VRN3 integrates the

vernalisation and photoperiod pathways (Yan et al. 2006).


Figure 2.5. Outline of flowering pathways in cereals. Components and genetic interactions that promote flowering are shown in blue; those that repress flowering are shown in red. The photoperiod pathway in cereals activates the floral integrator VRN3 (an Arabidopsis FT homolog), which in turn activates the floral meristem-identity gene VRN1 (an Arabidopsis AP1/FUL homolog). Flowering locus C (FLC), long day (LD), photoperiod response 1 (PPD1), short day (SD), vernalisation gene 1-3 (VRN1-3). From Kim et al. (2009).

2.3.4 TRANSCRIPTION FACTORS INVOLVED IN LIGHT-MEDIATED GENE REGULATION

In Arabidopsis and rice, at least 20 % of all genes are differentially expressed

in response to light (Jiao et al. 2005). A number of TFs have been identified to be

involved in light-mediated pathways. In developing Arabidopsis seedlings, 26 % of

the TF genes are differentially expressed in response to blue-light (Jiao et al. 2003).

The first TF identified to have a role in light-responsive pathways was the bZIP

TF HYPOCOTYL 5 (HY5; Koornneef et al. 1980; Oyama et al. 1997). HY5

expression is activated in response to far-red, red- or blue-light (Tepperman et al.

2001; Jiao et al. 2003). The HY5 TF binds to the G-box (CACGTG) cis-element,

which is required for light activated expression of a number of genes including the

ribulose bisphosphate carboxylase small subunit gene (Figure 2.6; Chattopadhyay et

al. 1998). The promoters of genes involved in the de-etiolation process are enriched

with the G-box cis-element, where the flanking sequences differ between induced


and repressed genes (Hudson and Quail 2003). In vitro DNA-binding site analysis of

HY5 in Arabidopsis revealed a set of promoter fragments enriched in the G-box (Gao

et al. 2004).

Another nuclear localised bZIP protein involved in photomorphogenesis is the

HY5 HOMOLOG (HYH) factor (Holm et al. 2002). HYH expression levels increase

in response to red and/or blue-light, but not far-red-light and protein levels

significantly decrease under dark conditions (Holm et al. 2002). HYH can bind to

light-responsive G-box cis-elements, likely interacting with HY5 (Holm et al. 2002).

HYH protein, but not mRNA levels, are positively regulated by HY5 demonstrating

another level of interaction between these bZIP proteins (Holm et al. 2002). HYH

has a role in the light induced expression of the peroxisomal membrane protein 11B

(PEX11b) gene in Arabidopsis (Desai and Hu 2008). HYH can bind to the promoter

of the PEX11b gene as part of a phyA-mediated signalling pathway (Desai and Hu

2008). HY5 and HYH have roles the regulation of photomorphogenesis and nitrate

reductase genes (Oyama et al. 1997; Holm et al. 2002; Jonassen et al. 2008).

Furthermore, HY5 and HYH are required for the light-mediated regulation of

numerous photosynthesis genes (Holm, et al. 2002; Lee et al. 2007).

Several members from the basic helix-loop-helix (bHLH) transcription factor

family, termed phytochrome interacting factors (PIFs), are involved in phytochrome-

mediated regulatory networks (Ni et al. 1998, 1999; Huq et al. 2002, 2004; Leivar et

al. 2008). All PIFs analysed for DNA-binding site specificity could bind to the G-box

cis-element (Martinez-Garcia et al. 2000; Huq et al. 2002; Shin et al. 2007; de Lucas

et al. 2008; Leivar et al. 2008; Moon et al. 2008; Hornitschek et al. 2009).

Furthermore, PIFs have been shown to have transcriptional activity in transfection or

heterologous systems (Huq et al. 2004; Al-Sady et al. 2008; de Lucas et al. 2008;

Leivar et al. 2008; Shen et al. 2008; Hornitschek et al. 2009). For example, PIF7 is a

transcriptional repressor in Arabidopsis (Kidokoro et al. 2009). All PIF members

contain the Active Phytochrome B-binding (APB) domain necessary for phyB

interaction (Khanna et al. 2004). PIF1 and PIF3 contain the Active Phytochrome A-

binding (APA) regions, allowing them to interact with phyA in addition to phyB (Al-

Sady et al. 2006; Shen et al. 2008).

PIF family members are involved in many light-mediated regulatory roles.

PIF1 and PIF3 are involved in seedling greening by negatively regulating the


synthesis of protochlorophyllide in the dark (Huq et al. 2004; Shin et al. 2009). PIF1

is involved in the regulation of seed germination, partly by repressing the expression

of gibberellin (GA)-biosynthetic genes in the dark (Oh et al. 2007). PIF4 and PIF5

have a role in the regulation of shade avoidance in completely de-etiolated seedlings

(Lorrain et al. 2008). Arabidopsis pif3 mutants have impaired red-light induction of a

number nuclear encoded chloroplast and zinc finger genes and exhibit impaired

accumulation of chlorophyll (Monte et al. 2004). PIF4 has a role in light-regulated

stomatal development in mature leaves (Casson et al. 2009). Furthermore, a recent

association study has indicated that PIF4 may also have a role in the regulation of

flowering time (Brock et al. 2010).

Figure 2.6. A model of light-signalling during photomorphogenesis. (A) In darkness, CRY1 dimers are bound to COP1 in the nucleus. CSN, COP1 and the COP10/DET1/ DDB1 (CDD) complexes co-operate to promote the ubiquitination of photomorphogenesis-promoting transcription factors such as HY5. In parallel, PIF3 is bound to G-box sequences in target promoters, inhibiting transcription of photomorphogenesis-related genes. (B) Blue-light exposure triggers the photoactivation of CRY1, which leads to the exit of COP1 from the nucleus and thus allows HY5 levels to increase. HY5 is then available to bind to G-box motifs and promote transcription of genes such as RBCS and Lhcb1. Phy-bound PIF3 is phosphorylated, rendering it susceptible to ubiquitination and subsequent degradation. As a result, transcription of genes such as those involved in chlorophyll biosynthesis can proceed. For abbreviations see text. From Waters and Langdale (2009).

A bHLH family member protein, LONG HYPOCOTYL IN FAR-RED 1

(HFR1) is involved in phyA- and cry1-mediated pathways (Fairchild et al. 2000;

Duek and Fankhauser 2003). HFR1 expression is induced by far-red- or blue-light

and is repressed by red-light (Duek and Fankhauser 2003). The regulatory role of

HFR1 is mediated through its interaction with PIF factors and the subsequent

interaction with phytochromes (Fairchild et al. 2000; Lorrain et al. 2009). HFR1 is


required for full de-etiolation in response to far-red-light (Fairchild et al. 2000).

Overexpression of HFR1 in Arabidopsis leads to exaggerated photoresponses,

including germination, de-etiolation, gravitropic hypocotyl growth, inhibition of

greening, and expression of some light-regulated genes such as CAB, DNA-damage-

repair/toleration protein 112 (DRT112), photosystem I subunit E (PSAE), PSBL

(PSBL), pchlide oxidoreductase (PORA), and xyloglucan endotransglycosylase 7

(XTR7; Yang et al. 2003).

PIF3-LIKE 1 (PIL1) is a Myc-related bHLH family member that interacts with

TIMING OF CAB EXPRESSION (TOC1) in a yeast-two-hybrid system (Makino et

al. 2002). The circadian clock modulates PIL1 expression peaking at dusk (Salter et

al. 2003). PIL1 is required for normal responses to low-red / far-red ratios necessary

for shade avoidance (Salter et al. 2003).

One of the earliest responses to low-red / far-red is the acute upregulation of

the homeodomain transcription factor Athb-2, occurring within 15 minutes of light-

treatment (Carabelli et al. 1996). This increase in Athb-2 expression occurs even in

phyA/phyB double mutant (Carabelli et al. 1996; Devlin et al. 2003). PhyE acts

redundantly with phyA and phyB to mediate this molecular response (Franklin et al.

2003). In Arabidopsis, constitutive overexpression of Athb-2 enhances longitudinal

stem growth (Schena et al. 1993; Steindler et al. 1999). Furthermore, Athb-2 plays an

important role mediating shade avoidance responses. This appears to be the result of

an affect of Athb-2 on auxin transport, as both the promotion of elongation by low-

red to far-red ratios or by Athb-2 expression can be attenuated by application of

auxin transport inhibitors (Steindler et al. 1999).

A Myb-related TF, CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) binds to

the AATCT element repeats within the promoters of light-regulated genes such as

CAB (Wang et al. 1997). The AATCT motif is necessary for normal regulation of

CAB expression and is highly conserved in the promoters of CAB genes (Wang et al.

1997). However, this motif is not found in the RBCS genes, which are also strongly

regulated by light. Antisense expression of the CCA1 gene reduces the induction of

CAB expression without affecting RBCS expression (Wang et al. 1997). The

expression of CCA1 oscillates following a circadian rhythm and is rapidly induced

by light (Wang et al. 1997; Wang and Tobin 1998). Constitutive overexpression of

CCA1 disrupts the rhythmic expression of several genes (Wang and Tobin 1998).


CCA1 can interact with another Myb-related protein LATE ELONGATED

HYPOCOTYL (LHY; Lu et al. 2009). However, this interaction is independent of

photoperiod (Lu et al. 2009).

A R2R3-Myb related protein, LONG AFTER FAR-RED-LIGHT (LAF1) is

involved in light-mediated gene regulation (Ballesteros et al. 2001). In Arabidopsis,

laf1 mutation impairs phyA-mediated responses (Ballesteros et al. 2001). The

expression of genes such as CAB, PLASTOCYANIN (PET E), CHALCONE

SYNTHASE (CHS), XYLOGLUCAN ENDOTRANSGLYCOSYLASE (XTR7) are

reduced in the laf1 mutant (Ballesteros et al. 2001). The really interesting new gene

(RING) motif protein CONSTITUTIVE PHOTOMORPHOGENESIS 1 (COP1) acts

as a negative regulator of LAF1 expression (Seo et al. 2003). COP1 is a nuclear

localised protein under dark conditions that becomes depleted upon exposure to light,

allowing light activated transcripts to be expressed (von Arnim and Deng 1994).

2.4 THE NF-Y FAMILY

Nuclear factor Y (NF-Y) is a heterotrimeric transcription factor (TF) complex

which binds specifically to the CCAAT-box cis-element in eukaryotes. The three

NF-Y subunits, NF-YA (HAP2/CBF-B), NF-YB (HAP3/CBF-A) and NF-YC

(HAP5/CBF-C) are defined by their highly conserved core regions that contain all of

the residues necessary for DNA and protein interactions. In contrast to mammals and

yeast, each of the three NF-Y subunits is encoded by gene families in plants.

Each NF-Y subunit has its own distinct, highly conserved core region

(Mantovani 1999). The conserved core of the NF-YA subunit is less than 60 amino

acids long comprising two subdomains of about 20 amino acids, each separated by a

non-conserved spacer region of approximately 10 amino acids (Maity and de

Crombrugghe 1992). The N-terminal domain of the core region is required for

subunit interaction with the NF-YB/NF-YC heterodimer while the C-terminal

domain is required for DNA-binding site recognition (Xing et al. 1994). Both

domains in the NF-YA subunit form amphipatic α-helices (Xing et al. 1994). The

DNA-binding domain of NF-YA is highly specific for the CCAAT-box

pentanucleotide and does not resemble those of other known DNA-binding proteins

(Romier et al. 2003). The conserved core regions of both the NF-YB and NF-YC


also contain residues contacting DNA (Romier et al. 2003) and NF-YB has been

found to contribute to DNA-binding specificity (Zemzoumi et al. 1999).

The NF-YB and NF-YC subunits contain the histone-fold motif (Figure 2.7;

HFM; Baxevanis et al. 1995). The HFM is a common motif in protein complexes

involved in DNA interaction and is highly conserved at the tertiary level between

animals, plants and lower eukaryotes (Arents and Moudrianakis 1995). NF-YB and

NF-YC are structurally similar to the core histone subunits H2B and H2A

respectively (Mantovani 1999). Based on the primary amino acid structure, NF-YB

and NF-YC are highly similar to down-regulator of transcription 1 (Dr1) associated

protein 1 [Drap1; also commonly referred to as negative cofactor 2 (NC2α)] and Dr1

(NC2β) respectively.

In contrast to the high levels of conservation of the NF-YA core regions across

vertebrates, plants and yeast, the core sequences of the NF-YB and NF-YC subunits

are not as conserved. Furthermore, the sequences of members of the NF-YB and NF-

YC subunit families of Arabidopsis are more divergent from each other than those of

the NF-YA family members (Gusmaroli et al. 2001). Moreover, the conserved core

regions of the NF-YB and NF-YC peptides are longer than the core region of the NF-

YA subunit; on average 90 and 84 amino acids in length, respectively.

Figure 2.7. Superimposition of NF-YC/NF-YB (orange) and H2A/H2B (gray) histone pairs. The tails of H2A and H2B have been removed for clarity. The elements of secondary structure showing major differences have been labelled. From Romier et al. (2003).


2.4.1 NF-Y TRANSCRIPTION FACTOR FAMILY IN PLANTS

Arabidopsis NF-YA, NF-YB and NF-YC subunit families have 10, 13 and 13

members, respectively (Siefers et al. 2009). Similar sizes of NF-Y subunit families

have been reported in rice (Thirumurugan et al. 2008). The expansion of the NF-Y

family in plants indicates increased regulatory complexity compared to mammals

and yeast due to specific interaction between subunit members and the spatial,

temporal and inducible expression profiles of individual subunit members (Edwards

et al. 1998; Gusmaroli et al. 2001; Gusmaroli et al. 2002; Li et al. 2008;

Thirumurugan et al. 2008; Siefers et al. 2009). Expression analysis has shown that

many NF-Y subunit genes in Arabidopsis are expressed ubiquitously, although some

are differentially expressed (Gusmaroli et al. 2001). For example, AtNF-YC-4

ribonucleic acid (RNA) accumulates in seeds 7 days after germination, while AtNF-

YB-9 (Leafy cotyledon 1 [LEC1]) is only expressed in green siliquae (Gusmaroli et

al. 2001). Tissue predominant expression profiles for NF-Y members are also seen in

rice, where OsHAP5C was detected mainly in leaf blades and not in the roots, while

OsHAP5F and OsHAP5G were detected only in callus and roots respectively

(Thirumurugan et al. 2008). Furthermore, both qRT-PCR and promoter:GUS fusions

of NF-Y members in Arabidopsis show that some members can be expressed in

etiolated tissues, while others cannot (Warpeha et al. 2007; Siefers et al. 2008).

2.4.2 THE NF-Y BINDING MOTIF

In mammals and yeast, NF-Y has an absolute requirement of the CCAAT

pentanucleotide sequence (Dorn et al. 1987). A number trans-acting factors have

previously been associated with CCAAT-related sequences, CCAAT binding

transcription factor/nuclear factor I (CTF/NF-I) and CCAAT-enhancer-binding

protein (C/EBP), but were later found not have an absolute requirement for the

pentanucleotide (Wedel and Ziegler-Heitbrock 1995; Gronostajski 2000). The

binding sites of C/EBP are composed of palindromic repeats occasionally containing

a CCAAT-box within the sequence (Osada et al. 1996). The CTF/NF-I DNA-binding

site contains the CCAA sequence, while T may or may not be present (Zorbas et al.

1992). NF-Y from mammals preferentially binds CCAAT with specific flanking

nucleotides: C[GA][GA]CCAAT[CG][AG]C[AC] (Mantovani 1999). The CCAAT-

box was one of the first promoter elements identified (Benoist et al. 1980;

Efstratiadis et al. 1980) and was found to be present in ~30 % of over 500 unrelated


promoter sequences from eukaryotes (Bucher 1990). The CCAAT-box is typically

found between 60-200 base pairs (bp) upstream of the transcription start site.

However, ~40 % of NF-Y sites are not in core promoters, rather they are in introns or

at distant 3′ or 5′ locations (Testa et al. 2005). An Arabidopsis promoter set of 16,851

sequences corresponding to -1000 to +200 from the transcription start site (TSS)

were analysed for the presence of the CCAAT-box motif (Siefers et al. 2009). It was

identified that the core CCAAT pentamer was present in around 12 % of promoters

analysed (Siefers et al. 2009). The CCAAT-box is functional in both direct and

inverted orientations (Dorn et al. 1987; Bucher 1990; Mantovani 1998). CCAAT-

boxes are highly conserved within homologous genes across species in terms of

position, orientation, and flanking nucleotides (Mantovani 1999). Genes under the

control of promoters containing CCAAT-boxes may be expressed in a ubiquitous

manner or can be tissue- and/or developmental stage-specific suggesting that patterns

of gene expression are also determined by other cis- and trans-acting factors.

CCAAT-boxes are found in the promoters of many different genes. In S. cerevisiae,

CCAAT-boxes are found in the promoters of cytochromes, genes activated by non-

fermentable carbon sources and genes involved in nitrogen metabolism (Pinkham et

al. 1987; Dang et al. 1996). In the filamentous fungus Aspergillus nidulans, CCAAT-

boxes are present in penicillin biosynthesis genes (Steidl et al. 1999). In higher

eukaryotes, the CCAAT-box is present in a wide variety of promoters, such as cell-

cycle regulated, developmental, tissue specific, housekeeping and inducible genes

(Berry et al. 1992; Roy and Lee 1995; Ronchi et al. 1996; Marziali et al. 1997;

Mantovani 1999). As NF-Y complexes are reportedly the only TFs that specifically

bind the CCAAT-box, it appears they have diverse functions and most likely interact

with other TFs to regulate genes containing the CCAAT-box within their promoters.

2.4.3 BIOLOGICAL ROLES OF NF-Y MEMBERS IN PLANTS

The biological roles of NF-Y in plants have primarily been elucidated using

single NF-YB subunits. Plant NF-YB members can be divided into two classes,

LEC1-type and non-LEC1-type (Lee et al. 2003). The LEC1-type of NF-YB

members were the earliest to be identified in plants (Meinke 1992). LEC1-types are

expressed predominantly in developing seeds and have roles in the regulation of

embryo and seed development (Lotan et al. 1998; Stone et al. 2001; Kwong et al.

2003; Gaj et al. 2005). In Arabidopsis, seed development is regulated by at least two


LEC-type NF-YB members (Kagaya et al. 2005; Santos Mendoza et al. 2005). LEC2

regulates the expression of LEC1 and seed specific genes. Furthermore,

overexpression of LEC2 in Arabidopsis leads to the accumulation of storage oil and

seed specific mRNAs in the leaves (Santos Mendoza et al. 2005). Overexpression of

LEC1 resulted in the upregulation of FUSCA3 (FUS3), ABSCISIC ACID

INSENSITIVE 3 (ABI3), SEED STORAGE PROTEIN (SSP) and fatty acid

biosynthetic genes (Kagaya et al. 2005). Therefore, it appears LEC1 and LEC2

function in a hierarchical manner and are both necessary for seed development and

embryogenesis (Kagaya et al. 2005; Santos Mendoza et al. 2005).

Three rice NF-YB members (OsHAP3A-C) regulate a number of

photosynthesis genes including CAB and RBCS, which encode a chlorophyll-a/b

binding protein and the small subunit of RuBisCO respectively (Miyoshi et al. 2003).

Rice plants with antisense or RNAi constructs of OsHAP3A had reduced chlorophyll

content in the leaves and degenerate chloroplasts (Figure 2.8; Miyoshi, et al. 2003).

The promoter region of the spinach photosynthesis gene chloroplast ATP synthase

(AtpC) encoding the γ subunit contains a CCAAT-box regulated by NF-Y

(Kusnetsov et al. 1999). The formation of the NF-Y complex and its subsequent

binding to the AtpC promoter is regulated by light (Kusnetsov et al. 1999). In

Arabidopsis, NF-YA5 and NF-YB9 are involved in the regulation of CAB (Warpeha

et al. 2007). Abscisic acid (ABA) and blue-light-treatment of Arabidopsis plants

induces CAB expression; however, transfer DNA (T-DNA) insertional mutants of the

members of the blue-light fluorescence pathway, including nf-ya5 and nf-yb9, did not

express CAB (Warpeha et al. 2007).

Figure 2.8. Leaves from OsHAP3A antisense and RNAi transgenic rice lines. Leaf blades of primary transformants are shown. WT is the non-transformed wild-type plant. From Miyoshi et al. (2003).

34 Chapter 2:

Figure 2.9. Overexpression of an NF-YB member improves tolerance to drought stress in Arabidopsis and maize. Constitutive expression of AtNF-YB1 confers drought tolerance in Arabidopsis (a). Constitutive expression of ZmNF-YB2 confers drought tolerance in maize (b). From Nelson et al. (2007).

Plant NF-Y members have roles in tolerance to drought stress (Nelson et al.

2007; Li et al. 2008). Overexpression of AtNF-YB1 in Arabidopsis improved

dehydration tolerance (Error! Reference source not found.a; Nelson et al. 2007).

Furthermore, overexpression of the orthologous subunit (ZmNF-YB2) in maize

improved tolerance to drought-stress in the field (Error! Reference source not

found.b; Nelson et al. 2007). Improved tolerance to drought stress in the field was

indicated by a number of parameters including chlorophyll content, stomatal

conductance, leaf temperature, rate of wilting, photosynthesis and grain yield

(Nelson et al. 2007). One Arabidopsis NF-YA member (NF-YA5) has a role in

regulating genes necessary for tolerance to drought-stress (Li et al. 2008). NF-YA5

expression is induced by drought-stress and ABA (Li et al. 2008). Furthermore, over-

expression of NF-YA5 resulted in improved tolerance to drought-stress, while nfya5

knockouts had the opposite effect (Li et al. 2008). It is particularly interesting as NF-

YA5 regulates CAB (Warpeha et al. 2007), indicating that tolerance to drought-stress

conferred by NF-YA5 might have some association with photosynthesis. Arabidopsis

NF-Y members are also involved in the regulation of stress related genes through

their interaction with bZIP TFs (Liu and Howell 2010). In a yeast-three-hybrid

system Arabidopsis NF-YB3 and NF-YC2 members could interact with either NF-

YA4 or bZIP28 (Liu and Howell 2010). In vitro DNA-binding assays showed these

Arabidopsis members could bind to the endoplasmic reticulum (ER) stress-

responsive element I (ERSE-I), which contains a CCAAT-box element and is

(a) (b)


enriched in the promoters of genes involved in ER stress response (Liu and Howell

2010).

Some plant NF-Y subunits can interact with other TFs such as MADS or

CONSTANS (CO; a zinc finger TF; Masiero et al. 2002; Wenkel et al. 2006). A

tomato NF-YC member (THAP5a) can bind either tomato CONSTANS-like 1

(TCOL1) or Arabidopsis thaliana CO (AtCO; Ben-Naim et al. 2006). Furthermore,

the yeast and tomato HAP2/HAP3/THAP5a complex is capable of recruiting TCOL1

to the HAP-responsive CCAAT-box sites in the yeast heme biosynthesis 1 (HEM1)

and cytochrome c1 (CYC1) genes (Ben-Naim et al. 2006). Several Arabidopsis NF-

YB and NF-YC members (AtLEC1, Arabidopsis thaliana leafy cotyledon 1-like

[AtL1L], AtHAP3a-c & AtHAP5a-c) can bind to both AtCO and AtCOL15 in a

yeast-two-hybrid system, while interactions between AtHAP3a and AtHAP5a with

AtCO heterodimers have been demonstrated both in vitro and in planta (Wenkel et

al. 2006). Overexpression of AtHAP3b in Arabidopsis promotes early flowering and

increases the expression of flowering time genes FLOWERING LOCUS T (FT) and

SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1; a MADS TF; Cai

et al. 2007). Furthermore, Arabidopsis mutants, hap3b-1 and hap3b-2 had reduced

expression of FT and exhibited delayed flowering under long days and osmotic-stress

conditions (Chen et al. 2007). In Arabidopsis, NF-YB2 and NF-YB3 have been shown

to play additive roles in the promotion of flowering by inductive long-day

photoperiods (Kumimoto et al. 2008). Furthermore, three Arabidopsis NF-YC

members (NF–YC3, NF–YC4, and NF–YC9) are required for flowering and can

interact with NF-YB2, NF-YB3 and CO (Kumimoto et al. 2010).


2.5 REFERENCES

Abe, M., Kobayashi, Y., Yamamoto, S., Daimon, Y., Yamaguchi, A., Ikeda, Y., Ichinoki, H., Notaguchi, M., Goto, K. and Araki, T. (2005). FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309(5737): 1052-1056.

Ahmad, M. and Cashmore, A. R. (1993). Hy4 gene of A. thaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature 366(6451): 162-166.

Al-Sady, B., Kikis, E. A., Monte, E. and Quail, P. H. (2008). Mechanistic duality of transcription factor function in phytochrome signaling. Proceedings of the National Academy of Sciences of the United States of America 105(6): 2232-2237.

Al-Sady, B., Ni, W., Kircher, S., Schäfer, E. and Quail, P. H. (2006). Photoactivated phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated degradation. Molecular Cell 23(3): 439-446.

Amunts, A. and Nelson, N. (2008). Functional organization of a plant photosystem I: Evolution of a highly efficient photochemical machine. Plant Physiology and Biochemistry 46(3): 228-237.

An, H., Roussot, C., Suárez-López, P., Corbesier, L., Vincent, C., Piñeiro, M., Hepworth, S., Mouradov, A., Justin, S., Turnbull, C. and Coupland, G. (2004). CONSTANS acts in the phloem to regulate a systemic signal that induces photoperiodic flowering of Arabidopsis. Development 131: 3615-3626.

Anderson, L. E., Ashton, A. R., Mohamed, A. H. and Scheibe, R. (1982). Light/dark modulation of enzyme activity in photosynthesis. Bioscience 32(2): 103-107.

Andersson, I., Knight, S. and Brändén, C. (1989). Three-dimensional structure of spinach RuBisCO, a key enzyme in photosynthesis and photorespiration. In: Photoconversion processes for energy and chemicals. Eds. D. Hall and G. Grassi. Taylor & Francis. London.

Apel, K. and Kloppstech, K. (1978). The plastid membranes of barley (Hordeum vulgare): light-induced appearance of mRNA coding for the apoprotein of the light-harvesting chlorophyll a/b protein. European Journal of Biochemistry 85(2): 581-588.

Apel, K. and Kloppstech, K. (1980). The effect of light on the biosynthesis of the light-harvesting chlorophyll a/b protein. Planta 150(5): 426-430.

Arents, G. and Moudrianakis, E. N. (1995). The histone fold: A ubiquitous architectural motif utilized in DNA compaction and protein dimerization. Proceedings of the National Academy of Sciences of the United States of America 92(24): 11170-11174.

Aro, E.-M., Virgin, I. and Andersson, B. (1993). Photoinhibition of photosystem II. Inactivation, protein damage and turnover. Biochimica et Biophysica Acta 1143(2): 113-134.

Arumuganathan, K. and Earle, E. (1991). Nuclear DNA content of some important plant species. Plant Molecular Biology Reporter 9(3): 208-218.


Asada, K. (1994). Production and action of active oxygen species in photosynthetic tissues. In: Causes of photooxidative stress and amelioration of defense systems in plants. Eds. C. Foyer and P. Mullineaux. CRC Press Incorporated. Boca Raton.

Asada, K. and Takahashi, M. (1987). Production and scavenging of active oxygen. In: Photoinhibition. Eds. D. Kyle, C. Osmond and C. Arntzen. Elsevier. Amsterdam.

Austin, R. B. (1989). Genetic variation in photosynthesis. The Journal of Agricultural Science 112(03): 287-294.

Austin, R. B., Bingham, J., Blackwell, R. D., Evans, L. T., Ford, M. A., Morgan, C. L. and Taylor, M. (1980). Genetic improvements in winter wheat yields since 1900 and associated physiological changes. The Journal of Agricultural Science 94(03): 675-689.

Bae, G. and Choi, G. (2008). Decoding of light-signals by plant phytochromes and their interacting proteins. Annual Review of Plant Biology 59: 281-311.

Ballesteros, M. a. L., Bolle, C., Lois, L. M., Moore, J. M., Vielle-Calzada, J.-P., Grossniklaus, U. and Chua, N.-H. (2001). LAF1, a MYB transcription activator for phytochrome A signaling. Genes and Development 15(19): 2613-2625.

Baniulis, D., Yamashita, E., Zhang, H., Hasan, S. S. and Cramer, W. A. (2008). Structure-function of the cytochrome b6f complex. Photochemistry and Photobiology 84(6): 1349-1358.

Barber, J. (2002). Photosystem II: A multisubunit membrane protein that oxidises water. Current Opinion in Structural Biology 12(4): 523-530.

Barber, J. and Andersson, B. (1992). Too much of a good thing: Light can be bad for photosynthesis. Trends in Biochemical Sciences 17(2): 61-66.

Bassham, J. A., Benson, A. A., Kay, L. D., Harris, A. Z., Wilson, A. T. and Calvin, M. (1954). The path of carbon in photosynthesis. XXI. The cyclic regeneration of carbon dioxide acceptor1. Journal of the American Chemical Society 76(7): 1760-1770.

Bassham, J. A. and Krause, G. H. (1969). Free energy changes and metabolic regulation in steady-state photosynthetic carbon reduction. Biochimica et Biophysica Acta 189(2): 207-221.

Baxevanis, A. D., Arents, G., Moudrianakis, E. N. and Landsman, D. (1995). A variety of DNA-binding and multimeric proteins contain the histone fold motif. Nucleic Acids Research 23(14): 2685-2691.

Ben-Naim, O., Eshed, R., Parnis, A., Teper-Bamnolker, P., Shalit, A., Coupland, G., Samach, A. and Lifschitz, E. (2006). The CCAAT binding factor can mediate interactions between CONSTANS-like proteins and DNA. Plant Journal 46(3): 462-476.

Benoist, C., O'Hare, K., Breathnach, R. and Chambon, P. (1980). The ovalbumin gene-sequence of putative control regions. Nucleic Acids Research 8(1): 127-142.


Berry, M., Grosveld, F. and Dillon, N. (1992). A single point mutation is the cause of the greek form of hereditary persistence of fetal haemoglobin. Nature 358(6386): 499-502.

Blázquez, M. A. (1997). Illuminating flowers: CONSTANS induces LEAFY expression. Bioessays 19(4): 277-279.

Blázquez, M. A. and Weigel, D. (2000). Integration of floral inductive signals in Arabidopsis. Nature 404(6780): 889-892.

Blum, A. (1990). Variation among wheat cultivars in the response of leaf gas exchange to light. The Journal of Agricultural Science 115(03): 305-311.

Bohlenius, H., Huang, T., Charbonnel-Campaa, L., Brunner, A. M., Jansson, S., Strauss, S. H. and Nilsson, O. (2006). CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science 312(5776): 1040-1043.

Bolle, C., Koncz, C. and Chua, N.-H. (2000). PAT1, a new member of the GRAS family, is involved in phytochrome A signal transduction. Genes and Development 14(10): 1269-1278.

Brettel, K. and Leibl, W. (2001). Electron transfer in photosystem I. Biochimica et Biophysica Acta 1507(1-3): 100-114.

Briggs, W. R. and Christie, J. M. (2002). Phototropins 1 and 2: Versatile plant blue-light receptors. Trends in Plant Science 7(5): 204-210.

Briggs, W. R. and Olney, M. A. (2001). Photoreceptors in plant photomorphogenesis to date. Five phytochromes, two cryptochromes, one phototropin, and one superchrome. Plant Physiology 125(1): 85-88.

Brock, M. T., Maloof, J. N. and Weinig, C. (2010). Genes underlying quantitative variation in ecologically important traits: PIF4 (phytochrome interacting factor 4) is associated with variation in internode length, flowering time, and fruit set in Arabidopsis thaliana. Molecular Ecology 19(6): 1187-1199.

Brudler, R., Hitomi, K., Daiyasu, H., Toh, H., Kucho, K.-i., Ishiura, M., Kanehisa, M., Roberts, V. A., Todo, T., Tainer, J. A. and Getzoff, E. D. (2003). Identification of a new cryptochrome class: Structure, function, and evolution. Molecular Cell 11(1): 59-67.

Buchanan, B. B. (1980). Role of light in the regulation of chloroplast enzymes. Annual Review of Plant Physiology 31(1): 341-374.

Bucher, P. (1990). Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. Journal of Molecular Biology 212(4): 563-578.

Buléon, A., Colonna, P., Planchot, V. and Ball, S. (1998). Starch granules: Structure and biosynthesis. International Journal of Biological Macromolecules 23(2): 85-112.

Butler, W. L., Norris, K. H., Siegelman, H. W. and Hendricks, S. B. (1959). Detection, assay, and preliminary purification of the pigment controlling


photoresponsive development of plants. Proceedings of the National Academy of Sciences of the United States of America 45(12): 1703-1708.


Calderini, D. F., Dreccer, M. F. and Slafer, G. A. (1995). Genetic improvement in wheat yield and associated traits. A re-examination of previous results and the latest trends. Plant Breeding 114(2): 108-112.

Calderini, D. F., Reynolds, M. P. and Slafer, G. A. (1999). Genetic gains in wheat yield and associated physiological changes during the twentieth century. In: Wheat: ecology and physiology of yield determination. Eds. E. Satorre and G Slafer. Haworth Press Incorporated. New York.

Calderini, D. F. and Slafer, G. A. (1998). Changes in yield and yield stability in wheat during the 20th century. Field Crops Research 57(3): 335-347.

Carabelli, M., Morelli, G., Whitelam, G. and Ruberti, I. (1996). Twilight-zone and canopy shade induction of the Athb-2 homeobox gene in green plants. Proceedings of the National Academy of Sciences of the United States of America 93(8): 3530-3535.

Casal, J. J. and Yanovsky, M. J. (2005). Regulation of gene expression by light. International Journal of Developmental Biology 49(5-6): 501-511.

Casson, S. A., Franklin, K. A., Gray, J. E., Grierson, C. S., Whitelam, G. C. and Hetherington, A. M. (2009). Phytochrome B and PIF4 regulate stomatal development in response to light quantity. Current biology : CB 19(3): 229-234.

Charles, S. A. and Halliwell, B. (1981). Light activation of fructose bisphosphatase in isolated spinach chloroplasts and deactivation by hydrogen peroxide. Planta 151(3): 242-246.

Chattopadhyay, S., Ang, L.-H., Puente, P., Deng, X.-W. and Wei, N. (1998). Arabidopsis bZIP protein HY5 directly interacts with light-responsive promoters in mediating light control of gene expression. The Plant Cell 10(5): 673-684.

Chen, M., Chory, J. and Fankhauser, C. (2004). Light-signal transduction in higher plants. Annual Review of Genetics 38: 87-117.


Chouard, P. (1960). Vernalization and its relations to dormancy. Annual Review of Plant Physiology 11(1): 191-238.

Christie, J. M. (2007). Phototropin blue-light receptors. Annual Review of Plant Biology 58: 21-45.

Christie, J. M., Reymond, P., Powell, G. K., Bernasconi, P., Raibekas, A. A., Liscum, E. and Briggs, W. R. (1998). Arabidopsis NPH1: A flavoprotein with


the properties of a photoreceptor for phototropism. Science 282(5394): 1698-1701.

Christie, J. M., Salomon, M., Nozue, K., Wada, M. and Briggs, W. R. (1999). Lov (light, oxygen, or voltage) domains of the blue-light photoreceptor phototropin (nph1): Binding sites for the chromophore flavin mononucleotide. Proceedings of the National Academy of Sciences of the United States of America 96(15): 8779-8783.

Churin, Y., Adam, E., Kozma-Bognar, L., Nagy, F. and Börner, T. (2003). Characterization of two myb-like transcription factors binding to CAB promoters in wheat and barley. Plant Molecular Biology 52(2): 447-462.

Corbesier, L., Vincent, C., Jang, S., Fornara, F., Fan, Q., Searle, I., Giakountis, A., Farrona, S., Gissot, L., Turnbull, C. and Coupland, G. (2007). FT protein movement contributes to long-distance signaling in floral induction of Arabidopsis. Science 316(5827): 1030-1033.

Corrado, M. E., Aliverti, A., Zanetti, G. and Mayhew, S. G. (1996). Analysis of the oxidation-reduction potentials of recombinant ferredoxin-NADP+ reductase from spinach chloroplasts. European Journal of Biochemistry 239(3): 662-667.

Cramer, W. A., Zhang, H., Yan, J., Kurisu, G. and Smith, J. L. (2004). Evolution of photosynthesis: Time-independent structure of the cytochrome b6f complex. Biochemistry 43(20): 5921-5929.

Cseke, L. J., Zheng, J. and Podila, G. K. (2003). Characterization of PTM5 in aspen trees: A MADS-box gene expressed during woody vascular development. Gene 318: 55-67.

Dang, V. D., Bohn, C., Bolotin-Fukuhara, M. and Daignan-Fornier, B. (1996). The CCAAT-box-binding factor stimulates ammonium assimilation in Saccharomyces cerevisiae, defining a new cross-pathway regulation between nitrogen and carbon metabolisms. The Journal of Bacteriology 178(7): 1842-1849.

Datta, A. G. and Racker, E. (1961). Mechanism of action of transketolase. Journal of Biological Chemistry 236(3): 617-623.

Davidson, J., Christian, K., Jones, D. and Bremner, P. (1985). Responses of wheat to vernalization and photoperiod. Australian Journal of Agricultural Research 36(3): 347-359.

de Lucas, M., Daviere, J.-M., Rodriguez-Falcon, M., Pontin, M., Iglesias-Pedraz, J. M., Lorrain, S., Fankhauser, C., Blazquez, M. A., Titarenko, E. and Prat, S. (2008). A molecular framework for light and gibberellin control of cell elongation. Nature 451(7177): 480-484.

Demarsy, E. and Fankhauser, C. (2009). Higher plants use LOV to perceive blue-light. Current Opinion in Plant Biology 12(1): 69-74.

Dennis, E. S. and Peacock, W. J. (2007). Epigenetic regulation of flowering. Current Opinion in Plant Biology 10(5): 520-527.


Desai, M. and Hu, J. (2008). Light induces peroxisome proliferation in Arabidopsis seedlings through the photoreceptor phytochrome A, the transcription factor HY5 homolog, and the peroxisomal protein peroxin11b. Plant Physiology 146(3): 1117-1127.

Devlin, P. F., Christie, J. M. and Terry, M. J. (2007). Many hands make light work. Journal of Experimental Botany 58(12): 3071-3077.

Devlin, P. F., Yanovsky, M. J. and Kay, S. A. (2003). A genomic analysis of the shade avoidance response in Arabidopsis. Plant Physiology 133(4): 1617-1629.

Dorn, A., Bollekens, J., Staub, A., Benoist, C. and Mathis, D. (1987). A multiplicity of CCAAT-box-binding proteins. Cell 50(6): 863-872.

Duek, P. D. and Fankhauser, C. (2003). HFR1, a putative bHLH transcription factor, mediates both phytochrome A and cryptochrome signalling. The Plant Journal 34(6): 827-836.

Dvorak, J., Luo, M. C., Yang, Z. L. and Zhang, H. B. (1998). The structure of the Aegilops tauschii genepool and the evolution of hexaploid wheat. Theoretical and Applied Genetics 97(4): 657-670.

Dvorak, J., McGuire, P. and Cassidy, B. (1988). Apparent sources of the a genomes of wheats inferred from polymorphism in abundance and restriction fragment length of repeated nucleotide sequences. Genome 30(5): 680-689.

Edwards, D., Murray, J. A. and Smith, A. G. (1998). Multiple genes encoding the conserved CCAAT-box transcription factor complex are expressed in Arabidopsis. Plant Physiology 117(3): 1015-1022.

Efstratiadis, A., Posakony, J. W., Maniatis, T., Lawn, R. M., O'Connell, C., Spritz, R. A., Deriel, J. K., Forget, B. G., Weissman, S. M., Slightom, J. L., Blechl, A. E., Smithies, O., Baralle, F. E., Shoulders, C. C. and Proudfoot, N. J. (1980). The structure and evolution of the human [beta]-globin gene family. Cell 21(3): 653-668.

Ellis, R. J. (1979). The most abundant protein in the world. Trends in Biochemical Sciences 4(11): 241-244.

Emerson, R. (1958). The quantum yield of photosynthesis. Annual Review of Plant Physiology 9(1): 1-24.

Eskling, M., Arvidsson, P. O. and Åkerlund, H. E. (1997). The xanthophyll cycle, its regulation and components. Physiologia Plantarum 100(4): 806-816.

Evans, L. T. (1971). Flower induction and the florigen concept. Annual Review of Plant Physiology 22(1): 365-394.

Evans, L. T. (1993). Increases in yield: trends and limits. In: Crop evolution, adaptation and yield. Cambridge University Press. Cambridge.

Fairchild, C. D., Schumaker, M. A. and Quail, P. H. (2000). HFR1 encodes an atypical bHLH protein that acts in phytochrome A signal transduction. Genes and Development 14(18): 2377-2391.


Fankhauser, C. (2001). The phytochromes, a family of red/far-red absorbing photoreceptors. Journal of Biological Chemistry 276(15): 11453-11456.

FAO. (2008). "Food and agriculture organization of the united nations.", from http://www.fao.org/.

Farquhar, G. D., Caemmerer, S. and Berry, J. A. (1980). A biochemical model of photosynthetic CO2 assimilation in leaves of C3 species. Planta 149(1): 78-90.

Farquhar, G. D. and von Caemmerer, S. (1982). Modelling of photosynthetic response to environmental conditions. In: Encyclopedia of plant physiology. New series. Volume 12B. Physiological plant ecology. II. Water relations and carbon assimilation. Eds. O. Lange, P Nobel, C. Osmond and H. Ziegler. Springer-Verlag. Berlin.

Ferrándiz, C., Gu, Q., Martienssen, R. and Yanofsky, M. (2000). FRUITFULL involvement in floral meristem identity in Arabidopsis. Development 127: 725-734.

Fischer, R.(2007). Understanding the physiological basis of yield potential in wheat. Journal of Agricultural Science 145(2): 99-113.

Fischer, R., Rees, D., Sayre, K., Lu, Z.-M., Condon, A. and Saavedra A. (1998). Wheat yield progress associated with higher stomatal conductance and photosynthetic rate, and cooler canopies. Crop Science 38(6): 1467-1475.

Fitter, D. W., Martin, D. J., Copley, M. J., Scotland, R. W. and Langdale, J. A. (2002). GLK gene pairs regulate chloroplast development in diverse plant species. The Plant Journal 31(6): 713-727.

Franklin, K. A., Praekelt, U., Stoddart, W. M., Billingham, O. E., Halliday, K. J. and Whitelam, G. C. (2003). Phytochromes B, D, and E act redundantly to control multiple physiological responses in Arabidopsis. Plant Physiology 131(3): 1340-1346.

Furuya, M. (1993). Phytochromes: Their molecular species, gene families, and functions. Annual Review of Plant Physiology and Plant Molecular Biology 44(1): 617-645.

Gaj, M. D., Zhang, S., Harada, J. J. and Lemaux, P. G. (2005). Leafy cotyledon genes are essential for induction of somatic embryogenesis of Arabidopsis. Planta 222(6): 977-988.

Gale, M. D. and Youssefian, S. (1985). Dwarfing genes in wheat. In: Progress in plant breeding. Eds. G. Russell. Butterworths. London.

Gao, Y., Li, J., Strickland, E., Hua, S., Zhao, H., Chen, Z., Qu, L. and Deng, X. W. (2004). An Arabidopsis promoter microarray and its initial usage in the identification of HY5 binding targets in vitro. Plant Molecular Biology 54(5): 683-699.

Garcia-Mendoza, E., Matthijs, H., Schubert, H. and Mur, L. (2002). Non-photochemical quenching of chlorophyll fluorescence in Chlorella fusca acclimated to constant and dynamic light conditions. Photosynthesis Research 74(3): 303-315.


Gott, M. B. (1957). Vernalization of green plants of a winter wheat. Nature 180(4588): 714-715.

Gramzow, L. and Theissen, G. (2010). A hitchhiker's guide to the MADS world of plants. Genome Biology 11(6): 214.

Gronostajski, R. M. (2000). Roles of the NFI/CTF gene family in transcription and development. Gene 249(1-2): 31-45.

Gusmaroli, G., Tonelli, C. and Mantovani, R. (2001). Regulation of the CCAAT-binding NF-Y subunits in Arabidopsis thaliana. Gene 264(2): 173-185.

Gusmaroli, G., Tonelli, C. and Mantovani, R. (2002). Regulation of novel members of the Arabidopsis thaliana CCAAT-binding nuclear factor Y subunits. Gene 283(1-2): 41-48.

Harada, A., Sakai, T. and Okada, K. (2003). Phot1 and phot2 mediate blue-light-induced transient increases in cytosolic ca2+ differently in Arabidopsis leaves. Proceedings of the National Academy of Sciences of the United States of America 100(14): 8583-8588.

Harley, P. C. and Sharkey, T. D. (1991). An improved model of C3 photosynthesis at high CO2: Reversed O2 sensitivity explained by lack of glycerate reentry into the chloroplast. Photosynthesis Research 27(3): 169-178.

Harrison E. P., Willingham N. M., Lloyd J. C., Raines C. A. (1997) Reduced sedoheptulose-1,7-bisphosphatase levels in transgenic tobacco lead to decreased photosynthetic capacity and altered carbohydrate accumulation. Planta 204:27-36.

Harrison, E. P., Olcer, H., Lloyd, J. C., Long, S. P. and Raines, C. A. (2001). Small decreases in SBPase cause a linear decline in the apparent RuBP regeneration rate, but do not affect RuBisCO carboxylation capacity. Journal of Experimental Botany 52(362): 1779-1784.

Hartman, F. C. and Harpel, M. R. (1994). Structure, function, regulation, and assembly of d-ribulose-1,5-bisphosphate carboxylase/oxygenase. Annual Review of Biochemistry 63(1): 197-232.

Havaux, M. and Niyogi, K. K. (1999). The violaxanthin cycle protects plants from photooxidative damage by more than one mechanism. Proceedings of the National Academy of Sciences of the United States of America 96(15): 8762-8767.

Helliwell, C. A., Wood, C. C., Robertson, M., James Peacock, W. and Dennis, E. S. (2006). The Arabidopsis FLC protein interacts directly in vivo with SOC1 and FT chromatin and is part of a high-molecular-weight protein complex. The Plant Journal 46(2): 183-192.

Hemming, M. N., Peacock, W. J., Dennis, E. S. and Trevaskis, B. (2008). Low-temperature and day-length cues are integrated to regulate flowering locus t in barley. Plant Physiology 147(1): 355-366.


Hempel, F. D., Weigel, D., Mandel, M. A., Ditta, G., Zambryski, P. C., Feldman, L. J. and Yanofsky, M. F. (1997). Floral determination and expression of floral regulatory genes in Arabidopsis. Development 124(19): 3845-3853.

Hepworth, S. R., Valverde, F., Ravenscroft, D., Mouradov, A. and Coupland, G. (2002). Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs. EMBO Journal 21(16): 4327-4337.

Herold, A. (1980). Regulation of photosynthesis by sink activity–the missing link. New Phytologist 86(2): 131-144.

Holm, M., Ma, L. G., Qu, L. J. and Deng, X. W. (2002). Two interacting bZIP proteins are direct targets of COP1-mediated control of light-dependent gene expression in Arabidopsis. Genes and Development 16(10): 1247-1259.

Horecker, B. L., Cheng, T. and Pontremoli, S. (1963). The coupled reaction catalyzed by the enzymes transketolase and transaldolase. Journal of Biological Chemistry 238(10): 3428-3431.

Horecker, B. L., Smyrniotis, P. Z. and Hurwitz, J. (1956). The role of xylulose 5-phosphate in the transketolase reaction. Journal of Biological Chemistry 223(2): 1009-1019.

Hornitschek, P., Lorrain, S., Zoete, V., Michielin, O. and Fankhauser, C. (2009). Inhibition of the shade avoidance response by formation of non-DNA-binding bHLH heterodimers. EMBO Journal 28(24): 3893-3902.

Hudson, G. S., Evans, J. R., von Caemmerer, S., Arvidsson, Y. B. and Andrews, T. J. (1992). Reduction of ribulose-1,5-bisphosphate carboxylase/oxygenase content by antisense RNA reduces photosynthesis in transgenic tobacco plants. Plant Physiology 98(1): 294-302.

Hudson, M. E. and Quail, P. H. (2003). Identification of promoter motifs involved in the network of phytochrome A-regulated gene expression by combined analysis of genomic sequence and microarray data. Plant Physiology 133(4): 1605-1616.

Huq, E., Al-Sady, B., Hudson, M., Kim, C., Apel, K. and Quail, P. H. (2004). Phytochrome-interacting factor 1 is a critical bHLH regulator of chlorophyll biosynthesis. Science 305(5692): 1937-1941.

Huq, E. and Quail, P. H. (2002). PIF4, a phytochrome-interacting bHLH factor, functions as a negative regulator of phytochrome B signaling in Arabidopsis. EMBO Journal 21(10): 2441-2450.

Hurwitz, J., Weissbach, A., Horecker, B. L. and Smyrniotis, P. Z. (1956). Spinach phosphoribulokinase. Journal of Biological Chemistry 218(2): 769-783.

Jakoby, W. B., Brummond, D. O. and Ochoa, S. (1956). Formation of 3-phosphoglyceric acid by carbon dioxide fixation with spinach leaf enzymes. Journal of Biological Chemistry 218(2): 811-822.

Janoudi, A. k., Konjevic, R., Whitelam, G., Gordon, W. and Poff, K. L. (1997). Both phytochrome A and phytochrome B are required for the normal expression of phototropism in Arabidopsis thaliana seedlings. Physiologia Plantarum 101(2): 278-282.


Jiao, Y., Ma, L., Strickland, E. and Deng, X. W. (2005). Conservation and divergence of light-regulated genome expression patterns during seedling development in rice and Arabidopsis. Plant Cell 17(12): 3239-3256.

Jiao, Y., Yang, H., Ma, L., Sun, N., Yu, H., Liu, T., Gao, Y., Gu, H., Chen, Z., Wada, M., Gerstein, M., Zhao, H., Qu, L.-J. and Deng, X. W. (2003). A genome-wide analysis of blue-light regulation of Arabidopsis transcription factor gene expression during seedling development. Plant Physiology 133(4): 1480-1493.

Jonassen, E. M., Lea, U. S. and Lillo, C. (2008). HY5 and HYH are positive regulators of nitrate reductase in seedlings and rosette stage plants. Planta 227(3): 559-564.

Kagaya, Y., Toyoshima, R., Okuda, R., Usui, H., Yamamoto, A. and Hattori, T. (2005). LEAFY COTYLEDON1 controls seed storage protein genes through its regulation of FUSCA3 and ABSCISIC ACID INSENSITIVE3. Plant and Cell Physiology 46(3): 399-406.

Kardailsky, I., Shukla, V. K., Ahn, J. H., Dagenais, N., Christensen, S. K., Nguyen, J. T., Chory, J., Harrison, M. J. and Weigel, D. (1999). Activation tagging of the floral inducer FT. Science 286(5446): 1962-1965.

Kellogg, E. A. (1998). Relationships of cereal crops and other grasses. Proceedings of the National Academy of Sciences of the United States of America 95(5): 2005-2010.

Kendrick, R. and Kronenberg, G. (1986). The physiology of action. In: Photomorphogenesis in plants. Eds. R. Kendrick and G. Kronenberg. Martinus Nijhoff. Dordrecht.

Khanna, R., Huq, E., Kikis, E. A., Al-Sady, B., Lanzatella, C. and Quail, P. H. (2004). A novel molecular recognition motif necessary for targeting photoactivated phytochrome signaling to specific basic helix-loop-helix transcription factors. The Plant Cell 16(11): 3033-3044.

Khush, G. S. (2001). Green revolution: The way forward. Nature Reviews. Genetics 2(10): 815-822.

Kidokoro, S., Maruyama, K., Nakashima, K., Imura, Y., Narusaka, Y., Shinwari, Z. K., Osakabe, Y., Fujita, Y., Mizoi, J., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2009). The phytochrome-interacting factor PIF7 negatively regulates DREB1 expression under circadian control in Arabidopsis. Plant Physiology 151(4): 2046-2057.

Kihara, H. (1944). Discovery of the DD-analyser, one of the ancestors of Triticum vulgare. Agric. Hortic. 19: 13-14.

Kim, W.-Y., Fujiwara, S., Suh, S.-S., Kim, J., Kim, Y., Han, L., David, K., Putterill, J., Nam, H. G. and Somers, D. E. (2007). ZEITLUPE is a circadian photoreceptor stabilized by GIGANTEA in blue-light. Nature 449(7160): 356-360.


Kimber, G. and Feldman, M. (1987). Wild wheat: An introduction. In: Special report 353, College of Agriculture. University of Missouri. Columbia.

Kimber, G. and Sears, E. (1987). Evolution in the genus Triticum and the origin of cultivated wheat. In: Wheat and wheat improvement. Eds. E. G. Heyne. Soil Science Society of America. Madison.

Kircher, S., Kozma-Bognar, L., Kim, L., Adam, E., Harter, K., Schafer, E. and Nagy, F. (1999). Light quality–dependent nuclear import of the plant photoreceptors phytochrome A and B. The Plant Cell 11(8): 1445-1456.

Kleine, T., Lockhart, P. and Batschauer, A. (2003). An Arabidopsis protein closely related to Synechocystis cryptochrome is targeted to organelles. The Plant Journal 35(1): 93-103.

Klimyuk, V. I., Persello-Cartieaux, F., Havaux, M., Contard-David, P., Schuenemann, D., Meiherhoff, K., Gouet, P., Jones, J. D. G., Hoffman, N. E. and Nussaume, L. (1999). A chromodomain protein encoded by the Arabidopsis CAO gene is a plant-specific component of the chloroplast signal recognition particle pathway that is involved in lhcp targeting. The Plant Cell 11(1): 87-100.

Knaff, D. B. and Hirasawa, M. (1991). Ferredoxin-dependent chloroplast enzymes. Biochimica et Biophysica Acta 1056(2): 93-125.

Knight, S., Andersson, I. and Branden, C.-I. (1989). Reexamination of the three-dimensional structure of the small subunit of RuBisCO from higher plants. Science 244(4905): 702-705.

Kobayashi, Y., Kaya, H., Goto, K., Iwabuchi, M. and Araki, T. (1999). A pair of related genes with antagonistic roles in mediating flowering signals. Science 286(5446): 1960-1962.

Kojima, S., Takahashi, Y., Kobayashi, Y., Monna, L., Sasaki, T., Araki, T. and Yano, M. (2002). Hd3a, a rice ortholog of the Arabidopsis FT gene, promotes transition to flowering downstream of Hd1 under short-day conditions. Plant and Cell Physiology 43(10): 1096-1105.

Koornneef, M., Rolff, E. and Spruit, C. J. P. (1980). Genetic control of light-inhibited hypocotyl elongation in Arabidopsis thaliana (L.). Heynh. Zeitschrift Fur Pflanzenphysiologie 100: 147-160.

Koßmann, J., Sonnewald, U. and Willmitzer, L. (1994). Reduction of the chloroplastic fructose-1,6-bisphosphatase in transgenic potato plants impairs photosynthesis and plant growth. The Plant Journal 6(5): 637-650.

Kulshrestha, V. and Jain, H. (1982). Eighty years of wheat breeding in India: Past selection pressures and future prospects. Zeitschrift Fur Pflanzenzuchtung 89: 19-30.



Kumimoto, R. W., Zhang, Y., Siefers, N. and Holt, B. F. (2010). NF–YC3, NF–YC4 and NF–YC9 are required for CONSTANS-mediated, photoperiod-dependent flowering in Arabidopsis thaliana. The Plant Journal 63(3): 379-391.

Kusnetsov, V., Landsberger, M., Meurer, J. and Oelmuller, R. (1999). The assembly of the CAAT-box-binding complex at a photosynthesis gene promoter is regulated by light, cytokinin, and the stage of the plastids. Journal of Biological Chemistry 274(50): 36009-36014.

Kwong, R. W., Bui, A. Q., Lee, H., Kwong, L. W., Fischer, R. L., Goldberg, R. B. and Harada, J. J. (2003). LEAFY COTYLEDON1-LIKE defines a class of regulators essential for embryo development. Plant Cell 15(1): 5-18.

Kyozuka, J., Konishi, S., Nemoto, K., Izawa, T. and Shimamoto, K. (1998). Down-regulation of RFL, the FLO/LFY homolog of rice, accompanied with panicle branch initiation. Proceedings of the National Academy of Sciences 95(5): 1979-1982.

Laing, W. A., Ogren, W. L. and Hageman, R. H. (1974). Regulation of soybean net photosynthetic CO2 fixation by the interaction of CO2, O2, and ribulose 1,5-diphosphate carboxylase. Plant Physiology 54(5): 678-685.

Laing, W. A., Stitt, M. and Heldt, H. W. (1981). Control of CO2 fixation. Changes in the activity of ribulosephosphate kinase and fructose- and sedoheptulose-bisphosphatase in chloroplasts. Biochimica et Biophysica Acta 637(2): 348-359.

Lam, E. and Chua, N. H. (1989). Asf-2: A factor that binds to the cauliflower mosaic virus 35s promoter and a conserved gata motif in CAB promoters. The Plant Cell 1(12): 1147-1156.

Lane, H. C., Siegelman, H. W., Butler, W. L. and Firer, E. M. (1963). Detection of phytochrome in green plants. Plant Physiology 38(4): 414-416.

Law, C. N. and Worland, A. J. (1997). Genetic analysis of some flowering time and adaptive traits in wheat. New Phytologist 137(1): 19-28.

Lee, H., Fischer, R. L., Goldberg, R. B. and Harada, J. J. (2003). Arabidopsis LEAFY COTYLEDON1 represents a functionally specialized subunit of the CCAAT binding transcription factor. Proceedings of the National Academy of Sciences of the United States of America 100(4): 2152-2156.

Lee, H., Suh, S.-S., Park, E., Cho, E., Ahn, J. H., Kim, S.-G., Lee, J. S., Kwon, Y. M. and Lee, I. (2000). The AGAMOUS-LIKE 20 MADS domain protein integrates floral inductive pathways in Arabidopsis. Genes and Development 14(18): 2366-2376.

Lee, I. and Amasino, R. M. (1995). Effect of vernalization, photoperiod, and light quality on the flowering phenotype of Arabidopsis plants containing the FRIGIDA gene. Plant Physiology 108(1): 157-162.

Lee, J., He, K., Stolc, V., Lee, H., Figueroa, P., Gao, Y., Tongprasit, W., Zhao, H., Lee, I. and Deng, X. W. (2007). Analysis of transcription factor HY5 genomic binding sites revealed its hierarchical role in light regulation of development. Plant Cell 19(3): 731-749.


Lee, S., Kim, J., Han, J. J., Han, M. J. and An, G. (2004). Functional analyses of the flowering time gene OsMADS50, the putative SUPPRESSOR OF OVEREXPRESSION OF CO 1/AGAMOUS-LIKE 20 (SOC1/AGL20) ortholog in rice. Plant Journal 38(5): 754-764.

Leegood, R. (1990). Enzymes of the calvin cycle. In: Methods in plant biochemistry. Eds. P. J. Lea. Academic Press. London.

Lefebvre, S., Lawson, T., Zakhleniuk, O. V., Lloyd, J. C., Raines, C. A. and Fryer, M. (2005). Increased sedoheptulose-1,7-bisphosphatase activity in transgenic tobacco plants stimulates photosynthesis and growth from an early stage in development. Plant Physiology 138(1): 451-460.

Leivar, P., Monte, E., Al-Sady, B., Carle, C., Storer, A., Alonso, J. M., Ecker, J. R. and Quail, P. H. (2008). The Arabidopsis phytochrome-interacting factor PIF7, together with PIF3 and PIF4, regulates responses to prolonged red light by modulating phyB levels. Plant Cell 20(2): 337-352.

Lev-Yadun, S., Gopher, A. and Abbo, S. (2000). The cradle of agriculture. Science 288(5471): 1602-1603.

Li, C. and Dubcovsky, J. (2008). Wheat FT protein regulates VRN1 transcription through interactions with FDL2. The Plant Journal 55(4): 543-554.

Li, Q. H. and Yang, H. Q. (2007). Cryptochrome signaling in plants. Photochemistry and Photobiology 83(1): 94-101.

Li, W. X., Oono, Y., Zhu, J., He, X. J., Wu, J. M., Iida, K., Lu, X. Y., Cui, X., Jin, H. and Zhu, J. K. (2008). The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance. Plant Cell 20(8): 2238-2251.

Li, X. Y., Mantovani, R., Hooft van Huijsduijnen, R., Andre, I., Benoist, C. and Mathis, D. (1992). Evolutionary variation of the CCAAT-binding transcription factor NF-Y. Nucleic Acids Research 20(5): 1087-1091.

Lichtenthaler, H. K. (1999). The 1-deoxy-d-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants. Annual Review of Plant Physiology and Plant Molecular Biology 50(1): 47-65.

Lifschitz, E., Eviatar, T., Rozman, A., Shalit, A., Goldshmidt, A., Amsellem, Z., Alvarez, J. P. and Eshed, Y. (2006). The tomato FT ortholog triggers systemic signals that regulate growth and flowering and substitute for diverse environmental stimuli. Proceedings of the National Academy of Sciences of the United States of America 103(16): 6398-6403.

Lin, C., Ahmad, M. and Cashmore, A. R. (1996). Arabidopsis cryptochrome 1 is a soluble protein mediating blue-light-dependent regulation of plant growth and development. The Plant Journal 10(5): 893-902.

Lin, C., Robertson, D. E. and Ahmad, M. (1995). Association of flavin adenine dinucleotide with the Arabidopsis blue-light receptor CRY1. Science 269(5226): 968-969.


Lin, C. and Shalitin, D. (2003). Cryptochrome structure and signal transduction. Annual Review of Plant Biology 54(1): 469-496.

Lin, C., Yang, H., Guo, H., Mockler, T., Chen, J. and Cashmore, A. R. (1998). Enhancement of blue-light sensitivity of Arabidopsis seedlings by a blue-light receptor cryptochrome 2. Proceedings of the National Academy of Sciences of the United States of America 95(5): 2686-2690.

Lin, M.-K., Belanger, H., Lee, Y.-J., Varkonyi-Gasic, E., Taoka, K.-I., Miura, E., Xoconostle-Cazares, B., Gendler, K., Jorgensen, R. A., Phinney, B., Lough, T. J. and Lucas, W. J. (2007). FLOWERING LOCUS T protein may act as the long-distance florigenic signal in the Cucurbits. The Plant Cell 19(5): 1488-1506.

Liscum, E. and Briggs, W. R. (1995). Mutations in the NPH1 locus of Arabidopsis disrupt the perception of phototropic stimuli. The Plant Cell 7(4): 473-485.

Liu, C., Xi, W., Shen, L., Tan, C. and Yu, H. (2009). Regulation of floral patterning by flowering time genes. Developmental Cell 16(5): 711-722.

Liu, C., Zhou, J., Bracha-Drori, K., Yalovsky, S., Ito, T. and Yu, H. (2007). Specification of Arabidopsis floral meristem identity by repression of flowering time genes. Development 134(10): 1901-1910.

Liu, J.-X. and Howell, S. H. (2010). bZIP28 and NF-Y transcription factors are activated by ER stress and assemble into a transcriptional complex to regulate stress response genes in Arabidopsis. Plant Cell 22(3): 782-796.

Long, S. P., Humphries, S. and Falkowski, P. G. (1994). Photoinhibition of photosynthesis in nature. Annual Review of Plant Physiology and Plant Molecular Biology 45(1): 633-662.

Long, S. P., Zhu, X. G., Naidu, S. L. and Ort, D. R. (2006). Can improvement in photosynthesis increase crop yields? Plant, Cell and Environment 29(3): 315-330.

Loomis, R. S. and Amthor, J. S. (1999). Yield potential, plant assimilatory capacity, and metabolic efficiencies. Crop Science 39(6): 1584-1596.

Lorrain, S., Allen, T., Duek, P. D., Whitelam, G. C. and Fankhauser, C. (2008). Phytochrome-mediated inhibition of shade avoidance involves degradation of growth-promoting bHLH transcription factors. The Plant Journal 53(2): 312-323.

Lorrain, S., Trevisan, M., Pradervand, S. and Fankhauser, C. (2009). Phytochrome interacting factors 4 and 5 redundantly limit seedling de-etiolation in continuous far-red light. The Plant Journal 60(3): 449-461.

Losada, M., Trebst, A. V. and Arnon, D. I. (1960). Photosynthesis by isolated chloroplasts. Journal of Biological Chemistry 235(3): 832-839.

Lotan, T., Ohto, M., Yee, K. M., West, M. A., Lo, R., Kwong, R. W., Yamagishi, K., Fischer, R. L., Goldberg, R. B. and Harada, J. J. (1998). Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 93(7): 1195-1205.


Loukoianov, A., Yan, L., Blechl, A., Sanchez, A. and Dubcovsky, J. (2005). Regulation of VRN-1 vernalization genes in normal and transgenic polyploid wheat. Plant Physiology 138(4): 2364-2373.

Lu, S. X., Knowles, S. M., Andronis, C., Ong, M. S. and Tobin, E. M. (2009). CIRCADIAN CLOCK ASSOCIATED1 and LATE ELONGATED HYPOCOTYL function synergistically in the circadian clock of Arabidopsis. Plant Physiology 150(2): 834-843.

Lutz, W. and Samir, K. (2010). Dimensions of global population projections: What do we know about future population trends and structures? Philosophical Transactions of the Royal Society B: Biological Sciences 365(1554): 2779-2791.

Maity, S. N. and de Crombrugghe, B. (1992). Biochemical analysis of the B subunit of the heteromeric CCAAT-binding factor. A DNA-binding domain and a subunit interaction domain are specified by two separate segments. Journal of Biological Chemistry 267(12): 8286-8292.

Makino, S., Matsushika, A., Kojima, M., Yamashino, T. and Mizuno, T. (2002). The APRR1/TOC1 quintet implicated in circadian rhythms of Arabidopsis thaliana: I. Characterization with APRR1-overexpressing plants. Plant and Cell Physiology 43(1): 58-69.

Mandel, M. A. and Yanofsky, M. F. (1995). A gene triggering flower formation in Arabidopsis. Nature 377(6549): 522-524.

Mantovani, R. (1998). A survey of 178 NF-Y binding CCAAT-boxes. Nucleic Acids Research 26(5): 1135-1143.

Mantovani, R. (1999). The molecular biology of the CCAAT-binding factor NF-Y. Gene 239(1): 15-27.

Manupeerapan, T., Davidson, J., Pearson, C. and Christian, K. (1992). Differences in flowering responses of wheat to temperature and photoperiod. Australian Journal of Agricultural Research 43(3): 575-584.

Martinez-Garcia, J. F., Huq, E. and Quail, P. H. (2000). Direct targeting of light-signals to a promoter element-bound transcription factor. Science 288(5467): 859-863.

Marziali, G., Perrotti, E., Ilari, R., Testa, U., Coccia, E. M. and Battistini, A. (1997). Transcriptional regulation of the ferritin heavy-chain gene: The activity of the CCAAT binding factor NF-Y is modulated in heme-treated friend leukemia cells and during monocyte-to-macrophage differentiation. Molecular and Cellular Biology 17(3): 1387-1395.

Masiero, S., Imbriano, C., Ravasio, F., Favaro, R., Pelucchi, N., Gorla, M. S., Mantovani, R., Colombo, L. and Kater, M. M. (2002). Ternary complex formation between MADS-box transcription factors and the histone fold protein NF-YB. Journal of Biological Chemistry 277(29): 26429-26435.

Maxwell, B. B., Andersson, C. R., Poole, D. S., Kay, S. A. and Chory, J. (2003). HY5, circadian clock-associated 1, and a cis-element, DET1 dark response


element, mediate DET1 regulation of chlorophyll a/b-binding protein 2 expression. Plant Physiology 133(4): 1565-1577.

McCarty, R. E., Evron, Y. and Johnson, E. A. (2000). The chloroplast atp synthase: A rotary enzyme? Annual Review of Plant Physiology and Plant Molecular Biology 51: 83-109.

McFadden, E. and Sears, E. (1944). The artificial synthesis of Triticum spelta. Genetics 30(14): (Abstr).

McFadden, E. S. and Sears, E. R. (1946). The origin of Triticum spelta and its free-threshing hexaploid relatives. Journal of Heredity 37(4): 107-116.

Meinke, D. W. (1992). A homoeotic mutant of Arabidopsis thaliana with leafy cotyledons. Science 258(5088): 1647-1650.

Melzer, S., Lens, F., Gennen, J., Vanneste, S., Rohde, A. and Beeckman, T. (2008). Flowering-time genes modulate meristem determinacy and growth form in Arabidopsis thaliana. Nature Genetics 40(12): 1489-1492.

Michaels, S. D. and Amasino, R. M. (2001). Loss of FLOWERING LOCUS C activity eliminates the late-flowering phenotype of FRIGIDA and autonomous pathway mutations but not responsiveness to vernalization. The Plant Cell 13(4): 935-942.

Miyoshi, K., Ito, Y., Serizawa, A. and Kurata, N. (2003). OsHAP3 genes regulate chloroplast biogenesis in rice. Plant Journal 36(4): 532-540.

Monte, E., Tepperman, J. M., Al-Sady, B., Kaczorowski, K. A., Alonso, J. M., Ecker, J. R., Li, X., Zhang, Y. and Quail, P. H. (2004). The phytochrome-interacting transcription factor, PIF3, acts early, selectively, and positively in light-induced chloroplast development. Proceedings of the National Academy of Sciences of the United States of America 101(46): 16091-16098.

Montgomery, B. L. and Lagarias, J. C. (2002). Phytochrome ancestry: sensors of bilins and light. Trends in Plant Science 7(8): 357-366.

Moon, J., Zhu, L., Shen, H. and Huq, E. (2008). PIF1 directly and indirectly regulates chlorophyll biosynthesis to optimize the greening process in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 105(27): 9433-9438.

Moose, S. P. and Mumm, R. H. (2008). Molecular plant breeding as the foundation for 21st century crop improvement. Plant Physiology 147(3): 969-977.

Moyroud, E., Kusters, E., Monniaux, M., Koes, R. and Parcy, F. (2010). LEAFY blossoms. Trends in Plant Science 15(6): 346-352.

Munekage, Y., Hashimoto, M., Miyake, C., Tomizawa, K., Endo, T., Tasaka, M. and Shikanai, T. (2004). Cyclic electron flow around photosystem I is essential for photosynthesis. Nature 429(6991): 579-582.

Murchie, E. H. and Horton, P. (2007). Toward C4 rice: Learning from acclimation of photosynthesis in the C3 leaf. In: Charting pathways to C4 rice. Eds. J. Sheehy, P. Mitchell and B. Hardy. International Rice Research Institute. Los Banos.


Nakamura, T., Song, I.-J., Fukuda, T., Yokoyama, J., Maki, M., Ochiai, T., Kameya, T. and Kanno, A. (2005). Characterization of TrcMADS1 gene of Trillium camtschatcense (trilliaceae) reveals functional evolution of the SOC1/TM3-like gene family. Journal of Plant Research 118(3): 229-234.

Nelson, D. E., Repetti, P. P., Adams, T. R., Creelman, R. A., Wu, J., Warner, D. C., Anstrom, D. C., Bensen, R. J., Castiglioni, P. P., Donnarummo, M. G., Hinchey, B. S., Kumimoto, R. W., Maszle, D. R., Canales, R. D., Krolikowski, K. A., Dotson, S. B., Gutterson, N., Ratcliffe, O. J. and Heard, J. E. (2007). Plant nuclear factor Y (NF-Y) B subunits confer drought tolerance and lead to improved corn yields on water-limited acres. Proceedings of the National Academy of Sciences of the United States of America 104(42): 16450-16455.

Nelson, N. and Ben-Shem, A. (2004). The complex architecture of oxygenic photosynthesis. Nature Reviews. Molecular Cell Biology 5(12): 971-982.

Ni, M., Tepperman, J. M. and Quail, P. H. (1998). PIF3, a phytochrome-interacting factor necessary for normal photoinduced signal transduction, is a novel basic helix-loop-helix protein. Cell 95(5): 657-667.

Ni, M., Tepperman, J. M. and Quail, P. H. (1999). Binding of phytochrome B to its nuclear signalling partner PIF3 is reversibly induced by light. Nature 400(6746): 781-784.

Nilsson, O., Lee, I., Blazquez, M. A. and Weigel, D. (1998). Flowering-time genes modulate the response to LEAFY activity. Genetics 150(1): 403-410.

Oh, E., Yamaguchi, S., Hu, J., Yusuke, J., Jung, B., Paik, I., Lee, H.-S., Sun, T.-p., Kamiya, Y. and Choi, G. (2007). PIL5, a phytochrome-interacting bHLH protein, regulates gibberellin responsiveness by binding directly to the GAI and RGA promoters in Arabidopsis seeds. The Plant Cell 19(4): 1192-1208.

Okamoto, M. (1962). Identification of the chromosomes of common wheat belonging to the A and B genomes. Genome 4: 31-37.

Osada, S., Yamamoto, H., Nishihara, T. and Imagawa, M. (1996). DNA-binding specificity of the CCAAT/enhancer-binding protein transcription factor family. Journal of Biological Chemistry 271(7): 3891-3896.

Osmond, C. (1994). What is photoinhibition? Some insights from comparisons of shade and sun plants. In: Photoinhibition of photosynthesis: From molecular mechanisms to the field. Eds. N. Baker and J. Bowyer. BIOS Scientific Publishers. Oxford.

Osterlund, M. T., Hardtke, C. S., Wei, N. and Deng, X. W. (2000). Targeted destabilization of HY5 during light-regulated development of Arabidopsis. Nature 405(6785): 462-466.

Oyama, T., Shimura, Y. and Okada, K. (1997). The Arabidopsis HY5 gene encodes a bZIP protein that regulates stimulus-induced development of root and hypocotyl. Genes and Development 11(22): 2983-2995.


Parry, M. A., Madgwick, P. J., Carvalho, J. F. C. and Andralojc, P. (2007). Prospects for increasing photosynthesis by overcoming the limitations of RuBisCO. Journal of Agricultural Science 145(1): 31-43.

Pfündel, E. and Bilger, W. (1994). Regulation and possible function of the violaxanthin cycle. Photosynthesis Research 42(2): 89-109.

Pinkham, J. L., Olesen, J. T. and Guarente, L. P. (1987). Sequence and nuclear localization of the Saccharomyces cerevisiae hap2 protein, a transcriptional activator. Molecular and Cellular Biology 7(2): 578-585.

Portis, A. R., Chon, C. J., Mosbach, A. and Heldt, H. W. (1977). Fructose-and sedoheptulosebisphosphatase. The sites of a possible control of CO2 fixation by light-dependent changes of the stromal Mg2+ concentration. Biochimica et Biophysica Acta 461(2): 313-325.

Prasad, K., Kushalappa, K. and Vijayraghavan, U. (2003). Mechanism underlying regulated expression of RFL, a conserved transcription factor, in the developing rice inflorescence. Mechanisms of Development 120(4): 491-502.

Preiss, J., Biggs, M. L. and Greenberg, E. (1967). The effect of magnesium ion concentration on the pH optimum of the spinach leaf alkaline fructose diphosphatase. Journal of Biological Chemistry 242(9): 2292-2294.

Preston, J. C. and Kellogg, E. A. (2006). Reconstructing the evolutionary history of paralogous APETALA1/FRUITFULL-LIKE genes in grasses (poaceae). Genetics 174(1): 421-437.

Putterill, J., Robson, F., Lee, K., Simon, R. and Coupland, G. (1995). The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell 80(6): 847-857.

Quail, P. (1997). An emerging molecular map of the phytochromes. Plant, Cell and Environment 20(6): 657-665.

Quick, W. and Neuhaus, H. (1997). The regulation and control of photosynthetic carbon assimilation. In: A molecular approach to primary metabolism in higher plants. Eds. C. Foyer and W. Quick. Taylor & Francis. London.

Quick, W., Schurr, U., Fichtner, K., Schulze, E. D., Rodermel, S., Bogorad, L. and Stitt, M. (1991). The impact of decreased RuBisCO on photosynthesis, growth, allocation and storage in tobacco plants which have been transformed with antisense rbcS. The Plant Journal 1(1): 51-58.

Raines, C. A. (2006). Transgenic approaches to manipulate the environmental responses of the C3 carbon fixation cycle. Plant, Cell and Environment 29(3): 331-339.

Reich, P. B., Walters, M. B. and Ellsworth, D. S. (1997). From tropics to tundra: Global convergence in plant functioning. Proceedings of the National Academy of Sciences of the United States of America 94(25): 13730-13734.

Reynolds, M., Bonnett, D., Chapman, S. C., Furbank, R. T., Manès, Y., Mather, D. E. and Parry, M. A. J. (2010). Raising yield potential of wheat. I. Overview of a


consortium approach and breeding strategies. Journal of Experimental Botany doi: 10.1093/jxb/erq311.

Reynolds, M. P., Pellegrineschi, A. and Skovmand, B. (2005). Sink-limitation to yield and biomass: A summary of some investigations in spring wheat. Annals of Applied Biology 146(1): 39-49.

Robson, F., Costa, M. M. R., Hepworth, S. R., Vizir, I., Pineiro, M., Reeves, P. H., Putterill, J. and Coupland, G. (2001). Functional importance of conserved domains in the flowering-time gene CONSTANS demonstrated by analysis of mutant alleles and transgenic plants. The Plant Journal 28(6): 619-631.

Romier, C., Cocchiarella, F., Mantovani, R. and Moras, D. (2003). The NF-YB/NF-YC structure gives insight into DNA-binding and transcription regulation by CCAAT factor NF-Y. Journal of Biological Chemistry 278(2): 1336-1345.

Ronchi, A., Berry, M., Raguz, S., Imam, A., Yannoutsos, N., Ottolenghi, S., Grosveld, F. and Dillon, N. (1996). Role of the duplicated CCAAT-box region in gamma-globin gene regulation and hereditary persistence of fetal haemoglobin. EMBO Journal 15(1): 143-149.

Rosegrant, M. W. and Cline, S. A. (2003). Global food security: Challenges and policies. Science 302(5652): 1917-1919.

Roy, B. and Lee, A. S. (1995). Transduction of calcium stress through interaction of the human transcription factor CBF with the proximal CCAAT regulatory element of the grp78/BiP promoter. Molecular and Cellular Biology 15(4): 2263-2274.

Sakamoto, K. and Briggs, W. R. (2002). Cellular and subcellular localization of phototropin 1. The Plant Cell 14(8): 1723-1735.

Salter, M. G., Franklin, K. A. and Whitelam, G. C. (2003). Gating of the rapid shade-avoidance response by the circadian clock in plants. Nature 426(6967): 680-683.

Samach, A., Onouchi, H., Gold, S. E., Ditta, G. S., Schwarz-Sommer, Z., Yanofsky, M. F. and Coupland, G. (2000). Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 288(5471): 1613-1616.

Sancar, A. (2003). Structure and function of DNA photolyase and cryptochrome blue-light photoreceptors. Chemical Reviews 103(6): 2203-2238.

Santos Mendoza, M., Dubreucq, B., Miquel, M., Caboche, M. and Lepiniec, L. (2005). LEAFY COTYLEDON 2 activation is sufficient to trigger the accumulation of oil and seed specific mRNAs in Arabidopsis leaves. FEBS Letters 579(21): 4666-4670.

Savitch, L. V., Allard, G., Seki, M., Robert, L. S., Tinker, N. A., Huner, N. P. A., Shinozaki, K. and Singh, J. (2005). The effect of overexpression of two Brassica CBF/DREB1-like transcription factors on photosynthetic capacity and freezing tolerance in Brassica napus. Plant and Cell Physiology 46(9): 1525-1539.

Sawa, M., Nusinow, D. A., Kay, S. A. and Imaizumi, T. (2007). FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis. Science 318(5848): 261-265.


Sayre, K. D., Rajaram, S. and Fischer, R. A. (1997). Yield potential progress in short bread wheats in northwest mexico. Crop Science 37(1): 36-42.

Schaffer, R., Ramsay, N., Samach, A., Corden, S., Putterill, J., Carré, I. A. and Coupland, G. (1998). The late elongated hypocotyl mutation of Arabidopsis disrupts circadian rhythms and the photoperiodic control of flowering. Cell 93(7): 1219-1229.

Scheller, H. V., Jensen, P. E., Haldrup, A., Lunde, C. and Knoetzel, J. (2001). Role of subunits in eukaryotic photosystem I. Biochimica et Biophysica Acta 1507(1-3): 41-60.

Schena, M., Lloyd, A. M. and Davis, R. W. (1993). The HAT4 gene of Arabidopsis encodes a developmental regulator. Genes and Development 7(3): 367-379.

Schimkat, D., Heineke, D. and Heldt, H. W. (1990). Regulation of sedoheptulose-1,7-bisphosphatase by sedoheptulose-7-phosphate and glycerate, and of fructose-1,6-bisphosphatase by glycerate in spinach chloroplasts. Planta 181(1): 97-103.

Searle, I. and Coupland, G. (2004). Induction of flowering by seasonal changes in photoperiod. EMBO Journal 23(6): 1217-1222.

Searle, I., He, Y., Turck, F., Vincent, C., Fornara, F., Kröber, S., Amasino, R. A. and Coupland, G. (2006). The transcription factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signaling in Arabidopsis. Genes and Development 20(7): 898-912.

Sears, E. (1954). The aneuploid of common wheat. Missouri Agricultural Experiment Station Research Bulletin 572: 1-57.

Seo, H. S., Yang, J.-Y., Ishikawa, M., Bolle, C., Ballesteros, M. L. and Chua, N.-H. (2003). LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. Nature 423(6943): 995-999.

Servaites, J. C. and Geiger, D. R. (1995). Regulation of ribulose 1,5-bisphosphate carboxylase/oxygenase by metabolites. Journal of Experimental Botany 46(special issue): 1277-1283.

Sessions, A., Yanofsky, M. F. and Weigel, D. (2000). Cell-cell signaling and movement by the floral transcription factors LEAFY and APETALA1. Science 289(5480): 779-781.

Sétif, P. (2001). Ferredoxin and flavodoxin reduction by photosystem I. Biochimica et Biophysica Acta 1507(1-3): 161-179.

Shahmuradov, I. A., Gammerman, A. J., Hancock, J. M., Bramley, P. M. and Solovyev, V. V. (2003). PlantProm: A database of plant promoter sequences. Nucleic Acids Research 31(1): 114-117.

Sharkey, T. (1985). Photosynthesis in intact leaves of C3 plants: Physics, physiology and rate limitations. The Botanical Review 51(1): 53-105.

Sharkey, T. D., Stitt, M., Heineke, D., Gerhardt, R., Raschke, K. and Heldt, H. W. (1986). Limitation of photosynthesis by carbon metabolism : II. O2-insensitive


CO2 uptake results from limitation of triose phosphate utilization. Plant Physiology 81(4): 1123-1129.

Sharrock, R. A. and Quail, P. H. (1989). Novel phytochrome sequences in Arabidopsis thaliana: Structure, evolution, and differential expression of a plant regulatory photoreceptor family. Genes and Development 3(11): 1745-1757.

Shen, H., Zhu, L., Castillon, A., Majee, M., Downie, B. and Huq, E. (2008). Light-induced phosphorylation and degradation of the negative regulator PHYTOCHROME-INTERACTING FACTOR1 from Arabidopsis depend upon its direct physical interactions with photoactivated phytochromes. The Plant Cell 20(6): 1586-1602.

Shin, J., Kim, K., Kang, H., Zulfugarov, I. S., Bae, G., Lee, C.-H., Lee, D. and Choi, G. (2009). Phytochromes promote seedling light responses by inhibiting four negatively-acting phytochrome-interacting factors. Proceedings of the National Academy of Sciences of the United States of America 106(18): 7660-7665.

Shin, J., Park, E. and Choi, G. (2007). PIF3 regulates anthocyanin biosynthesis in an HY5-dependent manner with both factors directly binding anthocyanin biosynthetic gene promoters in Arabidopsis. The Plant Journal 49(6): 981-994.

Shitsukawa, N., Takagishi, A., Ikari, C., Takumi, S. and Murai, K. (2006). WFL, a wheat FLORICAULA/LEAFY ortholog, is associated with spikelet formation as lateral branch of the inflorescence meristem. Genes & Genetic Systems 81:13-20.

Shitsukawa, N., Ikari, C., Shimada, S., Kitagawa, S., Sakamoto, K., Saito, H., Ryuto, H., Fukunishi, N., Abe, T., Takumi, S., Nasuda, S. and Murai, K. (2007). The einkorn wheat (Triticum monococcum) mutant, maintained vegetative phase, is caused by a deletion in the VRN1 gene. Genes and Genetic Systems 82(2): 167-170.


Siegel, M. I. and Lane, M. D. (1973). Chemical and enzymatic evidence for the participation of a 2-carboxy-3-ketoribitol-1,5-diphosphate intermediate in the carboxylation of ribulose 1,5-diphosphate. Journal of Biological Chemistry 248(15): 5486-5498.

Simon, R., Igeno, M. I. and Coupland, G. (1996). Activation of floral meristem identity genes in Arabidopsis. Nature 384(6604): 59-62.

Somerville, C. R. and Ogren, W. L. (1982). Genetic modification of photorespiration. Trends in Biochemical Sciences 7(5): 171-174.

Spreitzer, R. J. (1993). Genetic dissection of RuBisCO structure and function. Annual Review of Plant Physiology and Plant Molecular Biology 44(1): 411-434.


Spreitzer, R. J. and Salvucci, M. E. (2002). RuBisCO: Structure, regulatory interactions, and possibilities for a better enzyme. Annual Review of Plant Biology 53(1): 449-475.

Steidl, S., Papagiannopoulos, P., Litzka, O., Andrianopoulos, A., Davis, M. A., Brakhage, A. A. and Hynes, M. J. (1999). AnCF, the CCAAT binding complex of Aspergillus nidulans, contains products of the hapB, hapC, and hapE genes and is required for activation by the pathway-specific regulatory gene amdR. Molecular and Cellular Biology 19(1): 99-106.

Steindler, C., Matteucci, A., Sessa, G., Weimar, T., Ohgishi, M., Aoyama, T., Morelli, G. and Ruberti, I. (1999). Shade avoidance responses are mediated by the ATHB-2 HD-zip protein, a negative regulator of gene expression. Development 126(19): 4235-4245.

Stiller, M. (1962). The path of carbon in photosynthesis. Annual Review of Plant Physiology 13(1): 151-170.

Stitt, M., Gerhardt, R., Wilke, I. and Heldt, H. W. (1987). The contribution of fructose 2,6-bisphosphate to the regulation of sucrose synthesis during photosynthesis. Physiologia Plantarum 69(2): 377-386.

Stitt, M. and Quick, W. P. (1989). Photosynthetic carbon partitioning: Its regulation and possibilities for manipulation. Physiologia Plantarum 77(4): 633-641.

Stone, S. L., Kwong, L. W., Yee, K. M., Pelletier, J., Lepiniec, L., Fischer, R. L., Goldberg, R. B. and Harada, J. J. (2001). LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. Proceedings of the National Academy of Sciences of the United States of America 98(20): 11806-11811.

Suarez-Lopez, P., Wheatley, K., Robson, F., Onouchi, H., Valverde, F. and Coupland, G. (2001). CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature 410(6832): 1116-1120.

Tamoi, M., Nagaoka, M., Miyagawa, Y. and Shigeoka, S. (2006). Contribution of fructose-1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase to the photosynthetic rate and carbon flow in the calvin cycle in transgenic plants. Plant and Cell Physiology 47(3): 380-390.

Tepperman, J. M., Zhu, T., Chang, H.-S., Wang, X. and Quail, P. H. (2001). Multiple transcription-factor genes are early targets of phytochrome A signaling. Proceedings of the National Academy of Sciences of the United States of America 98(16): 9437-9442.

Thayer, S. S. and Björkman, O. (1992). Carotenoid distribution and deepoxidation in thylakoid pigment-protein complexes from cotton leaves and bundle-sheath cells of maize. Photosynthesis Research 33(3): 213-225.



Thorbjørnsen, T., Asp, T., Jørgensen, K. and Nielsen, T. (2002). Starch biosynthesis from triose-phosphate in transgenic potato tubers expressing plastidic fructose-1,6-bisphosphatase. Planta 214(4): 616-624.

Tobin, E. M. (1981). White light effects on the mRNA for the light-harvesting chlorophyll a/b-protein in Lemna gibba l. G-3. Plant Physiology 67(6): 1078-1083.

Traniello, S., Calcagno, M. and Pontremoli, S. (1971). Fructose 1,6-diphosphatase and sedoheptulose 1,7-diphosphatase from Candida utilis: Purification and properties. Archives of Biochemistry and Biophysics 146(2): 603-610.

Trentham, D. R., McMurray, C. H. and Pogson, C. I. (1969). The active chemical state of d-glyceraldehyde 3-phosphate in its reactions with d-glyceraldehyde 3-phosphate dehydrogenase, aldolase and triose phosphate isomerase. Biochemical Journal 114(1): 19-24.

Trevaskis, B., Bagnall, D. J., Ellis, M. H., Peacock, W. J. and Dennis, E. S. (2003). MADS box genes control vernalization-induced flowering in cereals. Proceedings of the National Academy of Sciences of the United States of America 100(22): 13099-13104.

Trevaskis, B., Hemming, M. N., Peacock, W. J. and Dennis, E. S. (2006). HvVRN2 responds to day-length, whereas HvVRN1 is regulated by vernalization and developmental status. Plant Physiology 140(4): 1397-1405.

Turner, A., Beales, J., Faure, S., Dunford, R. P. and Laurie, D. A. (2005). The pseudo-response regulator ppd-h1 provides adaptation to photoperiod in barley. Science 310(5750): 1031-1034.

Valverde, F., Mouradov, A., Soppe, W., Ravenscroft, D., Samach, A. and Coupland, G. (2004). Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303(5660): 1003-1006.

von Arnim, A. G. and Deng, X.-W. (1994). Light inactivation of Arabidopsis photomorphogenic repressor COP1 involves a cell-specific regulation of its nucleocytoplasmic partitioning. Cell 79(6): 1035-1045.

von Braun, J. (2010). Food insecurity, hunger and malnutrition: Necessary policy and technology changes. New Biotechnology doi: 10.1016/j.nbt.2010.08.006.

von Caemmerer, S. (2000). Modelling C3 photosynthesis. In: Biochemical models of leaf photosynthesis. CSIRO Publishing. Collingwood.

von Caemmerer, S. and Farquhar, G. D. (1981). Some relationships between the biochemistry of photosynthesis and the gas exchange of leaves. Planta 153(4): 376-387.

Wang, G.-Z., Miyashita, N. T. and Tsunewaki, K. (1997). Plasmon analyses of Triticum (wheat) and Aegilops: PCR–single-strand conformational polymorphism (PCR-SSCP) analyses of organellar DNAs. Proceedings of the National Academy of Sciences of the United States of America 94(26): 14570-14577.


Wang, H., Ma, L.-G., Li, J.-M., Zhao, H.-Y. and Deng, X. W. (2001). Direct interaction of Arabidopsis cryptochromes with COP1 in light control development. Science 294(5540): 154-158.

Wang, Q., Zhang, Q., Zhu, X. G., Lu, C., Kuang, T. and Li, C. (2002). PSII photochemistry and xanthophyll cycle in two superhigh‐yield rice hybrids, liangyoupeijiu and Hua‐an 3, during photoinhibition and subsequent restoration. Acta Botanica Sinica 44: 1297-1302.

Wang, Z. Y., Kenigsbuch, D., Sun, L., Harel, E., Ong, M. S. and Tobin, E. M. (1997). A Myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. Plant Cell 9(4): 491-507.

Wang, Z. Y. and Tobin, E. M. (1998). Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell 93(7): 1207-1217.

Warpeha, K. M., Upadhyay, S., Yeh, J., Adamiak, J., Hawkins, S. I., Lapik, Y. R., Anderson, M. B. and Kaufman, L. S. (2007). The GCR1, GPA1, PRN1, NF-Y signal chain mediates both blue-light and abscisic acid responses in Arabidopsis. Plant Physiology 143(4): 1590-1600.

Watanabe, N., Evans, J. R. and Chow, W. S. (1994). Changes in the photosynthetic properties of Australian wheat cultivars over the last century. Functional Plant Biology 21(2): 169-183.

Waters, M. T. and Langdale, J. A. (2009). The making of a chloroplast. EMBO Journal 28(19): 2861-2873.

Watson, L., Clifford, H. T. and Dallwitz, M. J. (1985). The classification of poaceae: Subfamilies and supertribes. Australian Journal of Botany 33(4): 433-484.

Wedel, A. and Ziegler-Heitbrock, H. W. (1995). The C/EBP family of transcription factors. Immunobiology 193(2-4): 171-185.

Weigel, D., Alvarez, J., Smyth, D. R., Yanofsky, M. F. and Meyerowitz, E. M. (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell 69(5): 843-859.

Weigel, D. and Meyerowitz, E. M. (1993). Activation of floral homeotic genes in Arabidopsis. Science 261(5129): 1723-1726.

Weissbach, A., Horecker, B. L. and Hurwitz, J. (1956). The enzymatic formation of phosphoglyceric acid from ribulose diphosphate and carbon dioxide. Journal of Biological Chemistry 218(2): 795-810.

Wenkel, S., Turck, F., Singer, K., Gissot, L., Le Gourrierec, J., Samach, A. and Coupland, G. (2006). CONSTANS and the CCAAT-box-binding complex share a functionally important domain and interact to regulate flowering of Arabidopsis. Plant Cell 18(11): 2971-2984.

Whitechurch, E. M., Slafer, G. A. and Miralles, D. J. (2007). Variability in the duration of stem elongation in wheat genotypes and sensitivity to photoperiod and vernalization. Journal of Agronomy and Crop Science 193(2): 131-137.


Wigge, P. A., Kim, M. C., Jaeger, K. E., Busch, W., Schmid, M., Lohmann, J. U. and Weigel, D. (2005). Integration of spatial and temporal information during floral induction in Arabidopsis. Science 309(5737): 1056-1059.

Woodrow, I. E. and Berry, J. A. (1988). Enzymatic regulation of photosynthetic CO2, fixation in C3 plants. Annual Review of Plant Physiology and Plant Molecular Biology 39(1): 533-594.

Woodrow, I. E., Murphy, D. J. and Latzko, E. (1984). Regulation of stromal sedoheptulose 1,7-bisphosphatase activity by pH and Mg2+ concentration. Journal of Biological Chemistry 259(6): 3791-3795.

Worland, A. J., Appendino, M. L. and Sayers, E. J. (1994). The distribution, in European winter wheats, of genes that influence ecoclimatic adaptability whilst determining photoperiodic insensitivity and plant height. Euphytica 80(3): 219-228.

Worland, A. J., Börner, A., Korzun, V., Li, W. M., Petrovíc, S. and Sayers, E. J. (1998). The influence of photoperiod genes on the adaptability of European winter wheats. Euphytica 100(1): 385-394.

Wu, S.-H. and Lagarias, J. C. (2000). Defining the bilin lyase domain: Lessons from the extended phytochrome superfamily. Biochemistry 39(44): 13487-13495.

Xia, X.-J., Huang, L.-F., Zhou, Y.-H., Mao, W.-H., Shi, K., Wu, J.-X., Asami, T., Chen, Z. and Yu, J.-Q. (2009). Brassinosteroids promote photosynthesis and growth by enhancing activation of RuBisCO and expression of photosynthetic genes in Cucumis sativus. Planta 230(6): 1185-1196.

Xing, Y., Zhang, S., Olesen, J. T., Rich, A. and Guarente, L. (1994). Subunit interaction in the CCAAT-binding heteromeric complex is mediated by a very short alpha-helix in HAP2. Proceedings of the National Academy of Sciences of the United States of America 91(8): 3009-3013.

Yamamoto, H. (1979). Biochemistry of the violaxanthin cycle in higher plants. Pure and Applied Chemistry 51: 639-648.

Yan, L., Fu, D., Li, C., Blechl, A., Tranquilli, G., Bonafede, M., Sanchez, A., Valarik, M., Yasuda, S. and Dubcovsky, J. (2006). The wheat and barley vernalization gene VRN3 is an orthologue of FT. Proceedings of the National Academy of Sciences of the United States of America 103(51): 19581-19586.

Yan, L., Loukoianov, A., Blechl, A., Tranquilli, G., Ramakrishna, W., SanMiguel, P., Bennetzen, J. L., Echenique, V. and Dubcovsky, J. (2004). The wheat VRN2 gene is a flowering repressor down-regulated by vernalization. Science 303(5664): 1640-1644.

Yan, L., Loukoianov, A., Tranquilli, G., Helguera, M., Fahima, T. and Dubcovsky, J. (2003). Positional cloning of the wheat vernalization gene VRN1. Proceedings of the National Academy of Sciences of the United States of America 100(10): 6263-6268.


Yang, H.-Q., Wu, Y.-J., Tang, R.-H., Liu, D., Liu, Y. and Cashmore, A. R. (2000). The C termini of Arabidopsis cryptochromes mediate a constitutive light response. Cell 103(5): 815-827.

Yang, K.-Y., Kim, Y.-M., Lee, S., Song, P.-S. and Soh, M.-S. (2003). Overexpression of a mutant basic helix-loop-helix protein HFR1, HFR1-ΔN105, activates a branch pathway of light-signaling in Arabidopsis. Plant Physiology 133(4): 1630-1642.

Yanovsky, M. J. and Kay, S. A. (2002). Molecular basis of seasonal time measurement in Arabidopsis. Nature 419(6904): 308-312.

Yeh, K.-C. and Lagarias, J. C. (1998). Eukaryotic phytochromes: Light-regulated serine/threonine protein kinases with histidine kinase ancestry. Proceedings of the National Academy of Sciences of the United States of America 95(23): 13976-13981.

Yoo, S. K., Chung, K. S., Kim, J., Lee, J. H., Hong, S. M., Yoo, S. J., Yoo, S. Y., Lee, J. S. and Ahn, J. H. (2005). CONSTANS activates SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 through FLOWERING LOCUS T to promote flowering in Arabidopsis. Plant Physiology 139(2): 770-778.

Zemzoumi, K., Frontini, M., Bellorini, M. and Mantovani, R. (1999). NF-Y histone fold alpha1 helices help impart CCAAT specificity. Journal of Molecular Biology 286(2): 327-337.

Zhu, X.-G., Long, S. P. and Ort, D. R. (2008). What is the maximum efficiency with which photosynthesis can convert solar energy into biomass? Current Opinion in Biotechnology 19(2): 153-159.

Zorbas, H., Rein, T., Krause, A., Hoffmann, K. and Winnacker, E. L. (1992). Nuclear factor I (NF I) binds to an NF I-type site but not to the CCAAT site in the human alpha-globin gene promoter. Journal of Biological Chemistry 267(12): 8478-8484.


Chapter 3: 63 Genome-wide identification and expression analysis of the NF-Y family of transcription factors in

Triticum aestivum

Chapter 3: Genome-wide identification and expression analysis of the NF-Y family of transcription factors in Triticum aestivum

3.1 STATEMENT OF JOINT AUTHORSHIP

Stephenson, T.J., McIntyre, C., Collet, C. and Xue, G.-P. (2007). Genome-

wide identification and expression analysis of the NF-Y family of transcription

factors in Triticum aestivum. Plant Molecular Biology 65(1): 77-92.

This chapter is presented in the format required for the journal Plant Molecular

Biology.

Troy J. Stephenson wrote the manuscript; contributed to experimental design

and research plan; performed all experimental work.

C. Lynne McIntyre critically reviewed manuscript proofs, contributed to the

intellectual input of the manuscript and approved final version of manuscript.

Christopher Collet critically reviewed manuscript proofs, contributed to the


Gang-Ping Xue conceived of the research plan; involved in experimental

planning and design; critically reviewed manuscript proofs, contributed to the


64 Chapter 3: Genome-wide identification and expression analysis of the NF-Y family of transcription factors in

Triticum aestivum

3.2 ABSTRACT

Nuclear factor Y (NF-Y) is a trimeric complex that binds to the CCAAT-box, a

ubiquitous eukaryotic promoter element. The three subunits NF-YA, NF-YB and

NF-YC are represented by single genes in yeast and mammals. However, in model

plant species (Arabidopsis and rice) multiple genes encode each subunit providing

the impetus for the investigation of the NF-Y transcription factor family in wheat. A

total of 37 NF-Y and Dr1 genes (10 NF-YA, 11 NF-YB, 14 NF-YC and 2 Dr1) in

Triticum aestivum were identified in the global DNA databases by computational

analysis in this study. Each of the wheat NF-Y subunit families could be further

divided into 4-5 clades based on their conserved core region sequences. Several

conserved motifs outside of the NF-Y core regions were also identified by

comparison of NF-Y members from wheat, rice and Arabidopsis. Quantitative RT-

PCR analysis revealed that some of the wheat NF-Y genes were expressed

ubiquitously, while others were expressed in an organ-specific manner. In particular,

each TaNF-Y subunit family had members that were expressed predominantly in the

endosperm. The expression of nine NF-Y and two Dr1 genes in wheat leaves

appeared to be responsive to drought stress. Three of these genes were upregulated

under drought conditions, indicating that these members of the NF-Y and Dr1

families are potentially involved in plant drought adaptation. The combined

expression and phylogenetic analyses revealed that members within the same

phylogenetic clade generally shared a similar expression profile. Organ-specific

expression and differential response to drought indicate a plant-specific biological

role for various members of this transcription factor family.


Triticum aestivum

3.3 INTRODUCTION

The CCAAT-box is one of the most common elements in eukaryotic

promoters. It is typically found between 60-100 bp upstream of the transcription start

site and is functional in both direct and inverted orientations (Bucher 1990; Dorn et

al. 1987b; Edwards et al. 1998; Mantovani 1998). CCAAT-boxes are highly

conserved within homologous genes across species in terms of position, orientation,

and flanking nucleotides (Mantovani 1999). Genes under the control of promoters

containing CCAAT-boxes may be expressed in a ubiquitous manner or can be tissue-

and/or stage-specific suggesting that patterns of gene expression are also determined

by other cis- and trans-acting factors. Multiple trans-acting factors are associated

with the CCAAT-box, but only Nuclear factor Y (NF-Y) has an absolute requirement

for the pentanucleotide (Dorn et al. 1987a). NF-Y from mammals preferentially

binds CCAAT with specific flanking nucleotides:

C[GA][GA]CCAAT[CG][AG]C[AC] (Mantovani 1999). NF-Y is comprised of three

distinct subunits: NF-YA (CBF-B in vertebrates), NF-YB/CBF-A, and NF-YC/CBF-

C (Romier et al. 2003). Each subunit is required for DNA-binding, subunit

association and transcriptional regulation in both vertebrates and plants (Sinha et al.

1995). The NF-Y subunit proteins from vertebrates and plants also share high

homology with the HAP2/3/5 complex from Saccharomyces cerevisiae (bakers

yeast) (Hahn et al. 1988; McNabb et al. 1995; Pinkham et al. 1987). Each NF-Y

subunit in animals and yeast is encoded by a single gene, but in plants each of the

three subunits are encoded by multiple genes (Edwards et al. 1998; Gong et al. 2004;

Riechmann et al. 2000). This indicates a more complex regulatory role for the

various NF-Y proteins in plants than in other organisms.

Each NF-Y subunit has its own distinct, highly conserved core region

(Mantovani 1999). The conserved core of the NF-YA subunit comprises two

functionally distinct domains (Maity and de Crombrugghe 1992) whereby the N-

terminal domain is required for subunit interaction with the NF-YB NF-YC

heterodimer and the C-terminal domain is involved in DNA-binding site recognition

(Xing et al. 1994). Both the NF-YB and NF-YC conserved core regions also contain

residues contacting DNA (Romier et al. 2003) and NF-YB has been found to

contribute to DNA-binding specificity (Zemzoumi et al. 1999).


Triticum aestivum

The NF-YB and NF-YC subunits contain the highly conserved histone-fold

motif (HFM) and are structurally similar to core histone subunits H2B and H2A,

respectively (Arents and Moudrianakis 1995; Baxevanis et al. 1995; Mantovani

1999). In contrast to the high levels of conservation of the NF-YA core regions

across vertebrates, plants and yeast, the core sequences of the NF-YB and NF-YC

subunits are not as conserved. Indeed, the sequences of members of the NF-YB and

NF-YC subunit families of Arabidopsis thaliana are more divergent from each other

than those of the NF-YA family members (Gusmaroli et al. 2001). Within the NF-Y

family, two groups of proteins, Dr1 (NC2β) and Drap1 (NC2α) are related to NF-YB

and NF-YC respectively (Sinha et al. 1996).

The biological roles of the NF-Y family in plants have not been well studied.

In Arabidopsis, many NF-Y subunit genes are expressed ubiquitously, although some

are differentially expressed (Gusmaroli et al. 2001). For example, AtNF-YC-4 RNA

accumulates in seeds 7 days after germination, while AtNF-YB-9 (LEC1) is only

expressed in green siliquae (Gusmaroli et al. 2001). Overexpression of LEC1 in

transgenic Arabidopsis activates expression of embryo specific genes and results in

the formation of embryo-like structures in leaves, indicating a role for LEC1 in

modulating embryo development (Lotan et al. 1998). AtNF-YA-4 shows the most

restricted expression patterns of the NF-YA members with RNA detected in

senescent flowers, caulines, stems and 4 day-old seedlings at varying levels of

abundance (Gusmaroli et al. 2001). Three NF-YB subunits from Oryza sativa

(OsHAP3A-C) are expressed ubiquitously (Miyoshi et al. 2003) and suppression of

OsHAP3 expression results in degeneration of the chloroplast and down regulation of

photosynthesis genes indicating involvement of the gene products in chloroplast

development (Miyoshi et al. 2003). In transgenic maize over-expression of a single

ZmNF-YB subunit gene improves corn yield and increases chlorophyll content in the

leaves of plants grown in the field under water-limited conditions (Heard et al. 2006).

Wheat boasts the largest total production of the cereal crops on the globe. Four

of the five major wheat exporters (Argentina, Australia, Canada and U.S.A) grow

wheat under conditions of moderate to severe drought, which is also the main abiotic

constraint on wheat yield (Araus et al. 2002). Drought affects over 10 % of arable

land, reducing average yields of major crops by over 50 % (Bray 2000). Response to

abiotic stress requires plants to alter many biological processes such as cell cycle


Triticum aestivum

progression, metabolic rates and physiological balance. Transcription factors act as

switches in the complex regulatory networks controlling these biochemical and

physiological processes (Shinozaki et al. 2003; Zhu 2002). There is no information

about the NF-Y family of transcription factors in wheat and their potential role in

drought response. This study aimed to use sequence information from the model

plants Arabidopsis and rice to identify all unique Triticum aestivum NF-Y subunit

members (TaNF-Y) from the global nucleotide sequence databases, to determine the

nature and pattern of expansion of the TaNF-Y subunit gene families, and to identify

the expression profile of the TaNF-Y genes.

3.4 MATERIALS AND METHODS

3.4.1 DATABASE SEARCHES FOR TANF-Y FAMILY MEMBERS

Database searches were performed to collect all members of T. aestivum NF-Y

family members using the conserved core of O. sativa and A. thaliana NF-Y subunit

amino acid sequences. NF-Y subunit protein sequences were retrieved from the Rice

Transcription Database (RiceTFDB) (version 2.0, http://ricetfdb.bio.uni-

potsdam.de/v2.0/) and the Arabidopsis Transcription Database (ArabTFDB) (version

1.0, http://arabtfdb.bio.uni-potsdam.de/v1.0). The TBLASTN program was used with

an E-value cut-off of 1.0e-08 to identify both assembled wheat expressed sequence tag

(EST) contiguous sequences and EST singletons from Triticum aestivum Gene

Indices (TaGI , Release 10.0, http://compbio.dfci.harvard.edu/tgi/plant.html), Plant

Genome Database (PlantGDB; http://www.plantgdb.org/), and GenBank

(http://www.ncbi.nih.gov/) available in October 2006. Many sequences initially

collected were not unique, had incomplete domains or appeared to contain incorrect

open-reading frames (ORFs). The latter two cases were excluded from further

analysis. Pairwise sequence alignments and comparison of the EST contents of

assembled sequences were used to find unique representatives of each gene. As some

sequence differences in ESTs are due to sequencing errors or DNA polymorphism in

wheat cultivars, nucleotide sequences with 98 % or greater identities over their

length were considered as the same gene (many homoeologous genes in wheat are

also likely to fall into this category) and a representative was chosen. For assembled

sequences, EST contig contents were analysed. Assembled sequences containing

ESTs identical to another were considered as the same sequence and one

representative was used for further analysis. Assembled sequences were queried


Triticum aestivum

against Pfam (version 20.0, http://www.sanger.ac.uk/Software/Pfam/) and ProDom

(Release 2005.1, http://protein.toulouse.inra.fr/prodom.html) to confirm their identity

as NF-Y subunits. The HAP subunit sequences used in the phylogenetic analysis

were retrieved from the Saccharomyces genome database (http://yeastgenome.org).

3.4.2 CONSENSUS LOGOS

A. thaliana, O. sativa and T. aestivum NF-Y subunit conserved core regions

and identified motifs were used to create consensus logos using WebLogo

(http://weblogo.berkeley.edu/) (Crooks et al. 2004). Default program parameters

were used.

3.4.3 ALIGNMENTS AND PHYLOGENETIC ANALYSIS

All unique sequences were aligned initially using CLUSTALX version 1.83

(Thompson et al. 1997). Outputs were further refined by manual alignment of the N-

and C-terminal sequences. Phylogenetic analysis was undertaken using the conserved

core amino acid sequences of each subfamily as well as full-length amino acid

sequences. TreePuzzle version 5.2 was used with exact Parameter estimation and

Gamma distribution of rates among sites, to calculate the shape parameter α

(Schmidt et al. 2002). The Coefficient of Variation (CV) parameter was calculated

by CV=1÷√α as described in the PHYLIP documentation

(http://evolution.genetics.washington.edu/phylip/phylip.html). Distance analysis was

performed using the PHYLIP program package version 3.65

(http://evolution.genetics.washington.edu/phylip.html) (Retief 2000). Sequences

were first bootstrapped using the SEQBOOT program in order to obtain an estimate

of the reliability for the analysis. The distance matrices were created for aligned and

bootstrapped amino acid core regions using the PROTDIST program using Gamma

distribution among sites and the Jones-Taylor-Thornton (JTT) matrix for amino acid

substitutions. The NEIGHBOR program was used to convert distance matrices into

phylogenetic trees using a randomized input order. The S. cerevisiae HAP2, HAP3

and HAP5 sequences were used for the NF-YA, NF-YB and NF-YC out-groups

respectively. For the bootstrapped data, the CONSENSE program was then used to

create a consensus tree using the Majority rule extended consensus type.


Triticum aestivum

3.4.4 DETERMINATION OF CONSERVED MOTIFS

Identification of conserved motifs outside of the highly conserved NF-Y

subunit core regions was accomplished with multiple sequence alignments and

Multiple Em for Motif Elicitation (MEME) version 3.5.3 (http://meme.sdsc.edu)

(Bailey and Elkan 1994). Options for MEME were adjusted to find motifs of lengths

4-12 amino acids. Input sequence data was modified to exclude the conserved core

for each and was replaced with poly-X eliminating the possibility of misleading

results (flanking regions to the conserved core are highly conserved among subunit

families). Training sets for each subunit family were the non-redundant NF-Y

subunit amino acid sequences from A. thaliana, O. sativa, and T. aestivum. Logos for

identified motifs were created as per the method for conserved core consensus logos.

3.4.5 PLANT MATERIALS

Spring wheat (Triticum aestivum L. cv. Babax) plants were grown in a

controlled-environment growth room under both controlled and drought stressed

growth-conditions (Xue et al. 2006). Night and day conditions were 16-h light and

14/18˚C. Control plants were well watered. The drought treatment was achieved by

water deprivation of 4-week-old plants grown in pots (~1.5 L volume) containing a

3:3:1 mix of sand:soil:peat, until desired water contents were achieved. Relative leaf

water contents of drought-stressed plants were determined as described by Xue and

Loveridge (2004). Plant organs were harvested and immediately immersed in liquid

nitrogen and stored at -80˚C.

3.4.6 PREPARATION OF TOTAL RNA AND CDNA SYNTHESIS

Total RNA was isolated from the leaf and root, pre-anthesis spike and stem of

well-watered plants at the pre-anthesis stage, 18-20 day post-anthesis endosperm, 24-

30 day post-anthesis embryo wheat organs and the leaf from drought stress and

control plants using Plant RNA Reagent from Invitrogen following the

manufacturer’s directions. RNA was treated with the ribonuclease (Rnase) Free

deoxyribonuclease (DNase; Xue et al. 2006) and purified using the RNeasy Plant

Mini-kit column (Qiagen) following manufacturer’s instructions. First strand

complementary DNA (cDNA) was synthesised using an oligo (dT20) primer from

purified total RNA using SuperScript III Reverse Transcriptase (Invitrogen)

following the manufacturer’s instructions.


Triticum aestivum

3.4.7 QUANTITATIVE RT-PCR ANALYSIS

Transcript levels for TaNF-YA, TaNF-YB and TaNF-YC subunit families were

quantified by real-time PCR with an Applied Biosystems (ABI) Prism 7900HT

sequence detection system using SYBR Green PCR Master Mix (Applied

Biosystems) according to manufacturer’s instructions. Gene-specific primer pairs

used are listed in Supplementary Table 3.2. For this analysis both internal and

external reference genes were used. Four house-keeping (HK) genes from T.

aestivum were used as internal controls (Supplementary Table 3.2): TaRPII36 is a

RNA polymerase II 36 kDa subunit gene; TaRP15 is a RNA polymerase 15 kDa

subunit gene; TaCCF is a putative chromosomal condensation factor gene and

TaPGM2 is a phosphoglucomutase gene. A bovine transcript (C12B07) was used as

an external control (Xue et al. 2006). Preliminary experiments were performed to

establish the amplification efficiency for each of the primer pairs, to allow for a

direct comparison of the expression levels of the NF-Y and Dr1 subunits. A dilution

range of cDNA samples were subjected to real-time PCR to collect Ct values where

Ct is related to the logarithm of the dilution factor and a slope of best-fit line is used

to measure the reaction efficiency E=10(-1/slope) (Rasmussen 2001). Relative

quantification was calculated as EtcCPt-sCPt×Er

sCPr-cCPr (Pfaffl 2001). Ct values were

collected from three replicate PCR reactions for each biological sample and a mean

was taken from three biological samples. The specificity of the PCR reactions was

determined by melting curve analysis of the products.

The apparent expression level (AEL) of each gene relative to an internal

reference gene, TaRPII36, was calculated using the following formula: ErCt ÷ Et

Ct ×

F, where Ct is cycle threshold (PCR cycle number required for reaching the signal

point used for detection across samples), Er is reference gene amplification

efficiency (TaRPII36), Et is target gene amplification efficiency, and F is amplicon

size factor (reference gene amplicon size target gene amplicon size). We used AEL

values here to provide an approximate estimation of relative expression levels among

various genes under the situation where the absolute quantification of mRNA levels

for a large number of genes using a RNA (or cDNA) calibration curve is not

possible.


Triticum aestivum

3.4.8 STATISTICAL ANALYSIS

The Students t-test was performed as a test of significance. P-values of ≤ 0.05

were considered to indicate statistically significant differences.

3.5 RESULTS

3.5.1 IDENTIFICATION OF NF-Y GENES IN TRITICUM AESTIVUM

The conserved NF-Y domains from Arabidopsis and rice NF-Y subunit

families were used to screen for T. aestivum NF-Y genes from public sequence

databases resulting in the identification of 37 unique nucleotide sequences. Ten NF-

YA, 11 NF-YB, 14 NF-YC and two Dr1 homologues were identified and assigned

the following identifiers: TaNF-YA1-10, TaNF-YB1-11, TaNF-YC1-14 and

TaDr1A-B (Table 3.1, Figure 3.1). Some NF-Y-like EST sequences have incomplete

domains or apparently incorrect ORFs and have not been included for further

analysis. Searches of Pfam and ProDom domain databases using the assembled

TaNF-Y proteins confirmed that the identified sequences were NF-Y homologues.

TaNF-YA subunits. Maity and de Crombrugghe (1992) report that the

conserved core of the NF-YA subunit is less than 60 amino acids long and contains

two functionally distinct domains of about 20 amino acids each separated by a non-

conserved spacer region of approximately 10 amino acids. Each of the ten TaNF-YA

subunits identified has support for containing a NF-YA/CBF-B/HAP2 domain

matching domain family PF02045.5 in the Pfam database with E-values less than

1.0e-34. The core sequence of the TaNF-YA subunit peptides were also found to

contain >60 % identity with the yeast HAP2 subunit (data not shown). The conserved

core domain of TaNF-YA is 57 amino acids long. The subunit association domain

(SAD) is 25 amino acids in length (Romier et al. 2003) and begins at the first residue

of the core (Figure 3.1A). A spacer region divides the SAD from the DNA-binding

domain and is located at positions 26-36, spanning 11 amino acids (Figure 3.1A).

The DNA-binding region is 21 amino acids in length (Romier et al. 2003) and is

located at the C-terminal region of the wheat NF-YA conserved core at positions 37-

57 (Figure 3.1A).

TaNF-YB subunits. Individual TaNF-YB peptide sequences were queried against

the Pfam database and matches were found with Pfam family PF00808.12. In each

case, strong support for containing a NF-YB/CBF-A/HAP3 domain was found, with


Triticum aestivum

E-values of ~1.0e-30 in all cases except for TaNF-YB6 which had an E-value of 1.5e-

15. Core regions of the TaNF-YB subunits share between 52 % and 62 % identity

with yeast HAP3 (data not shown). The TaNF-YB subunit core region is 88 amino

acids in length (Figure 3.1B) which is consistent with an average length of 90

residues reported by Maity and de Crombrugghe (1992). Functional domains

required for interaction between NF-YB, NF-YC and NF-YA homologues and

subunit interaction with DNA have been identified by Kim et al. (1996). Based on

the sequence similarity with the mammalian CBF-A homologue, amino acids 5-44

and 51-84 in the conserved core region of TaNF-YB may be involved in heterodimer

formation, residues 34-41 could interact with the TaNF-YA subunit and amino acids

1-29 may well be required for DNA interaction in the heterotrimer complex (Figure

3.1B).

TaNF-YC subunits. Queries using TaNF-YC sequences against the Pfam

database returned matches with NF-YB/CBF-A/HAP3 family domains and E-values

of ~1.0e-10 indicated regions of significant similarity. Identified TaNF-YC sequences

were then queried against the ProDom database and matches were found in each

instance with the PD003659 (NF-YC/CBF-C/HAP5). For each sequence, E-values

were <1.0e-22 except for TaNF-YC13 and TaNF-YC14, which had E-values of 4.0e-14

and 3.0e-14, respectively. TaNF-YC subunit members are more divergent from the

yeast HAP5 subunit than the two other subunit family members, with identities in the

range of 30 % to 40 % (data not shown). The TaNF-YC conserved core region is 74

amino acids long (Figure 3.1C), which is shorter than the average length of 84

residues found in other organisms (Maity and de Crombrugghe 1992). Sequence

similarity with the mammalian CBF complex suggests that amino acid residues 3-4

of the core region are likely to interact with DNA in the heterotrimer, residues 1-16

and 62-72 are likely to be involved in interaction with TaNF-YA in the heterodimer

and amino acids spanning positions 17-61 of the conserved region are likely to be

involved in dimerization with TaNF-YB (Figure 3.1C).

Dr1 subunits. Dr1 is a -subunit of NC2, NC2, and is highly homologous to

NF-YB at the amino acid level (Sinha et al. 1996). Two Dr1 homologues were

identified through database searches using the NF-YB conserved core as a query

sequence. Subsequent searches for Dr1 subunit members from the available wheat


Triticum aestivum

Table 3.1. Triticum aestivum NF-Y proteins identified in the sequence databases. Either the GenBank

accession or the tentative consensus (TC) identifier from TaGI is provided. Sequence identifiers in

parentheses are redundant and are represented in this study by the non-parenthesised sequence.

Name GenBank/TC Name GenBank/TC

NF-YA TaNF-YA1 BT008936 TaNF-YB3 BT009265 TaNF-YA2 BT009063 (TC238716)TaNF-YA3 BT009512 TaNF-YB4 TC247628

(TC270348) (BT009393) TaNF-YA4 BT009594 TaNF-YB5 CK203103 TaNF-YA5 TC240846 TaNF-YB6 CV776390

(BT009624) TaNF-YB7 TC238715 (CK207902) TaNF-YB8 TC238717

TaNF-YA6 DR739322 TaNF-YB9 TC240894 TaNF-YA7* TC238244 TaNF-YB10 TC248171

(AY456087) TaNF-YB11 TC269816

(AY568307) NF-YC(AY568304) TaNF-YC1 AL829454 (AY568299) TaNF-YC2 BT008988 (AY568298) (TC266361) (AY568297) TaNF-YC3 BT009224 (AY568295) TaNF-YC4 DN829033 (AY568303)** TaNF-YC5 DR738968

TaNF-YA8* TC253181 TaNF-YC6 TC233433 (AY568306) TaNF-YC7 TC237647 (AY568305) TaNF-YC8 TC241235 (AY568302) TaNF-YC9 TC255016 (AY568301) TaNF-YC10 TC266360 (AY569300) TaNF-YC11 TC268430

TaNF-YA9 TC253407 TaNF-YC12 TC268432 TaNF-YA10 TC256735 TaNF-YC13 BJ308764

(BT009542) TaNF-YC14 TC270995

NF-YB Dr1 TaNF-YB1 BT009029 TaDr1A TC236077

(AY058921) (AF464903) TaNF-YB2 BT009078 TaDr1B TC236076

(TC247302) (BT009234)* The assembled TaNF-YA7 and TaNF-YA8 genes may include paralogues in addition to homoeologues. ** Alternative spliced form of the assembled TaNF-YA7.

74 Chapter 3: Genome-wide identification and expression analysis of the NF-Y family of transcription factors in Triticum aestivum

(A)

Figure 3.1. Triticum aestivum TaNF-Y family protein sequence alignment. All sequences identified from the current sequence databases are designated TaNF-YA 1-10 (A); TaNF-YB1-11 (B); TaNF-YC1-14 (C); TaDr1A-B (D). Sequence alignments were created using the CLUSTALX X (v1.83) program. Dashes indicate gaps in the sequences. Asterisks indicate positions that have a single, fully conserved residue. Semicolons indicate strongly conserved residues. Periods indicate weakly conserved residues. Fully conserved amino acids are coloured blue. Red boxes indicate conserved core regions. Black boxes indicate the locations of possible motifs found using MEME 3.5.3. Within the conserved core regions: black lines under the alignments indicate regions involved in contacting DNA, green lines under the alignments indicate regions involved in heterodimerization and blue lines under the alignments indicate NF-YA interaction regions.

Chapter 3: 75 Genome-wide identification and expression analysis of the NF-Y family of transcription factors in Triticum aestivum

(B)


(C)


(D)


Triticum aestivum

nucleotide sequence data using the wheat, rice and Arabidopsis Dr1 homologues did

not result in the identification of additional unique Dr1 sequences. The high degree

of similarity between TaDr1A, TaDr1B and TaNF-YB subunit members can be seen

in Figure 3.1D where a representative TaNF-YB subunit member (TaNF-YB3) has

been aligned against the two TaDr1 sequences.

3.5.2 CONSERVED SEQUENCES IN THE NF-Y SUBUNITS

Conserved core consensus. In order to identify conserved amino acid residues

in the core region of the NF-Y subunits among plant species sequence logos were

created from multiple sequence alignments of the conserved core domains of T.

aestivum, A. thaliana and O. sativa NF-Y subunit members (Figure 3.2A-C). This

analysis showed that the core sequence of the NF-YA family of proteins from each

of these three plant species is the most highly conserved among the three subunits

(Figure 3.2A). The core sequence of the NF-YC proteins from these three plant

species is the most divergent (Figure 3.2C). There are only three absolutely

conserved residues between Arabidopsis, rice and wheat within the NF-YC core

region (Figure 3.2C). There are 17 residues absolutely conserved in the core domain

of the NF-YB subunit across the three species (Figure 3.2B).

Conserved motifs outside of the NF-YA core region. Four motifs outside the

conserved core region were identified in the NF-YA amino acid sequences of

Arabidopsis, rice and wheat with the use of the MEME algorithm and multiple

sequence alignments (Figure 3.1A and Figure 3.3). A non-polar/hydrophobic

hexapeptide region found in all three species is located approximately 40 amino

acids from the N-terminal end of the core region (Figure 3.1A and Figure 3.3A).

Figure 3.3B and 3.3C show DPYYG and RVPLP motifs that are located around 5

and 50 amino acids from the N-terminus of the core, respectively (Figure 3.1A). A

four-residue motif with absolute conservation across the first three residues (HPQ)

(Figure 3.3D) is found approximately 30 amino acids from the N-terminus of the

core.

Conserved motifs outside the NF-YB core region. Three motifs were

identified outside of the conserved core sequence of the NF-YB peptide. A six

residue motif (REQDRF) adjacent the N-terminal side of the conserved core region


Triticum aestivum

is entirely conserved across the central four residues (Figure 3.1B and Figure 3.4A).

A motif of 10 amino acid residues was found in eight NF-YB subunit proteins

(Figure 3.4B) and is located approximately 10 amino acids from the C-terminal

residue of the core region (Figure 3.1B). A polar and hydrophobic motif, which is

five amino acids in length, is located at the C-termini (Figure 3.1B and Figure 3.4C).

(A)

eePiyVNAKQYhaILRRRqsRAKlEaenklvKgRKPYLHESRHlHAMKRARGsGGRF (B)

LPIANvsRIMKkalPanaKIsKDAKEtvQECVSEFISFvTgEASDKCqrEkRKTINGDDllWAMttLGFEdYvdPLkvYLhkyRElEg

(C)

PlaRIkkimkadedvrmisaeaPvlfakacElFilelterawnhAeenkrrtiqksdiaaAVarteevfdFLvdi

Figure 3.2. Arabidopsis, rice, and wheat NF-Y subunit conserved core consensus sequence logos: NF-YA subunit family (A), NF-YB subunit family (B) and NF-YC subunit family (C). The NF-YA logo was created with 16 rice, 14 Arabidopsis and 10 wheat sequences. The NF-YB logo was created with 13 rice, 10 Arabidopsis and 11 wheat sequences. The NF-YC logo was created with 19 rice, 18 Arabidopsis and 14 wheat sequences. The Arabidopsis and rice sequences are the non-redundant sequence members collected from the RiceTFDB and the ArabTFDB. Below the logos is a text representation of the majority consensus created from the three species. Overall height in each stack indicates the sequence conservation at that position; height of each residue letter indicates relative frequency of the corresponding residue. Amino acids are coloured according to their chemical properties: green for polar (G,S,T,Y,C,Q,N), blue for basic (K,R,H), red for acidic (D,E) and black for hydrophobic (A,V,L,I,P,W,F,M) amino acids

Conserved motifs outside of the NF-YC core region. Four motifs outside of the

conserved core region were identified in the members of the NF-YC family from

Arabidopsis, rice and wheat. One five residue motif (DFKNH) is found in 19 NF-YC

proteins (Figure 3.5A) and is located two amino acids from the N-terminal residue of


Triticum aestivum

the core region (Figure 3.1C). A Gln and hydrophobic residue rich motif of 11 amino

acids is found in the NF-YC peptides approximately 20 amino acids from the N-

terminal side of the core region (Figure 3.1C and Figure 3.5B) and may represent a

motif within a transcriptional activation domain (Courey et al. 1989; Coustry et al.

1996; Gill et al. 1994). Flanking the C-terminus of the conserved core sequence is a

seven residue motif that is conserved among 14 NF-YC family members (Figure

3.1C and Figure 3.5C). The fourth motif is PY-rich (PYYYPP) (Figure 3.5D),

located in the C-terminus of NF-YC proteins (Figure 3.1C).

3.5.3 PHYLOGENETIC ANALYSIS

To determine the nature and pattern of expansion of the TaNF-Y subunit genes,

gene family trees were constructed using the Neighbor-joining (NJ) method for each

subunit family. Outside the conserved core sequences there is considerable

divergence making alignment difficult, thus for the initial analysis only the

sequences of conserved core regions of each subunit were used. However, since

many sequences were identical, in subsequent analysis the full-length protein

sequences were used to obtain more detailed information about some of the

relationships of the NF-Y subunits.

Phylogenetic trees of the TaNF-YA. Core region sequences of the TaNF-YA

peptides are highly conserved, but can be divided into four clades assigned identifiers

I-IV in wheat (Figure 3.6A). Clade I contains the most divergent core region

sequences from the majority consensus with substitutions at positions 1, 2, 20, and

30 (Figure 3.2A). Subunits clustering in clade IV have 100 % amino acid identity

between their conserved core regions, however the 65 amino acids in the N-terminal

region of TaNF-YA9 are not found in TaNF-YA4 (Figure 3.1A). Similarly, the

conserved core sequences from TaNF-YA3, TaNF-YA7 and TaNF-YA8 have 100 %

amino acid identity; however, TaNF-YA3 does not have a 63 amino acid N-terminal

sequence present in TaNF-YA7 and TaNF-YA8 (Figure 3.1A). TaNF-YA5 resides

on a separate branch in both trees and appears as an out-group to the other TaNF-YA

subunits. This is expected, as this subunit is the most divergent of the TaNF-YA

members in both the conserved core and full-length amino acid sequences. TaNF-

YA5 has substitutions at positions 21, 27, 29, and 54 within the core region (Figure

3.2A), which are unique and has a high level of divergence in both the N- and C-


termini of the protein (Figure 3.1A). The clustering of TaNF-YA members using

full-length sequences is shown in Figure 3.6B, which is the same as that using

(A) (B) G[VAL][VLMW][ATGS][ATGS]Y R[VM]PLP

(C) (D)

[DE][PQA]YY[GRA] HPQ[ILM]

Figure 3.3. Motifs outside of the conserved NF-YA core domain: GVVAAY (A), RVPLP (B), DPYYG (C) and HPQI (D). Motifs identified with the use of MEME 3.5.3 (http://meme.sdsc.edu). Alignments produced with CLUSTALX X (v1.83). Alignments are of Arabidopsis (starts with At), rice (starts with #) and wheat (starts with Ta) NF-YA subunits containing motifs depicted in the logos above. Below each alignment is a text representation of the consensus sequence.


Triticum aestivum

(A) (B)

K[ASG]G[DE][GVPS][SN][VA]K[KR]D

(C)

[RK]EQDR[FLY] Q[PQA]Q[YHQ][HQ]

Figure 3.4. Motifs outside of the conserved NF-YB core domain: REQDRF (A), KSGDGSVKKD (B), and QPQYH (C). Alignments are of Arabidopsis, rice and wheat NF-YB subunits containing motifs depicted in the logos above. Below each alignment is a text representation of the consensus sequence.

the conserved core except that TaNF-YA3 is not in clade II. Conserved core and full-

length NJ trees were constructed using the NF-YA subunit member amino acid

sequences from Arabidopsis, rice and wheat (Supplementary Figure 3.10A-B).

Phylogenetic trees of the TaNF-YB. The NF-YB proteins have been divided

into two classes in Arabidopsis, LEC1-like and non-LEC1-like and can be identified

by 16 unique residues within the core region of the LEC1-like NF-YB subunits (Lee

et al. 2003). The TaNF-YB subunit proteins cluster into four distinct clades in the NJ

trees using either the core sequence or the full-length protein sequence (Figure 3.6C-

D). Twelve of the LEC1 specific residues from Arabidopsis are conserved in the

wheat NF-YB proteins clustering in clade IV. The TaNF-YB subunit family has 12

non-LEC1-like NF-YB members that can be further divided into three clades.


Triticum aestivum

Branching patterns on both trees indicate that clade I and II are more closely related

to each other than they are to other clades in the protein subunit family.

(A) (B)

D[FI]KNH QQ[QCL][QKTA][QARE]QL[QR]xFW

(C) (D)

VPR[DE][ED][AILM][KR] PY[YG]Y[PLV]P

Figure 3.5. Motifs outside of the conserved NF-YC core domain. DFKNH (A), QQQQQQLQxFW (B), VPRDEAK (C) and PYYYPP (D). Alignments are of Arabidopsis, rice and wheat NF-YC subunits containing motifs depicted in the logos above. Below each alignment is a text representation of the consensus sequence.


Triticum aestivum

(A) (B) (C) (D) (E) (F) Figure 3.6. Phylogenetic trees of TaNF-Y subunit families: TaNF-YA conserved core tree (A), Full-length TaNF-YA gene family tree (B), TaNF-YB conserved core tree (C), TaNF-YB full-length tree (D), TaNF-YC conserved core tree (E) and TaNF-YC full-length tree (F). Each tree created with the PHYLIP program package (Retief 2000) using the Neighbor-joining method. Bootstrap values from 1000 replicates have been used to assess the robustness of the trees. Bootstrap values are shown in red. Each tree has been rooted using the Saccharomyces cerevisiae HAP homologues. Identifiers I-V have been used to indicate sequences which cluster with support from high bootstrap values.


Triticum aestivum

Conserved core and full-length NJ trees were constructed using the NF-YB subunit

member amino acid sequences from Arabidopsis, rice and wheat (Supplementary

Figure 3.10C-D).

Phylogenetic trees of the TaNF-YC. The TaNF-YC subunit family is the most

divergent of the three subunits. TaNF-YC subunit proteins cluster into five clades in

the NJ trees (Figure 3.6E-F). There is support from high bootstrap values that clades

IV and V are sister clades in both NJ trees (Figure 3.6E-F). Conserved core and full-

length NJ trees were constructed using the NF-YC subunit member amino acid

sequences from Arabidopsis, rice and wheat (Supplementary Figure 3.10E-F).

3.5.4 EXPRESSION PROFILES OF THE NF-Y GENE FAMILY IN WHEAT

Quantitative RT-PCR was used to examine the expression profiles of the wheat

NF-Y and Dr1 genes. To estimate relative expression levels between genes, we

analysed the apparent expression level (AEL) of each gene relative to an internal

control gene, TaRPII36, using a combination of the following factors: the Ct value,

PCR amplification efficiency and amplicon length (see Materials and Methods). A

gene with a higher level of expression generally has a lower Ct value when other

conditions (such as PCR amplification efficiency and amplicon length) are the same

(Pfaffl 2001), especially when the primers designed are predominantly located at or

near the 3' region.

A moderate expression level was seen in the root for the TaNF-YA genes

based on the AEL values (Supplementary Table 3.3). TaNF-YA1 and TaNF-YA6

were identified as being expressed at the highest level of all the TaNF-YA genes in

the root (Supplementary Table 3.3). TaNF-YA5 was found to be expressed the lowest

of all the TaNF-YA genes in the root (Supplementary Table 3.3). Four genes (TaNF-

YA3, 4, 7 and 9) were predominantly expressed in the endosperm tissue (Figure

3.7A). Two of these, TaNF-YA3 and TaNF-YA4 were expressed at their lowest levels

in the leaf, while TaNF-YA7 and TaNF-YA9 were expressed at their lowest levels in

the spike (Figure 3.7A). As TaNF-YA7 and TaNF-YA8 share extremely high

nucleotide sequence homology, real-time PCR primers for TaNF-YA7 also amplify

TaNF-YA8. Three genes (TaNF-YA1, 2 and 10) were expressed at their highest level

in the root and at their lowest levels in the endosperm. TaNF-YA6 was expressed at


Triticum aestivum

its highest level in the root and lowest in the leaf. TaNF-YA5 was found at its highest

expression level in the leaf.

The transcripts of TaNF-YB subunit genes were detected in all organs except

for TaNF-YB9, which was not detected in the stem (Figure 3.7B). Expression

analysis of the TaNF-YB5 gene was not carried out as no PCR products were

amplified using three sets of primer pairs attempted. TaNF-YB5 is an EST singleton

and thus may be a less reliable representation of the actual sequence. The transcript

levels of the TaNF-YB genes in the root varied more than the TaNF-YA genes, with

the highest transcript level being identified for the TaNF-YB2 gene and the lowest for

the TaNF-YB9 gene (Supplementary Table 3.3). TaNF-YB1 and TaNF-YB9, which

are homologous to the Arabidopsis LEC1 gene, were expressed predominantly in the

endosperm. However, TaNF-YB2 (which is not homologous to LEC1) was also

highly expressed in the endosperm, compared to other plant organs. Of the TaNF-YB

genes predominantly expressed in the endosperm, TaNF-YB1 and TaNF-YB2 were

expressed at their lowest level in the leaf, while TaNF-YB9 was expressed at the

lowest level in the root. Five genes (TaNF-YB3, 4, 6, 7 and 8) were expressed at their

highest levels in the leaf and their lowest in the embryo. TaNF-YB10 was expressed

at its highest level in the endosperm and leaf, while TaNF-YB11 showed little

variation between the organs.

Among the transcripts of TaNF-YC genes the highest expression level in the

root was found with TaNF-YC6 (Supplementary Table 3.3). TaNF-YC10 was not

detected in the leaf and is the single TaNF-YC gene not detectable in all organs.

Analysis of TaNF-YC4 expression was not undertaken for the same reasons

encountered for TaNF-YB5. The expression level of TaNF-YC1 was very low in all

of the six organs (Supplementary Table 3.3, Figure 3.7C). Two genes (TaNF-YC2

and TaNF-YC10) were expressed predominantly in the endosperm and were either

not expressed in the leaf (TaNF-YC10) or expressed at the lowest level in the leaf

(TaNF-YC2). Three genes (TaNF-YC5, 11 and 12) were expressed at their highest

levels in the leaf, spike and stem. Expression levels of TaNF-YC13 and TaNF-YC14

were at their highest in the embryo. Three genes (TaNF-YC6, 7 and 8) exhibited their

highest expression levels in the leaf. TaNF-YC3 and TaNF-YC9 were found at their


Triticum aestivum

(A)

(B) Figure 3.7. Expression profiles of NF-Y genes in wheat: TaNF-YA genes (A), TaNF-YB genes (B), TaNF-YC genes (C) and TaDr1 genes. Expression level is expressed relative to the root on a logarithmic scale. Error bars indicate SD of the mean of three biological samples. Each sample was analysed with triplicate real-time PCR assays. Real-time primers for TaNF-YA7 also amplify TaNF-YA8.


(C) (D)

lowest expression levels in the root, with relatively little variation among the other

five tissue types.

Expression analysis of the two TaDr1 genes revealed that both were expressed

in all six wheat organs (Figure 3.7D) with similar levels in the root (Supplementary


Triticum aestivum

Table 3.3). The highest expression level for both genes was in the endosperm,

embryo and spike, while the lowest expression levels were in the leaf.

A preliminary expression analysis for drought responsiveness of all TaNF-Y

genes was performed using one control leaf sample and one drought-stressed leaf

sample (data not shown). Thirteen genes that showed >2-fold difference in levels of

expression between control and drought-stressed samples were selected for further

analysis. As shown in Figure 3.8, eleven of the thirteen had statistically significant

differences between expression levels when subjected to drought-stressed conditions.

At least one member from each subunit family and both TaDr1 genes were found to

be responsive to drought stress (i.e. one TaNF-YA, five TaNF-YB, three TaNF-YC

and both TaDr1 genes). Eight of the eleven genes were down-regulated in drought-

stressed wheat leaves (relative leaf water content ranging from 75 % to 81 %) and

three genes were significantly upregulated under conditions of drought. TaNF-YA1

mRNA levels showed a significant reduction in drought-affected leaves to around a

third of that seen in leaves of the non-stressed control (Figure 3.8). A similar level of

down-regulation in the drought-stressed leaves was seen for four TaNF-YB genes

(TaNF-YB3, 6, 7 and 8) and two TaNF-YC genes (TaNF-YC11 and 12). TaNF-YB2,

TaDr1A and TaDr1B were upregulated genes under drought conditions by over 2-

fold for each.

3.5.5 CORRELATION BETWEEN THE GENE EXPRESSION LEVELS OF TANF-Y GENES

Transcription factors that have correlated expression may be involved in

transcriptional regulation of similar biological processes and strong correlation has

been found to exist between some TaNF-Y genes. Three TaNF-YB genes (TaNF-

YB3, TaNF-YB7 and TaNF-YB8), two TaNF-YA genes (TaNF-YA3 and TaNF-YA4)

and two TaNF-YC genes (TaNF-YC11 and TaNF-YC12) had high correlation

coefficients in expression within each of the three subunit families (Figure 3.9A-C).

Correlation of expression was also identified between members from different

subunit families. One TaNF-YA subunit member (TaNF-YA5) and one TaNF-YC

subunit member (TaNF-YC8) were found to be strongly correlated in expression (r =

0.94) (Figure 3.9D). High correlation was also found between TaNF-YA9 and TaNF-

YB10 (r = 0.96) (Figure 3.9E) and between TaNF-YB3 and TaNF-YC12 (r = 0.98)

(Figure 3.9F).


Figure 3.8. Changes in the mRNA levels of wheat NF-Y genes in the drought-stressed leaves. Transcript level is expressed relative to the levels in non-stressed control leaves. Insert graph shows there was no significant difference in expression levels for the control genes (TaRPII36 and TaRP15; the relative expression levels were normalised with another internal control gene TaSnRK1). The relative leaf water contents of the drought-stressed plants ranged from 75 %-81 %. Error bars indicate +SD of the mean of three biological samples. Each sample was analysed with triplicate PCR assays. Double asterisks indicate statistically significant differences with P ≤ 0.01 and triple asterisks indicate statistically significant differences with P ≤ 0.001 using Students t-test.


Figure 3.9. Correlation in expression levels between TaNF-Y genes across six wheat organs. Correlated gene expression between TaNF-YB3, TaNF-YB7 and TaNF-YB8 (A); TaNF-YA3 and TaNF-YA4 (B); TaNF-YC11 and TaNF-YC12 (C); TaNF-YA5 and TaNF-YC8 (D); TaNF-YA9 and TaNF-YB10 (E); TaNF-YB3 and TaNF-YC12 (F). Relative expression levels are used for each gene. These data have been fitted using linear regression analysis.


Triticum aestivum

3.6 DISCUSSION

A large expansion in the members of the NF-Y family in plant genomes

presents an interesting potential for differential gene regulation by NF-Y complexes.

The findings of multiple NF-Y subunit genes in Arabidopsis and rice provided the

impetus for the investigation of the biological role of this transcription factor family

in wheat. In this study, 10 NF-YA, 11 NF-YB, 14 NF-YC and 2 Dr1 genes were

identified in T. aestivum from the sequence databases. The numbers (a total of 37) of

TaNF-Y family members identified in this study are less than the apparent family

sizes listed at the Plant Transcription Factor Database (Riano-Pachon et al. 2007) for

Arabidopsis (42 NF-Y gene loci) and rice (45 NF-Y gene loci). It is likely this is the

minimum number of genes present in T. aestivum, as a complete list of TaNF-Y

genes will have to await the complete sequence of the wheat genome.

Given that wheat is an allohexaploid (genome AABBDD) (Feldman 2001), it

would be expected that each of the three genomes would contain the same genes

(homoeologues). To reduce the complexity of analysis in this study, we took

sequences with 98 % or greater identity to be a single gene. Therefore, it is likely that

homoeologous EST sequences were assembled into a single gene for analysis.

However, this approach also has an additional potential error of combining very

similar paralogous genes (Table 3.1), which arise through gene duplication events.

Thus, the number of NF-Y genes present in the wheat genome could be higher than

that reported here. Nevertheless, this study serves as a preliminary investigation into

the genome-wide investigation of the NF-Y family in this important cereal crop

species.

The analysis of the NF-Y transcription factor family in wheat has produced

several novel findings. The eleven motifs identified here, bioinformatically, have not

been reported elsewhere, and this is the first time conservation has been identified

outside of the core region in the plant NF-Y subunit families. The extremely high

level of conservation of these motifs between three plant species in the otherwise

highly divergent terminal regions provides support for the validity of these motifs.

Some of these motifs were common to subunits which share similar expression

profiles and cluster together in the NJ trees. The identification of NF-Y subunit

members which have identical conserved cores with highly similar expression


Triticum aestivum

profiles, such as those expressed predominantly in the endosperm, is interesting.

Furthermore, we identified a number of NF-Y subunit members that are drought

responsive. Taken with the organ specific expression pattern of some subunit

members, the expansion of the NF-Y TF family in plants may have resulted in

subfunctionalisation of some of the subunit members. However, high correlation in

expression patterns and high sequence homology of some members within the same

subunit family indicate the existence of a certain degree of redundancy or

overlapping functionality in each subunit family.

The TaNF-YA subunit family separates into four clades based on the

conserved core sequence region. Similarities within TaNF-YA subunit members

clustering in clade II (TaNF-YA3, TaNF-YA7 and TaNF-YA8) seem to extend

beyond their identical cores to include four short shared motifs (GVVAAY, RVPLP,

DPYYG, and HPQI). The transcript levels of TaNF-YA members of clade II were

higher in the endosperm than in other organs. TaNF-YA clade IV members (TaNF-

YA4 and TaNF-YA9) were also expressed predominantly in the endosperm.

Members of TaNF-YA clades II and IV contain two shared motifs (HPQI and

RVPLP) in addition to their shared expression profiles. Furthermore, one member

from each of TaNF-YA clades I and IV (TaNF-YA3 and TaNF-YA4) were identified

to have strongly correlated expression profiles across all six wheat organs. It is

possible that the genes in these two clades have a similar function and play a more

active regulatory role in the endosperm than in other organs, but DPYYG and

GVVAAY motifs are likely to be not required for this function due to the absence

from members of clade IV. The TaNF-YA subunit members that cluster as clade III

(TaNF-YA1 and TaNF-YA10) share 100 % amino acid identity over the core

sequence region and are quite similar over their terminal protein sequences.

Expression of the TaNF-YA1 and TaNF-YA10 genes was the highest in the root;

however, they showed different responses in the leaf to drought stress. TaNF-YA1

was down-regulated in the drought-stressed leaves to a third of its control transcript

levels, but from preliminary analysis TaNF-YA10 expression was seemingly

unaffected by drought stress.

TaNF-YB genes can also be divided into four phylogenetic groups. The TaNF-

YB proteins clustering in clade IV (TaNF-YB1 and TaNF-YB9) are homologues of

the Arabidopsis LEC1 gene (At1g21970.1) (Supplementary Figure 3.10C), that is


Triticum aestivum

involved in embryogenesis (Lotan et al. 1998). TaNF-YB1 and TaNF-YB9 are

predominantly expressed in the endosperm, suggesting that they are not involved in

embryogenesis as is LEC1. The REQDRF motif is present in both of these genes but

is not unique to the LEC1-like NF-YB subunit members as seven other NF-YB genes

also contain this conserved motif. In contrast to the members of clade IV, the

members of clade I (TaNF-YB3, 7 and 8) exhibited a very low level of expression in

the endosperm. These genes were expressed at a relatively higher level in leaf

compared to the other organs examined. Furthermore, the members of TaNF-YB

clade I were found to have strongly correlated expression profiles. These three

TaNF-YB genes also shared a similar response to drought stress and were down-

regulated to a third of their control levels in the leaf. TaNF-YB3, 7 and 8 share 100

% amino acid identity across the conserved NF-YB core and are unique over their N-

and C-terminal regions, however each contains the two conserved motifs, REQDRF

and QPQYH. The latter motif may be part of a transcriptional activation region; rich

in Gln and hydrophobic residues (Courey et al. 1989; Coustry et al. 1996; Gill et al.

1994). The members of clade I may share a similar biological function based on the

similarity in sequence and expression. TaNF-YB2 and TaNF-YB10 cluster in clade

III and also contain the QPQYH motif. TaNF-YB2 and TaNF-YB10 were expressed

at the highest level in the endosperm amongst the six organs examined. TaNF-YB2

represents an interesting TaNF-Y gene in terms of positive drought stress

responsiveness, while TaNF-YB10 was not.

Five clades were identified in the TaNF-YC family. Members of TaNF-YC

clade II (TaNF-YC5, 11 and 12) have identical conserved cores and slight variation

at the C-termini. These members share one conserved motif (DFKNH) outside of the

NF-YC core sequence. Expression patterns for these three TaNF-YC subunit genes

are highly similar in that they are mainly expressed in leaf, spike and stem and two

genes (TaNF-YC11 and TaNF-YC12) had strongly correlated expression profiles

across all of the organs analysed. Furthermore, TaNF-YC5, TaNF-YC11 and TaNF-

YC12 were down-regulated in the drought stress leaves. Expression levels of

members of clade IV were unchanged under conditions of drought stress. TaNF-

YC13 and TaNF-YC14 of clade V shared a similar expression pattern across the six

wheat organs but showed differential responses to drought stress. TaNF-YC clade III

members (TaNF-YC2 and TaNF-YC10) may have the functions in the endosperm, as


Triticum aestivum

their expression levels were extremely high in the latter organ compared to other

organs. In addition, TaNF-YC10 mRNA was not detectable in the leaf and was low

in other tissues. TaNF-YC clade IV members (TaNF-YC6 and TaNF-YC8) had a

similar expression pattern; they were expressed at the highest in the leaf and were not

responsive to drought.

The combined expression and phylogenetic analysis of the TaNF-Y genes in

this study revealed that the relationships identified phylogenetically were reflected in

their expression profiles. In general, phylogenetic clades with proteins containing

identical conserved core sequences were found to share a similar expression pattern.

In contrast, the sequences of the N-terminal and C-terminal regions of these proteins

did not appear to correlate with expression profiles. TaNF-YA clade IV, TaNF-YB

clade IV and TaNF-YC clade III all contain members with identical core regions

within each subunit family and all were highly expressed in the endosperm. It is

interesting to find a clade in both TaNF-YA and TaNF-YC families that are also

highly specific to endosperm and match with the expression pattern of TaNF-YB

genes in clade IV that are homologous to Arabidopsis LEC1. This may indicate that

these subunits potentially interact to form NF-Y trimer complexes in the endosperm.

Furthermore, strong correlation in expression was found between some members

from different subunit families in wheat. Whether the subunits members can form

unique NF-Y complex in plants awaits further investigation.

In rice, there would appear to be no more than three Dr1 (NC2β) subunits and

one Drap1 (NC2α) subunit (Song et al. 2002), while Arabidopsis has at least one NF-

YC subunit gene that exhibits significant sequence similarity to the human Drap1

subunit (Kusnetsov et al. 1999). Dr1 and Drap1 form a NC2 complex which is a

global transcriptional repressor (Kim et al. 1997). TaNF-YC6 is a homologue to the

rice OsDrap1 protein (Os11g34200.1) (Supplementary Figure 3.10E). Therefore, it

appears that wheat has a minimum of two Dr1 homologues and one Drap1

homologue. Both TaDr1 genes were upregulated during drought stress. NF-YB and

NF-YC can interact with TATA binding-protein (TBP) in the absence of NF-YA

indicating that some NF-YB and NF-YC subunits function independently on the

formation of a trimer with NF-YA (Bellorini et al. 1997). Furthermore, Dr1 and

Drap1 are highly homologous to NF-YB and NF-YC, which presents the question of


Triticum aestivum

whether the Dr1/Drap1 complex inhibits transcription by acting as an antagonist to

the NF-Y subunits, preventing subunit association and subsequence binding to TBP.

In contrast to vertebrates and fungi, which have a single gene for each NF-Y

subunit, plants have multiple genes for each subunit. The most intriguing questions

are why plants have multiple members of each subunit, how they form trimer

complexes among the members of the three subunit families and whether individual

NF-Y trimer complexes share the same DNA-binding specificity. Plants require

dynamic developmental programs that are able to adjust differentiation, growth and

metabolism in response to the continuous changes in the environment. The presence

of multiple genes for all three NF-Y subunits in wheat with different primary

structure and expression patterns indicates a high level of complexity of regulation

for this gene family in plants. Thus, the evolution of large NF-Y gene families may

support the development of flexible regulatory mechanisms. Organ-specific

expression of TaNF-Y genes and their differential response to drought stress suggest

that individual members of the wheat NF-Y genes may have specific physiological

roles, including their involvement in regulating gene expression in wheat adaptation

to drought stress. Importantly, this study identified a single wheat NF-YB gene

(TaNF-YB2) that was significantly upregulated in response to drought. Given that

transgenic maize plants that over-express a NF-YB subunit tolerate drought stress

better than wild-type (Heard et al. 2006), it would be interesting to investigate

whether over-expression of TaNF-YB2 could produce a drought-tolerant wheat.


Triticum aestivum

3.7 REFERENCES

Araus JL, Slafer GA, Reynolds MP, Royo C (2002) Plant breeding and drought in C3 cereals: what should we breed for? Ann Bot (Lond) 89 Spec No: 925-940

Arents G, Moudrianakis EN (1995) The histone fold: a ubiquitous architectural motif utilized in DNA compaction and protein dimerization. Proc Natl Acad Sci U S A 92: 11170-11174

Bailey TL, Elkan C (1994) Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 28-36

Baxevanis AD, Arents G, Moudrianakis EN, Landsman D (1995) A variety of DNA-binding and multimeric proteins contain the histone fold motif. Nucleic Acids Res 23: 2685-2691

Bellorini M, Lee DK, Dantonel JC, Zemzoumi K, Roeder RG, Tora L, Mantovani R (1997) CCAAT binding NF-Y-TBP interactions: NF-YB and NF-YC require short domains adjacent to their histone fold motifs for association with TBP basic residues. Nucleic Acids Res 25: 2174-2181

Bray EA, Bailey-Serres, J. and Weretilnyk, E (2000). Responses to abiotic stresses. In: Biochemistry and molecular biology of plants. Eds. B. Buchanan, W. Gruissem and R. Jones. American Society of Plant Physiologists. Rockville.

Bucher P (1990) Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. Journal of Molecular Biology 212: 563-578

Courey AJ, Holtzman DA, Jackson SP, Tjian R (1989) Synergistic activation by the glutamine-rich domains of human transcription factor Sp1. Cell 59: 827-836

Coustry F, Maity SN, Sinha S, de Crombrugghe B (1996) The transcriptional activity of the CCAAT-binding factor CBF is mediated by two distinct activation domains, one in the CBF-B subunit and the other in the CBF-C subunit. J Biol Chem 271: 14485-14491

Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) WebLogo: a sequence logo generator. Genome Res 14: 1188-1190

Dorn A, Bollekens J, Staub A, Benoist C, Mathis D (1987a) A multiplicity of CCAAT-box-binding proteins. Cell 50: 863-872

Dorn A, Durand B, Marfing C, Le Meur M, Benoist C, Mathis D (1987b) Conserved major histocompatibility complex class II boxes--X and Y--are transcriptional control elements and specifically bind nuclear proteins. Proc Natl Acad Sci U S A 84: 6249-6253

Edwards D, Murray JA, Smith AG (1998) Multiple genes encoding the conserved CCAAT-box transcription factor complex are expressed in Arabidopsis. Plant Physiol 117: 1015-1022

Feldman M (2001) The origin of cultivated wheat. In: The World Wheat Book. Eds. AP Bonjean and WJ Angus. Lavoisier Publishing. Paris.


Triticum aestivum

Gill G, Pascal E, Tseng ZH, Tjian R (1994) A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation. Proc Natl Acad Sci U S A 91: 192-196

Gong W, Shen YP, Ma LG, Pan Y, Du YL, Wang DH, Yang JY, Hu LD, Liu XF, Dong CX, Ma L, Chen YH, Yang XY, Gao Y, Zhu D, Tan X, Mu JY, Zhang DB, Liu YL, Dinesh-Kumar SP, Li Y, Wang XP, Gu HY, Qu LJ, Bai SN, Lu YT, Li JY, Zhao JD, Zuo J, Huang H, Deng XW, Zhu YX (2004) Genome-wide ORFeome cloning and analysis of Arabidopsis transcription factor genes. Plant Physiol 135: 773-782

Gusmaroli G, Tonelli C, Mantovani R (2001) Regulation of the CCAAT-Binding NF-Y subunits in Arabidopsis thaliana. Gene 264: 173-185

Hahn S, Pinkham J, Wei R, Miller R, Guarente L (1988) The HAP3 regulatory locus of Saccharomyces cerevisiae encodes divergent overlapping transcripts. Mol Cell Biol 8: 655-663

Heard JE, Nelson D, Adams TR, Purcell J (2006) Transgenic approaches to improving drought stress tolerance in maize Proc. 8th Intl. cong. Plant Mol.Biol., Sym, pp. 41.

Kim IS, Sinha S, de Crombrugghe B, Maity SN (1996) Determination of functional domains in the C subunit of the CCAAT-binding factor (CBF) necessary for formation of a CBF-DNA complex: CBF-B interacts simultaneously with both the CBF-A and CBF-C subunits to form a heterotrimeric CBF molecule. Mol Cell Biol 16: 4003-4013

Kim S, Na JG, Hampsey M, Reinberg D (1997) The Dr1/DRAP1 heterodimer is a global repressor of transcription in vivo. Proc Natl Acad Sci U S A 94: 820-825

Kusnetsov V, Landsberger M, Meurer J, Oelmuller R (1999) The assembly of the CAAT-box-binding complex at a photosynthesis gene promoter is regulated by light, cytokinin, and the stage of the plastids. J Biol Chem 274: 36009-36014

Lee H, Fischer RL, Goldberg RB, Harada JJ (2003) Arabidopsis LEAFY COTYLEDON1 represents a functionally specialized subunit of the CCAAT binding transcription factor. Proc Natl Acad Sci U S A 100: 2152-2156

Lotan T, Ohto M, Yee KM, West MA, Lo R, Kwong RW, Yamagishi K, Fischer RL, Goldberg RB, Harada JJ (1998) Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 93: 1195-1205

Maity SN, de Crombrugghe B (1992) Biochemical analysis of the B subunit of the heteromeric CCAAT-binding factor. A DNA-binding domain and a subunit interaction domain are specified by two separate segments. J Biol Chem 267: 8286-8292

Mantovani R (1998) A survey of 178 NF-Y binding CCAAT-boxes. Nucleic Acids Res 26: 1135-1143

Mantovani R (1999) The molecular biology of the CCAAT-binding factor NF-Y. Gene 239: 15-27


Triticum aestivum

McNabb DS, Xing Y, Guarente L (1995) Cloning of yeast HAP5: a novel subunit of a heterotrimeric complex required for CCAAT binding. Genes Dev 9: 47-58

Miyoshi K, Ito Y, Serizawa A, Kurata N (2003) OsHAP3 genes regulate chloroplast biogenesis in rice. Plant J 36: 532-540

Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45

Pinkham JL, Olesen JT, Guarente LP (1987) Sequence and nuclear localization of the Saccharomyces cerevisiae HAP2 protein, a transcriptional activator. Mol Cell Biol 7: 578-585

Rasmussen R (2001) Quantification on the LightCycler instrument. In: ) Rapid Cycle Real-time PCR, Methods and Applications. Eds. S. Meuer, C. Wittwer and K. Nakagawara. Springer Press. Heidelberg.

Retief JD (2000) Phylogenetic analysis using PHYLIP. Methods Mol Biol 132: 243-258

Riano-Pachon DM, Ruzicic S, Dreyer I, Mueller-Roeber B (2007) PlnTFDB: An integrative plant transcription factor database. BMC Bioinformatics 8: 42

Riechmann JL, Heard J, Martin G, Reuber L, Jiang C, Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR, Creelman R, Pilgrim M, Broun P, Zhang JZ, Ghandehari D, Sherman BK, Yu G (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290: 2105-2110

Romier C, Cocchiarella F, Mantovani R, Moras D (2003) The NF-YB/NF-YC structure gives insight into DNA-binding and transcription regulation by CCAAT factor NF-Y. J Biol Chem 278: 1336-1345

Schmidt HA, Strimmer K, Vingron M, von Haeseler A (2002) TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18: 502-504

Shinozaki K, Yamaguchi-Shinozaki K, Seki M (2003) Regulatory network of gene expression in the drought and cold stress responses. Curr Opin Plant Biol 6: 410-417

Sinha S, Kim IS, Sohn KY, de Crombrugghe B, Maity SN (1996) Three classes of mutations in the A subunit of the CCAAT-binding factor CBF delineate functional domains involved in the three-step assembly of the CBF-DNA complex. Mol Cell Biol 16: 328-337

Sinha S, Maity SN, Lu J, de Crombrugghe B (1995) Recombinant rat CBF-C, the third subunit of CBF/NFY, allows formation of a protein-DNA complex with CBF-A and CBF-B and with yeast HAP2 and HAP3. Proc Natl Acad Sci U S A 92: 1624-1628

Song W, Solimeo H, Rupert RA, Yadav NS, Zhu Q (2002) Functional dissection of a Rice Dr1/DrAp1 transcriptional repression complex. Plant Cell 14: 181-195


Triticum aestivum

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882

Xing Y, Zhang S, Olesen JT, Rich A, Guarente L (1994) Subunit interaction in the CCAAT-binding heteromeric complex is mediated by a very short alpha-helix in HAP2. Proc Natl Acad Sci U S A 91: 3009-3013

Xue GP, Bower NI, McIntyre CL, Riding GA, Kazan K, Shorter R (2006) TaNAC69 from the NAC superfamily of transcription factors is upregulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences. Functional Plant Biology 33: 43-57

Xue GP, Loveridge CW (2004) HvDRF1 is involved in abscisic acid-mediated gene regulation in barley and produces two forms of AP2 transcriptional activators, interacting preferably with a CT-rich element. Plant J 37: 326-339

Zemzoumi K, Frontini M, Bellorini M, Mantovani R (1999) NF-Y histone fold alpha1 helices help impart CCAAT specificity. J Mol Biol 286: 327-337

Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53: 247-273


Triticum aestivum

3.8 SUPPLEMENTARY MATERIALS


Supplementary Table 3.2 Triticum aestivum NF-Y subunit gene-specific and reference gene primers. All gene-specific primers used for RT-PCR analysis are listed with

assigned identifiers as well as reference gene primers.

Gene Forward Primer Sequence (5'-3') Reverse Primer Sequence (5'-3') TaNF-YA1 TNFYA1F TGCTTTGCACCCACATAGTTCT TNFYA1R TTTGTCCCAACGCACCAGTA TaNF-YA2 TNFYA2F CTTCCACGTCGCATTACCTCTT TNFYA2R ATCACAAGATCCCTGAGAACCAG TaNF-YA3 TNFYA3Fb AACTGTTTTCCTGTCACTTTGTTGTTT TNFYA3Rb ACGCCGGGAATGGTTATTACTT TaNF-YA4 TNFYA4F ATATCAGCTGGACCAAGACATTGTT TNFYA4R GGTCTCTGGGATAATCAAGGTGTG TaNF-YA5 TNFYA5F GCCGGTTTCTTAACGCAAAGT TNFYA5R GCAACGCCATTCTGCTTGT TaNF-YA6 TNFYA6Fd GTACAACGGTCGCTTCGAGTTT TNFYA6Rd GGCTACCAGGCGTCGATTT TaNF-YA7 TNFYA7F TGTGGTAGATTTGTGGCATGG TNFYA7R TACGCCGGGAATGCTTATTAGT TaNF-YA9 TNFYA9F TGGTGTGCTGATGGCACTATG TNFYA9R GGATAGTCAGGGTGCCTTATTTGA TaNF-YA10 TNFYA10F CAGCAGCAGTCTGGCAGTG TNFYA10R CCGCTGCCTAGCCGTAGATTaNF-YB1 TNFYB1F AGCTTCTGCGTCCTGTGTACTG TNFYB1R GACAAGCCCACATTAGATAAGCACTATaNF-YB2 TNFYB2F AAAGGCTGCTTCCCAGATGTAA TNFYB2R CAACCATGCTAAACCACAACTGA TaNF-YB3 TNFYB3F TGGATGAAGCCGTGACTTGTAG TNFYB3R ATGGAGAGCTTCCCAGGTATGA TaNF-YB4 TNFYB4F TAAGGCCCGCCAAACAGA TNFYB4R GACACCAATCAGCCCAAACA TaNF-YB6 TNFYB6F AGCGCGAGAACGCAAGAC TNFYB6R GAGCTTGAGGGCTTCCATGTAG TaNF-YB7 TNFYB7F CCGTACATGACTTGTAGCTTAAGGAAAT TNFYB7R GGATTAGAACAATCATTCCTCCTTGT TaNF-YB8 TNFYB8F GGTTCGGACGGAAAGAGTGA TNFYB8R TTAAGCTACAGGCAGGCTTCATC TaNF-YB9 TNFYB9F TTTTACCTAATGCGGGCTTGTC TNFYB9R GGGAAACCAAATTAAGCAACGATAA TaNF-YB10 TNFYB10Fb AAGGCTCGCCAGACAGACAT TNFYB10Rb GCTTGCACGTTGCATCACA TaNF-YB11 TNFYB11F GTTCTGTGCATGCGGGATACT TNFYB11R GACGTGGAAAAGGCGTATCTCT TaNF-YC1 TNFYC1F TGCCACCCACCAGGATAAG TNFYC1R CTTGGCGACCATCCATGA TaNF-YC2 TNFYC2F ACGCAGCATCGGTTGATTC TNFYC2R AATTCAGGGCGAACCATACAGT TaNF-YC3 TNFYC3F CATGCCATGCCGTCTCAT TNFYC3R CAAATTATTCTTACATCACCAACGAAGA TaNF-YC5 TNFYC5Fc CCCTTGAAATCTGAAGCAGAAAGA TNFYC5Rc TCTGCAAGCTAGGGCGATGT TaNF-YC6 TNFYC6F CTCGGTGGCGGTGAATCTT TNFYC6R TTGAAAATTTCCTTCTTCTGGGTAATC TaNF-YC7 TNFYC7F GTCTCCCTCAAACTAGCCAAGAGAT TNFYC7R GCCAACGATGACGGAAATAAATTaNF-YC8 TNFYC8F CCAGCTTGACAATGTAGTAGCAATTC TNFYC8R CAGCATCTGCGGGTACACATACTaNF-YC9 TNFYC9Fc CGAGGCAGGCCGTATGAT TNFYC9Rc CCACTGCTAATTACGATGCACAA TaNF-YC10 TNFYC10F GTGCTGCTATCCCGACAACAC TNFYC10R GGCGCTTCCTGGTGATGA TaNF-YC11 TNFYC11F AGTGATCGATGCCAGAGCTGTA TNFYC11R GCGCGCCGTGGTAAATAG TaNF-YC12 TNFYC12F CGCATTGGATACTCCTTGCTAGT TNFYC12R CTGCGCGCCATGGTAAATA TaNF-YC13 TNFYC13F CCGATGAAAGGTTCTCGTAGGTA TNFYC13R CCACCATCCGATCTAACAATGA TaNF-YC14 TNFYC14F TGGGCAAGGGAAGCACAT TNFYC14R ATTCAGAGCAGACGCACATCAA TaDR1A TADR1AFd GGCCTGGACTGGGACAGTT TADR1ARd TGGCTGAAATCACACACGATTTA TaDR1B TADR1BFc GTATTGTGCGTGTCGTGTCAGA TADR1BRc CAATTATTATCATCACAGGCGAACA TaCCF TaCCFF GCTCTAACCCACTCGGCCTAA TaCCFR TCTACACCCCAGTACACATATGACATAA C12B07 C12B07F GAACTGTCTGGATTGTCCCATCA C12B07R ACAGTAGGCCCACACCAATGTAC TaPGM2 TaPGM2F3 GCTTTCGAAGATCCAGGAGTACA TaPGM2R4 CTATCGAACAGGAGGCCAGAAC TaRPII36 TaRPII36fF3 ACGTATTAACCAAGAACTCATGGAGAC TaRPII36fR4 TCAAATACTTTTGTAGGGCTGCTCTC TaRP15 TaRP15F5 GCACACGTGCTTTGCAGATAAG TaRP15R6 GCCCTCAAGCTCAACCATAACT TaSnRK1 TaSnRK1F1 GCTTCGGTGTGGAGTCTGCTAT TaSnRK1R2 TCCCTTGTTTTGTAGAGCTGAATTTC


Triticum aestivum

Supplementary Table 3.3 Ct values of TaNF-Y genes analysed by real-time PCR. All Ct values are

means of three biological replicates from samples of non-stressed wheat plants. Amplicon size is the

PCR product size. PCR amplification efficiency is estimated from a dilution series of samples where

the gene was highly expressed. Apparent expression level (AEL) is provided to indicate the

expression levels between the TaNF-Y genes.

Gene Ct in root

Amplicon size (bp)

PCR amplification efficiency AEL

TaNF-YA1 22.87 73 2 0.99 TaNF-YA2 23.51 62 2 0.75 TaNF-YA3 24.68 95 1.95 0.41 TaNF-YA4 24.45 148 1.99 0.18 TaNF-YA5 25.82 79 2 0.12 TaNF-YA6 22.73 119 1.95 1.19 TaNF-YA7 24.31 142 2 0.19 TaNF-YA9 24.84 89 1.88 0.97 TaNF-YA10 24.95 86 2 0.2 TaNF-YB1 32.98 90 2 0.0007 TaNF-YB2 23.12 68 1.96 1.42 TaNF-YB3 27.73 139 1.9 0.07 TaNF-YB4 33.65 135 2 0.0003 TaNF-YB6 24.54 91 1.91 0.77 TaNF-YB7 26.62 63 2 0.09 TaNF-YB8 27.46 115 1.76 0.88 TaNF-YB9 39.15 80 1.94 0.00004 TaNF-YB10 24.96 58 2 0.29 TaNF-YB11 25.29 144 2 0.09 TaNF-YC1 32.73 140 1.9ª 0.003 TaNF-YC2 31.03 131 1.81 0.04 TaNF-YC3 30.63 86 1.83 0.06 TaNF-YC5 35.84 91 1.85 0.002 TaNF-YC6 24.55 61 1.99 0.42 TaNF-YC7 25.34 108 2 0.12 TaNF-YC8 26.43 55 1.95 0.22 TaNF-YC9 36.84 98 1.9ª 0.0003 TaNF-YC10 38.59 66 2 0.00002 TaNF-YC11 38.6 62 1.72 0.007 TaNF-YC12 34.05 57 2 0.0005 TaNF-YC13 24.86 141 2 0.13 TaNF-YC14 24.66 79 2 0.26 TaDr1A 23.41 130 1.93 0.88 TaDr1B 24.97 86 1.9 0.71

ªAn average value is given due to its very low level of expression in all organs and

experimental measurement of PCR amplification efficiency of this gene was not

accurate.


(A)

Supplementary Figure 3.10. Phylogenetic trees of the NF-Y subunit families in Arabidopsis, rice and wheat. NF-YA conserved core tree (A); NF-YA full-length tree (B); NF-YB conserved core tree (C); NF-YB full-length tree (D); NF-YC conserved core tree (E); NF-YC full-length tree (F). Bootstrap values from 1000 replicates have been used to assess the robustness of the trees. Bootstrap values are shown in red. Each tree has been rooted using the Saccharomyces cerevisiae HAP homologues. Arabidopsis sequences begin with (At), rice sequences begin with (Os) and wheat sequences begin with (Ta). Arabidopsis and rice sequences are all the unique protein sequences from ArabTFDB version 1.1 (http://arabtfdb.bio.uni-potsdam.de/v1.1/) and RiceTFDB version 2.1 (http://ricetfdb.bio.uni-potsdam.de/v2.1/).


(B)


(C)


Triticum aestivum

(D)


Triticum aestivum

(E)


Triticum aestivum

(F)


Triticum aestivum

Chapter 4: 111 TaNF-YC11, one of the light-upregulated NF-YC members in Triticum aestivum, is co-regulated with

photosynthesis-related genes

Chapter 4: TaNF-YC11, one of the light-upregulated NF-YC members in Triticum aestivum, is co-regulated with photosynthesis-related genes


Stephenson, T. J., McIntyre, C. L., Collet, C. and Xue, G. P. (2010). TaNF-

YC11, one of the light-upregulated NF-YC members in Triticum aestivum, is co-

regulated with photosynthesis-related genes. Functional and Integrative Genomics

10(2): 265-276.

This chapter is presented in the format required for the journal Functional and

Integrative Genomics.










112 Chapter 4: TaNF-YC11, one of the light-upregulated NF-YC members in Triticum aestivum, is co-regulated with


4.2 ABSTRACT

NF-Y is a heterotrimeric transcription factor complex. Each of the NF-Y

subunits in plants is encoded by multiple genes. Quantitative RT-PCR analysis

revealed that five wheat NF-YC members (TaNF-YC5, 8, 9, 11 & 12) were

upregulated by light in both the leaf and seedling shoot. Coexpression analysis of

Affymetrix wheat genome array datasets revealed that transcript levels of a large

number of genes were consistently correlated with those of the TaNF-YC11 and

TaNF-YC8 genes in 3-4 separate Affymetrix array datasets. TaNF-YC11-correlated

transcripts were significantly enriched with the Gene Ontology term photosynthesis.

Sequence analysis in the promoters of TaNF-YC11-correlated genes revealed the

presence of putative NF-Y complex binding sites (CCAAT motifs). Quantitative RT-

PCR analysis of a subset of potential TaNF-YC11 target genes showed that ten out of

the thirteen genes were also light-upregulated in both the leaf and seedling shoot and

had significantly correlated expression profiles with TaNF-YC11. The potential

target genes for TaNF-YC11 include subunit members from all four thylakoid

membrane bound complexes required for the conversion of solar energy into

chemical energy and rate-limiting enzymes in the Calvin cycle. These data indicate

that TaNF-YC11 is potentially involved in regulation of photosynthesis-related

genes.



4.3 INTRODUCTION

Light is one of the most important environmental stimuli to plants, triggering

the reprogramming of nuclear gene expression through complex biological pathways.

Plants sense the quality, quantity, direction and duration of light through four distinct

families of photoreceptors: phytochromes, cryptochromes, phototropins and

unidentified ultraviolet B photoreceptor (Christie 2007; Li et al. 2007; Bae et al.

2008). These photoreceptors trigger effectors such as transcription factors (TFs),

kinases, phosphatases and degradation-pathway proteins (Chen et al. 2004). TFs are

of particular interest as they act as master-controllers, capable of regulating multiple

genes within their transcriptional networks. Light-signalling induces differential

expression of at least 20 % of all Arabidopsis and rice genes (Jiao et al. 2005) and as

many as 26 % of the 1363 TF genes found in Arabidopsis are differentially expressed

in developing seedlings in response to blue-light (Jiao et al. 2003).

Several studies have suggested that the Nuclear factor Y (NF-Y) family is

involved in light-mediated gene regulation (Kusnetsov et al. 1999; Miyoshi et al.

2003; Warpeha et al. 2007). Kusnetsov et al. (1999) have shown that assembly of the

NF-Y complex at the CCAAT-box in the spinach AtpC promoter is regulated by

light. In rice, three NF-YB proteins (OsHAP3A-C) regulate a number of

photosynthesis genes including a chlorophyll-a/b binding protein (CAB) and the

small subunit of RuBisCO (RBCS) (Miyoshi et al. 2003). Furthermore, rice plants

with antisense or RNAi constructs of OsHAP3A have reduced chlorophyll content in

the leaves and degenerated chloroplasts (Miyoshi et al. 2003). In Arabidopsis, NF-

YA5 and NF-YB9 have been shown to be involved in the regulation of light-

harvesting chlorophyll a/b binding protein (Lhcb) (Warpeha et al. 2007).

Some plant NF-Y subunits can interact with other light-regulated TFs such as

CONSTANS (CO; a zinc finger TF) (Wenkel et al. 2006). A tomato NF-YC member

(THAP5a) can bind either tomato CONSTANS-like 1 (TCOL1) or Arabidopsis

thaliana CO (AtCO) (Ben-Naim et al. 2006). Furthermore, the yeast

HAP2/3/THAP5a complex is capable of recruiting TCOL1 to the HAP-responsive

CCAAT-box sites in the yeast HEM1 and CYC1 genes (Ben-Naim et al. 2006).

Several Arabidopsis NF-YB and NF-YC members (AtLEC1, AtL1L, AtHAP3a-c &

AtHAP5a-c) can bind to both AtCO and AtCOL15 in a yeast-two-hybrid system,

while interactions between AtHAP3a and AtHAP5a with AtCO have been



demonstrated both in vitro and in planta (Wenkel et al. 2006). Overexpression of

AtHAP3b in Arabidopsis promotes early flowering and increases the expression of

flowering time genes FLOWERING LOCUS T (FT) and SUPPRESSOR OF

OVEREXPRESSION OF CONSTANS1 (SOC1; a MADS TF) (Cai et al. 2007).

Furthermore, Arabidopsis mutants, hap3b-1 and hap3b-2 have reduced expression of

FT and exhibit delayed flowering under long days and osmotic-stress conditions

(Chen et al. 2007). In Arabidopsis, NF-YB2 and NF-YB3 have been shown to play

additive roles in the promotion of flowering by inductive long-day photoperiods

(Kumimoto et al. 2008).

NF-Y is a heterotrimeric complex which binds specifically to the cis-acting

CCAAT-box elements which is one of the most ubiquitous promoter elements in

eukaryote genomes (Bucher 1990; Mantovani 1998). The three NF-Y subunits, NF-

YA (HAP2/CBF-B), NF-YB (HAP3/CBF-A) and NF-YC (HAP5/CBF-C) are

defined by their highly conserved core regions, containing residues necessary for

DNA and protein interactions. In contrast to mammals and yeast, each of the three

NF-Y subunits is encoded by gene families in plants. Arabidopsis NF-YA, NF-YB

and NF-YC subunit families have 10, 13 and 13 members, respectively (Siefers et al.

2009). Similar sizes of NF-Y subunit families have been reported in wheat and rice

(Stephenson et al. 2007; Thirumurugan et al. 2008). Although there is an expansion

of the NF-Y family in plants, several NF-Y subunit members form functional

trimeric complexes with mammalian and/or yeast NF-Y subunits (Edwards et al.

1998; Ben-Naim et al. 2006; Park 2006; Kumimoto et al. 2008). These findings

indicate a high level of functional conservation in the recognition of the CCAAT-box

among NF-Y members from various divergent species. Any functional specialisation

of individual plant NF-Y subunit members in the formation of heterotrimer complex

and their DNA-binding specificity remain to be demonstrated.

Although, functional CCAAT-boxes have been identified in the promoters of

photosynthesis-related genes (Kehoe et al. 1994; Kusnetsov et al. 1999), the role of

NF-YC members in regulation of photosynthetic genes is currently unknown. This

study aims to identify light-responsive members of the NF-YC family in wheat and

investigate their potential roles in light-mediated gene regulation, with particular

attention on the regulation of photosynthetic genes. The Triticum aestivum NF-YC

(TaNF-YC) family comprises at least 14 genes, some of which are expressed



predominantly in the leaf (Stephenson et al. 2007). We have identified five NF-YC

genes which are significantly upregulated by light in wheat. Coexpression analysis

using public Affymetrix wheat genome array datasets and quantitative RT-PCR

revealed the potential role of the light-upregulated TaNF-YC11 in regulation of a

number of photosynthesis-related genes.


4.4.1 PLANT MATERIALS AND TREATMENTS

Spring wheat (Triticum aestivum L. cv. Babax) plants were grown in a

controlled-environment growth room in 1.5 L pots, containing a 3:1:1 mix of

sand:soil:peat under night/day conditions of 14/18°C, 90/60 % relative humidity and

16-h light with a photosynthetically active radiation flux of 500 µmol m-2s-1 at the

plant canopy level (supplied by 1000 W metal halide lamps, 1000 W quartz halogen

lamps and 150 W tungsten incandescent lamps). For the light and dark-treatment

experiment of 23-day-old plants fully expanded new leaves were collected from

plants 6-h after lights on (light-treatment) or from plants after 40-h dark-treatment in

a separate controlled-environment growth room with growth temperatures adjusted to

the same conditions as light-treated plants. Leaves from both light and dark-treated

plants were sampled at a similar time point (within 30 min from start to end) to

negate any impact of diurnal variation in expression. For dark and light-treatments of

seedlings, wheat seeds were germinated in wet tissue paper for 5 days at 20°C in

either complete darkness or continuous white fluorescence lights. At the time of

sampling, the residual endosperm starch of the grains was still visible. Samples were

immediately immersed in liquid nitrogen and stored at -80˚C prior to RNA isolation.

4.4.2 TOTAL RNA EXTRACTION AND CDNA SYNTHESIS

Total RNA was isolated from seedling shoots and fully expanded new leaves

under dark or light-treatment conditions using Plant RNA Reagent from Invitrogen

following the manufacturer’s directions. RNA was treated with RNase-Free DNase

(Xue and Loveridge 2004) and purified using the RNeasy Plant Mini-kit column

(Qiagen) following the manufacturer’s instructions. First strand complementary

DNA (cDNA) was synthesised using an oligo (dT20) primer from purified total RNA

using SuperScript III Reverse Transcriptase (Invitrogen) following the

manufacturer’s instructions.




Transcript levels for potential target genes were quantified by real-time PCR as

described in (Stephenson et al. 2007). Gene-specific primer pairs for TaNF-YC11 co-

expressed genes are listed in Supplementary Table 4.4. Two reference genes from

Triticum aestivum were used as internal controls (Supplementary Table 4.4):

TaRPII36 is a RNA polymerase II 36 kDa subunit gene; TaRP15 is a RNA

polymerase 15 kDa subunit gene (Xue et al. 2008). Amplification efficiency for each

of the primer pairs was calculated using a dilution series and relative quantification

was calculated as EtcCPt-sCPt×Er

sCPr-cCPr (Pfaffl 2001), where Et and Er represents the

amplification efficiencies of a target gene and a reference gene, cCPt and sCPt

represent the crossing point values for a control tissue sample and a target tissue

sample analysed using target gene-specific primers and sCPr and cCPr represent the

crossing point values for a target tissue sample and a control tissue sample analysed

using reference gene-specific primers. A mean crossing point (CP) value was taken

from three replicate PCR reactions for each of three biological samples. The

specificity of the PCR reactions was determined by melting curve analysis of the

products. The Students t-test was performed as a test of significance of differences in

expression levels. P-values of ≤ 0.05 were considered to indicate statistically

significant differences. Pearson correlation coefficients (r) for coexpression analysis

were calculated between potential target genes and the TaNF-YC members from

light and dark-treatments. Significance tests of correlation coefficients were

calculated using a t-distribution, where t was calculated as t=r÷√[(1-r2)÷df], where r

represents the population size and df represents the degrees of freedom. P-values

0.05 were considered to indicate statistically significant correlations.

4.4.4 IDENTIFICATION OF POTENTIAL TARGET GENES USING AFFYMETRIX GENECHIP® DATA ANALYSIS AND GO ENRICHMENT ANALYSIS

Affymetrix wheat genome array expression datasets were collected from

EMBL-EBI ArrayExpress Browser (http://www.ebi.ac.uk/microarray-as/ae)

(Parkinson et al. 2009). The Affymetrix wheat genome array contains 61,127 probe

sets representing 55,052 transcripts for all 42 chromosomes in the wheat genome.

Eight Affymetrix datasets (E-MEXP-1193, E-GEOD-9767, E-MEXP-971, E-GEOD-

6227, E-MEXP-1523, E-GEOD-6027, E-GEOD-4935, E-GEOD-5942) were

collected for analysis (Crismani et al. 2006; Jordan et al. 2007; Mott et al. 2007; Qin



et al. 2008; Wan et al. 2008; Xue et al. 2008). The raw GeneChip data was

normalised using a robust multi-array average (RMA) using a log scale measure of

expression (Irizarry et al. 2003) using the default settings for the Bioconductor affy

package within the R statistical programming environment (http://www.r-

project.org/) (Gautier et al. 2004) as described previously (Xue et al. 2008). The

normalised expression values were converted back to non-log values for analysis.

Probe sets representing the TaNF-YC family members were identified using NetAffx

(http://www.affymetrix.com/analysis/) (Liu et al. 2003). Pearson correlation

coefficients (r) were calculated between the mRNA levels of TaNF-YC members and

those of all other genes in each Affymetrix Wheat Genome array datasets.

Significance tests of correlation coefficients were calculated as described above.

Gene Ontology (GO) term enrichment analysis was performed on the list of probe

sets found to have significantly correlated expression with TaNF-YC probe sets

using the EasyGO Gene Ontology enrichment analysis tool

(http://bioinformatics.cau.edu.cn/easygo/) (Zhou et al. 2007). The aspect for analysis

used was Biological process. False discovery rate (FDR) adjusted P-values ≤ 0.01

were considered to indicate significantly enriched GO terms. Sequences representing

probe sets with significantly correlated expression profiles with TaNF-YC members

were collected from the Triticum aestivum Gene Indices (TaGI) (Release 11.0,

ftp://occams.dfci.harvard.edu/).

4.5 RESULTS

4.5.1 MEMBERS OF THE TANF-YC SUBUNIT FAMILY ARE UPREGULATED BY LIGHT

To identify whether TaNF-YC members are regulated by light, quantitative

Real-Time PCR was used to examine expression differences of TaNF-YC members

between light and dark-treatments. The expression levels of the TaNF-YC members

were analysed at two developmental stages in the leaf of 23-day-old plants and the

shoot (consisting of leaf and leaf sheath) of 5-day-old seedlings and were compared

between light and dark-treatments. Among 14 TaNF-YC members (Stephenson et al.

2007), TaNF-YC4 expression was not detectable in wheat leaves and seedlings using

three separate primer pairs attempted. Six TaNF-YC genes (TaNF-YC3, 5, 8, 9, 11 &

12) were upregulated in the leaves of 23-day-old wheat plants with 6-h exposure to

light, compared to plants with 40-h dark-treatment (Figure 4.1A). Light upregulation



of these TaNF-YC members was also observed in the seedling shoot except TaNF-

YC3 which was down-regulated in the seedling (Figure 4.1B). In particular three

members (TaNF-YC5, 11 & 12) were expressed 100- to 500-fold higher in the green

shoots of seedlings grown under continuous white light compared to complete

darkness (etiolated shoots) (Figure 4.1B). The discrepancy in TaNF-YC3 response to

light-treatment between the experimental systems of 23-day-old plants and 5-day-old

seedlings can be attributed to the difference in cellular sugar levels in the leaf

between light- and dark-treated 23-day-old soil-grown plants. The discrepancy

between the expression patterns of TaNF-YC3 in response to light at the two

developmental stages may be due to the changing carbohydrate status in the plant

source and sink tissues (Koch 1996). In the mature plants, sugar (sucrose and

hexoses) levels are likely to be higher when grown under light conditions. In the

seedling system, carbon is supplied by mobilisation of endosperm in the grain. By

the time of sampling, there was still plenty of residual starch visible. Therefore,

TaNF-YC3 may be involved in the regulation of genes involved in resource

distribution (Koch 1996). The expression levels of the remaining TaNF-YC members

in the leaves and seedling shoots showed little or no change between light and dark

conditions (Figure 4.1A-B).

4.5.2 GENES THAT ARE CORRELATED WITH TANF-YC11 IN AFFYMETRIX DATASETS ARE ENRICHED WITH THOSE INVOLVED IN PHOTOSYNTHESIS

To identify the potential target genes of the light-upregulated TaNF-YC

members several Affymetrix datasets were analysed to find transcripts with

significantly correlated expression profiles with the TaNF-YC members. Transcripts

found to be co-expressed with light-upregulated TaNF-YC members were then

compiled into query lists which were used to identify their putative roles using Gene

Ontology (GO) enrichment analysis.

Of the five light-upregulated TaNF-YC members that were observed in both 5-

day-old seedlings and 23-day-old plants, two (TaNF-YC8 & 11) had representative

probe sets (100 % sequence identities with all 11 probe sets) in the Affymetrix

Wheat Genome Array (Supplementary Table 4.5). Affymetrix datasets where TaNF-

YC8 and TaNF-YC11 had variable expression (at least 2-fold difference in

hybridisation signal within a dataset) were chosen to identify co-regulated

transcripts. Transcripts were selected for further analysis if significantly correlated



Figure 4.1. Changes in the mRNA levels of wheat NF-YC genes in the leaf and seedling shoot in response to dark and light growth-conditions. (A) Expression changes in the leaf of 23-day-old plants; (B) expression changes in the seedlings with relative expression levels presented using a logarithmic scale. Transcript level is expressed relative to the dark-growth-conditions. Values are means +SD of three biological samples. Each sample was analysed with triplicate PCR assays. Statistical significance of differences was analysed using the Students t-test and is indicated by triple asterisks (P 0.001), double asterisks (P 0.01) and a single asterisk (P 0.05). The sequences of these TaNF-YC genes were documented in (Stephenson et al. 2007)

TaNF-YC gene expression levels in the seedling in response to light

0.1

1

10

100

1000

TaN

F-Y

C1

TaN

F-Y

C2

TaN

F-Y

C3

TaN

F-Y

C5

TaN

F-Y

C6

TaN

F-Y

C7

TaN

F-Y

C8

TaN

F-Y

C9

TaN

F-Y

C10

TaN

F-Y

C11

TaN

F-Y

C12

TaN

F-Y

C13

TaN

F-Y

C14

TaNF-YC members

Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

TaNF-YC gene expression levels in the leaf in response to light

0

2

4

6

8

10

12

TaN

F-Y

C1

TaN

F-Y

C2

TaN

F-Y

C3

TaN

F-Y

C5

TaN

F-Y

C6

TaN

F-Y

C7

TaN

F-Y

C8

TaN

F-Y

C9

TaN

F-Y

C10

TaN

F-Y

C11

TaN

F-Y

C12

TaN

F-Y

C13

TaN

F-Y

C14

TaNF-YC members

Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

A

BTaNF-YC gene expression levels in the seedling in response to

light

0.1

1

10

100

1000

TaN

F-Y

C1

TaN

F-Y

C2

TaN

F-Y

C3

TaN

F-Y

C5

TaN

F-Y

C6

TaN

F-Y

C7

TaN

F-Y

C8

TaN

F-Y

C9

TaN

F-Y

C10

TaN

F-Y

C11

TaN

F-Y

C12

TaN

F-Y

C13

TaN

F-Y

C14

TaNF-YC members

Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

TaNF-YC gene expression levels in the seedling in response to light

0.1

1

10

100

1000

TaN

F-Y

C1

TaN

F-Y

C2

TaN

F-Y

C3

TaN

F-Y

C5

TaN

F-Y

C6

TaN

F-Y

C7

TaN

F-Y

C8

TaN

F-Y

C9

TaN

F-Y

C10

TaN

F-Y

C11

TaN

F-Y

C12

TaN

F-Y

C13

TaN

F-Y

C14

TaNF-YC members

Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light


0

2

4

6

8

10

12

TaN

F-Y

C1

TaN

F-Y

C2

TaN

F-Y

C3

TaN

F-Y

C5

TaN

F-Y

C6

TaN

F-Y

C7

TaN

F-Y

C8

TaN

F-Y

C9

TaN

F-Y

C10

TaN

F-Y

C11

TaN

F-Y

C12

TaN

F-Y

C13

TaN

F-Y

C14

TaNF-YC members

Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light


0

2

4

6

8

10

12

TaN

F-Y

C1

TaN

F-Y

C2

TaN

F-Y

C3

TaN

F-Y

C5

TaN

F-Y

C6

TaN

F-Y

C7

TaN

F-Y

C8

TaN

F-Y

C9

TaN

F-Y

C10

TaN

F-Y

C11

TaN

F-Y

C12

TaN

F-Y

C13

TaN

F-Y

C14

TaNF-YC members

Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

A

B



expression was identified in a minimum of three separate datasets. Positive

relationships were selected by focusing on transcripts expressed higher than their

potential regulator (TaNF-YC8 or TaNF-YC11), based on the general assumption of

signal amplification from a transcription factor to its target genes. About 300 probe

sets were significantly correlated with TaNF-YC11 expression in at least three of the

four datasets [E-MEXP-1193, E-MEXP-1523, E-GEOD-6027 & E-MEXP-

971(shoot)] analysed. Two hundred and six of the TaNF-YC11-correlated probe sets,

listed in Supplementary Table 4.6, had higher expression levels than TaNF-YC11.

For TaNF-YC8, 116 probe sets with had significantly correlated expression were

found in all three datasets (E-MEXP-1193, E-GEOD-6027 & E-GEOD-4935)

analysed. Seventy of the TaNF-YC8-correlated probe sets, listed in Supplementary

Table 4.7, had higher expression levels than TaNF-YC8.

To identify the potential roles of the transcripts represented by probe sets with

significantly correlated expression with TaNF-YC8 or TaNF-YC11, a functional

enrichment analysis tool for crop species was used to search for enriched Gene

Ontology (GO) terms (Zhou et al. 2007). As mentioned above, query lists contained

a subset of co-expressed probe sets to focus on positive regulatory relationships. To

identify enriched terms, a comparison was made for each list with all other

transcripts represented by probe sets in the Affymetrix wheat genome Array. Of the

206 probe sets in the query list for TaNF-YC11, 112 had GO annotations. Sixteen

GO terms were significantly enriched in the TaNF-YC11 list (Table 4.1). The most

enriched term identified was photosynthesis (44 probe sets, P-value = 5.4e-43).

Many other photosynthesis-related terms were also identified to be enriched within

the TaNF-YC11 query list (Table 4.1). A list of TaNF-YC11-correlated

photosynthetic genes is shown in Table 4.2. Of the 70 probe sets in the query list for

TaNF-YC8, 22 had GO annotations. No GO terms were identified to be enriched

within the TaNF-YC8 query list.

The combination of coexpression and GO enrichment analyses has identified

that photosynthesis-related genes are enriched within transcripts found to be

significantly correlated with TaNF-YC11. TaNF-YC8 correlated transcripts had no

enriched roles and for this reason no further investigation could be conducted for this

member. The most significantly enriched term identified was photosynthesis



providing the impetus for further investigation into the TaNF-YC11 co-expressed

transcripts.

4.5.3 TANF-YC11 CO-EXPRESSED GENES CONTAIN PUTATIVE CCAAT MOTIFS IN THE PROMOTERS REGIONS

To support the hypothesis that genes identified using coexpression and GO

enrichment analyses are potential targets regulated by NF-Y complexes containing

the light-upregulated TaNF-YC members, the presence of the CCAAT-box-binding

site in the promoters of TaNF-YC11-correlated genes is an essential requirement. The

light-responsive CCAAT-elements have been documented in at least nine light-

upregulated photosynthetic genes in plants (Kehoe et al., 1994; Kusnetsov et al.,

1999). Sequence alignment of these plant CCAAT-elements showed some degree of

similarity in those of the NF-Y consensus in higher eukaryotes (Figure 4.2A-C).

Table 4.1 Enriched GO terms within TaNF-YC11-correlated probe sets. GO term enrichment analysis

was performed using the EasyGO Gene Ontology enrichment analysis tool

(http://bioinformatics.cau.edu.cn/easygo/) (Zhou et al. 2007). GO ID indicates the Gene Ontology

Identifier. Term is the description associated with each GO ID. # genes indicates the number of genes

within each probe set list with the associated term. The aspect for analysis used was Biological

process. FDR P-values are the false discovery rate adjusted probability values

GO ID Term # genes FDR P-value GO:0015979 photosynthesis 44 5.4E-43 GO:0019684 photosynthesis, light reaction 28 8.5E-29 GO:0006091 generation of precursor metabolites and energy 36 5.3E-20 GO:0009767 photosynthetic electron transport chain 13 8.8E-15 GO:0019684 photosynthesis, light harvesting 14 6.8E-14 GO:0015977 carbon utilization by fixation of carbon dioxide 17 2.6E-13 GO:0015976 carbon utilization 17 1.1E-12GO:0022900 electron transport chain 14 6.4E-11 GO:0055114 oxidation reduction 14 6.4E-11GO:0009773 photosynthetic electron transport in photosystem I 7 8.4E-10 GO:0009768 photosynthesis, light harvesting in photosystem I 7 1.2E-07 GO:0009769 photosynthesis, light harvesting in photosystem II 7 1.6E-06 GO:0019253 reductive pentose-phosphate cycle 6 1.2E-05 GO:0019685 photosynthesis, dark reaction 6 1.2E-05 GO:0009409 response to cold 11 2.6E-03 GO:0008152 metabolic process 75 2.5E-02



Table 4.2 Photosynthesis-related transcripts correlated with the mRNA levels of TaNF-YC11 in

Affymetrix genome arrays. Pearson correlation coefficients (r) were calculated for the expression

profiles of all probe sets compared to Ta.22404.1.S1_at (TaNF-YC11) in four Affymetrix datasets:

developing grain (E-MEXP-1193), heat-stressed leaf (E-MEXP-1523), developing anthers (E-GEOD-

6027) and salt-stressed shoot (E-MEXP-971). Affymetrix IDs are the unique Affymetrix probe set

identifiers. TaGI IDs are the Triticum aestivum Gene Index identifiers for contigs most likely

represented by each probe set. Statistical significance of each r value was calculated using a t-

distribution. Statistical significance of correlations is indicated by triple asterisks (P 0.001), double

asterisks (P 0.01) and a single asterisk (P 0.05)

Affy ID TaGI ID Annotation Developing grain

Heat-stressed

leaf

Developing anthers

Salt-stress shoot

Ta.1130.3.S1_x_at TC321544 Chlorophyll a-b binding protein of LHCII type III, chloroplast precursor

0.62*** 0.83*** 0.76*** 0.27

Ta.1135.1.S1_at TC285503 Glyceraldehyde-3-phosphate dehydrogenase B, chloroplast precursor

0.55*** 0.07 0.77*** 0.92***

Ta.1167.1.S1_at TC309636 Ferredoxin-NADP reductase, leaf isozyme, chloroplast precursor

0.6*** 0.28 0.85*** 0.91***

Ta.1988.1.S1_x_at TC296071 Sedoheptulose-1,7-bisphosphatase, chloroplast precursor

0.54*** 0.43* 0.82*** 0.96***


0.52** 0.28 0.85*** 0.96***

Ta.1988.3.S1_at TC303696 Sedoheptulose-1,7-bisphosphatase, chloroplast precursor

0.56*** 0.16 0.83*** 0.91***


0.56*** 0.36 0.84*** 0.96***

Ta.20639.1.S1_x_at TC277936 Chlorophyll a/b-binding protein precursor

0.64*** 0.82*** 0.79*** 0.86***

Ta.20639.2.A1_at TC287435 Chlorophyll a/b-binding protein precursor

0.57*** 0.85*** 0.84*** 0.9***

Ta.20639.2.A1_x_at TC287435 Chlorophyll a/b-binding protein precursor

0.63*** 0.78*** 0.81*** 0.9***

Ta.20639.3.S1_a_at TC290903 Chlorophyll a/b-binding protein precursor

0.71*** 0.89*** 0.73*** 0.9***

Ta.20639.3.S1_x_at TC290903 Chlorophyll a/b-binding protein precursor

0.55*** 0.9*** 0.74*** 0.89***

Ta.22101.1.A1_at CA721955 Chlorophyll a-b binding protein 1, chloroplast precursor

0.64*** 0.79*** 0.88*** 0.6***

Ta.2383.1.S1_s_at TC291505 Proton gradient regulation 5 chloroplastic precursor

0.62*** -0.22 0.82*** 0.99***

Ta.2383.2.S1_a_at CA620041 Proton gradient regulation 5 chloroplastic precursor

0.66*** -0.32 0.83*** 0.98***

Ta.2402.3.S1_x_at TC354919 Chlorophyll a-b binding protein 6A, chloroplast precursor

0.64*** 0.8*** 0.68*** 0.93***

Ta.25600.1.S1_x_at TC294318 Chlorophyll a/b-binding apoprotein CP24 precursor

0.57*** 0.75*** 0.75*** 0.91***

Ta.2742.2.S1_a_at TC304703 Proton gradient regulation 5-like A

0.59*** 0.54** 0.79*** 0.95***

Ta.2742.3.S1_x_at TC288984 cyclic electron transport around photosystem I (PGR5A)

0.77*** 0.56** 0.67*** 0.93***

Ta.27646.1.S1_at TC339855 Chlorophyll a-b binding protein 8, chloroplast precursor

0.66*** 0.85*** 0.84*** 0.82***

Ta.27646.1.S1_x_at TC331302 Chlorophyll a-b binding protein 8, chloroplast precursor

0.67*** 0.85*** 0.83*** 0.64***

Ta.27751.6.S1_at TC306088 Chlorophyll a-b binding protein, chloroplast precursor

0.59*** 0.85*** 0.85*** 0.75***

Ta.28363.1.A1_at TC293434 Photosystem I reaction centre subunit N

0.59*** 0.73*** 0.75*** 0.96***



Table 4.2 (continued)

Affy ID TaGI ID Annotation Developing grain

Heat-stressed

leaf

Developing anthers

Salt-stress shoot

Ta.28363.1.A1_x_at TC293434 Photosystem I reaction centre subunit N, chloroplast precursor (PSI-N)

0.62*** 0.71*** 0.74*** 0.95***

Ta.28363.2.S1_a_at TC302457 Photosystem I reaction centre subunit N chloroplast precursor (PSI- N)

0.66*** 0.67*** 0.84*** 0.93***


0.59*** 0.68*** 0.85*** 0.91***

Ta.30727.1.S1_at TC289661 Light-harvesting complex IIa protein

0.64*** 0.83*** 0.59** 0.63***

Ta.3249.1.S1_at TC277865 Chlorophyll a/b-binding protein WCAB precursor

0.54*** 0.69*** 0.78*** 0.89***

Ta.3249.2.S1_x_at TC282377 Chlorophyll a/b-binding protein WCAB precursor

0.64*** 0.7*** 0.81*** 0.6***

Ta.3249.3.A1_at TC297579 Chlorophyll a/b-binding protein WCAB precursor

0.62*** 0.67*** 0.73*** 0.87***

Ta.347.3.S1_x_at TC280225 Ribulose-5-phosphate-3-epimerase

0.54*** 0.2 0.75*** 0.93***

Ta.3581.1.S1_x_at TC277864 Photosystem I reaction centre subunit III, chloroplast precursor (Light-harvesting complex I 17 kDa protein) (PSI-F)

0.63*** 0.83*** 0.83*** 0.91***


0.52** 0.83*** 0.8*** 0.9***

Ta.4346.1.A1_x_at TC279724 Chlorophyll a-b binding protein, chloroplast precursor (LHCII type I CAB) (LHCP)

0.6*** 0.56** 0.87*** 0.84***

Ta.8061.1.S1_at TC317800 Photosystem II reaction centre W protein

0.52** -0.23 0.76*** 0.97***

Ta.841.1.S1_a_at NP234466 Oxygen-evolving enhancer protein 1, chloroplast precursor

0.72*** 0.8*** 0.73*** 0.65***

Ta.85.1.S1_at TC277987 Oxygen-evolving enhancer protein 2, chloroplast precursor

0.65*** 0.71*** 0.77*** 0.8***

Ta.861.1.S1_at TC336547 Cytochrome b6-f complex iron-sulfur subunit, chloroplast precursor

0.57*** -0.47* 0.72*** 0.95***

Ta.881.1.S1_a_at TC283142 Light-harvesting complex protein

0.58*** 0.25 0.78*** 0.95***

Ta.881.2.S1_a_at TC278413 Light-harvesting complex protein

0.73*** 0.15 0.82*** 0.91***

Ta.881.2.S1_x_at TC278413 Light-harvesting complex protein

0.67*** 0.13 0.87*** 0.93***

TaAffx.80290.1.S1_at TC363309 Ferredoxin, chloroplast precursor

0.52** 0.41* 0.79*** 0.95***

TaAffx.80290.1.S1_x_at TC363309 Ferredoxin, chloroplast precursor

0.56*** 0.37* 0.76*** 0.97***

TaAffx.80290.2.S1_at TC305823 Ferredoxin, chloroplast precursor

0.53*** 0.18 0.81*** 0.9***



Figure 4.2. Plant light-responsive CCAAT-box in the promoters of photosynthetic genes and CCAAT-box in the promoters of TaNF-YC11-correlated genes. Plant light-responsive CCAAT-box was reported by Kehoe et al. (1994) and Kusnetsov et al. (1999) and NF-Y consensus sequences in higher eukaryotes were reported by Mantovani (1998). Sequence log was created in the Weblogo website (http://weblogo.berkeley.edu/logo.cgi). LgCabAB19, Lemna gibba chlorophyll a/b-binding protein (M12152); TaCab1 or Cab1, Triticum aestivum cab1 (X05823, Affymetrix probe set = Ta.4346.1.A1_x_at); AtCab140, Arabidopsis thaliana cab140 (X03909); AtCab165, A. thaliana cab165 (X03907); AtCab180, A. thaliana cab180 (X03908); PscabAB215, Pisum sativum Cab II (X57082); PsCab8, P. sativum Cab-8 (X56538); ZmCab1, Zea mays cab-1 (X14794); SoAtpC, Spinacia oleracea AtpC gene for chloroplast ATP synthase (X17257); tAPX, T. aestivum thylakoid ascorbate peroxidase (AY513261, Ta.11386.2.S1_a_at); petF, T. aestivum chloroplast ferredoxin (X75089, TaAffx.80290.1.S1_x_at); cFBPase, T. aestivum chloroplast fructose-1,6-bisphosphatase (X53957, Ta.439.1.S1_at); cSBPase, T. aestivum sedoheptulose-1,7-bisphosphatase (S63737, Ta.1988.2.S1_x_at)

Sequence search for the promoters of TaNF-YC11-correlated genes in the National

Centre for Biotechnology Information (NCBI) sequence databases identified 5

promoters: chlorophyll a/b-binding protein (cab1) (X05823), thylakoid ascorbate

peroxidase (AY513261), chloroplast ferredoxin (X75089), chloroplast fructose-1,6-

bisphosphatase (X53957 and A20727) and sedoheptulose-1,7-bisphosphatase

(S63737). As preferred sequences flanking the CCAAT-box in plants are currently

unknown, the core CCAAT motif was used as the potential binding sites of plant NF-

Y complex. To reduce the rate of false positives, the presence of the CCAAT was

searched only within 500 bp upstream of translation start codon (transcription start

A. Light-responsive plant CCAAT box

LgCabAB19 TCAACCAATCCCA TaCab1 TGCACCAATGGCAAtCab140 CTAGCCAATAGCAAtCab165 AAATCCAATGAAT AtCab180 AAATCCAATGAGT PsCabAB215 ACAACCAATAAGAPsCab8 ACTCCCAATGAAA ZmCab1 CGAGCCAATGGCASoAtpC AAATTCAATGGCC

B. Plant light-responsive CCAAT-box logo

RRCCAATSRC. NF-Y consensus in higher eukaryotes R = A or G

S = G or C

D. CCAAT-box in the promoters (between -500bp and -80bp relative to translation start codon) of TaNF-YC11-correlated wheat genes

Cab1 TGCACCAATGGCACCAACCAATTAAT

tAPX TGGTCCAATTTTGGTCGCCAATCGACATGACCAATATATTGGACCAATTGAGCAGCCCAATAATA

petF GAAACCAATAGGGCCAACCAATTAAACCCTCCAATCCCT

cFBPase GCCCCCAATCCACGGAACCAATGGAA

cSBPase GCAACCAATCTGA



sites of most of these promoters are not known), as the CCAAT motifs are typically

located within 300 bp upstream of the transcription start site in yeast and mammalian

genes (Mantovani, 1998). This analysis revealed that all five promoters contained at

least one CCAAT-box within the region (Figure 4.2D). In particular, one of the

CCAAT motif regions in the TaCab promoter is known to be light-responsive (Nagy

et al. 1987).

4.5.4 TANF-YC11 CO-EXPRESSED GENES ARE UPREGULATED BY LIGHT IN THE LEAF AND SEEDLING SHOOT

To investigate whether the TaNF-YC11-correlated photosynthesis-related

transcripts identified from the Affymetrix datasets are light-regulated and co-

regulated with TaNF-YC11 in response to light and dark-treatments, quantitative RT-

PCR analysis of their transcript levels was performed. Gene-specific primers were

designed for thirteen of TaNF-YC11 co-expressed transcripts identified to have the

significantly enriched GO term of photosynthesis. The transcript levels of the

selected genes (TaATPa9, TaATPaG, TaCAB, TaFBPa5, TaFNR, TaGluTR,

TaLHCII, TaLHCI, TaOEE, TaPC, TaPSIK, TaPSIN & TaTRXM) were all were

significantly upregulated by light in the leaves of 23-day-old plants (Figure 4.3A).

All but three (TaGluTR, TaPC & TaTRXM) of these genes were also upregulated by

light in the seedling shoots (Figure 4.3B). The expression levels of 10 potential target

genes were significantly correlated with that of TaNF-YC11 among the leaf or

seedling samples of plants with light or dark-treatment (Table 4.3). These results

support those from the Affymetrix datasets.



Figure 4.3. Changes in the mRNA levels of TaNF-YC11 co-expressed genes in wheat leaves (A) and seedling shoots (B) in response to light. Transcript level is expressed relative to the dark conditions. Values are means +SD of three biological samples. Each sample was analysed with triplicate PCR assays. Statistical significance of differences was analysed using the Students t-test and is indicated by triple asterisks (P ≤ 0.001) and double asterisks (P ≤ 0.01). TaATPa9 is ATP synthase B chain, TaATPaG is ATP synthase gamma chain, TaCAB is Chlorophyll a/b-binding protein 4, TaFBPa5 is Fructose-1,6-bisphosphatase, TaFNR is Ferredoxin-NADP(H) oxidoreductase, TaGluTR is Glutamyl-tRNA reductase, TaLHCII Light-harvesting complex IIa protein, TaLHCI is chlorophyll a/b-binding protein 7, TaOEE is Oxygen-evolving enhancer protein 1, TaPC is Plastocyanin, TaPSIK is Photosystem I reaction centre subunit K, TaPSIN is Photosystem I reaction centre subunit N and TaTRXM is Thioredoxin M-type. The TC #s or GenBank accession # for these genes are listed in Table 4.3

Potential target genes up-regulated in the leaf by light

0

5

10

15

20

25

30

35

40

45

50T

aAT

Pa9

TaA

TP

aG

TaC

AB

TaF

BP

a5

TaF

NR

TaG

luT

R

TaL

HC

II

TaL

HC

I

TaO

EE

TaP

C

TaP

SIK

TaP

SIN

TaT

RX

M

Potential target genes

Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

P < 0.001 ***

Potential target genes up-regulated in the seedling by light

0

5

10

15

20

25

30

35

TaA

TP

a9

TaA

TP

aG

TaC

AB

TaF

BP

a5

TaF

NR

TaL

HC

II

TaL

HC

I

TaO

EE

TaP

SIK

TaP

SIN


Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

P < 0.001 ***P < 0.01 **

A

B

Potential target genes up-regulated in the leaf by light

0

5

10

15

20

25

30

35

40

45

50T

aAT

Pa9

TaA

TP

aG

TaC

AB

TaF

BP

a5

TaF

NR

TaG

luT

R

TaL

HC

II

TaL

HC

I

TaO

EE

TaP

C

TaP

SIK

TaP

SIN

TaT

RX

M


Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

P < 0.001 ***

Potential target genes up-regulated in the seedling by light

0

5

10

15

20

25

30

35

TaA

TP

a9

TaA

TP

aG

TaC

AB

TaF

BP

a5

TaF

NR

TaL

HC

II

TaL

HC

I

TaO

EE

TaP

SIK

TaP

SIN


Rel

ativ

e ex

pre

ssio

n l

evel

s

Dark

Light

P < 0.001 ***P < 0.01 **

A

B



Table 4.3 Expression correlations of potential TaNF-YC11 target genes with TaNF-YC11 in wheat

leaves and seedling shoots with dark or light-treatment. Gene ID represents identifiers based on

annotation of similar sequences from model organism and full names are listed above. TaGI

represents the Triticum aestivum Gene Index identifiers. r values represent Pearson correlation

coefficients calculated for the expression profiles of the potential target genes and TaNF-YC11.

Statistical significance of each r value was calculated using a t-distribution. Statistical significance of

correlations is indicated by triple asterisks (P ≤ 0.001), double asterisks (P ≤ 0.01) and a single

asterisk (P ≤ 0.05)

Gene ID TaGI Correlation coefficient (r)

Leaf Seedling TaATPa9 TC324139 0.96** 0.93** TaATPaG TC280940 0.95** 0.93** TaCab1 TC287435 0.96** 0.98*** TaFBPa5 TC277182 0.93** 0.95** TaFNR TC309636 0.93** 0.99*** TaGluTR TC293908 0.94** 0.32 TaLHCII TC289661 0.96** 0.95** TaLHCI TC279817 0.94** 0.96** TaOEE TC288877 0.89** 0.94** TaPC CA598047 0.94** 0.76* TaPSIK TC296414 0.97*** 0.96** TaPSIN TC293434 0.96** 0.97***

TaTRXM TC354027 0.97*** 0.33



4.6 DISCUSSION

Light-mediated gene regulation is necessary for many important physiological

processes in plants, including photosynthesis. In this study we investigated members

of the TaNF-YC subunit family that are involved in light-mediated regulation of

gene expression. Five TaNF-YC members were found to be upregulated by light in

both the leaf of 23-day-old plants and the shoot of 5-day-old seedlings. Four of these

light-upregulated TaNF-YC members (TaNF-YC5, 8, 11 & 12) have been shown to

be expressed highest in the leaf, while the other one (TaNF-YC9) is expressed

highest in the pre-anthesis spike (Stephenson et al. 2007). Both leaf and pre-anthesis

spike possess strong photosynthetic activity. TaNF-YC5, TaNF-YC11 and TaNF-

YC12 cluster with the rice NF-YC member OsHAP5C (Supplementary Figure 4.4).

Like TaNF-YC5, 11 & 12, OsHAP5C is expressed highest in the leaf. However, it is

unknown whether OsHAP5C is light-responsive in rice. TaNF-YC5, 11 & 12 also

cluster with two Arabidopsis NF-YC members (AtNF-YC1 & AtNF-YC4)

(Supplementary Figure 4.4). T-DNA insertional mutants of AtNF-YC1 and AtNF-

YC4 did not prevent the expression of light harvesting chlorophyll a/b-binding

proteins in response to blue-light (Warpeha et al. 2007). The promoter activity

analysis of AtNF-YC1 and AtNF-YC4 using promoter:GUS fusion transgenic

Arabidopsis showed a similar GUS staining intensity between dark and light grown

seedlings (Siefers et al. 2009). This expression pattern of AtNF-YC1 and AtNF-YC4

differs from that of TaNF-YC11, which was essentially not expressed in the dark-

grown wheat seedling. TaNF-YC9 cluster with the rice NF-YC member OsHAP5D

(Supplementary Figure 4.4). OsHAP5D is known to interact with OsHAP3A and has

a potential role in plastid development (Thirumurugan et al. 2008). TaNF-YC8

clusters with three Arabidopsis NF-YC members (AtNF-YC10, 11, & 13). Two of

these Arabidopsis NF-YC members (AtNF-YC10 & 11) are expressed strongly in the

dark while the third (AtNF-YC13) is not (Siefers et al. 2009).

Transcription factors (TFs) play a pivotal role in regulation of gene expression.

The abundance of a TF directly impacts on the expression of its target genes (Kagaya

et al. 2005; Miyoshi et al. 2003; Mendoza et al. 2005; Zuo et al. 2007). Therefore,

identification of TF target genes can be partially predicted by identifying transcripts

with correlated expression, particularly if identified in response to multiple

conditions. Significantly correlated expression between a TF and another transcript



alone does not indicate a regulatory relationship, when combined with additional

data, such as a known TF binding site and enriched Gene Ontology (GO) terms,

target gene predictions can be made with relatively high accuracy (Cai et al. 2007;

Haverty et al. 2004; Zheng et al. 2003).

To identify the potential target genes for light-regulated TaNF-YC members,

genome-wide expression correlation analysis was performed using multiple

Affymetrix wheat genome array datasets. The wheat genome array represents over

55,000 transcripts covering all 42 chromosomes. However, only two (TaNF-YC8 &

11) of the five light-regulated TaNF-YC members have representative probe sets.

The expression of all transcripts in the wheat genome array was compared with

TaNF-YC8 or TaNF-YC11 in 3-4 separate datasets. Transcripts with significantly

correlated expression in at least three datasets were analysed for common roles based

on GO terms using a functional enrichment analysis tool (Ashburner et al. 2000;

Zhou et al. 2007). This genome-wide expression analysis identified over 200 genes

that have significantly correlated expression with TaNF-YC11. Moreover, the GO

term, photosynthesis, is significantly enriched in the list of transcripts with correlated

expression with TaNF-YC11. Expression analysis of a subset of TaNF-YC11-

correlated photosynthetic genes in wheat leaves and seedling shoots in response to

light showed that these genes were also upregulated by light and were highly

correlated in expression with TaNF-YC11 in these datasets.

In silico prediction of TF target genes often includes the identification of over-

represented TF binding sites in co-regulated genes (Aerts et al. 2003; Brazma et al.

1998; Cora et al. 2004; Elkon et al. 2003; Liu et al. 2003; Sharan et al. 2003). The

NF-Y binding site (CCAAT-box) is well characterised in mammals and yeast

(Mantovani 1998) and light-responsive CCAAT elements have been reported in the

promoters of photosynthetic genes in plants (Nagy et al., 1987; Kehoe et al. 1994;

Kusnetsov et al., 1999). Wheat does not have a fully sequenced genome making in

silico prediction of cis-regulatory elements tedious or in some cases, impossible. An

extensive search for the promoter sequences of TaNF-YC11-correlated genes

identified five sequences in the NCBI databases and all these genes contained at least

one CCAAT-box within 500 bp upstream of translation start codon. The occurrence

of the core CCAAT motif in Arabidopsis promoters in the region between -1000 and

+200 from the transcription start site is about 12 sites per 100 promoters (Siefers et



al., 2009). In comparison with the Arabidopsis data, the promoters of these TaNF-

YC11-correlated genes are clearly enriched with CCAAT motifs. Furthermore, a

promoter deletion study has shown that one of the CCAAT motif regions in the

promoter of wheat Cab1 is responsible for the light upregulation (Nagy et al. 1987).

The identification of potential NF-Y binding sites indicates that it can not be ruled

out that these TaNF-YC-correlated genes are potential targets.

The energy requirements of plants are fulfilled through photosynthesis.

However, light quality and intensity as well as daily dark-light cycles necessitate

constant regulation of genes encoding key enzymes and proteins within the

photosynthetic pathways. The principal converters of sunlight into chemical energy

are the four thylakoid membrane bound complexes, photosystem I (PSI),

photosystem II (PSII), cytochrome b6f, and ATP synthase (Baniulis et al. 2008;

Barber 2002; McCarty et al. 2000; Scheller et al. 2001). PSII is a multimeric

complex comprised of ~30 subunits driving the oxidation of water during

photosynthesis (Barber 2002). Cytochrome b6f mediates electron transfer from PSII

to PSI coupled with proton translocations across the membrane (proton motive force)

(Baniulis et al. 2008; Cramer et al. 2004). PSI is a highly efficient photochemical

system catalysing the light-driven electron transfer from plastocyanin to ferredoxin

(Fdn) (Amunts et al. 2008). Our data showed that TaNF-YC11 was one of the

potential regulators of genes encoding ATP synthase, ferredoxin and subunits of PSI,

PSII and cytochrome b6f.

The carbon reduction cycle is the primary pathway for carbon fixation in C3

plants such as wheat. Chemical energy generated in the light reactions of

photosynthesis is used to power the Calvin cycles for the fixation of CO2. Ribulose

1,5-bisphosphate carboxylase/oxygenase (RuBisCO) catalyses the first step in the net

photosynthetic CO2 assimilation and photorespiratory carbon oxidation (Zelitch

1975). RuBisCO is a highly inefficient enzyme and is considered a rate-limiting

factor for carbon assimilation (Hudson et al. 1992; Makino et al. 1985). The

dephosphorylation of sedoheptulose-1,7-bisphosphate by Sedoheptulose-1,7-

bisphosphatase (SBPase) during the regenerative stage of the Calvin cycle is another

rate-limiting step (Raines et al. 2000). Decreases in both photosynthetic capacity and

carbon assimilation result from the reduced levels of SBPase (Harrison et al. 1997).

Another rate-limiting step in the Calvin cycle is the conversion of fructose-1,6-



bisphosphate to fructose-6-phosphate by fructose-1,6-bisphosphatase (FBPase)

(Bassham et al. 1969). Overexpression of SBPase and FBPase leads to the increased

rates of photosynthesis and plant growth (Tamoi et al. 2006). Data from this study

indicate that genes encoding RuBisCO, SBPase and chloroplast FBPase are also

potential target genes of TaNF-YC11.

Light is available at intensities in excess of the current capabilities of C3

photosynthesis in crops such as rice and wheat (Sharkey 1985). All stages of

photosynthesis occur simultaneously at the rate of the slowest step. Increasing the

expression of genes encoding rate-limiting enzymes in the Calvin cycle could

potentially improve overall photosynthesis rates and consequently growth rates

(Lefebvre et al. 2005). If TaNF-YC11 regulates subunit members and rate-limiting

enzymes in photosynthesis, there is potential to increase the light saturation point and

carbon assimilation of C3 crops by over-expression of TaNF-YC11 and its interacting

partners, which awaits further investigation.



4.7 REFERENCES

Aerts S, Thijs G, Coessens B, Staes M, Moreau Y, De Moor B (2003) Toucan: deciphering the cis-regulatory logic of co-regulated genes. Nucl Acids Res 31:1753-1764.

Amunts A, Nelson N (2008) Functional organization of a plant Photosystem I: evolution of a highly efficient photochemical machine. Plant Physiol Biochem 46:228-237.

Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G (2000) Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25:25-29.

Bae G, Choi G (2008) Decoding of light-signals by plant phytochromes and their interacting proteins. Annu Rev Plant Biol 59:281-311.

Baniulis D, Yamashita E, Zhang H, Hasan SS, Cramer WA (2008) Structure-function of the cytochrome b6f complex. Photochem Photobiol 84:1349-1358.

Barber J (2002) Photosystem II: a multisubunit membrane protein that oxidises water. Curr Opin Struct Biol 12:523-530.

Bassham JA, Krause GH (1969) Free energy changes and metabolic regulation in steady-state photosynthetic carbon reduction. Biochim Biophys Acta 189:207-221.

Ben-Naim O, Eshed R, Parnis A, Teper-Bamnolker P, Shalit A, Coupland G, Samach A, Lifschitz E (2006) The CCAAT binding factor can mediate interactions between CONSTANS-like proteins and DNA. Plant J 46:462-476.

Brazma A, Jonassen I, Vilo J, Ukkonen E (1998) Predicting gene regulatory elements in silico on a genomic scale. Genome Res 8:1202-1215.

Bucher P (1990) Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J Mol Biol 212:563-578.

Cai X, Ballif J, Endo S, Davis E, Liang M, Chen D, DeWald D, Kreps J, Zhu T, Wu Y (2007) A putative CCAAT-binding transcription factor is a regulator of flowering timing in Arabidopsis. Plant Physiol 145:98-105.

Cai Y-D, Jen C-H, Qian J, Qian Z, Muldoon M (2007) Prediction of regulatory networks: identification of transcription factor-target relationship from gene ontology information and gene expression data. School of Mathematics. Manchester Institute for Mathematical Sciences, University of Manchester Manchester, UK.

Chen M, Chory J, Fankhauser C (2004) Light-signal transduction in higher plants. Annu Rev Genet 38:87-117.



Chen NZ, Zhang XQ, Wei PC, Chen QJ, Ren F, Chen J, Wang XC (2007) AtHAP3b plays a crucial role in the regulation of flowering time in Arabidopsis during osmotic stress. J Biochem Mol Biol 40:1083-1089.

Christie JM (2007) Phototropin blue-light receptors. Annu Rev Plant Biol 58:21-45.

Cora D, Di Cunto F, Provero P, Silengo L, Caselle M (2004) Computational identification of transcription factor binding sites by functional analysis of sets of genes sharing overrepresented upstream motifs. BMC Bioinformatics 5:57.

Cramer WA, Zhang H, Yan J, Kurisu G, Smith JL (2004) Evolution of photosynthesis: time-independent structure of the cytochrome b6f complex. Biochem 43:5921-5929.

Crismani W, Baumann U, Sutton T, Shirley N, Webster T, Spangenberg G, Langridge P, Able JA (2006) Microarray expression analysis of meiosis and microsporogenesis in hexaploid bread wheat. BMC Genomics 7:267.

Edwards D, Murray JA, Smith AG (1998) Multiple genes encoding the conserved CCAAT-box transcription factor complex are expressed in Arabidopsis. Plant Physiol 117:1015-1022.

Elkon R, Linhart C, Sharan R, Shamir R, Shiloh Y (2003) Genome-wide in silico identification of transcriptional regulators controlling the cell cycle in human cells. Genome Res 13:773-780.

Gautier L, Cope L, Bolstad BM, Irizarry RA (2004) affy-analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 20:307-315.

Harrison EP, Willingham NM, Lloyd JC, Raines CA (1997) Reduced sedoheptulose-1,7-bisphosphatase levels in transgenic tobacco lead to decreased photosynthetic capacity and altered carbohydrate accumulation. Planta 204:27-36.

Haverty PM, Hansen U, Weng Z (2004) Computational inference of transcriptional regulatory networks from expression profiling and transcription factor binding site identification. Nucl Acids Res 32:179-188.

Hudson GS, Evans JR, von Caemmerer S, Arvidsson YB, Andrews TJ (1992) Reduction of ribulose-1,5-bisphosphate carboxylase/oxygenase content by antisense RNA reduces photosynthesis in transgenic tobacco plants. Plant Physiol 98:294-302.

Irizarry RA, Bolstad BM, Collin F, Cope LM, Hobbs B, Speed TP (2003) Summaries of Affymetrix GeneChip probe level data. Nucl Acids Res 31:e15.

Jiao Y, Ma L, Strickland E, Deng XW (2005) Conservation and divergence of light-regulated genome expression patterns during seedling development in rice and Arabidopsis. Plant Cell 17:3239-3256.

Jiao Y, Yang H, Ma L, Sun N, Yu H, Liu T, Gao Y, Gu H, Chen Z, Wada M, Gerstein M, Zhao H, Qu L-J, Deng XW (2003) A genome-wide analysis of blue-light regulation of Arabidopsis transcription factor gene expression during seedling development. Plant Physiol 133:1480-1493.



Jordan MC, Somers DJ, Banks TW (2007) Identifying regions of the wheat genome controlling seed development by mapping expression quantitative trait loci. Plant Biotechnol J 5:442-453.

Kagaya Y, Toyoshima R, Okuda R, Usui H, Yamamoto A, Hattori T (2005) LEAFY COTYLEDON1 controls seed storage protein genes through its regulation of FUSCA3 and ABSCISIC ACID INSENSITIVE3. Plant Cell Physiol 46:399-406.

Kehoe DM, Degenhardt J, Winicov I, Tobin EM (1994) Two 10-bp regions are critical for phytochrome regulation of a Lemna gibba Lhcb gene promoter. Plant Cell 6:1123-1134.

Koch, KE (1996) Carbohydrate-modulated gene expression in plants. Annual Review of Plant Physiology and Plant Molecular Biology 47: 509-540.

Kumimoto RW, Adam L, Hymus GJ, Repetti PP, Reuber TL, Marion CM, Hempel FD, Ratcliffe OJ (2008) The Nuclear factor Y subunits NF-YB2 and NF-YB3 play additive roles in the promotion of flowering by inductive long-day photoperiods in Arabidopsis. Planta 228:709-723.

Kusnetsov V, Landsberger M, Meurer J, Oelmuller R (1999) The assembly of the CAAT-box-binding complex at a photosynthesis gene promoter is regulated by light, cytokinin, and the stage of the plastids. J Biol Chem 274:36009-36014.

Lefebvre S, Lawson T, Zakhleniuk OV, Lloyd JC, Raines CA, Fryer M (2005) Increased sedoheptulose-1,7-bisphosphatase activity in transgenic tobacco plants stimulates photosynthesis and growth from an early stage in development. Plant Physiol 138:451-460.

Li QH, Yang HQ (2007) Cryptochrome signaling in plants. Photochem Photobiol 83:94-101.

Liu G, Loraine AE, Shigeta R, Cline M, Cheng J, Valmeekam V, Sun S, Kulp D, Siani-Rose MA (2003) NetAffx: Affymetrix probesets and annotations. Nucl Acids Res 31:82-86.

Liu R, McEachin RC, States DJ (2003) Computationally identifying novel NF-kappa B-regulated immune genes in the human genome. Genome Res 13:654-661.

Makino A, Mae T, Ohira K (1985) Photosynthesis and ribulose-1,5-bisphosphate carboxylase/oxygenase in rice leaves from emergence through senescence. Quantitative analysis by carboxylation/oxygenation and regeneration of ribulose 1,5-bisphosphate. Planta 166:414-420.

Mantovani R (1998) A survey of 178 NF-Y binding CCAAT-boxes. Nucleic Acids Res 26:1135-1143.

McCarty RE, Evron Y, Johnson EA (2000) The chloroplast ATP synthase: A rotary enzyme? Annu Rev Plant Physiol Plant Mol Biol 51:83-109.

Mendoza M, Dubreucq B, Miquel M, Caboche M, Lepiniec L (2005) LEAFY COTYLEDON 2 activation is sufficient to trigger the accumulation of oil and seed specific mRNAs in Arabidopsis leaves. FEBS Lett 579:4666-4670.



Miyoshi K, Ito Y, Serizawa A, Kurata N (2003) OsHAP3 genes regulate chloroplast biogenesis in rice. Plant J 36:532-540.

Mott IW, Wang RRC (2007) Comparative transcriptome analysis of salt-tolerant wheat germplasm lines using wheat genome arrays. Plant Science 173:327-339.

Nagy F, Boutry M, Hsu MY, Wong M, Chua NH (1987) The 5'-proximal region of the wheat Cab-1 gene contains a 268-bp enhancer-like sequence for phytochrome response. EMBO J 6:2537-2542.

Park S (2006) Recombinant AtNF-YA, a subunit of the Arabidopsis CCAAT-binding transcription factor, forms a protein-DNA complex with mammalian NF-YB and NF-YC. J Plant Biol 49:281-285.

Parkinson H, Kapushesky M, Kolesnikov N, Rustici G, Shojatalab M, Abeygunawardena N, Berube H, Dylag M, Emam I, Farne A, Holloway E, Lukk M, Malone J, Mani R, Pilicheva E, Rayner TF, Rezwan F, Sharma A, Williams E, Bradley XZ, Adamusiak T, Brandizi M, Burdett T, Coulson R, Krestyaninova M, Kurnosov P, Maguire E, Neogi SG, Rocca-Serra P, Sansone SA, Sklyar N, Zhao M, Sarkans U, Brazma A (2009) ArrayExpress update--from an archive of functional genomics experiments to the atlas of gene expression. Nucl Acids Res 37:D868-872.

Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucl Acids Res 29:e45.

Qin D, Wu H, Peng H, Yao Y, Ni Z, Li Z, Zhou C, Sun Q (2008) Heat stress-responsive transcriptome analysis in heat susceptible and tolerant wheat (Triticum aestivum L.) by using Wheat Genome Array. BMC Genomics 9:432.

Raines CA, Harrison EP, Ölçer H, Lloyd JC (2000) Investigating the role of the thiol-regulated enzyme sedoheptulose-1,7-bisphosphatase in the control of photosynthesis. Physiol Plant 110:303-308.

Scheller HV, Jensen PE, Haldrup A, Lunde C, Knoetzel J (2001) Role of subunits in eukaryotic Photosystem I. Biochim Biophys Acta 1507:41-60.

Sharan R, Ovcharenko I, Ben-Hur A, Karp RM (2003) CREME: a framework for identifying cis-regulatory modules in human-mouse conserved segments. Bioinformatics 19 Suppl 1:i283-291.

Sharkey T (1985) Photosynthesis in intact leaves of C3 plants: Physics, physiology and rate limitations. Bot Rev 51:53-105.

Siefers N, Dang KK, Kumimoto RW, Bynum WEt, Tayrose G, Holt BF, 3rd (2009) Tissue-specific expression patterns of Arabidopsis NF-Y transcription factors suggest potential for extensive combinatorial complexity. Plant Physiol 149:625-641.

Stephenson TJ, McIntyre CL, Collet C, Xue GP (2007) Genome-wide identification and expression analysis of the NF-Y family of transcription factors in Triticum aestivum. Plant Mol Biol 65:77-92.

Tamoi M, Nagaoka M, Miyagawa Y, Shigeoka S (2006) Contribution of fructose-1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase to the photosynthetic



rate and carbon flow in the Calvin cycle in transgenic plants. Plant Cell Physiol 47:380-390.

Thirumurugan T, Ito Y, Kubo T, Serizawa A, Kurata N (2008) Identification, characterization and interaction of HAP family genes in rice. Mol Genet Genomics 279:279-289.

Wan Y, Poole RL, Huttly AK, Toscano-Underwood C, Feeney K, Welham S, Gooding MJ, Mills C, Edwards KJ, Shewry PR, Mitchell RA (2008) Transcriptome analysis of grain development in hexaploid wheat. BMC Genomics 9:121.

Warpeha KM, Upadhyay S, Yeh J, Adamiak J, Hawkins SI, Lapik YR, Anderson MB, Kaufman LS (2007) The GCR1, GPA1, PRN1, NF-Y signal chain mediates both blue-light and abscisic acid responses in Arabidopsis. Plant Physiol 143:1590-1600.

Wenkel S, Turck F, Singer K, Gissot L, Le Gourrierec J, Samach A, Coupland G (2006) CONSTANS and the CCAAT-box-binding complex share a functionally important domain and interact to regulate flowering of Arabidopsis. Plant Cell 18:2971-2984.

Xue GP, Loveridge CW (2004) HvDRF1 is involved in abscisic acid-mediated gene regulation in barley and produces two forms of AP2 transcriptional activators, interacting preferably with a CT-rich element. Plant J 37:326-339.

Xue GP, McIntyre CL, Glassop D, Shorter R (2008) Use of expression analysis to dissect alterations in carbohydrate metabolism in wheat leaves during drought-stress. Plant Mol Biol 67:197-214.

Xue GP, McIntyre CL, Jenkins CL, Glassop D, van Herwaarden AF, Shorter R (2008) Molecular dissection of variation in carbohydrate metabolism related to water-soluble carbohydrate accumulation in stems of wheat. Plant Physiol 146:441-454.

Zelitch I (1975) Pathways of carbon fixation in green plants. Annu Rev Biochem 44:123.

Zheng J, Wu J, Sun Z (2003) An approach to identify over-represented cis-elements in related sequences. Nucl Acids Res 31:1995-2005.

Zhou X, Su Z (2007) EasyGO: Gene Ontology-based annotation and functional enrichment analysis tool for agronomical species. BMC Genomics 8:246.

Zuo KJ, Qin J, Zhao JY, Ling H, Zhang LD, Cao YF, Tang KX (2007) Overexpression GbERF2 transcription factor in tobacco enhances brown spots disease resistance by activating expression of downstream genes. Gene 391:80-90.



4.8 SUPPLEMENTARY MATERIALS

138 Chapter 4: TaNF-YC11, one of the light-upregulated NF-YC members in Triticum aestivum, is co-regulated with photosynthesis-related genes

Supplementary Table 4.4 Real-Time PCR primers of Triticum aestivum NF-YC11 potential target genes and reference gene. All gene-specific primers used for qRT-PCR

analysis are listed with assigned identifiers as well as reference gene primers

Gene Forward Primer Sequence (5'-3') Reverse Primer Sequence (5'-3') TaLhca44 TaLhca4Fb TGGCCGACCCATGGCACAACA TaLhca4Rb CCCGGTCGGTGAAATCGACGGATTTAT

TaFNR TaFNRFa GGGAGGTCGTCAAGGGCGTCTGCTCA TaFNRRa TCCAGAGGAAGGAGCGGAACGGCG

TaPSIN TaPSINFa CGTCTTCTGGAAATGGTGAAGCTGGT TaPSINFa GTACACGCGGTGCGCTGACA

TaPSIK TaPSIKFb GGCTCCTTCGGCCACATCTTG TaPSIKRb ATGCGAATGCAGAACAGCTATGGA

TaATPa9 TaATPa9Fa CACGGAGCTGGAGGCGAAGCTC TaATPa9Ra TCACGCGGATGGGAGCACCT

TaFBPa TaFBPa5cF ATGCTCTACGGCGGCATCT TaFBPa5cR TTGCCGTTCTTGCTCTTCTG

TaLHCI TaLHCIFb TCCTCAACACACCGTCGTGG TaLHCIRb GGTCGGTGTTGACGCAGCC

TaATPaG TaATPaGFa TCAACAGCCAGATCCTGCGTGC TaATPaGRa GCATTGTCTGTGGCGCTGCTC

TaTRXM TaTRXMFa TTAATCGAGGACGCACACACCT TaTRXMRa CAAGTCACAACTGGTCGGTGGAT

TaPC TaPCFa CGACTTCAACGTCAAGGGCCG TaPCRa CCAACGTTTGTTGCGGAAACCCG

TaOEE TaOEEFc AGTTCTGCCTGGAGCCCACCTC TaOEERc AAGGCCGGCGGCTCGTTCTTCT

TaGluTR TaGluTRFa CTGAGGTCGTACGCCGACAGGA TaGluTRRa CAGTGGGCCGTGAAGGAGCTTG

TaLhcb4 TaLhcb4Fa CGTTCACGCTCACCACGCTGAT TaLhcb4Ra CGAGTCCCAGCGGGTCGAAGTA

TaRPII36f TaRPII36fF3 ACGTATTAACCAAGAACTCATGGAGAC TaRPII36fR4 TCAAATACTTTTGTAGGGCTGCTCTC

TaRP15 TaRP15F5 GCACACGTGCTTTGCAGATAAG TaRP15R6 GCCCTCAAGCTCAACCATAACT



Supplementary Table 4.5 TaNF-YC members in Affymetrix GeneChip® Wheat Genome Array.

TaNF-YC member nucleotide sequences (Stephenson et al., 2007) were queried against the

Affymetrix wheat probe set database using Probe Match

(https://www.affymetrix.com/analysis/netaffx/probematch/probe_match.affx?netaffx=netaffx4_annot)

. Each Affymetrix probe set consists of 11 probes

Name Probe ID Probe matches TaNF-YC1 Ta.7755.2.S1_a_at 0 / 11 TaNF-YC2 Ta.10021.1.S1_at 11 / 11 TaNF-YC3 Ta.14442.1.S1_at 11 / 11 TaNF-YC4 TaAffx.15315.1.A1_at 0 / 11 Ta.24041.1.A1_x_at 0 / 11 TaNF-YC5* Ta.22404.1.S1_at 1 / 11 TaNF-YC6 TaAffx.110336.1.S1_s_at 11 / 11 Ta.8971.1.S1_at 1 / 11 TaNF-YC7 Ta.7755.1.A1_at 11 / 11 Ta.7755.2.S1_a_at 11 / 11 TaNF-YC8* TaAffx.123361.1.A1_at 11 / 11 TaNF-YC9* Ta.14442.1.S1_at 0 / 11 TaNF-YC10 Ta.10021.1.S1_at 0 / 11 TaNF-YC11* Ta.22404.1.S1_at 11 / 11 TaNF-YC12* Ta.22404.1.S1_at 8 / 11 TaNF-YC13 Ta.6757.1.A1_at 0 / 11 TaNF-YC14 Ta.6757.1.A1_at 11 / 11

* Light upregulated in both the leaves of 23-dayold plants and the shoots of 5-day-

old seedlings.



Supplementary Table 4.6 TaNF-YC11-co-regulated genes in Affymetrix wheat genome array datasets.

Pearson correlation coefficients (r) were calculated for the expression profiles of all probe sets compared to

Ta.22404.1.S1_at (TaNF-YC11) in four Affymetrix datasets: developing grain (E-MEXP-1193), heat-

stressed leaf (E-MEXP-1523), developing anthers (E-GEOD-6027) and salt-stressed shoot (E-MEXP-971).

Affymetrix IDs are the unique Affymetrix probe set identifiers. TaGI IDs are the Triticum aestivum Gene

Index identifiers for contigs most likely represented by each probe set. Statistical significance of each r value

was calculated using a t-distribution. Statistical significance of correlations is indicated by triple asterisks (P

≤ 0.001), double asterisks (P ≤ 0.01) and a single asterisk (P ≤ 0.05)

Affy ID TaGI ID Annotation Developing

grain

Heat-stressed

leaf

Developing

anthers

Salt-stress shoot

Ta.12065.1.S1_at TC294656 2Fe-2S iron-sulfur cluster binding domain-containing protein

0.57*** 0.48* 0.83*** 0.98***

TaAffx.21600.1.S1_s_at

TC283160 2-oxoglutarate/malate translocator 0.35* 0.71*** 0.58** 0.99***

Ta.1334.1.S1_at TC322723 Acyl-CoA-binding protein 0.71*** -0.17 0.86*** 0.53**

Ta.10015.3.S1_at TC302511 Alcohol dehydrogenase class III (Alcohol dehydrogenase 2) (Glutathione-dependent formaldehyde dehydrogenase) (FDH) (FALDH) (Alcohol dehydrogenase-B2) (ADH-B2)

0.28 0.55** 0.8*** 0.94***

Ta.2009.1.S1_at TC287729 aluminum-induced protein-like 0.56*** 0.88*** 0.52** 0.72***

Ta.28357.1.A1_s_at CA723868 Aminomethyltransferase, mitochondrial precursor (Glycine cleavage system T protein) (GCVT)

0.57*** -0.36 0.89*** 0.82***

Ta.25525.1.S1_at TC283530 Aminopropyl transferase 0.53*** 0.51** 0.76*** 0.92***

Ta.7196.1.S1_at TC282594 Aminopropyl transferase 0.32* 0.74*** 0.72*** 0.86***

Ta.24600.1.A1_at TC361373 Arginine vasopressin type 1b receptor 0.65*** -0.11 0.72*** 0.98***

Ta.2412.1.S1_at TC324139 ATP synthase B chain, chloroplast precursor 0.73*** 0.26 0.57** 0.95***

Ta.2412.1.S1_x_at TC324139 ATP synthase B chain, chloroplast precursor 0.73*** 0.25 0.74*** 0.94***

TaAffx.55941.1.S1_x_at

TC283206 ATP synthase B chain, chloroplast precursor 0.7*** 0.56** 0.25 0.93***

Ta.23120.1.S1_at TC280940 ATP synthase gamma chain, chloroplast precursor

0.63*** 0.55** 0.85*** 0.91***

Ta.3499.1.S1_at TC339556 Autophagy-related protein 8 precursor 0.68*** -0.2 0.81*** 0.75***

Ta.2737.1.S1_at TC280814 cDNA expressed protein 0.6*** 0.01 0.88*** 0.99***

Ta.2742.2.S1_a_at TC304703 cDNA expressed protein 0.59*** 0.54** 0.79*** 0.95***

Ta.4043.1.A1_a_at TC286571 cDNA expressed protein 0.62*** -0.16 0.82*** 0.91***

Ta.4991.1.S1_a_at TC302736 cDNA expressed protein 0.52** -0.14 0.73*** 0.86***

Ta.8219.1.S1_at TC284618 cDNA expressed protein 0.64*** -0.15 0.85*** 0.95***

Ta.981.1.S1_a_at TC307663 cDNA expressed protein 0.61*** 0.45* 0.79*** 0.96***

Ta.3698.2.S1_x_at CA679345 CG3400-PB, isoform B (Cg3400-pg, isoform g) (6-phosphofructo 2-kinase/fructose 2,6-bisphosphatase long form) (GH17337p)

-0.24 0.64*** 0.8*** 0.88***

Ta.22426.1.S1_at TC334781 Chalcone isomerase-like 0.56*** 0.22 0.8*** 0.95***

Ta.10166.1.A1_at TC287578 chlorophyll a oxygenase 0.35* 0.65*** 0.88*** 0.94***

Ta.25600.1.S1_x_at TC294318 Chlorophyll a/b-binding apoprotein CP24 precursor

0.57*** 0.75*** 0.75*** 0.91***

Ta.20639.1.S1_x_at TC277936 Chlorophyll a/b-binding protein precursor 0.64*** 0.82*** 0.79*** 0.86***

Ta.20639.2.A1_at TC287435 Chlorophyll a/b-binding protein precursor 0.57*** 0.85*** 0.84*** 0.9***

Ta.20639.2.A1_x_at

TC287435 Chlorophyll a/b-binding protein precursor 0.63*** 0.78*** 0.81*** 0.9***

Ta.20639.3.S1_a_at TC290903 Chlorophyll a/b-binding protein precursor 0.71*** 0.89*** 0.73*** 0.9***

Ta.20639.3.S1_x_at TC290903 Chlorophyll a/b-binding protein precursor 0.55*** 0.9*** 0.74*** 0.89***

Ta.3249.1.S1_at TC277865 Chlorophyll a/b-binding protein WCAB precursor

0.54*** 0.69*** 0.78*** 0.89***



Ta.3249.2.S1_x_at TC282377 Chlorophyll a/b-binding protein WCAB precursor

0.64*** 0.7*** 0.81*** 0.6***

Ta.3249.3.A1_at TC297579 Chlorophyll a/b-binding protein WCAB precursor

0.62*** 0.67*** 0.73*** 0.87***

Ta.1139.1.S1_at TC284496 Chlorophyll A-B binding protein 0.62*** 0.84*** 0.82*** 0.54**

Ta.1139.1.S1_x_at TC284496 Chlorophyll A-B binding protein 0.61*** 0.8*** 0.84*** 0.52**

Ta.22101.1.A1_at CA721955 Chlorophyll a-b binding protein 1, chloroplast precursor

0.64*** 0.79*** 0.88*** 0.6***

Ta.2402.3.S1_x_at TC354919 Chlorophyll a-b binding protein 6A, chloroplast precursor

0.64*** 0.8*** 0.68*** 0.93***


0.59*** 0.68*** 0.85*** 0.91***


0.66*** 0.85*** 0.84*** 0.82***

Ta.27646.1.S1_x_at TC331302 Chlorophyll a-b binding protein 8, chloroplast precursor

0.67*** 0.85*** 0.83*** 0.64***

Ta.1130.3.S1_x_at TC321544 Chlorophyll a-b binding protein of LHCII type III, chloroplast precursor

0.62*** 0.83*** 0.76*** 0.27

Ta.27751.6.S1_at TC306088 Chlorophyll a-b binding protein, chloroplast precursor

0.59*** 0.85*** 0.85*** 0.75***

Ta.4346.1.A1_x_at TC279724 Chlorophyll a-b binding protein, chloroplast precursor (LHCII type I CAB) (LHCP)

0.6*** 0.56** 0.87*** 0.84***

Ta.12565.2.S1_at TC278318 chloroplast inositol phosphatase 0.57*** 0.46* 0.7*** 0.9***

Ta.9378.1.S1_at TC292793 CMV 1a interacting protein 1 0.58*** 0.74*** 0.75*** 0.97***

Ta.2742.3.S1_x_at TC288984 cyclic electron transport around photosystem I (PGR5A)

0.77*** 0.56** 0.67*** 0.93***

Ta.861.1.S1_at TC336547 Cytochrome b6-f complex iron-sulfur subunit, chloroplast precursor

0.57*** -0.47* 0.72*** 0.95***

Ta.5430.2.S1_x_at TC325796 dehydration-responsive family protein 0.13 0.82*** 0.52** 0.83***

Ta.28209.2.S1_x_at TC296437 Dehydration-responsive protein RD22 0.53*** -0.39* 0.76*** 0.92***

Ta.10577.1.S1_at TC353521 DnaJ domain-containing protein 0.64*** -0.35 0.8*** 0.9***

Ta.6420.1.S1_at TC305309 FAD binding domain-containing protein 0.53*** 0.03 0.77*** 0.85***

TaAffx.80290.1.S1_at

TC285357

Ferredoxin, chloroplast precursor 0.52** 0.41* 0.79*** 0.95***


TC285357

Ferredoxin, chloroplast precursor 0.56*** 0.37* 0.76*** 0.97***


TC305823 Ferredoxin, chloroplast precursor 0.53*** 0.18 0.81*** 0.9***

Ta.1167.1.S1_at TC309636 Ferredoxin-NADP reductase, leaf isozyme, chloroplast precursor

0.6*** 0.28 0.85*** 0.91***


TC304875 FKBP-type peptidyl-prolyl cis-trans isomerase 2, chloroplast precursor

0.6*** 0.54** 0.72*** 0.9***

Ta.6185.1.S1_at TC291439 formiminotransferase-cyclodeaminase -0.09 0.73*** 0.7*** 0.94***

Ta.439.1.S1_at TC277182 Fructose-1,6-bisphosphatase, chloroplast precursor

0.65*** 0.25 0.88*** 0.93***

Ta.20429.2.S1_at TC293502 Fructose-bisphosphate aldolase, chloroplast precursor

0.56*** -0.05 0.84*** 0.9***

Ta.506.2.A1_at TC304640 Fructose-bisphosphate aldolase, chloroplast precursor

0.58*** -0.21 0.87*** 0.94***

Ta.447.2.S1_a_at TC295134 Fructose-bisphosphate aldolase, cytoplasmic isozyme 1

0.74*** -0.1 0.76*** 0.95***

Ta.29359.1.A1_s_at TC290031 Fumarylacetoacetase 0.57*** -0.21 0.8*** 0.8***

Ta.8792.2.A1_a_at TC298088 Gamma interferon inducible lysosomal thiol reductase family protein

0.53*** -0.56** 0.77*** 0.91***

Ta.28361.1.S1_x_at TC288715 GB|AAM10278.1|20147123|AY091679 AT4g01150/F2N1_18

0.61*** 0.45* 0.75*** 0.91***

Ta.4885.1.S1_x_at TC296685 GB|AAM10278.1|20147123|AY091679 AT4g01150/F2N1_18

0.57*** 0.35 0.89*** 0.94***

Ta.1982.1.A1_s_at TC326021 GB|AAM91372.1|22137054|AY133542 At4g35250/F23E12_190

0.23 0.66*** 0.83*** 0.97***

Ta.1971.2.S1_x_at TC297374 GB|BAD20753.1|47827071|AB164642 transcriptional regulator

0.6*** -0.09 0.73*** 0.95***



Ta.23163.1.A1_at TC297385 GB|CAD35362.1|21535744|ATH490171 FK506 binding protein 1

0.54*** -0.46* 0.83*** 0.97***

Ta.23665.1.S1_at TC308136 Glucose-1-phosphate adenylyltransferase large subunit 3, chloroplast precursor

0.56*** 0.54** 0.77*** 0.83***

Ta.3243.1.S1_at TC293908 Glutamyl-tRNA reductase, chloroplast precursor

0.48** 0.83*** 0.82*** 0.79***

Ta.3243.1.S1_x_at TC293908 Glutamyl-tRNA reductase, chloroplast precursor

0.39* 0.84*** 0.81*** 0.8***

Ta.1333.1.S1_at TC295369 glutathione S-transferase GSTU6 0.7*** 0.45* 0.81*** 0.98***

Ta.30808.1.S1_s_at TC289424 Glyceraldehyde-3-phosphate dehydrogenase A, chloroplast precursor

0.6*** 0.37* 0.79*** 0.91***

Ta.1135.1.S1_at TC285503 Glyceraldehyde-3-phosphate dehydrogenase B, chloroplast precursor

0.55*** 0.07 0.77*** 0.92***

Ta.28775.1.S1_x_at TC300037 glycerophosphoryl diester phosphodiesterase family protein

0.63*** 0.11 0.89*** 0.97***

Ta.581.2.S1_a_at TC282120 Glycine cleavage system H protein, mitochondrial precursor

0.54*** 0.04 0.76*** 0.95***

Ta.27772.1.S1_at TC308109 Glycolate oxidase 0.59*** 0.29 0.9*** 0.97***


CA635519 GP|11692898|gb| At2g21280 0.71*** -0.09 0.83*** 0.85***

Ta.30733.2.S1_at CA696784 GP|15289926|dbj P0483G10.15 0.64*** 0.85*** 0.81*** 0.72***

Ta.1730.1.A1_at TC354652 GP|18461295|dbj P0014E08.1 0.54*** 0.77*** -0.55** 0.88***

TaAffx.120241.2.A1_at

TC282992 GP|29028856|gb At5g22340 0.01 0.74*** 0.52** 0.95***

Ta.5273.3.A1_a_at BJ252399 GP|7300056|gb| CG4699-PA -0.57*** 0.6** 0.88*** 0.77***

Ta.1977.1.S1_x_at TC316686 H(+)-transporting ATP synthase 0.59*** 0.21 0.87*** 0.86***

Ta.2431.1.S1_at TC295853 HAD-superfamily hydrolase, subfamily IA, variant 3 containing protein

0.55*** 0.39* 0.87*** 0.93***

Ta.2431.1.S1_x_at TC295853 HAD-superfamily hydrolase, subfamily IA, variant 3 containing protein

0.53*** 0.33 0.82*** 0.95***

Ta.7378.19.S1_at TC305565 Histone H2B 0.73*** 0.77*** -0.32 0.82***

Ta.7378.19.S1_x_at TC305565 Histone H2B 0.69*** 0.74*** -0.33 0.82***

Ta.10329.1.S1_x_at TC311177 Histone H4 0.73*** 0.52** -0.33 0.94***

Ta.3259.1.S1_at TC308626 HOTHEAD protein precursor 0.53*** 0.81*** 0.77*** 0.05

Ta.8450.1.S1_x_at TC299570 hydrolase, alpha/beta fold family protein -0.03 0.82*** 0.59** 0.92***

Ta.8450.2.S1_a_at TC323126 hydrolase, alpha/beta fold family protein 0.1 0.9*** 0.62** 0.9***

Ta.25941.1.S1_at TC324913 Klotho protein -0.14 0.68*** 0.8*** 0.89***

Ta.11386.2.S1_a_at TC292464 L-ascorbate peroxidase 8, chloroplast precursor

0.58*** 0.59** 0.86*** 0.93***

Ta.11386.2.S1_x_at TC292464 L-ascorbate peroxidase 8, chloroplast precursor

0.6*** 0.6** 0.87*** 0.94***

Ta.488.1.S1_x_at TC334642 L-ascorbate peroxidase, chloroplast precursor 0.51** 0.76*** 0.75*** 0.82***

Ta.488.3.S1_at CA627364 L-ascorbate peroxidase, chloroplast precursor 0.6*** 0.74*** 0.81*** 0.78***

Ta.30807.1.S1_at TC357445 Light-regulated protein precursor 0.55*** 0.92*** 0.95*** 0.88***

Ta.30807.2.S1_s_at TC302050 Light-regulated protein precursor 0.5** 0.92*** 0.75*** 0.78***

Ta.3890.1.S1_a_at TC280651 Light stress-responsive one-helix protein-like 0.66*** 0.37* 0.75*** 0.95***

Ta.2402.1.S1_a_at CD454957 Light-harvesting complex I 0.67*** 0.74*** 0.71*** 0.93***

Ta.2402.1.S1_at CD454957 Light-harvesting complex I 0.53*** 0.73*** 0.78*** 0.96***

Ta.30727.1.S1_at TC289661 Light-harvesting complex IIa protein 0.64*** 0.83*** 0.59** 0.63***

Ta.881.1.S1_a_at TC283142 Light-harvesting complex protein 0.58*** 0.25 0.78*** 0.95***

Ta.881.2.S1_a_at TC278413 Light-harvesting complex protein 0.73*** 0.15 0.82*** 0.91***

Ta.881.2.S1_x_at TC278413 Light-harvesting complex protein 0.67*** 0.13 0.87*** 0.93***

Ta.1395.1.S1_at TC278576 Magnesium-protoporphyrin IX monomethyl ester cyclase, chloroplast precursor

0.64*** 0.8*** 0.73*** 0.74***

Ta.22762.2.S1_at TC293615 mRNA-binding protein precursor 0.6*** 0.21 0.8*** 0.96***

Ta.28404.1.S1_s_at TC346296 myb-like DNA-binding domain, SHAQKYF class family protein

-0.31* 0.59** 0.8*** 0.88***

Ta.12695.1.S1_at TC338254 Nodule membrane protein -0.11 0.76*** 0.69*** 0.91***

Ta.13670.1.S1_at TC325787 ORMDL family protein 0.11 0.57** 0.78*** 0.85***

Ta.10081.2.S1_at TC284174 oxidoreductase, aldo/keto reductase family protein

0.65*** 0.1 0.81*** 0.94***



Ta.841.1.S1_a_at TC288877 Oxygen-evolving enhancer protein 1, chloroplast precursor

0.72*** 0.8*** 0.73*** 0.65***

Ta.85.1.S1_at TC277987 Oxygen-evolving enhancer protein 2, chloroplast precursor

0.65*** 0.71*** 0.77*** 0.8***

Ta.20902.2.S1_at TC318056 PASTICCINO2 0.57*** 0.05 0.79*** 0.86***

Ta.6572.1.S1_a_at TC305803 Peroxiredoxin Q 0.55*** -0.11 0.77*** 0.96***

Ta.6572.2.S1_at TC317863 Peroxiredoxin Q, complete 0.53*** 0.15 0.72*** 0.94***

Ta.1842.1.S1_a_at TC301116 Phosphoethanolamine N-methyltransferase 0.55*** 0.35 0.76*** 0.91***

Ta.2307.1.S1_at TC278059 Phosphoglycerate kinase, chloroplast precursor

0.47** 0.58** 0.88*** 0.91***

Ta.28589.1.A1_s_at TC299487 phosphoglycolate/pyridoxal phosphate phosphatase family protein

0.58*** 0.17 0.91*** 0.94***

Ta.3256.1.S1_at TC299487 phosphoglycolate/pyridoxal phosphate phosphatase family protein

0.55*** 0.4* 0.87*** 0.94***

Ta.18063.3.S1_x_at TC361473 Phospholipid hydroperoxide glutathione peroxidase, chloroplast precursor

-0.28 0.71*** 0.72*** 0.96***

Ta.23158.1.S1_at TC285886 Phosphoribulokinase, chloroplast precursor 0.63*** 0.03 0.91*** 0.87***


0.63*** 0.83*** 0.83*** 0.91***


0.52** 0.83*** 0.8*** 0.9***

Ta.27761.1.S1_x_at TC310527 Photosystem I reaction centre subunit psaK, chloroplast precursor

0.58*** 0.69*** 0.73*** 0.83***


0.62*** 0.67*** 0.81*** 0.74***


0.57*** 0.69*** 0.78*** 0.83***

Ta.24400.1.S1_at CA626380 Photosystem I reaction centre subunit V, chloroplast precursor (PSI-G) (Photosystem I 9 kDa protein)

0.69*** 0.37* 0.79*** 0.89***

Ta.27751.3.S1_at TC343475 Photosystem I reaction centre subunit XI, chloroplast precursor

0.68*** 0.75*** 0.82*** 0.82***

Ta.28363.2.S1_a_at TC302457 Photosystem I reaction centre subunit N chloroplast precursor (PSI- N)

0.66*** 0.67*** 0.84*** 0.93***

Ta.28363.1.A1_at TC293434 Photosystem I reaction centre subunit N, chloroplast precursor (PSI-N)

0.59*** 0.73*** 0.75*** 0.96***

Ta.28363.1.A1_x_at

TC293434 Photosystem I reaction centre subunit N, chloroplast precursor (PSI-N)

0.62*** 0.71*** 0.74*** 0.95***

Ta.28363.3.S1_x_at TC326095 Photosystem I reaction centre subunit N, chloroplast precursor (PSI-N)

0.6*** 0.68*** 0.76*** 0.95***

Ta.27793.2.S1_x_at TC316864 Photosystem II 10 kDa polypeptide, chloroplast precursor

0.65*** -0.34 0.76*** 0.9***

Ta.1161.1.S1_at TC280250 Photosystem II 22 kDa protein, chloroplast precursor

0.51** 0.18 0.72*** 0.83***

Ta.22587.1.S1_x_at TC310040 Photosystem II reaction centre Psb27 protein 0.49** 0.74*** 0.76*** 0.97***

Ta.8061.1.S1_at TC317800 Photosystem II reaction centre W protein 0.52** -0.23 0.76*** 0.97***

Ta.891.1.S1_x_at TC310000 Photosystem II reaction centre W protein, chloroplast precursor (PSII 6.1 kDa protein)

0.65*** 0.66*** 0.71*** 0.87***

Ta.20878.1.S1_x_at TC320279 Photosystem II reaction centre X protein containing protein

0.42** 0.72*** 0.85*** 0.94***


CA598047 Plastocyanin, chloroplast precursor 0.55*** 0.42* 0.78*** 0.96***

Ta.28197.1.S1_at TC279111 Probable (S)-2-hydroxy-acid oxidase, peroxisomal 2 (Glycolate oxidase 2) (GOX 2) (Short chain alpha-hydroxy acid oxidase 2)

0.69*** -0.03 0.87*** 0.91***

Ta.645.1.S1_a_at TC286830 Proline-rich family protein-like 0.58*** -0.15 0.75*** 0.97***

Ta.645.1.S1_x_at TC286830 Proline-rich family protein-like 0.52** -0.36 0.75*** 0.97***

Ta.1968.1.S1_at TC315023 protease inhibitor/seed storage/lipid transfer protein

0.66*** -0.28 0.83*** 0.89***

Ta.28117.1.S1_x_at TC319453 protease inhibitor/seed storage/lipid transfer protein

0.69*** -0.2 0.86*** 0.94***



Ta.29425.1.S1_x_at TC353840 Quinone oxidoreductase 0.53*** 0.25 0.9*** 0.94***

TaAffx.3767.3.S1_s_at

CK211869 rhodanese family protein 0.46** 0.54** 0.75*** 0.83***

Ta.1131.1.A1_at TC336124 Rhodanese-like domain-containing protein 0.46** 0.83*** 0.88*** 0.88***

Ta.28875.1.S1_at TC280134 Rhodanese-like domain-containing protein 0.57*** 0.83*** 0.59** 0.92***


CA689363 Ribulose bisphosphate carboxylase small chain chloroplast precursor (EC 4.1.1.39)

0.53*** 0.55** 0.89*** 0.93***


CA689363 Ribulose bisphosphate carboxylase small chain chloroplast precursor (EC 4.1.1.39)

0.55*** 0.54** 0.88*** 0.94***

TaAffx.449.1.A1_at TC353236 Ribulose bisphosphate carboxylase small chain A, chloroplast precursor

0.56*** 0.44* 0.8*** 0.93***

Ta.27923.2.S1_x_at TC339786 Ribulose bisphosphate carboxylase small chain C

0.59*** 0.25 0.8*** 0.93***

Ta.2752.2.S1_x_at TC355586 Ribulose bisphosphate carboxylase small chain C, chloroplast precursor

0.57*** 0.16 0.9*** 0.92***

Ta.2752.3.S1_x_at TC355586 Ribulose bisphosphate carboxylase small chain C, chloroplast precursor

0.58*** 0.08 0.91*** 0.94***

Ta.20830.1.A1_at TC285261 Ribulose bisphosphate carboxylase small chain PW9, chloroplast precursor

0.56*** 0.46* 0.85*** 0.91***

Ta.27660.1.S1_at TC282967 Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplast precursor (RuBisCO activase A) (RA A)

0.63*** 0.24 0.86*** 0.93***

Ta.27660.1.S1_x_at TC282967 Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor

0.63*** 0.08 0.88*** 0.91***


CA658565 ribulose-1 5-bisphosphate carboxylase/oxygenase small subunit

0.53*** 0.28 0.87*** 0.92***

Ta.2752.1.S1_x_at TC320607 Ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit

0.78*** 0.27 0.86*** 0.97***

Ta.347.3.S1_x_at TC280225 Ribulose-5-phosphate-3-epimerase 0.54*** 0.2 0.75*** 0.93***

Ta.8647.1.S1_at TC357932 RING-H2 zinc finger protein-like 0.77*** 0.55** -0.46* 0.95***

Ta.1983.1.S1_at TC280210 RNA binding protein 0.54*** 0.29 0.86*** 0.95***


0.54*** 0.43* 0.82*** 0.96***


0.52** 0.28 0.85*** 0.96***

Ta.1988.3.S1_at TC303696 Sedoheptulose-1,7-bisphosphatase, chloroplast precursor

0.56*** 0.16 0.83*** 0.91***


0.56*** 0.36 0.84*** 0.96***

Ta.6344.1.S1_at TC291757 Senescence-associated protein 0.52** 0.32 0.83*** 0.91***

Ta.2586.2.S1_x_at TC287167 Senescence-associated protein-like 0.64*** 0.81*** -0.41* 0.73***

Ta.4448.1.S1_at TC290155 Ser/Arg-related nuclear matrix protein 0.66*** -0.41* 0.83*** 0.94***

Ta.27135.1.S1_at TC356717 Serine hydroxymethyltransferase, mitochondrial precursor

0.43** 0.5* 0.84*** 0.94***

Ta.25434.1.S1_a_at TC283049 SHOOT1 protein 0.55*** -0.05 0.74*** 0.95***

Ta.9366.1.S1_x_at TC306781 TaDof 0.55*** 0.72*** -0.07 0.95***

Ta.2407.1.S1_x_at TC297969 thioredoxin family protein 0.56*** 0.51** 0.89*** 0.94***

Ta.2407.2.A1_at TC315009 thioredoxin family protein 0.47** 0.64*** 0.9*** 0.97***

Ta.136.1.S1_at TC354027 Thioredoxin M-type, chloroplast precursor 0.62*** 0.3 0.81*** 0.96***

Ta.636.1.S1_s_at TC293312 Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor

0.59*** 0.24 0.89*** 0.97***


TC292386 transposon protein 0.53*** -0.24 0.77*** 0.91***

Ta.28361.3.S1_x_at TC296448 Twist related protein 1 0.59*** 0.73*** 0.63** 0.86***

Ta.11777.1.S1_x_at TC315783 Two-component response regulator ARR3 0.83*** 0.42* 0.79*** 0.82***

Ta.25244.1.S1_at TC299702 Ubiquitin-conjugating enzyme 0.64*** -0.34 0.73*** 0.91***

Ta.392.1.S1_x_at TC292885 UP|B2_DAUCA (P37707) B2 protein 0.52** -0.44* 0.89*** 0.95***

Ta.22648.1.S1_a_at TC306930 UP|CF54_HUMAN (Q9Y6Z4) 0.58*** -0.04 0.83*** 0.95***

Ta.1147.2.S1_a_at TC316871 UP|P74338 (P74338) Slr1623 protein 0.71*** 0.05 0.74*** 0.98***

Ta.1147.3.S1_at TC305601 UP|P74338 (P74338) Slr1623 protein 0.56*** -0.11 0.72*** 0.97***

Ta.1147.3.S1_x_at TC305601 UP|P74338 (P74338) Slr1623 protein 0.63*** 0.08 0.82*** 0.98***



Ta.22826.1.S1_s_at TC323450 UP|Q5W7C2 (Q5W7C2) 0.62*** -0.03 0.88*** 0.76***

Ta.9102.1.S1_at TC294291 UP|Q6F2V2 (Q6F2V2) 0.68*** -0.26 0.79*** 0.91***

Ta.9102.2.S1_a_at CA600902 UP|Q6F2V2 (Q6F2V2) 0.57*** -0.04 0.76*** 0.85***

Ta.1147.2.S1_x_at TC316871 UP|Q7NKF6 (Q7NKF6) Glr1522 protein 0.69*** 0.14 0.77*** 0.98***

Ta.20911.1.A1_at TC339713 UP|Q86B64 (Q86B64) CG3960-PD, isoform D

0.57*** 0.1 0.71*** 0.97***

Ta.10093.1.A1_at TC304333 UP|Q93Z46 (Q93Z46) AT4g23890/T32A16_60

0.6*** 0.49* 0.78*** 0.95***

Ta.25061.1.S1_at TC360357 UP|Q94JR0 (Q94JR0) At1g32790 (At1g32790/F6N18_9)

0.58*** 0 0.82*** 0.84***

Ta.769.1.S1_at TC286095 UP|Q9ASP7 (Q9ASP7) AT3g46780/T6H20_190

0.52** 0.78*** 0.8*** 0.9***

Ta.7771.1.A1_s_at TC304500 UP|Q9FPJ7 (Q9FPJ7) At2g27680 0.71*** -0.1 0.72*** 0.9***

Ta.2825.1.S1_a_at TC314060 UP|Q9JGT1 (Q9JGT1) PORF1 0.61*** 0.71*** 0.86*** 0.95***

Ta.5343.1.A1_a_at TC291034 UP|Q9LGY0 (Q9LGY0) 0.57*** -0.43* 0.77*** 0.85***

Ta.9368.1.S1_a_at TC287090 UP|Q9M9U4 (Q9M9U4) F6A14.16 protein 0.5** -0.36 0.84*** 0.95***

Ta.9368.2.S1_x_at TC294731 UP|Q9M9U4 (Q9M9U4) F6A14.16 protein 0.52** -0.23 0.84*** 0.94***

Ta.2383.1.S1_s_at TC291505 UP|Q9SL05 (Q9SL05) 0.62*** -0.22 0.82*** 0.99***

Ta.2383.2.S1_a_at CA620041 UP|Q9SL05 (Q9SL05) 0.66*** -0.32 0.83*** 0.98***

Ta.10949.1.S1_at TC363642 UP|TOP2_TRYBB (P12531) DNA topoisomerase II

0.49** 0.76*** 0.51** 0.97***

Ta.3452.1.S1_at TC280241 Zinc finger (C3HC4-type RING finger) protein-like

-0.7*** 0.69*** 0.79*** 0.9***

Ta.16093.1.S1_at TC360455 0.53*** -0.13 0.76*** 0.9***

Ta.5452.1.S1_x_at TC334209 0.57*** -0.58** 0.75*** 0.9***

Ta.7930.1.S1_at TC303327 0.52** -0.24 0.76*** 0.96***


TC311080 0.57*** 0.32 0.82*** 0.96***



Supplementary Table 4.7 Transcripts correlated with the mRNA levels of TaNF-YC8 in Affymetrix genome array

datasets. Pearson correlation coefficients (r) were calculated for the expression profiles of all probe sets compared to

TaAffx.123361.1.A1_at (TaNF-YC8) in three Affymetrix datasets: developing grain (E-MEXP-1193), developing

anthers (E-GEOD-6027) and grain DAA5 Loc1 (E-GEOD-4935). Affymetrix IDs are the unique Affymetrix probe set

identifiers. TaGI IDs are the Triticum aestivum Gene Index identifiers for contigs most likely represented by each probe

set. Statistical significance of each r value was calculated using a t-distribution. Statistical significance of correlations is

indicated by triple asterisks (P ≤ 0.001), double asterisks (P ≤ 0.01) and a single asterisk (P ≤ 0.05)

Affy ID TaGI ID Annotation Developing grain Developing anthers

Grain DAA5 Loc1

Ta.30552.1.S1_x_at TC255169 1,2-diacyl-sn-glycerol:acyl-CoA acyltransferase 0.8*** 0.93*** 0.65*** Ta.6099.1.S1_at TC235667 2-nitropropane dioxygenase-like protein 0.85*** 0.96*** 0.55*** Ta.647.3.S1_x_at TC251276 3'-5' exonuclease ERI1 0.81*** 0.82*** 0.64*** Ta.25069.1.S1_x_at TC264425 40S ribosomal protein 0.87*** 0.86*** 0.51*** TaAffx.9579.1.S1_at CA594500 ankyrin repeat family protein 0.79*** 0.97*** 0.56*** Ta.14496.1.S1_x_at TC235579 Asparaginyl endopeptidase REP-2 0.81*** 0.8*** 0.58*** Ta.14496.2.A1_at TC235582 Asparaginyl endopeptidase REP-2 0.83*** 0.75*** 0.59*** Ta.4014.2.S1_at TC248263 ATP-dependent Clp protease ATP-binding subunit 0.77*** 0.97*** 0.58*** Ta.11824.1.A1_at TC256547 beta-fructofuranosidase 0.61*** 0.96*** 0.71*** TaAffx.50091.1.S1_at TC238096 C2 domain-containing protein 0.72*** 0.97*** 0.58*** Ta.10361.1.S1_at TC268409 calcineurin-like phosphoesterase family protein 0.57*** 0.85*** 0.73*** Ta.9437.1.S1_at TC238137 chloroplast nucleoid DNA-binding protein 0.72*** 0.98*** 0.66*** Ta.30522.1.S1_at TC255435 Chloroplast thylakoidal processing peptidase-like protein 0.86*** 0.91*** 0.72*** Ta.4704.1.S1_at TC249308 Choline-phosphate cytidylyltransferase B 0.74*** 0.86*** 0.68*** Ta.20812.1.S1_at TC239612 CHY zinc finger family protein 0.7*** 0.88*** 0.7*** Ta.7307.1.S1_at TC269517 co-chaperone Hsc20 family protein 0.87*** 0.94*** 0.62*** Ta.3876.1.A1_at TC255560 diacylglycerol kinase variant B 0.71*** 0.98*** 0.56*** Ta.11198.1.S1_at TC238389 DnaJ domain-containing protein 0.89*** 0.58*** 0.72*** Ta.3886.1.S1_at TC255994 Exo-glucanase 0.73*** 0.97*** 0.57*** Ta.26203.1.S1_a_at TC234630 FAD linked oxidases 0.75*** 0.95*** 0.51*** Ta.7899.1.A1_at TC257395 F-box family protein 0.87*** 0.97*** 0.65*** Ta.22959.1.S1_at TC272365 GATA zinc finger family protein 0.78*** 0.97*** 0.54*** Ta.19471.1.S1_at TC253937 GTP pyrophosphokinase 0.79*** 0.97*** 0.53*** Ta.5718.1.S1_at TC252682 hexose transporter 0.85*** 0.96*** 0.71*** Ta.30191.1.A1_s_at TC266568 Homeobox protein engrailed-1 (Hu-En-1) 0.83*** 0.85*** 0.66*** Ta.7820.1.S1_at TC253022 ICE-like protease p20 domain-containing protein 0.87*** 0.93*** 0.51*** Ta.6477.1.A1_a_at TC239582 Lipase class 3-like 0.77*** 0.84*** 0.74*** Ta.7669.1.S1_a_at TC268952 Mitochondrial carrier protein 0.79*** 0.95*** 0.64*** Ta.7669.1.S1_at TC268952 Mitochondrial carrier protein 0.74*** 0.94*** 0.59*** Ta.7669.2.S1_at BG904886 Mitochondrial carrier protein 0.74*** 0.97*** 0.51*** Ta.5602.2.S1_at TC236554 Nuclear protein-like 0.82*** 0.84*** 0.66*** Ta.21613.1.S1_at TC248781 Ornithine aminotransferase 0.71*** 0.97*** 0.53*** Ta.3839.1.S1_a_at TC254155 outer envelope protein 0.83*** 0.91*** 0.53*** Ta.27006.1.S1_at TC255297 Phagocytosis and cell motility protein ELMO1-like 0.74*** 0.96*** 0.53*** Ta.20993.1.S1_at TC268098 PHD-finger family homeodomain protein 0.64*** 0.81*** 0.71*** Ta.4794.1.A1_at TC254960 Plus-3 domain-containing protein 0.77*** 0.85*** 0.5*** Ta.10124.1.S1_at TC238796 Protein kinase CK2 regulatory subunit CK2B3 0.72*** 0.96*** 0.61*** Ta.4966.2.S1_s_at CA646341 Protein phosphatase 2C containing protein 0.84*** 0.89*** 0.5*** Ta.12338.1.S1_at TC253438 Protein phosphatase-like 0.79*** 0.85*** 0.58*** Ta.28185.1.S1_at TC251136 Q640C2 0.78*** 0.95*** 0.63*** Ta.5052.2.A1_at TC248202 Q7RW17 0.78*** 0.84*** 0.53*** Ta.9353.1.S1_at TC255150 Q8LPT2 0.75*** 0.82*** 0.59*** Ta.28902.1.A1_at TC240679 Q8VZG0 0.68*** 0.81*** 0.72*** Ta.5625.1.A1_s_at TC268851 Q9LRN1 0.81*** 0.88*** 0.68*** Ta.9706.1.S1_a_at TC254267 Q9LTY5 0.89*** 0.8*** 0.54*** Ta.15822.1.S1_at TC272074 regulator of chromosome condensation 0.5*** 0.96*** 0.74*** Ta.7776.1.S1_at TC268249 RNA-binding protein-like 0.85*** 0.85*** 0.53*** Ta.11105.1.S1_at TC238159 Serine/threonine protein phosphatase 2A, 72/130 kDa

regulatory subunit B 0.75*** 0.97*** 0.58***

Ta.1154.1.S1_at TC253272 SNARE domain-containing protein 0.75*** 0.98*** 0.58*** TaAffx.4200.1.S1_at TC269025 TATA box-binding protein (TBP) associated factor (TAF)-like

protein 0.8*** 0.89*** 0.52***

Ta.12406.1.S1_at TC254993 Ubiquitin carboxyl-terminal hydrolase family protein 0.82*** 0.65*** 0.74*** Ta.5837.1.S1_at TC258584 ubiquitin family protein 0.85*** 0.86*** 0.63*** Ta.22953.1.S1_a_at TC268060 Ubiquitin protein ligase Praja1 0.92*** 0.99*** 0.5*** Ta.13370.1.A1_at TC245643 Vacuolar targeting receptor bp-80 0.78*** 0.83*** 0.62*** Ta.14476.2.S1_at TC265373 Y-box protein MSY2 isoform a 0.74*** 0.93*** 0.54*** Ta.3674.1.S1_at TC236727 Yippee-like protein 0.86*** 0.97*** 0.58*** Ta.10464.1.A1_at TC256857 0.78*** 0.98*** 0.66*** Ta.11988.1.S1_at TC254829 0.86*** 0.77*** 0.59*** Ta.12148.1.S1_a_at TC256008 0.77*** 0.82*** 0.72*** Ta.12148.1.S1_x_at TC256008 0.76*** 0.91*** 0.76*** Ta.12822.1.A1_at TC254349 0.82*** 0.96*** 0.52*** Ta.13288.1.A1_at TC240954 0.84*** 0.95*** 0.6*** Ta.26419.1.A1_at CD490761 0.52*** 0.84*** 0.7*** Ta.27956.1.S1_at TC271986 0.81*** 0.92*** 0.53*** Ta.28166.1.S1_a_at TC248451 0.71*** 0.93*** 0.53*** Ta.482.1.A1_a_at TC258245 0.61*** 0.86*** 0.81*** Ta.6272.2.S1_x_at TC249691 0.83*** 0.96*** 0.54*** Ta.7696.2.A1_a_at TC267835 0.73*** 0.96*** 0.66*** Ta.8488.1.S1_a_at CA637893 0.76*** 0.97*** 0.69*** TaAffx.29359.1.S1_at TC242617 0.71*** 0.9*** 0.51***



Supplementary Figure 4.4. Phylogenetic tree of the light-regulated NF-YC subunit members in wheat with the published NF-YC families in Arabidopsis and rice and two NF-YC members from tomato. Bootstrap values from 1000 replicates have been used to assess the robustness of the trees. Bootstrap values are shown in blue. Each tree has been rooted using the Saccharomyces cerevisiae HAP homologues. Arabidopsis sequences begin with (At), rice sequences begin with (Os), wheat sequences begin with (Ta) and tomato with (T)



Chapter 5: 149 TaNF-YB3 is involved in the regulation of photosynthesis genes in Triticum aestivum

Chapter 5: TaNF-YB3 is involved in the regulation of photosynthesis genes in Triticum aestivum


Stephenson, T. J., McIntyre, C., Collet, C. and Xue, G.-P. (2010). TaNF-YB3

is involved in the regulation of photosynthesis genes in Triticum aestivum.

Functional and Integrative Genomics: doi 10.1007/s10142-011-0212-9.

This chapter is presented in the format required for the journal Functional and

Integrative Genomics.










150 Chapter 5: TaNF-YB3 is involved in the regulation of photosynthesis genes in Triticum aestivum

5.2 ABSTRACT

Nuclear factor Y (NF-Y) transcription factor is a heterotrimer comprised of

three subunits: NF-YA, NF-YB and NF-YC. Each of the three subunits in plants is

encoded by multiple genes with differential expression profiles, implying the

functional specialisation of NF-Y subunit members in plants. In this study, we

investigated the roles of NF-YB members in the light-mediated regulation of

photosynthesis genes. We identified two NF-YB members from Triticum aestivum

(TaNF-YB3 & 7) which were markedly upregulated by light in the leaves and

seedling shoots using quantitative RT-PCR. A genome-wide coexpression analysis of

multiple Affymetrix Wheat Genome Array datasets revealed that TaNF-YB3-

coexpressed transcripts were highly enriched with the Gene Ontology term

photosynthesis. Transgenic wheat lines constitutively overexpressing TaNF-YB3 had

a significant increase in the leaf chlorophyll content, photosynthesis rate and early

growth rate. Quantitative RT-PCR analysis showed that the expression levels of a

number of TaNF-YB3-coexpressed transcripts were elevated in the transgenic wheat

lines. The mRNA level of TaGluTR encoding glutamyl-tRNA reductase, which

catalyses the rate-limiting step of the chlorophyll biosynthesis pathway, was

significantly increased in the leaves of the transgenic wheat. Significant increases in

the expression level in the transgenic plant leaves were also observed for four

photosynthetic apparatus genes encoding chlorophyll a/b-binding proteins (Lhca4

and Lhcb4) and photosystem I reaction centre subunits (subunit K and subunit N), as

well as for a gene coding for chloroplast ATP synthase subunit. These results

indicate that TaNF-YB3 is involved in the positive regulation of a number of

photosynthesis genes in wheat.


5.3 INTRODUCTION

Light regulates a number of important physiological processes in plants,

including photosynthesis to acquire energy from light (Casal and Yanovsky 2005).

Jiao et al. (2005) have shown that light signalling induces differential expression of

at least 20 % of all Arabidopsis and rice genes. Plants sense the quality, quantity,

direction and duration of light through at least four distinct families of

photoreceptors: phytochromes, cryptochromes, phototropins and zeitlupes (Christie

2007; Devlin et al. 2007; Li and Yang 2007; Bae and Choi 2008). These

photoreceptors trigger effectors such as transcription factors, kinases, phosphatases

and degradation pathway proteins (Chen et al. 2004; Casal and Yanovsky 2005).

Some experimental evidence indicates that light-mediated gene regulation may

also involve the nuclear factor Y (NF-Y) proteins as some members of this

transcription factor family are light-upregulated (Stephenson et al. 2010) and the

assembly of a NF-Y complex at the promoter of a photosynthesis gene is regulated

by light (Kusnetsov et al. 1999). NF-Y is a heterotrimer that is formed from NF-YA,

NF-YB and NF-YC subunits and binds specifically to the CCAAT-box, a cis-acting

promoter element in eukaryotes (Mantovani 1998). Whereas a single gene encodes

each of the three NF-Y subunits in mammals and yeast, multiple genes encode each

subunit in plants. For example, Arabidopsis NF-YA, NF-YB and NF-YC subunit

families have 10, 13 and 13 members, respectively (Siefers et al. 2009) and similar

sizes of NF-Y subunit families have been reported in wheat and rice (Stephenson et

al. 2007; Thirumurugan et al. 2008). Many plant NF-Y subunit members show

differential gene expression during development and in response to external stimuli

(Gusmaroli et al. 2001, 2002; Chen et al. 2007; Stephenson et al. 2007, 2010;

Warpeha et al. 2007; Li et al. 2008; Thirumurugan et al. 2008; Siefers et al. 2009;

Liu and Howell 2010). Recently, some subunit members have been shown to be

capable of specific interaction with other regulators in the regulation of flowering

time genes and stress response genes (Wenkel et al. 2006; Cai et al. 2007; Kumimoto

et al. 2008, 2010; Distelfeld et al. 2009; Yamamoto et al. 2009; Liu and Howell

2010). These studies suggest that some NF-Y subunit members in plants have

evolved a degree of functional specialisation.

The involvement of NF-Y members in the regulation of photosynthesis has

been implicated in a few previous studies (Miyoshi et al. 2003; Warpeha et al. 2007;


Stephenson et al. 2010). In rice, antisense and RNAi constructs to OsHAP3A (NF-

YB) resulted in reduced chlorophyll content in the leaves, degenerate chloroplasts

and a marked reduction in the mRNA level of a light harvesting chlorophyll-a/b

binding protein gene (CAB) (Miyoshi et al. 2003). Mutation of NF-YA5 and NF-

YB9 subunit members in Arabidopsis resulted in loss of the blue light fluorescence-

mediated expression of light harvesting chlorophyll a/b-binding protein (Lhcb) in

etiolated seedlings (Warpeha et al. 2007). In wheat, a gene expression correlation

analysis has shown that a light-upregulated TaNF-YC11 is predominantly expressed

in photosynthetic organs and is closely co-regulated with a number of photosynthesis

genes in various expression profiling datasets (Stephenson et al. 2010). It indicates

that TaNF-YC11 may have a role in the regulation of photosynthesis genes, likely

through the formation of a NF-Y heterotrimer with other light-upregulated partners

and subsequent binding to light-responsive CCAAT-box cis-elements in the

promoters of photosynthesis genes. The promoters of a number of photosynthesis

genes, such as CAB, in wheat contain the CCAAT-box (Stephenson et al. 2010).

We are interested in identifying NF-Y subunit members involved in the

regulation of photosynthesis genes in wheat to gain an understanding of the gene

networks that underlie carbon assimilation. This paper reports the identification of a

light-upregulated NF-YB gene (TaNF-YB3) which is significantly correlated with

expression of photosynthesis-related transcripts in at least three separate Affymetrix

Wheat Genome Array datasets. The potential role of light-upregulated members of

the plant NF-YB subunit family in the regulation of photosynthesis genes was

investigated by creating transgenic wheat lines that constitutively overexpressed

TaNF-YB3. This transgenic wheat study showed that overexpression of TaNF-YB3

resulted in the elevated mRNA levels of a number of genes involved in

photosynthesis, such as the components of photosynthesis apparatus, and enzymes

involved in the chlorophyll biosynthesis pathway and light-driven ATP synthesis in

chloroplasts. The overexpression transgenic data together with positive expression

correlation data between TaNF-YB3 and photosynthesis genes provide experimental

evidence that TaNF-YB3 is one of the rate-limiting factors involved in the positive

regulation of a number of photosynthesis genes in wheat. Furthermore,

overexpression of TaNF-YB3 in transgenic wheat increased the leaf chlorophyll

content, photosynthesis rate and early growth rate.




Spring wheat (Triticum aestivum L. cv. Bobwhite) plants were grown in a

controlled-environment growth room in 1.5 litre pots under night/day conditions of

14/18°C, 90/60 % relative humidity and 16 h light with a photosynthetically active

radiation flux of 500 µmol m-2 s-1 at the plant canopy level as described previously

(Stephenson et al. 2010).

For the light and dark treatment experiment of 23-day-old wheat plants, these

were grown with the daily 16 h light/8 h dark cycle as above. For the purpose of

investigating gene expression difference in dark and light environments, 40 h dark

treatment was used, which enables us to observe gene response to dark well beyond

diurnal variation and with a reasonable length of time for degradation of much of the

transcript that was produced during the light period. The fully expanded new leaves

were collected from the plants after 6 h light exposure (i.e. 6 h after the light turned

on) or after 40 h dark-treatment. The daily 16 h light/8 h dark cycle for the plants

with 40 h dark treatment was interrupted after a 14 h light period and plants were

placed in another controlled-environment growth room at the start of the dark

treatment. Leaves from both light- and dark-treated plants were sampled at a similar

time point (within 30 minutes from start to end) to minimise the impact of diurnal

variation in expression.

For dark- and light-treatments of seedlings, wheat seeds were germinated in

wet tissue paper for 5 days at 20°C in either complete darkness or continuous white

fluorescent lights. At the time of sampling, the residual endosperm starch of the

grains was still visible.

5.4.2 CONSTRUCTION OF TANF-YB3 EXPRESSION CASSETTE

A 946-bp fragment, including the full-length coding region (639 bp) and the 5'-

and 3'-untranslated regions of TaNF-YB3, was amplified from wheat leaf cDNA (cv.

Babax) using polymerase chain reaction (PCR) and the following primers: sense, 5'-

ACAAGTGTCCTTCCTTCCAGTTA-3'; antisense, 5'-

TTCATGGAGAGCTTCCCAGGTATG-3'. The fragment was gel purified using the

QIAEX II Gel Extraction Kit (QIAGEN), cloned into the vector pGEM-T easy

(Promega) and sequenced (GenBank accession number HM777005). The 639-bp


region encoding TaNF-YB3 was amplified by PCR using the primer pair

TaNFYB3S1 (5'-

CGGGATCCTAAGCAACTTAATTAAACCATGCCGGAGTCGGACAACGACT-

3') and TaNFYB3A2 (5'-

GACTAGTAAGCTTACCCCTCTTTCCGTCCGAACCCCGACGAA-3') which also

served to introduce terminal restriction sites (italicised) to facilitate directional

cloning. The PCR-amplified fragment was inserted into a pUbiSXR-based

expression vector (Vickers et al. 2003), containing the promoter and first intron of

the maize Ubiquitin-1 (Ubi-1) gene and the terminator region from the rice RBCS

(Christensen and Quail 1996; Matsuoka et al. 1988). The 3-kb TaNF-YB3 expression

cassette was confirmed by nucleotide sequencing.

5.4.3 WHEAT TRANSFORMATION

Immature embryos from the wheat strain Bobwhite SH98 26 were transformed

by particle bombardment as described previously (Pellegrineschi et al. 2002). The

TaNF-YB3 expression cassette and selectable marker gene cassette [(rice

Act1:Bar:Nos 3') constructed from pAAI1GUSR and pDM803 (Patel et al. 2000)]

were amplified from expression plasmids constructed in the pSP72 vector by PCR

using the following primers SP72HA2 (5'-CCGAACGACCGAGCGCAGC-3’) and

SP72X5 (5'-AACTATGCGGCATCAGAGCAG-3’) anchored in the vector

sequence. The amplified gene cassettes were purified using the QIAquick PCR

Purification Kit (QIAGEN). The TaNF-YB3 expression cassette was co-bombarded

with the selectable marker gene cassette into the immature embryos. The herbicide

phosphinothricin was used for selection of transformed calli. Plantlets generated

through the wheat transformation process were grown in a controlled-environment

growth room as described above, except 16/20°C (night/day) growth temperatures

were used for all experiments involving transgenic plants.


Total RNA was isolated, purified and converted to cDNA as described

previously (Xue and Loveridge 2004). Transcript levels for the selected genes were

quantified by real-time PCR as described by Stephenson et al. (2010). Gene-specific

primer pairs for TaNF-YB3-coexpressed genes are listed in Supplementary Table 5.4.

In addition to the reference genes TaRPII36 and TaRP15, a phosphoglucomutase


gene (TaPGM2) was included as an internal control gene (Supplementary Table 5.4)

(Xue et al. 2006, 2008a).

5.4.5 IDENTIFICATION OF POTENTIAL TARGET GENES USING AFFYMETRIX GENECHIP® DATA ANALYSIS AND GENE ONTOLOGY ENRICHMENT ANALYSIS

Identification of potential NF-Y target genes using Affymetrix GeneChip®

data analysis and GO enrichment analyses was carried out as essentially described by

Stephenson et al. (2010). Affymetrix Wheat Genome Array expression datasets were

collected from EMBL-EBI ArrayExpress Browser (http://www.ebi.ac.uk/microarray-

as/ae, including those initially deposited at GEO at NBCI) (Parkinson et al. 2009).

The Affymetrix wheat genome array contains 61,127 probe sets representing 55,052

transcripts for all 42 chromosomes in the wheat genome. Eight Affymetrix datasets

(E-MEXP-1193, E-GEOD-9767, E-MEXP-971, E-GEOD-6227, E-MEXP-1523, E-

GEOD-6027, E-GEOD-4935, E-GEOD-5942) were collected for analysis (Crismani

et al. 2006; Jordan et al. 2007; Mott and Wang 2007; Qin et al. 2008; Wan et al.

2008; Xue et al. 2008b). The raw Affymetrix array data was normalised using a

robust multi-array average using a log scale measure of expression using the default

settings for the Bioconductor affy package within the R statistical programming

environment (http://www.r-project.org/) as described previously (Xue et al. 2008b).

The normalised expression values were converted back to non-log values for

correlation analysis. Pearson correlation coefficients (r) were calculated between the

mRNA levels of TaNF-YB3 and those of all other genes in each Affymetrix Wheat

Genome Array dataset. Enrichment analysis was performed using the AgriGO Gene

Ontology (GO) enrichment analysis tool (http://bioinfo.cau.edu.cn/agriGO/) (Du et

al. 2010). False discovery rate adjusted P-values of ≤ 1 × 10-10 were considered to

indicate highly enriched GO terms. Sequences representing probe sets significantly

correlated with the expression profiles of TaNF-YB3 were collected from the

Triticum aestivum Gene Index database (TaGI) (Release 12.0,


5.4.6 CHLOROPHYLL CONTENT MEASUREMENT

Wild-type and transgenic leaves were collected and immediately immersed in

liquid nitrogen. Samples were homogenised using a ball mill and 200 milligrams

(mg) of each sample was extracted with 80 % acetone. Leaf chlorophyll content was


determined by measurement of absorbance at 645 and 663 nm as per the method of

Yoshida et al. (1971).

5.4.7 PHOTOSYNTHETIC RATE MEASUREMENT

Photosynthetic rate was determined by gas exchange analysis, which was

performed on intact and fully expanded new leaves of 4-week-old plants using a LI-

6400 portable photosynthesis system (LI-6400, Li-Cor Inc., Lincoln NE, USA). The

leaf to be measured was placed in a 2 × 3 cm leaf chamber with a built-in red + blue

light–emitting diode light source (LI-COR 6400-02B) at the light setting of 500 µmol

photons m–2 s–1. Photosynthesis rate was measured as the net assimilation rate of CO2

by the leaf and was expressed as mol CO2 m-2 s-1. Plants were kept in the growth

room at a light level of 500 µmol photons m–2 s–1 during the gas exchange analysis.

5.5 RESULTS

5.5.1 MEMBERS OF THE TANF-YB SUBUNIT FAMILY ARE UPREGULATED BY LIGHT

To identify whether TaNF-YB subunit members are differentially expressed in

response to light their transcript levels were measured using quantitative RT-PCR in

both 5-day-old and 23-day-old wheat plants with light or dark treatment. Among the

11 TaNF-YB members (Stephenson et al. 2007), TaNF-YB5 expression was not

detectable in wheat leaves and seedling shoots. Four TaNF-YB genes (TaNF-YB3, 6,

7, & 9) were light-upregulated by more than 2-fold in the shoots of 5-day-old

seedlings (Figure 5.1a). TaNF-YB9 was light-upregulated by ~5-fold in the seedling

shoots, but was not expressed in the leaves of 23-day-old plants (Figure 5.1b). Three

TaNF-YB genes (TaNF-YB3, 7 & 8) were upregulated by more than 4-fold in the

leaves of 23-day-old wheat plants in response to light (Figure 5.1b). In particular, the

mRNA level of TaNF-YB3 in the light-treated leaves of 23-day-old plants was 17

times higher than that in the dark-treated leaves. However, only two TaNF-YB

members (TaNF-YB3 and TaNF-YB7) were upregulated by more than 2-fold by light

in both 5-day-old seedling shoots and 23-day-old wheat leaves.

5.5.2 GENES THAT ARE CORRELATED IN EXPRESSION WITH TANF-YB3 IN LARGE SCALE EXPRESSION PROFILING DATASETS ARE ENRICHED WITH THOSE INVOLVED IN PHOTOSYNTHESIS

To identify the potential target genes of NF-Y complexes containing light-

upregulated TaNF-YB subunit members, a genome-wide expression correlation


analysis was used to find transcripts with significantly correlated expression profiles

with light-upregulated TaNF-YB members. Several Affymetrix Wheat Genome

Array datasets were analysed for this purpose. Of the light-upregulated TaNF-YB

members, one (TaNF-YB3) had a perfectly matching probe set (Ta.2879.1.S1_at),

while the remaining did not have representative probe sets (Supplementary Table

5.5). Of the Affymetrix Wheat Genome Array datasets collected, four [E-GEOD-

6027 (developing anthers), E-MEXP-1523 (heat-stressed leaves), E-MEXP-971 (salt-

stressed shoots) and E-GEOD-6227 (rust-infected leaves)] were found to be suitable

for expression correlation analysis, as TaNF-YB3 hybridisation signals (expression

values) are in a reliable range (mean hybridisation signal values within a dataset

being over 300 in these four datasets) and vary by more than two-fold within each

dataset.


Figure 5.1. Changes in the mRNA levels of wheat NF-YB genes in the leaf and seedling shoot in response to dark or light-treatment. (a) In the shoots of 5-day-old seedlings. (b) In the leaves of 23-day-old plants. Transcript level is expressed relative to the dark-treatment. Values are means + SD of three biological samples. Each sample was analysed with triplicate PCR assays. Statistical significance of differences was analysed using the Students t-test and is indicated by triple asterisks (P ≤ 0.001), double asterisks (P ≤ 0.01) and a single asterisk (P ≤ 0.05). The sequences of these TaNF-YB genes were documented in Stephenson et al. (2007).

Transcripts were selected for further analysis if significantly correlated

expression was identified in a minimum of three separate datasets. Positive

relationships were selected by focusing on transcripts expressed higher than their

potential regulator (TaNF-YB3), based on the general assumption of signal

amplification from a transcription factor to its target genes. This analysis identified

0

5

10

15

20

25

TaN

F-Y

B1

TaN

F-Y

B2

TaN

F-Y

B3

TaN

F-Y

B4

TaN

F-Y

B6

TaN

F-Y

B7

TaN

F-Y

B8

TaN

F-Y

B9

TaN

F-Y

B10

TaN

F-Y

B11

Rel

ativ

e ex

pre

ssio

n l

evel

s

TaNF-YB expression levels in the leaf in response to light

Dark

Light

**

***

**

***

***

**

0

1

2

3

4

5

6

TaN

F-Y

B1

TaN

F-Y

B2

TaN

F-Y

B3

TaN

F-Y

B4

TaN

F-Y

B6

TaN

F-Y

B7

TaN

F-Y

B8

TaN

F-Y

B9

TaN

F-Y

B10

TaN

F-Y

B11

Rel

ativ

e ex

pre

ssio

n l

evel

s

TaNF-YB expression levels in the seedling shoot in response to light

Dark

Light

*** ** ***

***

**

*** *

A

B

a

b


449 probe sets that were significantly correlated in expression with TaNF-YB3 in at

least three datasets and had higher hybridisation signals than TaNF-YB3 on average

(data not shown).

To identify the potential biological roles of these TaNF-YB3-coexpressed

transcripts, a functional enrichment analysis tool for crop species was used to search

for enriched Gene Ontology (GO) terms. Among these TaNF-YB3-coexpressed

transcripts, 407 probe sets had GO annotation with 27 GO terms being highly

enriched (P-value < 1 × 10-10) (Table 5.1). The most enriched GO term of the

biological process ontology type was photosynthesis (GO:0015979, P-value = 1.9 ×

10-68, 68 probe sets) (Table 5.1). The most enriched GO terms of the cellular

component and molecular function ontology types were chloroplast (GO:0009507,

P-value = 2.5 × 10-71, 135 probe sets) and chlorophyll binding (GO:0016168, P-

value = 4.1 × 10-30, 21 probe sets), respectively (Table 5.1). A list of TaNF-YB3-

correlated photosynthesis genes is shown in Table 5.2, which includes genes

encoding the components of photosynthetic apparatus (e.g., light harvesting

chlorophyll a/b-binding proteins associated with photosystem I or II, photosystem I

subunits and oxygen-evolving enhancer proteins), enzymes involved in carbon

fixation through the Calvin cycle (e.g., RuBisCO, sedoheptulose-1,7-bisphosphatase

and fructose-1,6-bisphosphatase) and enzymes involved in the chlorophyll

biosynthetic pathway (e.g., glutamyl-tRNA reductase, chloroplast 1-deoxy-D-

xylulose-5-phosphate synthase and uroporphyrinogen decarboxylase). These data

indicate that the role of TaNF-YB3 is potentially associated with photosynthesis. The

organs used for generating these four datasets have high levels of TaNF-YB3

transcript based on Affymetrix array hybridisation signals and are all capable of

photosynthesis, including anthers (Clément et al. 1997).


Table 5.1 Enriched GO terms within TaNF-YB3-correlated probe sets. GO term enrichment analysis

was performed using the AgriGO Gene Ontology enrichment analysis tool

(http://bioinfo.cau.edu.cn/agriGO/). GO ID indicates the Gene Ontology Identifier. Ontology types are

the aspects of analysis: P = Biological Process, F = Molecular Function and C = Cellular Process.

Term is the description associated with each GO ID. No. of genes indicates the number of genes

within each probe set list with the associated term. A false discovery rate (FDR) adjusted P-value cut-

off of 1.0 × 10-10 has been used for this table.

GO ID Ontology type

Term Genes Adjusted P-value

GO:0015979 P photosynthesis 68 1.90E-68

GO:0019684 P photosynthesis, light reaction 39 7.60E-47

GO:0009765 P photosynthesis, light harvesting 27 1.80E-34

GO:0018298 P protein-chromophore linkage 20 3.00E-26

GO:0006091 P generation of precursor metabolites and energy 50 1.90E-19

GO:0019253 P reductive pentose-phosphate cycle 14 1.00E-15

GO:0019685 P photosynthesis, dark reaction 14 7.20E-15

GO:0016168 F chlorophyll binding 21 4.10E-30

GO:0009507 C chloroplast 135 2.50E-71

GO:0009579 C thylakoid 78 1.30E-70

GO:0034357 C photosynthetic membrane 69 2.80E-68

GO:0009521 C photosystem 45 1.10E-55

GO:0009522 C photosystem I 32 1.80E-47

GO:0009536 C plastid 223 5.60E-45

GO:0009534 C chloroplast thylakoid 45 1.20E-40

GO:0031976 C plastid thylakoid 45 3.30E-40

GO:0044434 C chloroplast part 58 3.30E-40

GO:0031984 C organelle subcompartment 45 1.40E-39

GO:0044435 C plastid part 58 6.10E-39

GO:0044436 C thylakoid part 45 1.00E-38

GO:0009523 C photosystem II 31 6.80E-38

GO:0042651 C thylakoid membrane 38 1.60E-34

GO:0055035 C plastid thylakoid membrane 36 1.40E-33

GO:0009535 C chloroplast thylakoid membrane 36 1.40E-33

GO:0031090 C organelle membrane 47 5.50E-16

GO:0044446 C intracellular organelle part 80 7.80E-12

GO:0044422 C organelle part 80 8.20E-12


5.5.3 TANF-YB3-COEXPRESSED GENES ARE UPREGULATED BY LIGHT IN THE LEAF AND SEEDLING SHOOTS AND THEIR MRNA LEVELS ARE POSITIVELY CORRELATED WITH TANF-YB3

To investigate whether TaNF-YB3-coexpressed transcripts identified from

Affymetrix Wheat Genome Array datasets are light-upregulated and are positively

correlated with TaNF-YB3 expression in the light- and dark-treated leaf and seedling

shoot samples, we have examined our previously generated expression data of a set

of 13 photosynthesis genes: ATP synthase B chain (TaATPa9), ATP synthase

subunit (TaATPaG), light harvesting Chlorophyll a/b-binding proteins (TaLhca2,

TaLhca4 and TaLhcb4), Fructose-1,6-bisphosphatase (TaFBPa5), Ferredoxin-

NADP(H) oxidoreductase (TaFNR), Glutamyl-tRNA reductase (TaGluTR), Oxygen-

evolving enhancer protein 1 (TaOEE), Plastocyanin (TaPC), Photosystem I reaction

center subunit K (TaPSIK), Photosystem I reaction center subunit N (TaPSIN) and

Thioredoxin M-type (TaTRXM). As reported previously, all of these genes are light-

upregulated in wheat leaves and seedling shoots (Stephenson et al., 2010). A further

analysis revealed that the mRNA levels of 10 of the 13 genes (TaATPa9, TaATPaG,

TaLhca2, TaLhca4, TaLhcb4, TaFBPa5, TaFNR, TaOEE, TaPSIK and TaPSIN)

were significantly correlated with that of TaNF-YB3 among the leaf and seedling

samples of plants with light or dark treatment (Table 5.3). The remaining three genes

showed significantly positive correlation in expression with TaNF-YB3 in the leaves

of 23-day-old plants with dark or light treatment. These positive correlation data

suggest that close coregulation between TaNF-YB3 and these photosynthesis genes

also occurs in the leaves of wheat plants in response to light.


Table 5.2 Photosynthesis-related transcripts correlated with the mRNA levels of TaNF-YB3 in

Affymetrix Wheat Genome Array datasets. Pearson correlation coefficients (r) were calculated for the

expression profiles of all probe sets compared to Ta.2879.1.S1_at (TaNF-YB3) in four Affymetrix

datasets: developing anthers (E-GEOD-6027); salt-stressed shoots (E-MEXP-971); heat-stressed

leaves (E-MEXP-1523); and rust-infected leaves (E-GEOD-6227). Affymetrix IDs are the unique

Affymetrix probe set identifiers. TaGI IDs are the Triticum aestivum Gene Index identifiers for

contigs most likely represented by each probe set. Statistical significance of each r value was

calculated using a t-distribution. Statistical significance of correlations is indicated by triple asterisks

(P ≤ 0.001), double asterisks (P ≤ 0.01) and a single asterisk (P ≤ 0.05)

Affymetrix ID TaGI ID Annotation Developing anthers

Heat-stessed leaf

Salt-stressed shoot

Rust-infected leaf

Ta.22831.1.S1_x_at TC388871 Photosystem I subunit O (PsaO)

0.97*** 0.43** 0.75*** 0.74***

Ta.29587.2.S1_x_at TC429086 Light harvesting chlorophyll a/b-binding protein associated with photosystem II (Lhcb) Lhcb1.4

0.66*** 0.58*** 0.56*** 0.91***

Ta.25600.1.S1_x_at TC386108 Lhcb6 0.8*** 0.64*** 0.92*** 0.81*** Ta.22984.2.S1_x_at TC369171 Lhcb1.5 0.84*** 0.81*** 0.15 0.81*** Ta.27751.2.S1_x_at TC370039 Lhcb2.2 0.95*** 0.56*** 0.37* 0.8*** Ta.27751.6.S1_at TC402022 Lhcb2.1 0.91*** 0.88*** 0.75*** 0.83*** Ta.27751.7.A1_x_at TC454951 Lhcb1.3 0.96*** 0.46** 0.78*** 0.73*** Ta.3795.1.S1_x_at TC372540 Lhcb1.5 0.81*** 0.7*** 0.27 0.81*** Ta.1130.1.S1_a_at TC452191 Lhcb3 0.95*** 0.55*** -0.53** 0.8*** Ta.1130.3.S1_x_at TC413836 Lhcb3 0.93*** 0.72*** 0.33* 0.78*** Ta.20639.1.S1_x_at TC378917 Light harvesting

chlorophyll a/b-binding protein associated with photosystem I (Lhca) Lhca4

0.73*** 0.78*** 0.84*** 0.62***

Ta.20639.2.A1_a_at TC372628 Lhca4 0.95*** 0.72*** 0.75*** 0.44** Ta.20639.3.S1_a_at TC382396 Lhca4 0.54** 0.84*** 0.87*** 0.46** Ta.20639.3.S1_x_at TC382396 Lhca4 0.54** 0.83*** 0.87*** 0.49** Ta.2402.3.S1_x_at TC375338 Lhca1 0.94*** 0.78*** 0.93*** 0.79*** Ta.28496.1.A1_at TC379848 Lhcb1.4 0.75*** 0.51** 0.74*** 0.83*** Ta.28496.1.A1_x_at TC379848 Lhcb1.4 0.76*** 0.51** 0.69*** 0.83*** Ta.30702.1.S1_x_at TC374577 Lhcb1.5 0.79*** 0.6*** 0.43** 0.8*** Ta.3249.2.S1_x_at CK215785 Lhcb1.4 0.91*** 0.82*** 0.62*** 0.74*** Ta.4346.1.A1_x_at TC371215 Lhcb1.5 0.75*** 0.7*** 0.85*** 0.84*** Ta.3366.1.S1_at TC404327 Chloroplast 1-deoxy-

D-xylulose-5-phosphate synthase

0.87*** 0.05 0.61*** 0.85***

Ta.12565.2.S1_at TC400992 Chloroplast-localized Ptr ToxA-binding protein1

0.76*** 0.54*** 0.91*** 0.41**

Ta.28806.1.S1_at TC370684 Ferredoxin-NADP(H) oxidoreductase

0.77*** -0.05 0.93*** 0.82***

Ta.23273.1.S1_at TC434552 Ferredoxin-thioredoxin reductase

-0.53** 0.59*** 0.78*** 0.76***

Ta.439.1.S1_at TC368647 Chloroplast Fructose-1,6-bisphosphatase

0.72*** 0.4* 0.92*** 0.69***



Affymetrix ID TaGI ID

Annotation Developing anthers

Heat-stessed leaf

Salt-stressed shoot

Rust-infected leaf

Ta.1364.1.S1_at TC379591

Geranylgeranyl hydrogenase 0.87*** 0.36* 0.81***

0.78***

Ta.3243.1.S1_at TC385481

Glutamyl-tRNA reductase 1 0.71*** 0.82***

0.82***

0.88***

Ta.3243.1.S1_x_at TC385481

Glutamyl-tRNA reductase 1 0.69*** 0.84***

0.83***

0.87***

Ta.30808.1.S1_s_at

CK211832

Chloroplast glyceraldehyde-3-phosphate dehydrogenase A

0.87*** 0.41**

0.92***

0.79***

Ta.1135.1.S1_at TC376922

Chloroplast glyceraldehyde-3-phosphate dehydrogenase B

0.88*** 0.18 0.93***

0.55***

Ta.20911.1.A1_at TC415515

Kinase binding protein 0.91*** 0.26 0.97***

0.85***

Ta.20911.2.A1_at TC415515

Kinase binding protein 0.83*** 0.38* 0.97***

0.84***

Ta.28697.3.S1_at TC371257

Lhca2 0.86*** 0.5** 0.92***

0.69***

Ta.30727.1.S1_at TC381159

Lhcb4 0.96*** 0.53***

0.82***

0.76***

Ta.881.1.S1_a_at CK213344

Lhca5 0.85*** 0.34* 0.95***

0.85***

Ta.881.2.S1_x_at TC374543

Lhca5 0.75*** 0.27 0.95***

0.87***

Ta.1395.1.S1_at TC388241

Magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase

0.89*** 0.65***

0.77***

0.73***

Ta.9574.1.S1_at TC375499

Mg-chelatase subunit XANTHA-F

0.91*** 0.3* 0.75***

0.85***

Ta.595.1.S1_at TC370409

Chloroplast omega-6 fatty acid desaturase

0.86*** -0.01 0.71***

0.89***


CA689372

Oxygen-evolving complex (Fragment)

-0.3 0.64***

0.91***

0.64***

Ta.841.1.S1_a_at BJ319092

Oxygen-evolving enhancer protein 1

0.82*** 0.68***

0.79***

0.5***

Ta.85.1.S1_at TC372246

Oxygen-evolving enhancer protein 2

0.87*** 0.58***

0.79***

0.52***

Ta.2307.1.S1_at TC386668

Chloroplast phosphoglycerate kinase

0.82*** 0.53***

0.91***

0.81***

Ta.23158.1.S1_at TC377328

Chloroplast phosphoribulokinase 0.87*** 0 0.86***

0.79***

Ta.24304.2.S1_a_at

TC456410

Photosystem I reaction centre subunit II

0.86*** 0.69***

0.78***

0.65***

Ta.3581.1.S1_x_at TC369833

Photosystem I reaction centre subunit III,

0.82*** 0.82***

0.9***

0.62***

Ta.3581.3.S1_x_at TC421201

Photosystem I reaction centre subunit III,

0.84*** 0.83***

0.9***

0.73***

Ta.1969.1.S1_a_at TC375307

Photosystem I reaction centre subunit IV

0.98*** 0.38* 0.65***

0.78***

Ta.27761.1.S1_x_at

TC388041

Photosystem I reaction centre subunit psaK

0.96*** 0.68***

0.82***

0.78***

Ta.27761.2.S1_x_at

TC412122


0.75*** 0.69***

0.72***

0.8***

Ta.27761.3.S1_x_at

TC388041


0.9*** 0.72***

0.82***

0.77***

Ta.27751.3.S1_x_at

TC382472

Photosystem I reaction centre subunit XI

0.76*** 0.64***

0.74***

0.67***

Ta.27751.3.S1_at TC373665

Photosystem I reaction centre subunit XI

0.69*** 0.73***

0.83***

0.65***



Affymetrix ID TaGI ID Annotation Developing anthers

Heat-stessed leaf

Salt-stressed shoot

Rust-infected leaf

Ta.28363.3.S1_x_at TC418745 Photosystem I reaction centre subunit N (PSI-N)

0.94*** 0.72*** 0.95*** 0.73***

Ta.1161.1.S1_at TC375393 Photosystem II subunit PsbS

0.86*** 0.22 0.81*** 0.85***

Ta.8027.1.S1_at TC389636 Chloroplast plastid-lipid-associated protein 3

0.66*** 0.52** 0.94*** 0.7***

Ta.8027.1.S1_x_at TC389636 Chloroplast plastid-lipid-associated protein 3

0.69*** 0.45** 0.93*** 0.71***

Ta.22648.1.S1_a_at TC398802 Oxygen evolving enhancer 3 (PsbQ)

0.83*** -0.19 0.95*** 0.82***

TaAffx.7419.1.A1_x_at CK216646 Ribose-5-phosphate isomerase

0.52** 0.44** 0.93*** 0.85***

Ta.2752.2.S1_x_at TC370099 Ribulose bisphosphate carboxylase small chain (rbcS)

0.82*** 0.25 0.93*** 0.52***

Ta.2752.3.S1_x_at TC370099 rbcS 0.8*** 0.24 0.93*** 0.54*** TaAffx.449.1.A1_at CA722056 rbcS 0.53** 0.63*** 0.92*** 0.78*** TaAffx.108219.1.S1_at CA690622 rbcS 0.72*** 0.62*** 0.95*** 0.5*** Ta.1988.1.S1_x_at TC387438 Sedoheptulose-

1,7-bisphosphatase

0.76*** 0.52** 0.95*** 0.75***

Ta.1988.2.S1_x_at TC373708 Sedoheptulose-1,7-bisphosphatase

0.9*** 0.4* 0.97*** 0.78***

Ta.1988.3.S1_x_at TC395470 Sedoheptulose-1,7-bisphosphatase

0.87*** 0.46** 0.95*** 0.81***

Ta.636.1.S1_s_at TC384854 Thylakoid membrane phosphoprotein 14 kDa

0.74*** 0.08 0.97*** 0.83***

Ta.12190.1.A1_at TC381309 Thylakoid membrane phosphoprotein 14kDa

0.94*** 0.69*** 0.97*** 0.89***

Ta.23411.1.S1_at TC376508 Chloroplast transketolase

0.87*** 0.18 0.79*** 0.81***

Ta.4315.1.S1_at TC392505 Chloroplast Triosephosphate isomerase

0.7*** 0.05 0.79*** 0.81***

Ta.27646.1.S1_at TC454548 Lhca3 0.8*** 0.77*** 0.81*** 0.69*** Ta.27646.1.S1_x_at TC432666 Lhca3 0.84*** 0.77*** 0.68*** 0.69*** Ta.28648.1.S1_s_at TC419769 Uroporphyrinogen

decarboxylase 0.96*** 0.52** 0.41* 0.9***


Table 5.3 Expression correlations of photosynthesis genes with TaNF-YB3 in wheat leaves and

seedling shoots with dark or light treatment. Gene ID represents identifiers based on annotation of

similar sequences from the model organisms Arabidopsis and rice. TaGI represents the Triticum

aestivum Gene Index identifiers. r values represent Pearson correlation coefficients between the

mRNA levels of TaNF-YB3 and its co-regulated genes. Statistical significance of each r value was

calculated using a t-distribution. Statistical significance of correlations is indicated by triple asterisks

(P ≤ 0.001), double asterisks (P ≤ 0.01) and a single asterisk (P ≤ 0.05)

Gene ID TaGI Correlation coefficient (r)

Leaf Seedling TaATPa9 TC416524 0.96** 0.93** TaATPaG TC372375 0.95** 0.93** TaLhca4 TC378917 0.97** 0.97** TaFBPase TC368647 0.94** 0.96** TaFNR TC401602 0.94** 0.95** TaGluTR TC385481 0.95** 0.28 TaLhcb4 TC381159 0.97** 0.91*TaLhca2 TC371257 0.94** 0.93** TaOEE TC380359 0.91* 0.91* TaPC CA598047 0.95** 0.78TaPSIK TC388041 0.97** 0.94** TaPSIN TC385047 0.97** 0.96**

TaTRXM TC447076 0.98*** 0.47

5.5.4 OVEREXPRESSION OF TANF-YB3 UPREGULATES PHOTOSYNTHESIS GENES IN TRITICUM AESTIVUM

To investigate whether light-upregulated TaNF-YB genes have a role in the

regulation of photosynthesis genes, we produced transgenic wheat lines

constitutively overexpressing TaNF-YB3 as a representative of these TaNF-YB

genes. Quantitative RT-PCR was used to determine the relative transcript levels of a

number of TaNF-YB3-co-regulated photosynthesis genes in TaNF-YB3-

overexpressing transgenic wheat plants. Transgenic wheat plants were generated by

transforming wheat (cv. Bobwhite) with a TaNF-YB3 expression construct (UbiNF-

YB3) driven by the maize Ubi-1 promoter. Three transgenic lines were selected for

molecular analysis and the presence of the transgene UbiNF-YB3 was verified by

PCR using UbiNF-YB3-specific primers (Figure 5.2a). The relative transcript levels

of TaNF-YB3 in transgenic lines was determined by quantitative RT-PCR and were

found to be 3-19 times higher in these three transgenic lines than in Bobwhite control

plants (Figure 5.2b). The differences in the TaNF-YB3 transcript levels observed

between the TaNF-YB3-overexpressing lines and Bobwhite were much higher than


those that were found among samples in each of the four Affymetrix Wheat Genome

Array datasets used for the expression correlation analyse. Therefore, these TaNF-

YB3-overexpressing lines were used for analysis of potential TaNF-YB3 target

genes.

Figure 5.2. Overexpression of TaNF-YB3 in transgenic wheat lines carrying the UbiNF-YB3 transgene. (a) The PCR amplification of the UbiNF-YB3 transgene in transgenic lines (at the T2 stage): UbiNF-YB3-38 (the lane labelled as 38), UbiNF-YB3-46 (the lane labelled as 46) and UbiNF-YB3-89 (the lane labelled as 89). The UbiNF-YB3 DNA fragment was amplified from genomic DNA by PCR using UbiNF-YB3-specific primers. The specificity of the UbiNF-YB3 PCR product was verified using Bobwhite (BW) as negative control, where no transgene product was amplified. M indicates lanes containing the Promega 1kb+ DNA ladder. (b) Expression levels of TaNF-YB3 in Bobwhite (BW) and T2 transgenic lines, determined by quantitative RT-PCR using real-time PCR primers that amplify both endogenous and transgene TaNF-YB3 transcripts. Expression levels are expressed relative to Bobwhite. Values are means + SD of three biological samples. Each sample was analysed with triplicate PCR assays. Statistical significance of differences was analysed using the Students t-test and is indicated by triple asterisks (P ≤ 0.001) and double asterisks (P ≤ 0.01).

b

Control

***

**

***

Rel

ativ

e ex

pre

ssio

n l

evel

BW UbiNF-YB3-38

UbiNF-YB3-46

UbiNF-YB3-89

M BW 38 46 89 M

200

300

400

500650850

1000

a


The transcript levels of 11 photosynthesis genes [TaLhca2, TaLhca4, TaLhcb4,

TaPSIN, TaPSIK, thylakoid ascorbate peroxidase (tAPX), chloroplast ferredoxin

(TaPetF), TaFBPase, sedoheptulose-1,7-bisphosphatase (TaSBPase), TaATPaG and

TaGluTR] were analysed. All of these photosynthesis genes appeared to have

increased expression levels in the transgenic lines, compared to Bobwhite control

(Figure 5.3a). TaLhca4 transcript levels were significantly higher in the leaf from all

three transgenic lines than Bobwhite (Figure 5.3a). TaLhcb4 transcript levels were

significantly higher in two lines. In the highest TaNF-YB3 overexpressing line

(UbiNF-YB3-38), the expression levels of four photosynthesis genes (TaLhca4,

TaLhca2, TaLhcb4 & TaATPaG) were significantly upregulated (Figure 5.3a).

Comparison between the mean transcript levels of all transgenic lines with Bobwhite

controls showed that overexpression of TaNF-YB3 in the transgenic wheat resulted in

significant increases in the mRNA levels of four photosynthesis apparatus genes

(TaLhca4, TaLhcb4, TaPSIN, TaPSIK), one gene involved in the chlorophyll

synthetic pathway (TaGluTR) and another gene (TaATPaG) encoding chloroplast

ATP synthase subunit (Figure 5.3b).

5.5.5 OVEREXPRESSION OF TANF-YB3 RESULTED IN INCREASED LEAF CHLOROPHYLL CONTENT, PHOTOSYNTHESIS AND EARLY GROWTH RATE IN TRITICUM AESTIVUM

To further investigate the biological function of TaNF-YB3, two transgenic

lines (UbiNF-YB3-38 and UbiNF-YB3-46) were selected for phenotypic analysis. A

striking phenotype of these transgenic lines was the visibly greener leaves of the

TaNF-YB3-overexpressing lines than those of the wild-type control (Bobwhite).

Therefore, the leaf chlorophyll content was measured. The total chlorophyll,

chlorophyll a and chlorophyll b contents in the leaves of 4-week-old wheat plants

were significantly increased in the transgenic lines compared to Bobwhite (Figure

5.4a-c), which appears to coincide with the increased expression level of TaGluTR,

encoding a known rate-limiting enzyme in the chlorophyll synthetic pathway

(Tanaka and Tanaka 2006).

To examine whether the increased expression of photosynthetic genes and leaf

chlorophyll content has an effect on photosynthesis, the photosynthesis rates were

also measured in the leaves of plants from these transgenic lines in comparison with

Bobwhite. As shown in Figure 5.4d, the leaf photosynthesis rates per unit of leaf area

were significantly higher in the transgenic lines than Bobwhite. An increase in the


photosynthesis rate appears to be accompanied by an increased growth rate. Four-

week-old TaNF-YB3 overexpressing lines had a significant increase in plant height

and an approximately 30 % increase in shoot fresh weight and dry weight compared

to Bobwhite (Figure 5.5a-c).

Figure 5.3. Expression levels of photosynthesis genes in Bobwhite controls and TaNF-YB3-overexpressing transgenic wheat lines. (a) Expression levels of photosynthesis genes in the leaves of individual T2 transgenic lines. (b) Mean expression levels of photosynthesis-related genes in the leaves of three transgenic lines. Values are means + SD of three biological samples (i.e. three separate plants). All quantitative RT-PCR assays were done with three technical replicates. Statistical significance of differences was analysed using the Students t-test and is indicated by double asterisks (P ≤ 0.01) and a single asterisk (P ≤ 0.05). Accession identifiers of these genes are listed in Supplementary Table 5.4.

0.5

1.0

1.5

2.0

2.5

Ta

Ca

b

Ta

PS

IN

Ta

LH

CI

tAP

X

Ta

Pe

tF

Ta

LH

CII

Ta

FB

Pa

se

Ta

SB

Pa

se

Ta

PS

IK

Ta

Glu

TR

Ta

AT

Pa

G

Photosynthesis genes

Re

lati

ve

ex

pre

ss

ion

le

ve

ls Control

UbiNF-YB

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

4.5T

aC

ab

Ta

PS

IN

Ta

LH

CI

tAP

X

Ta

Pe

tF

Ta

LH

CII

Ta

FB

Pa

se

Ta

SB

Pa

se

Ta

PS

IK

Ta

Glu

TR

Ta

AT

Pa

GRe

lati

ve

ex

pre

ss

ion

le

ve

ls Control

UbiNF-YB3-38

UbiNF-YB3-46

UbiNF-YB3-89

*

**

**

*

*

***

** **

*

a

b

**

TaL

hca4

TaL

hca4

TaL

hca2

TaL

hca2

TaL

hcb4

TaL

hcb4


Figure 5.4. The increased leaf chlorophyll content and photosynthetic rate in T2 TaNF-YB3 overexpressing transgenic wheat lines. (a) Total leaf chlorophyll content. (b) Leaf chlorophyll a content. (c) Leaf chlorophyll b content. (d) Leaf photosynthetic rate per unit of leaf area. Plants at four weeks old were used for analysis. All values are the mean + SD of four biological samples. Controls are Bobwhite. Statistical significance of differences was analysed using the Students t-test and is indicated by double asterisks (P ≤ 0.01) or a single asterisk (P ≤ 0.05). FW, fresh weight; BW, Bobwhite.

1.25

1.35

1.45

1.55

1.65

BW UbiNF-YB-38 UbiNF-YB3-46

Ch

loro

ph

yll c

on

ten

t (m

g g

-1F

W)

0.8

0.9

1.0

1.1

1.2

1.3


Ch

loro

ph

yll a

co

nte

nt

(mg

g-1

FW

)

0.30

0.35

0.40

0.45


Ch

loro

ph

yll b

co

nte

nt

(mg

g-1

FW

)

0

4

8

12

16

20

BW UbiNF-YB3-38 UbiNF-YB3-46

Ph

oto

syn

thet

ic r

ate

(m

ol C

O2

m-2

s-1 )

** **

**

**

* *


Figure 5.5. The increased early growth rate in T2 TaNF-YB3 overexpressing transgenic wheat lines. (a) Plant height. (b) Fresh weight of shoots per plant. (c) Dry weight of shoots per plant. Plants at four weeks old were used for analysis. All values are the mean + SD of six biological samples. Controls are Bobwhite (BW). Statistical significance of differences was analysed using the Students t-test and is indicated by double asterisks (P ≤ 0.01) or a single asterisk (P ≤ 0.05).

400

415

430

445

460


Pla

nt h

eig

ht (

mm

)

*

**

2.0

2.3

2.5

2.8

3.0


Fre

sh w

eig

ht (

g)

*

**

0.25

0.30

0.35

0.40

0.45


Dry

wei

gh

t (g

)

** **

a

b

c

** **


5.6 DISCUSSION

This study identified two TaNF-YB members (TaNF-YB3 and TaNF-YB7) that

were light-upregulated by more than 2-fold in both the leaves and seedling shoots of

wheat. TaNF-YB8 was also markedly light-upregulated in the leaf, but light-

upregulation in the seeding shoots was less pronounced. The protein sequences of

TaNF-YB3, TaNF-YB7 and TaNF-YB8 are highly homologous and cluster together

in a neighbour-joining tree (Stephenson et al. 2007). These three genes have similar

organ mRNA distribution profiles with predominant expression in the leaf, followed

by the other green photosynthetic organs (young spike and developing stem)

(Stephenson et al. 2007). In particular, the mRNA levels of these three TaNF-YB

genes in the leaf are about 20-fold higher than those in the root (a non-photosynthetic

organ), indicating that their role is predominantly associated with photosynthetic

organs. With the presence of a TaNF-YB3 probe set in the Affymetrix Wheat

Genome Array and the availability of several Affymetrix Wheat Genome Array

datasets we performed a genome-wide gene expression correlation analysis to

identify TaNF-YB3-coexpressed genes. This analysis revealed that TaNF-YB3-

coexpressed genes were highly enriched with photosynthesis genes. Expression

analysis of a selected set of TaNF-YB3-coexpressed photosynthesis genes in wheat

leaves and seedling shoots showed that these genes were also upregulated by light

and were positively correlated in expression with TaNF-YB3 in response to light.

These data suggest a potential role of TaNF-YB3 in the positive regulation of

photosynthesis genes.

NF-Y transcription factor binds to the CCAAT-box, which is known to be one

of the most common promoter elements in eukaryotes (Mantovani 1998, 1999; Testa

et al. 2005; Siefers et al. 2009), suggesting that NF-Y is capable of regulating a large

number of genes. Although experimental evidence on the binding of plant NF-Y

transcription factor to the promoter elements of photosynthesis genes is limited, a

NF-Y binding CCAAT-box has been functionally identified in the promoter of the

spinach photosynthetic gene AtpC (Kusnetsov et al. 1999). Bioinformatic analysis

has revealed the presence of the CCAAT-box elements in the promoters of several

wheat photosynthetic genes (Stephenson et al. 2010). This transgenic study showed

that overexpression of TaNF-YB3 in wheat resulted in significant increases in the

expression levels of several photosynthesis genes that encode the components of the


photosynthetic apparatus (TaLhca4, TaLhcb4, TaPSIN and TaPSIK), the subunit of

chloroplast ATP synthase (TaATPaG) and glutamyl-tRNA reductase (TaGluTR), an

enzyme involved in the chlorophyll biosynthetic pathway. An increase in the

expression of genes encoding enzymes (TaSBPase and TaFBPase) involved in the

Calvin cycle was also observed, although it was not statistically significant. In

particular, an increase in the TaGluTR transcript level in TaNF-YB3-overexpressing

lines was accompanied by an elevated level of chlorophyll in the leaves.

Chlorophylls are essential molecules in photosynthetic organisms as they are

responsible for harvesting solar energy and are necessary for charge separation and

electron transport within the photosystem reaction centers (Tanaka and Tanaka

2006). In photosynthetic eukaryotes, chlorophyll synthesis starts with the precursor

5-aminolevulinic acid (ALA), the availability of which is a primary controller of

chlorophyll biosynthesis (Ilag et al. 1994). ALA is synthesised from glutamate by

glutamyl-tRNA synthetase (GluRS), glutamyl-tRNA reductase (GluTR) and

glutamate-1-semialdehyde aminotransferase (GSA-AT) (Mochizuki et al. 2010).

ALA synthesis is the rate-limiting step of the chlorophyll biosynthesis pathway in

higher plants (Tanaka and Tanaka 2006). ALA synthesis is controlled at the GluTR

reaction and is modulated at both transcriptional and post-translational levels

(Goslings et al. 2004; Tanaka and Tanaka 2006; Peter and Grimm 2009; Mochizuki

et al. 2010). For the transcriptional control GluTR mRNA levels have been shown to

be directly correlated with ALA levels and chlorophyll biosynthesis in higher plants

(Tanaka and Tanaka 2006), although this positive association is not observed in the

unicellular green alga Chlamydomonas reinhardtii (Nogaj et al. 2005). An increase

in the leaf chlorophyll content observed in the TaNF-YB3-overexpressing lines with

an increased level of TaGluTR transcript provides another line of evidence for the

transcriptional regulation of GluTR being part of the regulatory mechanism in

modulating chlorophyll synthesis in higher plants.

These functional analysis data obtained from the overexpression transgenic

wheat study provide supporting evidence for the involvement of TaNF-YB3 in the

regulation of photosynthesis genes speculated on the basis of various expression

data. The most significant finding of this study is that the enhanced expression levels

of these photosynthesis genes in TaNF-YB3-overexpressing transgenic wheat leads to

an increase in leaf chlorophyll content and photosynthesis rate. The transgenic results


together with positive expression correlation data obtained from this study suggest

that TaNF-YB3 is one of the rate-limiting factors involved in the positive regulation

of photosynthesis genes. Over-production of TaNF-YB3 in transgenic wheat is likely

to enhance the formation of the TaNF-YB3-associated NF-Y heterotrimer, based on

the principle of stoichiometry. However, photosynthesis genes are likely to be

regulated by multiple transcription factors, not just by the action of NF-Y and

general transcriptional machinery. NF-Y in plants is likely to serve as a general

promoter organizer, helps the binding of neighbouring factors and attracts

coactivators as observed in mammalian and yeast systems (Testa et al. 2005).

Therefore, further increase in the expression levels of these photosynthetic genes

would require enhancement of other regulators. This limitation was observed in this

study. The high TaNF-YB3 expression line (UbiNF-YB3-38) did not lead to further

increase in the expression levels of the photosynthesis genes, compared to the low

expression line (UbiNF-YB3-46).

Involvement of NF-YB members in the regulation of some photosynthesis

genes has also been shown in rice by suppression of OsHAP3A-C genes (Miyoshi et

al. 2003). Suppression of OsHAP3A, OsHAP3B and OsHAP3C in transgenic rice led

to degenerate chloroplasts and a significant reduction in the expression of CAB

(Miyoshi et al. 2003). However, whether these three rice NF-YB genes are

upregulated by light and have an influence on the expression of genes encoding

enzymes such as GluTR involved in chlorophyll biosynthesis and other components

of photosynthetic apparatus (e.g. photosystem I reaction center subunits) have not

been reported. OsHAP3A, OsHAP3B and OsHAP3C appear to be expressed

uniformly in all organs examined, including the non-photosynthetic organ root in rice

(Miyoshi et al. 2003). Comparing the OsHAP3A-C amino acid sequences with those

from wheat shows that they do not cluster phylogenetically with TaNF-YB3; rather

OsHAP3A clusters with TaNF-YB4 and TaNF-YB10, OsHAP3B with TaNF-YB2

and OsHAP3C with TaNF-YB11 (Stephenson et al. 2007). In Arabidopsis, AtNF-

YB9 has been implicated in the blue light mediated regulation of Lhcb, as the blue

light induction of Lhcb expression in etiolated seedlings is lost in an AtNF-YB9

mutant line generated through T-DNA insertion (Warpeha et al. 2007). AtNF-YB9

(also known as LEC1) is expressed mainly within seeds during early and late

embryogenesis and its expression is not detectable in the leaf under light conditions


(Lotan et al. 1998; Gusmaroli et al. 2001). Unlike AtNF-YB9, the mRNA levels of

TaNF-YB3 in wheat grains (endosperm and embryo) are very low, being at least 20

times lower than that in the leaf (Stephenson et al. 2007). AtNF-YB9 protein

sequence clusters phylogenetically with TaNF-YB1 and TaNF-YB9 and not with

TaNF-YB3 (Stephenson et al. 2007). The above expression profile and phylogenetic

comparisons suggest that TaNF-YB3 is a novel member of the NF-YB subunit

family with a role in the light-mediated regulation of photosynthetic genes in plants.

The increased growth rate of TaNF-YB3-overexpressing lines observed at the

early vegetative stage is a noteworthy phenotype. The increased growth rate in

TaNF-YB3-overexpressing lines is likely attributed to the enhanced photosynthesis

rate observed in these transgenic lines. The fast early growth rate has also been

observed in transgenic tobacco plants overproducing sedoheptulose-1,7-

bisphosphatase, which leads to the enhanced photosynthesis (Lefebvre et al. 2005).

An increase in the expression of the subunit of chloroplast ATP synthase observed

in TaNF-YB3-overexpressing lines may also contribute to the energy required for the

increased carbon assimilation. Chloroplast ATP synthase comprises five subunits (,

, , and ) and catalyses the light-driven synthesis of ATP coupled with an

electrochemical gradient of photons established by the photoelectron transfer chain.

The subunit is considered to be important in the regulation of ATP synthase activity

(Inohara et al. 1991). However, the possibility of TaNF-YB3 that is also involved in

the regulation of other growth-related genes cannot be excluded. The fast early

growth rate can be considered as an early vigour trait, which is a physiological

attribute that can enhance water-use efficiency and yield of wheat crops grown in

Mediterranean-type climates via rapid canopy closure (Richards 2000, Soltani and

Galeshi 2002; Mir-Mahmoodi and Soleimanzadeh 2009). Rapid canopy closure of

young wheat plants reduces water loss due to evaporation from soil and hence

enhances water-use efficiency (Richards 2000).

Photosynthesis is a multistep physiological process, encompassing harvesting

solar energy, transferring excitation energy, energy conversion, electron transfer

from water to NADP+, ATP generation and a series of enzymatic reactions for

assimilation of carbon dioxide (Tanaka and Makino 2009). Therefore, photosynthesis

involves a large number of genes in higher plants. Photosynthetic capacity is

considered to be one of the main limiting factors for further improvement of the yield


potential of wheat (Reynolds et al. 2009) and other grain crops (Zhu et al. 2010).

Results from this study provide substantial evidence that a light-upregulated member

from the NF-YB family (TaNF-YB3) is involved in the positive regulation of

photosynthesis genes in wheat. The expression level of TaNF-YB3 in wheat appears

to be one of the rate-limiting factors in the expression of a number of photosynthesis

genes. These results provide experimental evidence on possible genetic manipulation

for simultaneous enhancement of several photosynthetic components to achieve the

improved photosynthetic capacity of crop species in the future.


5.7 REFERENCES

Bae G, Choi G (2008) Decoding of light-signals by plant phytochromes and their interacting proteins. Annu Rev Plant Biol 59: 281-311

Cai X, Ballif J, Endo S, Davis E, Liang M, Chen D, DeWald D, Kreps J, Zhu T, Wu Y (2007) A putative CCAAT-binding transcription factor is a regulator of flowering timing in Arabidopsis. Plant Physiol 145: 98-105

Casal JJ, Yanovsky MJ (2005) Regulation of gene expression by light. Int J Dev Biol 49: 501-511

Chen M, Chory J, Fankhauser C (2004) Light-signal transduction in higher plants. Annu Rev Genet 38: 87-117

Chen NZ, Zhang XQ, Wei PC, Chen QJ, Ren F, Chen J, Wang XC (2007) AtHAP3b plays a crucial role in the regulation of flowering time in Arabidopsis during osmotic stress. J Biochem Mol Biol 40:1083-1089

Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res 5: 213-218

Christie JM (2007) Phototropin blue-light receptors. Annu Rev Plant Biol 58: 21-45

Clément C, Mischler P, Burrus M, Audran J-C (1997) Characteristics of the photosynthetic apparatus and CO2-fixation in the flower bud of Lilium. II. Anther. Int J Plant Sci 158: 801-810

Crismani W, Baumann U, Sutton T, Shirley N, Webster T, Spangenberg G, Langridge P, Able JA (2006) Microarray expression analysis of meiosis and microsporogenesis in hexaploid bread wheat. BMC Genomics 7: 267

Devlin PF, Christie JM, Terry MJ (2007) Many hands make light work. J Exp Bot 58: 3071-3077

Distelfeld A, Li C, Dubcovsky J (2009) Regulation of flowering in temperate cereals. Curr Opi Plant Boil 12: 178-184

Du Z, Zhou X, Ling Y, Zhang Z, Su Z (2010) AgriGO: a GO analysis toolkit for the agricultural community. Nucl Acids Res 38: Suppl_2:W64-W70

Goslings D, Meskauskiene R, Kim C, Lee KP, Nater M, Apel M (2004) Concurrent interactions of heme and FLU with Glu tRNA reductase (HEMA1), the target of metabolic feedback inhibition of tetrapyrrole biosynthesis, in dark- and light-grown Arabidopsis plants. Plant J 40:957-967

Gusmaroli G, Tonelli C, Mantovani R (2001) Regulation of the CCAAT-Binding NF-Y subunits in Arabidopsis thaliana. Gene 264: 173-185

Gusmaroli G, Tonelli C, Mantovani R (2002) Regulation of novel members of the Arabidopsis thaliana CCAAT-binding nuclear factor Y subunits. Gene 283: 41-48

Ilag LL, Kumar AM, Soll D (1994) Light regulation of chlorophyll biosynthesis at the level of 5-aminolevulinate formation in Arabidopsis. Plant Cell 6: 265-275


Inohara N, Iwamoto A, Moriyama Y, Shimomura S, Maeda M, Futai M (1991). Two genes, atpC1 and atpC2, for the subunit of Arabidopsis thaliana chloroplast ATP synthase. J Biol Chem 266: 7333-7338

Jiao Y, Ma L, Strickland E, Deng XW (2005) Conservation and divergence of light-regulated genome expression patterns during seedling development in rice and Arabidopsis. Plant Cell 17: 3239-3256

Jordan MC, Somers DJ, Banks TW (2007) Identifying regions of the wheat genome controlling seed development by mapping expression quantitative trait loci. Plant Biotech J 5: 442-453

Kumimoto RW, Adam L, Hymus GJ, Repetti PP, Reuber TL, Marion CM, Hempel FD, Ratcliffe OJ (2008) The Nuclear Factor Y subunits NF-YB2 and NF-YB3 play additive roles in the promotion of flowering by inductive long-day photoperiods in Arabidopsis. Planta 228: 709-723

Kumimoto RW, Zhang Y, Siefers N, Holt BF 3rd (2010) NF–YC3, NF–YC4 and NF–YC9 are required for CONSTANS-mediated, photoperiod-dependent flowering in Arabidopsis thaliana. Plant J 63: 379-391

Kusnetsov V, Landsberger M, Meurer J, Oelmuller R (1999) The assembly of the CAAT-box binding complex at a photosynthesis gene promoter is regulated by light, cytokinin, and the stage of the plastids. J Biol Chem 274: 36009-36014

Lefebvre S, Lawson T, Fryer M, Zakhleniuk OV, Lloyd JC, Raines CA (2005) Increased sedoheptulose-1,7-bisphosphatase activity in transgenic tobacco plants stimulates photosynthesis and growth from an early stage in development. Plant Physiol 138: 451–460

Li QH, Yang HQ (2007) Cryptochrome signaling in plants. Photochem Photobiol 83: 94-101

Li WX, Oono Y, Zhu J, Zhu J, He XJ, Wu JM. Iida K, Lu XY, Cui X, Jin H, Zhu JK (2008) The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance. Plant Cell 20: 2238–2251

Liu J-X, Howell SH (2010) bZIP28 and NF-Y transcription factors are activated by ER stress and assemble into a transcriptional complex to regulate stress response genes in Arabidopsis. Plant Cell 22: 782-796

Lotan T, Ohto M, Yee KM, West MA, Lo R, Kwong RW, Yamagishi K, Fischer RL, Goldberg RB, Harada JJ (1998) Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 93: 1195-1205

Mantovani R (1998) A survey of 178 NF-Y binding CCAAT-boxes. Nucl Acids Res 26: 1135-1143

Mantovani R (1999) The molecular biology of the CCAAT-binding factor NF-Y. Gene 239: 15-27

Matsuoka M, Kano-Murakami Y, Tanaka Y, Ozeki Y, Yamamoto N (1988) Classification and nucleotide sequence of cDNA encoding the small subunit of


ribulose-1,5-bisphosphate carboxylase from rice. Plant Cell Physiol 29: 1015-1022

Mir-Mahmoodi T, Soleimanzadeh H (2009) Relationship between rapid canopy closure and grain yield in wheat. Asian J Plant Sci 8: 250-253

Miyoshi K, Ito Y, Serizawa A, Kurata N (2003) OsHAP3 genes regulate chloroplast biogenesis in rice. Plant J 36: 532-540

Mochizuki M, Tanaka R, Grimm B, Masuda T, Moulin M, Smith AG, Tanaka A, Terry MJ (2010) The cell biology of tetrapyrroles: a life and death struggle. Trends Plant Sci doi:10.1016/j.tplants.2010.05.012

Mott IW, Wang RRC (2007) Comparative transcriptome analysis of salt-tolerant wheat germplasm lines using wheat genome arrays. Plant Sci 173: 327-339

Nogaj LA, Srivastava A, van Lis R, Beale SI (2005) Cellular levels of glutamyl-tRNA reductase and glutamate-1-semialdehyde aminotransferase do not control chlorophyll synthesis in Chlamydomonas reinhardtii. Plant Physiol 139: 389–396

Parkinson H, Kapushesky M, Kolesnikov N, Rustici G, Shojatalab M, Abeygunawardena N, Berube H, Dylag M, Emam I, Farne A, Holloway E, Lukk M, Malone J, Mani R, Pilicheva E, Rayner TF, Rezwan F, Sharma A, Williams E, Bradley XZ, Adamusiak T, Brandizi M, Burdett T, Coulson R, Krestyaninova M, Kurnosov P, Maguire E, Neogi SG, Rocca-Serra P, Sansone SA, Sklyar N, Zhao M, Sarkans U, Brazma A (2009) ArrayExpress update--from an archive of functional genomics experiments to the atlas of gene expression. Nucl Acids Res 37: D868-872

Patel M, Johnson JS, Brettell RIS, Jacobsen J, Xue GP (2000) Transgenic barley expressing a fungal xylanase gene in the endosperm of the developing grains. Mol Breeding 6: 113-124

Pellegrineschi A, Noguera LM, Skovmand B, Brito RM, Velazquez L, Salgado MM, Hernandez R, Warburton M, Hoisington D (2002) Identification of highly transformable wheat genotypes for mass production of fertile transgenic plants. Genome 45: 421-430

Peter E, Grimm B (2009) GUN4 is required for posttranslational control of plant tetrapyrrole biosynthesis. Mol Plant 2: 1198-1210

Qin D, Wu H, Peng H, Yao Y, Ni Z, Li Z, Zhou C, Sun Q (2008) Heat stress-responsive transcriptome analysis in heat susceptible and tolerant wheat (Triticum aestivum L.) by using Wheat Genome Array. BMC Genomics 9: 432

Reynolds M, Foulkes MJ, Slafer GA, Berry P, Parry MAJ, Snape JW, Angus WJ (2009) Raising yield potential in wheat. J Exp Bot 60:1899-1918

Richards RA (2000) Selectable traits to increase crop photosynthesis and yield of grain crops. J Exp Bot 51: 447-458

Siefers N, Dang KK, Kumimoto RW, Bynum WE, Tayrose G, Holt .BF 3rd (2009) Tissue-specific expression patterns of Arabidopsis NF-Y transcription factors


suggest potential for extensive combinatorial complexity. Plant Physiol 149: 625-641

Soltani A, Galeshi S (2002) Importance of rapid canopy closure for wheat production in a temperate sub-humid environment: experimentation and simulation. Field Crop Res 77: 17-30

Stephenson TJ, McIntyre CL, Collet C, Xue GP (2007) Genome-wide identification and expression analysis of the NF-Y family of transcription factors in Triticum aestivum. Plant Mol Biol 65: 77-92

Stephenson TJ, McIntyre CL, Collet C, Xue GP (2010) TaNF-YC11, one of the light-upregulated NF-YC members in Triticum aestivum, is co-regulated with photosynthesis-related genes. Funct Integr Genomics 10: 265-276

Tanaka A, Tanaka R (2006) Chlorophyll metabolism. Curr Opin Plant Biol 9: 248-255

Tanaka A, Makino A (2009) Photosynthetic research in plant science. Plant Cell Physiol 50: 681-683

Testa A, Donati G, Yan P, Romani F, Huang TH, Vigano MA, Mantovani R (2005) Chromatin immunoprecipitation (ChIP) on chip experiments uncover a widespread distribution of NF-Y binding CCAAT sites outside of core promoters. J Biol Chem 280: 13606–13615

Thirumurugan T, Ito Y, Kubo T, Serizawa A, Kurata N (2008) Identification, characterization and interaction of HAP family genes in rice. Mol Genet Genomics 279: 279-289

Vickers CE, Xue GP, Gresshoff PM (2003) A synthetic xylanase as reporter in plants. Plant Cell Rep 22: 135-140

Wan Y, Poole RL, Huttly AK, Toscano-Underwood C, Feeney K, Welham S, Gooding MJ, Mills C, Edwards KJ, Shewry PR, Mitchell RA (2008) Transcriptome analysis of grain development in hexaploid wheat. BMC Genomics 9: 121

Warpeha KM, Upadhyay S, Yeh J, Adamiak J, Hawkins SI, Lapik YR, Anderson MB, Kaufman LS (2007) The GCR1, GPA1, PRN1, NF-Y signal chain mediates both blue light and abscisic acid responses in Arabidopsis. Plant Physiol 143: 1590-1600

Wenkel S, Turck F, Singer K, Gissot L, Le Gourrierec J, Samach A, Coupland G (2006) CONSTANS and the CCAAT box binding complex share a functionally important domain and interact to regulate flowering of Arabidopsis. Plant Cell 18: 2971-2984

Xue GP, Bower NI, McIntyre CL, Riding GA, Kazan K, Shorter R (2006) TaNAC69 from the NAC superfamily of transcription factors is up-regulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences. Func Plant Biol 33: 43-57


Xue GP, Loveridge CW (2004) HvDRF1 is involved in abscisic acid-mediated gene regulation in barley and produces two forms of AP2 transcriptional activators, interacting preferably with a CT-rich element. Plant J 37: 326-339

Xue GP, McIntyre CL, Glassop D, Shorter R (2008a) Use of expression analysis to dissect alterations in carbohydrate metabolism in wheat leaves during drought stress. Plant Mol Biol 67: 197-214

Xue GP, McIntyre CL, Jenkins CL, Glassop D, van Herwaarden AF, Shorter R (2008b) Molecular dissection of variation in carbohydrate metabolism related to water-soluble carbohydrate accumulation in stems of wheat. Plant Physiol 146: 441-454

Yamamoto A, Kagaya Y, Toyoshima R, Kagaya M, Takeda S, Hattori T (2009) Arabidopsis NF-YB subunits LEC1 and LEC1-LIKE activate transcription by interacting with seed-specific ABRE-binding factors. Plant J 58: 843-856

Yoshida S, Forno D, Cock J (1971) Laboratory manual for physiological studies of rice. 2 edn. International Rice Research Institute, Los Banos, Philippines

Zhu XG, Long SP, Ort DR (2010) Improving photosynthetic efficiency for greater yield. Annu Rev Plant Biol 61: 235-261


5.8 SUPPLEMENTARY MATERIAL


Supplementary Table 5.4 Real-Time PCR primers of Triticum aestivum NF-YB3-correlated genes

and reference genes. All gene-specific primers used for quantitative RT-PCR analysis are listed with

assigned identifiers as well as reference gene primers. (A) Photosynthesis-related genes from

Stephenson et al. 2010; (B) Photosynthesis-related gene primers; (C) House-keeping gene-specific

primers from Xue et al. (2006) and Xue et al. (2008).

Gene TaGI / GenBank

Forward Primer

Sequence (5'-3') Reverse Primer

Sequence (5'-3')

A

TaLhca4 TC378917 TaLhca4Fb

TGGCCGACCCATGGCACAACA TaLhca4Rb

CCCGGTCGGTGAAATCGACGGATTTAT

TaPSIN TC385047 TaPSINFa CGTCTTCTGGAAATGGTGAAGCTGGT

TaPSINFa GTACACGCGGTGCGCTGACA

TaLhca2 TC371257 TaLHCIFb

TCCTCAACACACCGTCGTGG TaLHCIRb

GGTCGGTGTTGACGCAGCC

TaLhcb4 TC381159 TaLhcb4Fa

CGTTCACGCTCACCACGCTGAT TaLhcb4Ra

CGAGTCCCAGCGGGTCGAAGTA

TaPSIK TC388041 TaPSIKFb GGCTCCTTCGGCCACATCTTG TaPSIKRb

ATGCGAATGCAGAACAGCTATGGA

TaGluTR TC385481 TaGluTRFa

CTGAGGTCGTACGCCGACAGGA TaGluTRRa

CAGTGGGCCGTGAAGGAGCTTG

TaATPaG TC372375 TaATPaGFa

TCAACAGCCAGATCCTGCGTGC TaATPaGRa

GCATTGTCTGTGGCGCTGCTC

B

tAPX AY513261

tAPXF GGTCGACATGCAAGATGACCAGT tAPXR AGTCAGAAACATCCCATGGTTTCCAG

TaPetF X75089 petFF TGCATGCACGGACATTGCCA petFR AGACGCCTCAGCCATCAGGA

TaFBPase

X53957 cFBPaseF ACAAGAACGAGGGATACACAGGCT

cFBPaseR TTCCGCATTACAAGAAAAGGGCTACA

TaSBPase X65540 cSBPaseF CAGACCGGCTTGCGTACGTCT cSBPaseR GCCATGCACAAACGCACGACTG

C

TaRPII36f

TC370362 TaRPII36fF3

ACGTATTAACCAAGAACTCATGGAGAC

TaRPII36fR4

TCAAATACTTTTGTAGGGCTGCTCTC

TaRP15 TC373661 TaRP15F5

GCACACGTGCTTTGCAGATAAG TaRP15R6

GCCCTCAAGCTCAACCATAACT

TaPGM2 TC380500 TaPGM2F3

GCTTTCGAAGATCCAGGAGTACA TaPGM2R4

CTATCGAACAGGAGGCCAGAAC


Supplementary Table 5.5 TaNF-YB members in Affymetrix GeneChip® Wheat Genome Array.

TaNF-YB member nucleotide sequences (Stephenson et al., 2007) were queried against the

Affymetrix wheat probe set database using Probe Match

(https://www.affymetrix.com/analysis/netaffx/probematch/probe_match.affx?netaffx=netaffx4_annot)

. Each Affymetrix probe set consists of 11 probes

Name Probe ID Probe matches

TaNF-YB1 Ta.24093.1.S1_at 11 TaNF-YB9 Ta.24093.1.S1_at 0 TaNF-YB2 Ta.4075.1.S1_at 11

Ta.4075.1.S1_s_at 11 TaNF-YB3* Ta.2879.1.S1_at 11 TaNF-YB7* Ta.2879.1.S1_at 3 TaNF-YB8* Ta.2879.1.S1_at 1 TaNF-YB4 Ta.3325.1.S1_at 9

TaNF-YB10 Ta.3325.1.S1_at 11 TaNF-YB5 TaAffx.27013.1.S1_at 2

TaNF-YB6* TaAffx.27013.1.S1_at 1 TaNF-YB11 Ta.20537.1.S1_x_at 11

Ta.20537.1.S1_at 11

* Light upregulated in both the leaves of 23-day-old plants and the shoots of 5-day-

old seedling

Supplementary references Stephenson, T. J., C. L. McIntyre, et al. (2010). "TaNF-YC11, one of the light-

upregulated NF-YC members in Triticum aestivum, is co-regulated with photosynthesis-related genes." Functional and Integrative Genomics

10(2): 265-76.

Xue, G., N. I. Bower, et al. (2006). "TaNAC69 from the NAC superfamily of transcription factors is upregulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences." Functional Plant Biology 33(1): 43-57.

Xue, G. P., C. L. McIntyre, et al. (2008). "Use of expression analysis to dissect alterations in carbohydrate metabolism in wheat leaves during drought stress." Plant Molecular Biology 67(3): 197-214.

184 Chapter 6: TaNF-YB3 is involved in the regulation of flowering time genes in Triticum aestivum


Chapter 6: TaNF-YB3 is involved in the regulation of flowering time genes in Triticum aestivum


Stephenson, T. J., McIntyre, C., Collet, C. and Xue, G. P. (2010). TaNF-YB3

is involved in the regulation of flowering time genes in Triticum aestivum. Prepared.











6.2 ABSTRACT

In wheat the floral integrator [FLOWERING LOCUS T (TaFT)] regulates the

floral meristem identity gene [VERNALISATION GENE 1 (TaVRN1)]. In

Arabidopsis, some NF-Y subunit members can interact with CONSTANS and

CONSTANS-Like proteins to activate the expression of FT. In this study the role of

a wheat NF-YB member (TaNF-YB3) in the regulation of FT was investigated using

a transgenic approach. Transgenic wheat plants with increased constitutive

expression of TaNF-YB3 have enhanced expression levels of TaFT as well as its

downstream genes, TaFT2 and TaVRN1. The transgenic wheat plants flowered 2-

days earlier than the wild-type (Bobwhite). Large-scale gene expression correlation

analysis using several Affymetrix Wheat Genome Array datasets showed that the

transcript levels of three CCT domain-containing genes encoding CONSTANS and

CONSTANS-Like proteins (TaCO5, TaCOLa & TaCOLb) were significantly

correlated with that of TaNF-YB3. These results imply that TaNF-YB3 is involved in

the positive regulation of flowering genes and provides fine tuning of flowering time

in wheat.

Chapter 6: 187 TaNF-YB3 is involved in the regulation of flowering time genes in Triticum aestivum

6.3 INTRODUCTION

The floral transition in wheat is controlled by seasonal cues, such day-length

and temperature (Davidson et al. 1985). Although sensitivity to photoperiod differs

among genotypes, many wheat varieties flower in response to increasing day-length

(Manupeerapan et al. 1992). Additionally, winter wheat varieties tend to have a

vernalisation requirement (Gott 1957). Photoreceptors are the sensors of day-length;

capable of detecting light duration, quality and intensity (Christie 2007; Li and Yang

2007; Bae and Choi 2008). Activated photoreceptors trigger effectors such as

transcription factors (TFs), which in turn activate the expression of their target genes

(Chen et al. 2004). For example, under long day (LD) conditions photoreceptors

contribute to the initiation of flowering by the stabilisation of the CONSTANS (CO)

transcription factor (TF) protein in Arabidopsis thaliana (At; Valverde et al. 2004).

The Nuclear factor Y (NF-Y) TF is a heterotrimeric complex comprised of the

three subunits NF-YA, NF-YB and NF-YC (Romier et al. 2003). A unique feature of

the plant NF-Y family is that each subunit is encoded by gene families, which is in

contrast to the situation in mammals and yeast where only one to two genes encode

each subunit (Mantovani 1999). Some studies indicate NF-Y subunit members have

roles in the regulation of flowering time through interactions with CCT [CO,

CONSTANS-LIKE (COL), TOC1] domain-containing proteins and MADS (MCM1,

AGAMOUS, DEFICIENS, SRF) box-binding proteins (Masiero et al. 2002;

Kumimoto et al. 2008; Wenkel et al. 2006). Several Arabidopsis members of the NF-

YB and NF-YC protein families (e.g., AtLEC1, AtL1L, AtHAP3a-c & AtHAP5a-c)

can bind to both AtCO and AtCOL15 in a yeast-two-hybrid system. Interactions of

AtHAP3a and AtHAP5a with AtCO have been demonstrated both in vitro and in

planta (Wenkel et al. 2006). Overexpression of AtHAP3b in Arabidopsis promotes

early flowering and increases the expression levels of the flowering time genes

FLOWERING LOCUS T (FT) and SUPPRESSOR OF OVEREXPRESSION OF

CONSTANS1 (SOC1; Cai et al. 2007). Furthermore, Arabidopsis mutants, hap3b-1

and hap3b-2 have reduced expression of FT and exhibit delayed flowering under

conditions of LD and osmotic-stress (Chen et al. 2007). In tomato, NF-YC family

members (e.g., THAP5a) interact with COL proteins (e.g., TCOL1) through their

CCT domains in a yeast-two-hybrid system (Ben-Naim et al. 2006). Furthermore, the

yeast HAP2/HAP3/THAP5a complex is capable of recruiting TCOL1 to the HAP-


binding sites (CCAAT-box) in the yeast HEM1 and CYC1 genes (Ben-Naim et al.

2006). In Arabidopsis, NF-YB2 and NF-YB3 have been shown to play additive roles

in the promotion of flowering under LD conditions (Kumimoto et al. 2008).

Recently, we have identified members from the NF-Y TF family that are light-

upregulated in the wheat leaves and seedling shoots (Stephenson et al. 2010; Chapter

5). The wheat NF-Y family (TaNF-Y) contains at least 35 subunit members, 10 NF-

YA, 11 NF-YB and 14 NF-YC with similar sizes in Arabidopsis and rice

(Stephenson et al. 2007; Thirumurugan et al. 2008; Siefers et al. 2009). Two NF-YB

(TaNF-YB3 & 7) and five NF-YC (TaNF-YC5, 8, 9, 11 & 12) subunit members are

light-upregulated in 23-day-old wheat leaves and 5-day-old wheat seedling shoots

(Stephenson et al. 2010; Chapter 5). The light-upregulation of some wheat NF-Y

members indicates that they are likely involved in light-mediated transcriptional

regulation. For example, transgenic wheat plants constitutively overexpressing

TaNF-YB3 have the enhanced transcript levels of photosynthesis genes, increased

chlorophyll content and fast early growth (Chapter 5).

In this chapter, the potential role of TaNF-YB3 in the regulation of flowering

time genes was investigated using the transgenic wheat lines generated in Chapter 5.

The constitutive overexpression of TaNF-YB3 in transgenic wheat led to a significant

increase in the transcript levels of flowering time genes and earlier flowering

compared to wild-type plants. TaNF-YB3 expression was co-regulated with genes

encoding CO and COL proteins involved in the regulation of flowering time in

wheat.



Spring wheat (Triticum aestivum L. cv. Bobwhite) plants were grown in a

controlled-environment growth room in 1.5 L pots under night/day conditions of

16/20°C, 90/60 % relative humidity and 16 hours light with a photosynthetically

active radiation flux of 500 µmol m-2s-1 at the plant canopy level as described

previously (Stephenson et al. 2010).


Total RNA was isolated, purified and cDNA synthesised as described

previously (Xue et al. 2004). Transcript levels for six flowering time genes


[FLOWERING LOCUS T (TaFT), FLOWERING LOCUS T 2 (TaFT2),

FLOWERING LOCUS D-LIKE 2 (TaFDL2), FLOWERING LOCUS D-LIKE 6

(TaFDL6), FLOWERING LOCUS D-LIKE 13 (TaFDL13) & VERNALISATION

GENE 1 (TaVRN1)] were quantified by qRT-PCR as described by Stephenson et al.

(2010). Flowering time gene-specific primers were designed according to Yan et al.

(2006) and Li and Dubcovsky (2008). House-keeping gene-specific primers were

designed according to Xue et al. (2006, 2008).

6.4.3 COEXPRESSION ANALYSIS USING AFFYMETRIX WHEAT GENOME ARRAY DATASETS

Four datasets (E-GEOD-6027, E-MEXP-1193, E-MEXP-971 and E-MEXP-

1523) were collected from EMBL-EBI ArrayExpress Browser

(http://www.ebi.ac.uk/microarray-as/ae) (Parkinson et al. 2009). The raw Affymetrix

array data was analysed with the Bioconductor affy package within the R statistical

programming environment (http://www.r-project.org/) (Gautier et al. 2004) as

described previously (Xue et al. 2008). A robust multi-array average (RMA) was

used on a log scale measure of expression (Irizarry et al. 2003). The normalised

expression values were subsequently converted to non-log values for analysis.

Pearson correlation coefficients (r) were calculated to look for correlations between

the mRNA levels of TaNF-YB3 (Ta.2879.1.S1_at) and mRNA levels of all other

transcripts in each of the Affymetrix Wheat Genome Array datasets. Significance

tests of the correlation coefficients were calculated using a t-distribution. Sequences

of genes with expression profiles that correlate with that of TaNF-YB3 were collected

from the Triticum aestivum Gene Indices (TaGI) (Release 12.0,


6.5 RESULTS

6.5.1 CONSTITUTIVE OVEREXPRESSION OF TANF-YB3 PROMOTED EARLY FLOWERING IN TRITICUM AESTIVUM

To examine whether TaNF-YB3 is involved in the regulation of flowering

time, anthesis dates were compared between TaNF-YB3 overexpressing transgenic

lines (generated in Chapter 5) and the wild-type control (Bobwhite). As the flowering

time of wheat is influenced by many environmental factors such as the nitrogen level

and moisture status of soil, transgenic and control plants were grown together in 20

cm × 18.5 cm (diameter × height) pots, with each of the three pots containing two


transgenic plants and two wild-type plants. Of the three transgenic lines with high-

level expression of TaNF-YB3, two lines (UbiNF-YB3-46 and UbiNF-YB3-89)

flowered significantly earlier than the Bobwhite control plants by around 2-days

(Figure 6.1).

Figure 6.1 Comparison in anthesis date between TaNF-YB3 overexpressing transgenic wheat lines at the T2 stage and non-transgenic wild-type control. Anthesis dates are expressed as days after planting (DAP). All values are the mean + SD from six biological replicates (six plants). Controls are the cultivar Bobwhite. Statistical significance of differences was analysed using the Student’s t-test and is

indicated by double asterisks (P 0.01) or a single asterisk (P 0.05).

6.5.2 OVEREXPRESSION OF TANF-YB3 INCREASES FLOWERING GENE TRANSCRIPT LEVELS IN TRITICUM AESTIVUM

To investigate the molecular basis of the earlier flowering of TaNF-YB3-

overexpressing transgenic lines, the transcript levels of flowering time genes were

analysed in the leaves of the six-week-old UbiNF-YB3-46 and UbiNF-YB3-89 lines

using qRT-PCR analysis. The transcript levels of six flowering genes (TaFT, TaFT2,

TaFDL2, TaFDL6, TaFDL13 & TaVRN1) were measured. All six flowering genes

were upregulated in the leaves of the UbiNF-YB3-46 and UbiNF-YB3-89 lines

(Figure 6.2). The upregulation of TaFT was the most pronounced among six

flowering time genes analysed, with 7- and 14-fold increases in expression levels in

UbiNF-YB3-46 and UbiNF-YB3-89 respectively compared to the wild-type

expression levels (Figure 6.2). The expression levels of TaFT2 and TaVRN1 in the

UbiNF-YB3-46 and UbiNF-YB3-89 lines were also markedly higher than the wild-

type Bobwhite (Figure 6.2). A slight, but significant, increase in the transcript levels

of three wheat FD-like (TaFDL) genes was also observed in TaNF-YB3

Ant

hesi

s (D

AP

)

0

10

20

30

40

50

60

70

UbiNF-YB3-46 UbiNF-YB3-89

Control

UbiNF-YB

* **


overexpressing lines (Figure 6.2). FDL proteins are bZIP TFs, which are required for

FT to promote flowering (Abe et al. 2005).

Figure 6.2 Expression levels of flowering time genes in transgenic wheat lines and wild-type controls. Values are means + SD of three biological samples (i.e. three separate plants). All assays were done with three technical replicates. Statistical significance of differences was analysed using the Students t-test and is indicated by triple asterisk (P ≤ 0.001), double asterisks (P ≤ 0.01) and a single asterisk (P ≤ 0.05).

6.5.3 TANF-YB3 IS SIGNIFICANTLY CO-EXPRESSED WITH GENES ENCODING CONSTANS AND CONSTANS-LIKE PROTEINS

As genes encoding subunits of many protein complexes are co-ordinately

expressed both spatially and temporally (Walhout et al. 2002; Liu et al. 2008; van

Waveren and Moraes 2008), a large-scale expression correlation analysis was

conducted to identify whether transcripts encoding CO and COL proteins are

significantly co-regulated with TaNF-YB3 using four publically available Affymetrix

wheat genome array datasets (E-GEOD-6027, E-MEXP-1193, E-MEXP-971S and E-

MEXP-1523).

The transcript levels of three CCT domain-containing proteins (TaCO5,

TaCOLa, and TaCOLb) were significantly correlated with TaNF-YB3 transcript

levels in at least three of the four datasets (Table 6.1, Figure 6.3). The amino acid

sequence alignment of the CCT domains of these TaNF-YB3-co-regulated genes is

shown in (Figure 6.4).

02468

1012141618

TaFT TaFT2 TaFDL2 TaFDL6 TaFDL13 TaVRN1

Control

UbiNF-YB3-46

UbiNF-YB3-89

Rel

ativ

e ex

pres

sion

leve

ls***

***

**

**

***

**

**

*

**

***


Table 6.1 Expression correlation between TaNF-YB3 and CO and COL genes in Affymetrix Wheat

Genome Array datasets. Pearson correlation coefficients were calculated between the expression of

TaNF-YB3 and the CO and COL genes using four separate Affymetrix datasets. Annotation is based

on homology searches. TC is the tentative consensus accession identifier from the DFCI Gene Index

Release 12.0. Probe ID is the Affymetrix Wheat Genome Array probe set identifier. TaNF-YB3 probe

set is Ta.2879.1.S1_at. All probe sets were perfect matches with the representative TC sequences

analysed. Statistical significance of each r value was calculated using a t-distribution. Statistical

significance of correlations is indicated by triple asterisks (P 0.001) and a single asterisk (P

0.05).

Gene Annotation TC Probe ID Developing anthers

Developing grain

Salt-stressed shoot

Heat-stessed leaf

TaCO5 CONSTANS protein 5 TC453772 Ta.1672.3.S1_x_at -0.43* 0.34* 0.65*** 0.94***

TaCOLa CONSTANS-like protein TC419097 Ta.1249.1.S1_at 0.74*** 0.35* 0.94*** 0.14

TaCOLb CONSTANS-like protein TC415739 Ta.12387.2.S1_x_at 0.94*** 0.42* 0.98*** 0.45*

Figure 6.3 Expression correlation chart between TaNF-YB3 and CO or COL genes (TaCO5, TaCOLa, and TaCOLb) in the Affymetrix Wheat Genome Array data sets. Axis values are the normalised hybridisation signals.

Figure 6.4. Multiple sequence alignment of the CCT domain regions from TaNF-YB3 co-regulated CO and COL proteins. Dashes indicate gaps in the sequences. Fully conserved amino acids are coloured red. Partially conserved residues are coloured blue. Below the alignment is a sequence logo (http://weblogo.berkeley.edu).

0

500

1000

1500

2000

2500

3000

3500

4000

4500

0 500 1000 1500 2000 2500 3000 3500

TaCO5

TaCOLa

TaCOLb

CC

T d

omai

n ex

pres

sion

val

ues

TaNF-YB3 expression values


6.6 DISCUSSION

In this study, the light-upregulated TaNF-YB3 subunit was found to be

involved in the regulation of flowering time in wheat. Constitutive overexpression of

TaNF-YB3 in transgenic wheat promoted early flowering and markedly upregulated

the expression levels of TaFT and TaFT2 in the leaves. TaFT is known to integrate

the photoperiodic and vernalisation signals and to interact with TaFDL2 and TaFDL6

in the regulation of TaVRN1 in wheat (Li and Dubcovsky 2008). TaVRN1 is a

member of the APETALA1 (AP1) subfamily of the MADS-box transcription factor

family and is involved in the transition from vegetative to reproductive phase in

wheat (Yan et al. 2003). We observed that TaVRN1 expression was increased in the

transgenic lines overexpressing TaNF-YB3. Involvement of NF-YB members in the

regulation of FT has been reported in Arabidopsis previously. Overexpression of two

NF-YB members (AtNF-YB2 and AtNF-YB3) significantly accelerates the onset of

flowering and increases expression of the floral integrator FT in Arabidopsis

(Kuminto et al. 2008). This study showed a similar role for TaNF-YB3 in wheat in

the regulation of flowering time genes.

The involvement of NF-Y in flowering time regulation appears to be via

interactions with CO and COL proteins (Ben-Naim et al. 2006; Wenkel et al. 2006;

Tiwari et al. 2010). At least three Arabidopsis NF-YB members (AtHAP3a,

AtHAP3b and AtLEC1) are currently known to be capable of interacting with

CONSTANS (Wenkel et al. 2006). Furthermore, the C-terminal CCT domain regions

of the Arabidopsis AtCO protein and the tomato TCOL1, TCOL2 and TCOL3

proteins are capable of interacting with the two tomato NF-YC members THAP5a

and THAP5c in a yeast-two-hybrid system (Ben-Naim et al. 2006). The full-length

TCOL and AtCO can also interact with THAP5a and THAP5c, but not when the

CCT domains are deleted (Ben-Naim 2006). The CCT domain is required for the

regulation of FT, by recruitment to its target cis-element in the FT promoter (Tiwari

et al. 2010).

To investigate whether TaNF-YB3 is co-regulated with genes encoding CO

and COL proteins, a large-scale gene expression correlation analysis was carried out.

Genes encoding subunits of many protein complexes are co-ordinately expressed

both spatially and temporally (Walhout et al. 2002; Liu et al. 2008; van Waveren and

Moraes 2008). The expression levels of three genes encoding CO and COL proteins


correlated significantly with that of TaNF-YB3 in four Affymetrix datasets. Whether

any of these three CCT domain proteins interact with NF-Y complexes containing

the TaNF-YB3 subunit member remains to be determined.

Results from this study provide experimental evidence that a light-upregulated

member from the NF-YB family (TaNF-YB3) is involved in the regulation of

flowering time in wheat. The level of expression of TaNF-YB3 appears to be one of

the rate-limiting factors in the transcript levels of flowering genes in wheat.

Therefore, changing the level of TaNF-YB3 can potentially be useful for the fine-

tuning of flowering time in wheat. The promotion of earlier flowering is often

beneficial to wheat productivity in drought-prone environments (Woodruff and

Tonks 1983).


6.7 REFERENCES

Abe, M., Kobayashi, Y., Yamamoto, S., Daimon, Y., Yamaguchi, A., Ikeda, Y., Ichinoki, H., Notaguchi, M., Goto, K. and Araki, T. (2005). FD, a bZIP protein mediating signals from the floral pathway integrator FT at the shoot apex. Science 309(5737): 1052-1056.

Bae, G. and Choi, G. (2008). Decoding of light-signals by plant phytochromes and their interacting proteins. Annual Review of Plant Biology 59: 281-311.

Ben-Naim, O., Eshed, R., Parnis, A., Teper-Bamnolker, P., Shalit, A., Coupland, G., Samach, A. and Lifschitz, E. (2006). The CCAAT binding factor can mediate interactions between constans-like proteins and DNA. Plant Journal 46(3): 462-476.


Chen, M., Chory, J. and Fankhauser, C. (2004). Light-signal transduction in higher plants. Annual Review of Genetics 38: 87-117.


Christie, J. M. (2007). Phototropin blue-light receptors. Annual Review of Plant Biology 58: 21-45.

Davidson, J., Christian, K., Jones, D. and Bremner, P. (1985). Responses of wheat to vernalization and photoperiod. Australian Journal of Agricultural Research 36(3): 347-359.

Gautier, L., Cope, L., Bolstad, B. M. and Irizarry, R. A. (2004). Affy--analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 20(3): 307-315.

Gott, M. B. (1957). Vernalization of green plants of a winter wheat. Nature 180(4588): 714-715.

Irizarry, R. A., Bolstad, B. M., Collin, F., Cope, L. M., Hobbs, B. and Speed, T. P. (2003). Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Research 31(4): e15-.



Li, Q. H. and Yang, H. Q. (2007). Cryptochrome signaling in plants. Photochemistry and Photobiology 83(1): 94-101.


Liu, C. T., Yuan, S. and Li, K. C. (2009). Patterns of coexpression for protein complexes by size in Saccharomyces cerevisiae. Nucleic Acids Research 37(2): 526-532.

Manupeerapan, T., Davidson, J., Pearson, C. and Christian, K. (1992). Differences in flowering responses of wheat to temperature and photoperiod. Australian Journal of Agricultural Research 43(3): 575-584.

Masiero, S., Imbriano, C., Ravasio, F., Favaro, R., Pelucchi, N., Gorla, M. S., Mantovani, R., Colombo, L. and Kater, M. M. (2002). Ternary complex formation between MADS-box transcription factors and the histone fold protein NF-YB. Journal of Biological Chemistry 277(29): 26429-26435.

Parkinson, H., Kapushesky, M., Kolesnikov, N., Rustici, G., Shojatalab, M., Abeygunawardena, N., Berube, H., Dylag, M., Emam, I., Farne, A., Holloway, E., Lukk, M., Malone, J., Mani, R., Pilicheva, E., Rayner, T. F., Rezwan, F., Sharma, A., Williams, E., Bradley, X. Z., Adamusiak, T., Brandizi, M., Burdett, T., Coulson, R., Krestyaninova, M., Kurnosov, P., Maguire, E., Neogi, S. G., Rocca-Serra, P., Sansone, S. A., Sklyar, N., Zhao, M., Sarkans, U. and Brazma, A. (2009). ArrayExpress update--from an archive of functional genomics experiments to the atlas of gene expression. Nucleic Acids Research 37(Database issue): D868-872.

Romier, C., Cocchiarella, F., Mantovani, R. and Moras, D. (2003). The NF-YB/NF-YC structure gives insight into DNA binding and transcription regulation by CCAAT factor NF-Y. Journal of Biological Chemistry 278(2): 1336-1345.


Stephenson, T., McIntyre, C., Collet, C. and Xue, G.-P. (2007). Genome-wide identification and expression analysis of the NF-Y family of transcription factors in Triticum aestivum. Plant Molecular Biology 65(1): 77-92.

Stephenson, T. J., McIntyre, C. L., Collet, C. and Xue, G. P. (2010). TaNF-YC11, one of the light-upregulated NF-YC members in Triticum aestivum, is co-regulated with photosynthesis-related genes. Functional and Integrative Genomics 10(2): 265-276.


Tiwari, S. B., Shen, Y., Chang, H.-C., Hou, Y., Harris, A., Ma, S. F., McPartland, M., Hymus, G. J., Adam, L., Marion, C., Belachew, A., Repetti, P. P., Reuber, T. L. and Ratcliffe, O. J. (2010). The flowering time regulator CONSTANS is recruited to the FLOWERING LOCUS T promoter via a unique cis-element. New Phytologist 187(1): 57-66.

Valverde, F., Mouradov, A., Soppe, W., Ravenscroft, D., Samach, A. and Coupland, G. (2004). Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303(5660): 1003-1006.


van Waveren, C. and Moraes, C. T. (2008). Transcriptional coexpression and co-regulation of genes coding for components of the oxidative phosphorylation system. BMC Genomics 9: 18.

Walhout, A. J., Reboul, J., Shtanko, O., Bertin, N., Vaglio, P., Ge, H., Lee, H., Doucette-Stamm, L., Gunsalus, K. C., Schetter, A. J., Morton, D. G., Kemphues, K. J., Reinke, V., Kim, S. K., Piano, F. and Vidal, M. (2002). Integrating interactome, phenome, and transcriptome mapping data for the C. elegans germline. Current Biology 12(22): 1952-1958.

Waters, M. T. and Langdale, J. A. (2009). The making of a chloroplast. EMBO Journal 28(19): 2861-2873.

Wenkel, S., Turck, F., Singer, K., Gissot, L., Le Gourrierec, J., Samach, A. and Coupland, G. (2006). CONSTANS and the CCAAT-box-binding complex share a functionally important domain and interact to regulate flowering of Arabidopsis. Plant Cell 18(11): 2971-2984.

Woodruff, D. and Tonks, J. (1983). Relationship between time of anthesis and grain yield of wheat genotypes with differing developmental pattern. Australian Journal of Agricultural Research 34(1): 1-11.

Xue, G. P., McIntyre, C. L., Jenkins, C. L., Glassop, D., van Herwaarden, A. F. and Shorter, R. (2008). Molecular dissection of variation in carbohydrate metabolism related to water-soluble carbohydrate accumulation in stems of wheat. Plant Physiology 146(2): 441-454.

Yan, L., Loukoianov, A., Tranquilli, G., Helguera, M., Fahima, T. and Dubcovsky, J. (2003). Positional cloning of the wheat vernalization gene VRN1. Proceedings of the National Academy of Sciences of the United States of America 100(10): 6263-6268.


Chapter 7: 199 General Discussion

Chapter 7: General Discussion

7.1 DISCUSSION

This thesis focused on the identification of the wheat NF-Y TF family and the

elucidation of the biological roles of some family members in the regulation of light-

mediated gene expression through a series of investigations from bioinformatic

analyses to functional characterisation, which have resulted in a number of important

findings as discussed below.

Prior to this investigation, only the NF-Y family of the dicotyledon

Arabidopsis had been characterised at the molecular level (Gusmaroli et al. 2001,

2002). The Arabidopsis NF-Y subunit families were initially reported to comprise 10

NF-YA, 10 NF-YB and 9 NF-YC (Gusmaroli et al. 2001, 2002). However, an

additional three NF-YB and four NF-YC members were later identified in

Arabidopsis (Siefers et al. 2009). The defining feature of each NF-Y subunit is the

highly conserved core region. The conserved core regions of all Arabidopsis NF-Y

subunit members were used to identify the three NF-Y subunit families in wheat

from both the TaGI EST sequence and the NCBI gene sequence databases. This

bioinformatic analysis resulted in the identification of 10 NF-YA, 11 NF-YB, 14 NF-

YC and 2 Dr1 genes in wheat, with no attempt made to distinguish between the three

homoeologous copies of each gene. However, this is likely an underestimate due to

the lack of the whole wheat genome sequence. The current EST collection (over one

million ESTs) is likely to be incomplete, particularly for genes expressed at a low

level or only at certain developmental stages or only in response to specific

environmental stimuli. However, the NF-Y family size reported here is close to that

reported for Arabidopsis and rice (Thirumurugan et al. 2008; Siefers et al. 2009).

Therefore, these data provide a good starting point for the investigation of the

biological roles of the NF-Y family in wheat.

To identify the potential biological roles of the NF-Y subunit members in

wheat, an in depth gene expression profile was constructed for each subunit. The

mRNA expression levels of all NF-Y members were measured in six wheat organs

(leaf, stem, spike, root, endosperm and embryo) and in response to external stimuli,

200 Chapter 7: General Discussion

such as light. This expression analysis showed that some members of the TaNF-Y

subunit families had only slight variation in expression levels between all organs

analysed, indicating their regulatory roles are not confined to specific organs and

may have roles as general regulators. In contrast, several TaNF-YB and TaNF-YC

members were expressed highest in the photosynthetic organs. Of the wheat NF-Y

members expressed highest in the photosynthetic organs (leaf, stem and spike), four

TaNF-YB (TaNF-YB3, 6, 7 & 8) and three TaNF-YC (TaNF-YC5, 8, 11 & 12) were

significantly upregulated in response to light in wheat leaves and seedling shoots. As

these light-upregulated members of the NF-YB and NF-YC families were expressed

highest in the photosynthetic organs it was hypothesised that some of them may be

involved in light-dependant regulation of gene expression, functioning within the

photosynthetic organs.

In order to elucidate the gene regulatory networks that the light-upregulated

TaNF-YB and TaNF-YC members may play a role in gene regulation, a large-scale

gene expression correlation analysis was performed. This approach derives from the

observation that the expression level of a TF is often correlated with that of its target

genes (Haverty et al. 2004; Cai et al. 2007). The availability of a number of

publically available Affymetrix Wheat Genome Array datasets provides a large

amount of data for a high quality gene expression correlation analysis to be

conducted. The Affymetrix Wheat Genome Array covers over 55,000 transcripts.

Despite the coverage of the Affymetrix Wheat Genome Array, of the light-

responsive NF-YB and NF-YC members, only TaNF-YB3, TaNF-YC8 and TaNF-

YC11 had matching probe sets. The expression correlation analysis revealed 116, 303

and 1329 transcripts were significantly co-regulated with TaNF-YC8, TaNF-YC11

and TaNF-YB3 respectively in multiple Affymetrix Wheat Genome Array datasets.

Transcripts significantly correlated in expression with TaNF-Y subunit genes were

analysed to identify enriched Gene Ontology (GO) terms. The most significantly

enriched GO term for both TaNF-YB3- and TaNF-YC11-co-regulated genes was

photosynthesis (GO:0015979). All other significantly enriched terms were associated

with photosynthesis-related processes. This enrichment analysis provided support to

the hypothesis that TaNF-YB3 and TaNF-YC11 may be involved in the light-

mediated regulation of genes, functioning primarily within photosynthetic organs.


To examine whether the light-upregulated TaNF-Y members have a role in the

regulation of photosynthesis genes, constructs driven by a strong constitutive

promoter and containing either TaNF-YB3 or TaNF-YC11 were transformed into

wheat to generate transgenic lines overexpressing the NF-Y subunit members.

However, only TaNF-YB3 overexpressing transgenic lines were successfully

obtained in this study. The transcript levels of a number of potential target genes in

the TaNF-YB3 overexpressing lines were measured. Increased constitutive

expression of TaNF-YB3 in wheat resulted in a significant increase in the expression

levels of several photosynthesis genes, including those that encode components of

the light harvesting systems (TaLhca4, TaLhcb4, TaPSIN and TaPSIK), the subunit

of chloroplast ATP synthase (TaATPaG) and a rate-limiting enzyme in the

chlorophyll biosynthetic pathway, glutamyl-tRNA reductase (TaGluTR). Increased

expression of two enzymes of the Calvin cycle (TaSBPase and TaFBPase) was also

observed, although the increase was slight and not statistically significant. It has been

shown that increased expression of photosynthesis genes can increase the

photosynthetic rate and biomass of a plant (Lefebvre et al. 2005). The regulatory role

TaNF-YB3 has on photosynthesis genes could be used to improve the radiation use

efficiency by increasing the photosynthetic rate. Better radiation use efficiency could

increase the yield potential of C3 plants.

In eukaryotes, NF-Y functions as heterotrimeric complex that binds to the

CCAAT-box in the promoters genes under its regulatory control (Mantovani 1998,

1999). There is limited data on the binding of NF-Y to the CCAAT-box in the

promoters of photosynthesis genes. One report has identified a NF-Y binding

CCAAT-box in the promoter of a spinach photosynthesis gene, AtpC (Kusnetsov et

al. 1999). A bioinformatic analysis showed that the CCAAT-box is present in the

promoter regions of five photosynthesis genes (Lhca4/TaCab, tAPX, petF, cFBPase

& cSBPase) in wheat. As the expression profile of TaNF-YB3 is highly similar to that

for TaNF-YC11, it seems likely that they are interaction partners and function in the

regulation of photosynthesis genes. The interaction between TaNF-YB3 and TaNF-

YC11 was examined in vitro in this study using the protein/protein interaction

method described by Xue et al. (2006). In this method, a biotinylation peptide fused

protein is immobilised in a streptavidin-coated 96-well plate. The potential

interaction partner is fused to a CELD reporter enzyme. Constructs were made for


the production of TaNF-YB3 and TaNF-YC11 fusion proteins in E. coli. Full-length

TaNF-B3 protein could not be expressed in E. coli, likely due to the presence of a

long stretch of methionine residues and codon bias. Expression of a peptide

containing the TaNF-YB3 core domain could be achieved after complete truncation

of the 5′ and 3′ regions. The truncated peptide did not interact with TaNF-YC11 in

these assays.

Phenotypic analysis of transgenic lines overexpressing TaNF-YB3 revealed a

significant increase in the leaf chlorophyll content. This increase coincides with the

enhanced expression level of TaGluTR, which encodes a rate-limiting enzyme in the

chlorophyll biosynthetic pathway, in the transgenic lines. Chlorophylls are

responsible for harvesting the solar energy and are necessary for charge separation

and electron transport within the photosystem reaction centres (Tanaka and Tanaka

2006).

To investigate whether the increased photosynthesis gene transcript levels and

the increased chlorophyll content in the transgenic lines has an impact on

photosynthesis, the photosynthetic rate was measured in the leaves of 4-week-old

transgenic wheat plants. A significant increase in the photosynthetic rate was

observed in the leaves of the transgenic wheat lines compared to the wild-type

(Bobwhite). The 4-week-old transgenic wheat lines had a more rapid early growth

rate, which was observed for both height and vegetative biomass. These transgenic

lines had a 30 % increase in vegetative biomass compared to the wild-type plants.

The increased photosynthetic rate may be the primary cause of the increased early

growth rates observed in the transgenic lines. Early growth rates can be beneficial for

achieving rapid canopy closure and for outcompeting weeds. Rapid canopy closure

can increase water availability by reducing water evaporation.

Another novel phenotype identified for the transgenic lines was earlier

flowering. The transgenic wheat plants flowered earlier than the wild-type by

approximately 2-days. Previous reports have indicated that NF-Y members are

involved in the regulation of flowering time in Arabidopsis and this role is mediated

through the interaction with CCT domain-containing proteins, such as CO and COL

(Wenkel 2006; Kumimoto et al. 2008; Tiwari 2010). To identify the molecular basis

of the earlier flowering phenotype, the transcript levels of flowering time genes were

measured. Analysis of six flowering time genes (TaFT, TaFT2, TaFDL2, TaFDL6,


TaFDL13 & TaVRN1) revealed that their transcript levels (particularly TaFT, TaFT2

and TaVRN1) were higher in the TaNF-YB3 overexpressing lines compared to the

wild-type. TaFT is the floral integrator, which combines the photoperiodic and

vernalisation pathways to promote flowering (Li and Dubcovsky 2008). TaFDL2 and

TaFDL6 interact with TaFT to regulate TaVRN1 (Li and Dubcovsky 2008).

Furthermore, TaFT positively regulates TaFT2 (Li and Dubcovsky 2008). The

transgenic wheat plants constitutively expressing TaNF-YB3 had up to a 13-fold

increase in the transcript levels of TaFT. This increase led to the increased

expression of the two downstream genes, TaFT2 and TaVRN1. These data suggest

that TaNF-YB3 act upstream of these flowering time genes.

To identify whether genes encoding CCT domain-containing proteins are co-

regulated with TaNF-YB3, gene expression correlation analysis was conducted using

publically available Affymetrix Wheat Genome Array datasets. It has been shown

that genes encoding subunits of multimeric complexes are often spatially and

temporally coexpressed (Walhout et al. 2002; van Waveren and Moraes 2008; Liu et

al. 2009). This expression correlation analysis showed that TaNF-YB3 was co-

regulated with three gene encoding CCT domain-containing proteins (TaCO5,

TaCOLa & TaCOLb) that are known to be involved in the regulation of flowering

time. Some NF-YB and NF-YC subunits have been shown to interact with CCT

domain-containing proteins (Ben-Naim et al. 2006). Furthermore, increased

expression of NF-YB members in Arabidopsis can promote earlier flowering

(Kumimoto et al. 2008).

To summarise, in this study the wheat NF-Y family members were identified

through extensive bioinformatic analysis. The expression profiles of all wheat NF-Y

members were generated including their transcript distribution among organs and

expression responses to some environmental stimuli. These results provided the basic

information necessary for the selection of subunit members for further

characterisation of their role in relevant physiological processes. Most importantly,

the identification of TaNF-YB and TaNF-YC members that are light-upregulated and

the correlation of their expression profiles with photosynthesis genes led to the novel

finding that TaNF-YB3 is involved in the regulation of photosynthesis genes using a

transgenic approach. Additionally, the transgenic study revealed that TaNF-YB3 is

involved in the fine-tuning of flowering time in wheat.


The ever growing demand for wheat products requires significant increases in

the genetic yield potential (YP) of modern cultivars. The genetic gains obtained

during the 20th century were largely the result of the introgression of dwarfing genes,

which improved the lodging resistance of wheat plants. Further increases were

realised by intensive artificial selection for higher yielding cultivars. Both of these

methods primarily increased the harvest index (HI) of the crop. However, the current

HI is ~92% of the theoretical limit in wheat, indicating there is a need to explore the

other factors of YP. One factor of YP that is speculated to have considerable room

for improvement is radiation use efficiency (RUE).

Enhancing RUE can be achieved by increasing the photosynthetic rate.

Furthermore, the photosynthetic rate is correlated with wheat yields (Blum 1990;

Watanabe et al. 1994; Fischer et al. 1998). However, there are two inputs of

photosynthesis that can saturate C3 photosynthesis. Firstly, wheat is commonly

grown in environments where light intensities can be up to four times the saturation

point of C3 photosynthesis resulting in photoinhibition (Osmond 1994; Sharkey

1985). Secondly, based on current trends, atmospheric CO2 levels may reach a

critical concentration within a decade that would cause RuBP regeneration to become

rate limiting (Farquhar & von Caemmerer 1982). While these are only two examples

of rate-limiting factors of photosynthesis, a number were highlighted in Chapter 2.

Therefore, to improve the photosynthetic rate the system needs to be manipulated as

a whole to avoid creating new bottlenecks.

It is known that increasing the expression levels of genes encoding certain

components of photosynthesis can improve the photosynthetic rate (Harrison et al.

1997; Lefebvre et al. 2005). However, to systematically manipulate the expression of

genes encoding each rate-limiting component of photosynthesis is not a viable option

using the current technologies. In this study, TFs were selected for investigation

because they are known to control the expression of multiple genes within their

associated pathways. Furthermore, there are some TFs known to regulate multiple

photosynthesis genes.

Prior investigations indicated that some members from the NF-Y TF family

may be involved in light-mediated gene regulation pathways. In this study, the

systematic investigation of the wheat NF-Y family identified a number of members

likely involved in light-mediated pathways. Further studies identified a light-


regulated NF-Y member in wheat that confers multiple desirable phenotypes when

misexpressed. These findings provide an opportunity for researchers to potentially

increase the genetic yield potential of wheat in the future.

If the findings in this investigation are to be used to further improve the genetic

yield potential of wheat a considerable amount of further research is required. Here a

transgenic approach was used to demonstrate TaNF-YB3 expression levels can

influence those of photosynthesis genes. However, it is not known whether NF-Y

complexes containing TaNF-YB3 are directly regulating photosynthesis genes

because it is still unknown whether these complexes can activate the expression of

photosynthesis genes by binding to their promoters. Furthermore, it is not known

whether TaNF-YB3 interacts with other NF-Y members in wheat. To understand

how TaNF-YB3 positively regulates photosynthesis and flowering time genes,

further investigation is required to identify the interaction partners of TaNF-YB3.

Some candidate interaction partners have been identified in this investigation.

A candidate gene approach was used to identify TaNF-YB3 in wheat. To

identify the potential roles of TaNF-YB3 transgenic wheat lines were created.

However, the application of these findings does not necessarily need to include the

creation of GM wheat. Recent advances in high throughput sequencing makes it

convenient to uncover polymorphisms and to carryout large-scale genotyping. The

identification of populations for an association study of TaNF-YB3 with selected

trait phenotypes can be done. Introgression of desirable alleles using current

molecular breeding approaches could then be used.


7.2 REFERENCES

FAO. (2008). "Food and agriculture organization of the united nations.", from http://www.fao.org/.

Ben-Naim, O., Eshed, R., Parnis, A., Teper-Bamnolker, P., Shalit, A., Coupland, G., Samach, A. and Lifschitz, E. (2006). The CCAAT binding factor can mediate interactions between CONSTANS-like proteins and DNA. Plant Journal 46(3): 462-476.

Blum, A. (1990). Variation among wheat cultivars in the response of leaf gas exchange to light. The Journal of Agricultural Science 115(03): 305-311.

Cai, Y.-D., Jen, C.-H., Qian, J., Qian, Z. and Muldoon, M. (2007). Prediction of regulatory networks: Identification of transcription factor-target relationship from gene ontology information and gene expression data. School of Mathematics, Manchester Institute for Mathematical Sciences, University of Manchester Manchester, UK.

Farquhar, G. D. and von Caemmerer, S. (1982). Modelling of photosynthetic response to environmental conditions. In: Encyclopedia of plant physiology. New series. Volume 12B. Physiological plant ecology. II. Water relations and carbon assimilation. Eds. O. Lange, P Nobel, C. Osmond and H. Ziegler. Springer-Verlag. Berlin.

Finger, R. (2010). Evidence of slowing yield growth - the example of Swiss cereal yields. Food Policy 35(2): 175-182.

Fischer, R., Rees, D., Sayre, K., Lu, Z.-M., Condon, A. and Saavedra A. (1998). Wheat yield progress associated with higher stomatal conductance and photosynthetic rate, and cooler canopies. Crop Science 38(6): 1467-1475.

Gusmaroli, G., Tonelli, C. and Mantovani, R. (2001). Regulation of the CCAAT-binding NF-Y subunits in Arabidopsis thaliana. Gene 264(2): 173-185.

Gusmaroli, G., Tonelli, C. and Mantovani, R. (2002). Regulation of novel members of the Arabidopsis thaliana CCAAT-binding nuclear factor Y subunits. Gene 283(1-2): 41-48.

Harrison E. P., Willingham N. M., Lloyd J. C., Raines C. A. (1997) Reduced sedoheptulose-1,7-bisphosphatase levels in transgenic tobacco lead to decreased photosynthetic capacity and altered carbohydrate accumulation. Planta 204:27-36.

Haverty, P. M., Hansen, U. and Weng, Z. (2004). Computational inference of transcriptional regulatory networks from expression profiling and transcription factor binding site identification. Nucleic Acids Research 32(1): 179-188.

Kalra, N., Chakraborty, D., Sharma, A., Rai, H., Jolly, M., Chander, S., Ramesh, K., Bhadraray, S., Barman, D., Mittal, R., Lal, M. and Sehgal, M. (2008). Effect of increasing temperature on yield of some winter crops in northwest india. Current Science 94: 82-88.

Kumimoto, R. W., Adam, L., Hymus, G. J., Repetti, P. P., Reuber, T. L., Marion, C. M., Hempel, F. D. and Ratcliffe, O. J. (2008). The Nuclear factor Y subunits


NF-YB2 and NF-YB3 play additive roles in the promotion of flowering by inductive long-day photoperiods in Arabidopsis. Planta 228(5): 709-723.

Kusnetsov, V., Landsberger, M., Meurer, J. and Oelmuller, R. (1999). The assembly of the CAAT-box binding complex at a photosynthesis gene promoter is regulated by light, cytokinin, and the stage of the plastids. Journal of Biological Chemistry 274(50): 36009-36014.

Ladha, J. K., Dawe, D., Pathak, H., Padre, A. T., Yadav, R. L., Singh, B., Singh, Y., Singh, Y., Singh, P., Kundu, A. L., Sakal, R., Ram, N., Regmi, A. P., Gami, S. K., Bhandari, A. L., Amin, R., Yadav, C. R., Bhattarai, E. M., Das, S., Aggarwal, H. P., Gupta, R. K. and Hobbs, P. R. (2003). How extensive are yield declines in long-term rice-wheat experiments in Asia? Field Crops Research 81(2-3): 159-180.

Lefebvre, S., Lawson, T., Zakhleniuk, O. V., Lloyd, J. C., Raines, C. A. and Fryer, M. (2005). Increased sedoheptulose-1,7-bisphosphatase activity in transgenic tobacco plants stimulates photosynthesis and growth from an early stage in development. Plant Physiology 138(1): 451-460.


Liu, C. T., Yuan, S. and Li, K. C. (2009). Patterns of co-expression for protein complexes by size in Saccharomyces cerevisiae. Nucleic Acids Research 37(2): 526-532.

Mantovani, R. (1998). A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Research 26(5): 1135-1143.

Mantovani, R. (1999). The molecular biology of the CCAAT-binding factor NF-Y. Gene 239(1): 15-27.

Osmond, C. (1994). What is photoinhibition? Some insights from comparisons of shade and sun plants. In: Photoinhibition of photosynthesis: From molecular mechanisms to the field. Eds. N. Baker and J. Bowyer. BIOS Scientific Publishers. Oxford.

Peltonen-Sainio, P., Jauhiainen, L. and Laurila, I. P. (2009). Cereal yield trends in northern european conditions: Changes in yield potential and its realisation. Field Crops Research 110(1): 85-90.

Ramachandran, S., Hiratsuka, K. and Chua, N. H. (1994). Transcription factors in plant growth and development. Current Opinion in Genetics and Development 4(5): 642-646.

Sharkey, T. (1985). Photosynthesis in intact leaves of C3 plants: Physics, physiology and rate limitations. The Botanical Review 51(1): 53-105.



Tanaka, A. and Tanaka, R. (2006). Chlorophyll metabolism. Current Opinion in Plant Biology 9(3): 248-255.


Tiwari, S. B., Shen, Y., Chang, H.-C., Hou, Y., Harris, A., Ma, S. F., McPartland, M., Hymus, G. J., Adam, L., Marion, C., Belachew, A., Repetti, P. P., Reuber, T. L. and Ratcliffe, O. J. (2010). The flowering time regulator CONSTANS is recruited to the FLOWERING LOCUS T promoter via a unique cis-element. New Phytologist 187(1): 57-66.

van Waveren, C. and Moraes, C. T. (2008). Transcriptional co-expression and co-regulation of genes coding for components of the oxidative phosphorylation system. BMC Genomics 9: 18.

von Braun, J. (2010). Food insecurity, hunger and malnutrition: Necessary policy and technology changes. New Biotechnology doi: 10.1016/j.nbt.2010.08.006

Walhout, A. J., Reboul, J., Shtanko, O., Bertin, N., Vaglio, P., Ge, H., Lee, H., Doucette-Stamm, L., Gunsalus, K. C., Schetter, A. J., Morton, D. G., Kemphues, K. J., Reinke, V., Kim, S. K., Piano, F. and Vidal, M. (2002). Integrating interactome, phenome, and transcriptome mapping data for the C. elegans germline. Current Biology 12(22): 1952-1958.

Watanabe, N., Evans, J. R. and Chow, W. S. (1994). Changes in the photosynthetic properties of Australian wheat cultivars over the last century. Functional Plant Biology 21(2): 169-183.

Wenkel, S., Turck, F., Singer, K., Gissot, L., Le Gourrierec, J., Samach, A. and Coupland, G. (2006). CONSTANS and the CCAAT box binding complex share a functionally important domain and interact to regulate flowering of Arabidopsis. Plant Cell 18(11): 2971-2984.

Xue, G. P., Bower, N. I., McIntyre, C. L., Riding, G. A., Kazan, K. and Shorter, R. (2006). TaNAC69 from the NAC superfamily of transcription factors is up-regulated by abiotic stresses in wheat and recognises two consensus DNA-binding sequences. Functional Plant Biology 33(1): 43-57.

Date post:	26-Mar-2020
Category:	Documents
Upload:	others
View:	1 times
Download:	0 times

CHARACTERISATION OF THE ANF-Y FAMILY OF TRANSCRIPTION ... · Troy James Stephenson Bachelor of...

Documents