Characterization and functional analysis of eugenolO-methyltransferase gene reveal metabolite shifts, chemotypespecific differential expression and developmental regulationin Ocimum tenuiflorum L.

Indu Kumari Renu • Inamul Haque •

Manish Kumar • Raju Poddar • Rajib Bandopadhyay •

Amit Rai • Kunal Mukhopadhyay

Received: 11 February 2013 / Accepted: 4 January 2014 / Published online: 14 January 2014

� Springer Science+Business Media Dordrecht 2014

Abstract Eugenol-O-methyltransferase (EOMT) cata-

lyzes the conversion of eugenol to methyleugenol in one of

the final steps of phenylpropanoid pathway. There are no

comprehensive reports on comparative EOMT gene

expression and developmental stage specific accumulation

of phenylpropenes in Ocimum tenuiflorum. Seven chemo-

types, rich in eugenol and methyleugenol, were selected by

assessment of volatile metabolites through multivariate

data analysis. Isoeugenol accumulated in higher levels

during juvenile stage (36.86 ng g-1), but reduced sharply

during preflowering (8.04 ng g-1), flowering (2.29 ng g-1)

and postflowering stages (0.17 ng g-1), whereas methyl-

eugenol content gradually increased from juvenile

(12.25 ng g-1) up to preflowering (16.35 ng g-1) and then

decreased at flowering (7.13 ng g-1) and post flowering

(5.95 ng g-1) from fresh tissue. Extreme variations of free

intracellular and alkali hydrolysable cell wall released

phenylpropanoid compounds were observed at different

developmental stages. Analyses of EOMT genomic and

cDNA sequences revealed a 843 bp open reading frame

and the presence of a 90 bp intron. The translated proteins

had eight catalytic domains, the major two being dimeri-

sation superfamily and methyltransferase_2 superfamily. A

validated 3D structure of EOMT protein was also deter-

mined. The chemotype Ot7 had a reduced reading frame

that lacked both dimerisation domains and one of the two

protein-kinase-phosphorylation sites; this was also reflec-

ted in reduced accumulation of methyleugenol compared to

other chemotypes. EOMT transcripts showed enhanced

expression in juvenile stage that increased further during

preflowering but decreased at flowering and further at

postflowering. The expression patterns may possibly be

compared and correlated to the amounts of eugenol/iso-

eugenol and methyleugenol in different developmental

stages of all chemotypes.

Keywords Developmental stages � Eugenol O-

methyltransferase � GC–MS based metabolite profiling �Gene characterization � Gene expression profiling �Multivariate analysis � Quantitative real time PCR � Ultra

performance liquid chromatography

Introduction

Indian holy basil Ocimum tenuiflorum L. f. (syn. Ocimum

sanctum L.; family Lamiaceae) is a herbaceous, pubescent

and aromatic plant that grows abundantly in tropical and

subtropical regions of the Indian subcontinent. These plants

are annual, predominantly naturally self-pollinated with a

short life cycle of about 50–60 days. Ocimum tenuiflorum

Indu Kumari Renu, Inamul Haque contributed equally.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11033-014-3035-7) contains supplementarymaterial, which is available to authorized users.

I. K. Renu � I. Haque � M. Kumar � R. Poddar �R. Bandopadhyay � A. Rai � K. Mukhopadhyay (&)

Department of Biotechnology, Birla Institute of Technology,

Mesra, Ranchi 835215, India

e-mail: kmukhopadhyay@bitmesra.ac.in; mkunalus@yahoo.com

Present Address:

I. Haque

Department of Botany, Derozio Memorial College,

Kolkata 700136, India

Present Address:

A. Rai

Department of Biological Science, National University of

Singapore, Singapore 117543, Singapore

123

Mol Biol Rep (2014) 41:1857–1870

DOI 10.1007/s11033-014-3035-7

extracts have been widely used for the treatment of various

ailments like common cold and cough, digestive com-

plaints and hepatic disorders [1, 2], it is also mentioned in

Ayurvedic and other traditional systems of medicine for

treatment of various common health disorders. These

numerous medicinal properties are attributed to the wide

diversity of the volatile aromatic essential oils [3] that are

synthesized and stored in specialized glandular trichomes

present on the aerial parts of various lamiaceae plants [4].

Diversity of essential oils within O. tenuiflorum species is

due to distinct biochemical races: chemotypes [5], arising

out of natural selection [1] owing to genetic and bio-

chemical heterogeneity [6]. Furthermore, developmental

stage of the plant influences the composition as well as the

quantity of the essential oil.

Essential oils of O. tenuiflorum are rich in phenylprop-

enes like eugenol, methyleugenol, chavicol, methylchavi-

col and some terpenoids [7, 8]. These metabolites

individually or in combination impart aroma, fragrance,

UV protection and have important roles in plant defence or

serve as signal molecules between plants and microbes [9].

Though the detailed biosynthetic pathway of these phe-

nylpropenes has not yet been established, the initial steps

follow the general phenylpropanoid biosynthetic pathway

via cinnamic acid, coumaric acid, caffeic acid and ferulic

acid had been proposed earlier [10] (Supplementary Fig.

S1). Phenylpropenes as well as many of the intermediate

compounds exist both in soluble form within the plant cells

or remain bound to the cell wall [11].

Several plant secondary metabolites synthesized via the

phenylpropanoid pathway are modified by a variety of O-

methyltransferases [12]. The final step in the biosynthesis

of the phenylpropene, methyleugenol, is catalysed by the

enzyme eugenol O-methyltransferase (EOMT, EC

2.1.1.146). This enzyme (EOMT) catalyzes the conversion

of eugenol to methyleugenol (Supplementary Fig. S1).

Both eugenol and methyleugenol are important drug scaf-

folds with therapeutic [13] and insecticidal properties [14].

Therefore, the dissection of its developmental regulation at

the molecular and genetic levels is of considerable strategic

significance for improvement and use of O. tenuiflorum as

a natural source of pharmaceuticals.

Two operationally different O-methyltransferases,

EOMT and chavicol O-methyltransferase (CVOMT) were

isolated by affinity chromatography from sweet basil

(Ocimum basilicum) leaves, but the homodimeric proteins

had the same molecular mass and could not be further

separated [15]. In a later study, the same group identified

two cDNA sequences specific for EOMT and CVOMT from

a sweet basil EST library. Recombinant proteins obtained

by heterologous expression of these two cDNAs in E. coli,

displayed very high specificity towards their respective

substrates, eugenol and chavicol [16]. In a later study,

transcripts of eugenol synthase and isoeugenol synthase in

glands and floral tissues respectively were found to be

responsible for emission and storage of volatiles like

eugenol, isoeugenol, chavicol and their biosynthetic

derivatives [17].

For the study of genes involved in the production and

modification of terminal metabolites in biosynthetic path-

ways, the combined analysis of transcripts and metabolites

is a powerful technology [18–20]. In conjunction, the use

of multivariate techniques like principal component ana-

lysis (PCA) of complex metabolite datasets provide for

pattern recognition [21]. The present study focuses on an

integrated approach at two biological levels of function

involving developmental accumulation of phenylpropene

metabolites and EOMT gene expression. We also present a

bioinformatics-based examination of the fine structure of

EOMT gene and its encoded protein.

Materials and methods

Plant materials

A large collection of O. tenuiflorum chemotypes from

different geographical habitats of peninsular India (Sup-

plementary Table S1) were planted at the Indigenous

Medicinal Plant Garden at BIT, Ranchi (23�240N, 85�260E,

619 m asl). Plants were grown on riverbed loamy soil with

an average daytime temperature of 28 �C and a mean

annual rainfall of 1,430 mm. Seed stocks were maintained

for each plant and were germinated as and when required.

Screening of plants by GC–MS

Fresh mature leaves and inflorescences (100 mg) were

collected from 18 chemotypes of 15 days old plants of O.

tenuiflorum. Essential oils were extracted using methyl

tert-butyl ether (MTBE) [22]. Analyses of the extracted

oils were performed in a Clarus 500 gas chromatograph,

using Elite-5MS fused silica capillary column

(30 m 3 0.25 mm ID 3 0.18 lm film thickness). Injec-

tion volumes were 1.0 ll for each sample in splitless mode.

Other GC conditions were as mentioned by Iijima et al.

[22]. Mass range was recorded from 100 to 600 m/z with

electron energy of 70 eV. The instrument was operated

using Turbomass v 5.4.2.1617 software and identification

of the major compounds was done by Wiley Mass Spectral

Browser ver. 3.2.3 and NIST 2005 GC–MS Mass Spectral

library ver 2.0. Authentic standards of eugenol, chavicol,

methyleugenol and methylchavicol (all from Chromadex,

Irvine, CA, USA) and isoeugenol (Sigma-Aldrich Chemie

GmbH, Steinheim, Germany) were used for quantification.

All standards were injected in triplicate at concentrations of

1858 Mol Biol Rep (2014) 41:1857–1870

123

5 mg mL-1. Three samples were collected from each plant

and duplicate GC–MS analyses of each sample were per-

formed. The results were expressed as ng g-1 fresh weight

(FW), and log10 transformed for PCA. Hotelling’s T2

analysis was performed with the software Unscrambler v

9.8 [23] using a sample covariance matrix having 95 % CI

(a = 0.05) and PCA was presented as a two dimensional

graphical display of the data.

In vitro development of callus

Young leaves from one month old (flowering stage)

chemotypes selected for the present study were inoculated

in MS [24] media supplemented with benzyl amino purine

(1.0 mg L-1) and naphthoxy acetic acid (0.5 mg L-1) to

obtain callus. The cultures were incubated at 23 �C under a

16/8 h light/dark cycle with the light intensity of

40 lmol m-2 s-1. The cultures were maintained in the

same media and transferred to fresh medium at 4-week

intervals. Callus, on their fourth week of growth, were used

for all studies.

Analysis of essential oils at different developmental

stages

For stage specific quantification and determination of pre-

cise composition of essential oil, four different develop-

mental stages (stage I: juvenile, 14 days old plants; stage

II: preflowering, 25 days old plants; stage III: flowering,

30 days old plants and stage IV: postflowering, 40 days old

plants) and in vitro grown callus on their fourth week of

growth were selected (Fig. 1). Essential oils were obtained

from 50 g of freshly harvested leaf and inflorescence from

the seven selected chemotypes at the desired stage as well

as from callus by hydro-distillation (1 g in 20 mL) in a

clevenger apparatus for 3 h. The essential oils were

obtained from three independent experiments from each

developmental stage of all the seven chemotypes, dried

over anhydrous Na2SO4 and stored in dark glass bottles at

4 �C until analysis. The GC–MS conditions and metabolite

quantification were performed exactly as mentioned earlier.

Extraction, separation and quantification

of phenylpropanoids using UPLC

The cell wall bound phenylpropanoids were extracted fol-

lowing the procedure of Santiago et al. [25]. All extractions

were carried out in triplicates from all the seven selected

chemotypes at the specified developmental stages and from

callus. HPLC grade acetonitrile, methanol and formic acid

(all from Merck) were used. Water used in all procedures

was purified through a MilliQ system. Reference standards

of eugenol, methyleugenol (both from Chromadex Inc.),

Caffeic acid (HiMedia, Mumbai, India), isoeugenol, van-

illin, trans-ferulic acid, cinnamyl alcohol and trans-cin-

namic acid (Sigma-Aldrich) were used for identification

and quantification. Solutions of the standards were pre-

pared by dissolving 1 mg respective standards in 1 mL

methanol.

Analytes were separated using a Waters Acquity UPLC

system (Waters Corporation) on UPLC BEH C18 reverse

phase column (2.1 mm 9 50 mm; 1.7 lm particle size).

For the optimal separation and detection, the process of

Tan et al. [26] was modified by the addition of formic acid

(0.1 %) in both solvent A and B instead of trifluoroacetic

acid (0.1 %) and the parameters were successfully trans-

ferred from HPLC to a UPLC system. The binary mobile

phase consisted of (A) 0.1 % formic acid in water and

(B) acetonitrile: water (98:2) containing 0.1 % formic acid.

A linear gradient elution program was applied as follows:

initial-100 % A; 2.5 min—75 % A; 5.5 min—50 % A;

6 min—100 % A. The composition was held at 100 % A

for another 1 min to re-equilibrate the system, giving a

total run time of 7 min. The flow rate was maintained at

0.3 mL min-1, temperature of the column and sample

manager were set at 26 and 5 �C respectively. Injection

volumes were 2.5 lL for all standards and samples. The

TUV detector was set at 254 nm with instrument

Fig. 1 Developmental stages of O. tenuiflorum selected for the study. a Juvenile, 14 day old plants, b preflowering, 25 day old plants,

c flowering, 30 day old plants, d postflowering, 40 day old plants and e in vitro grown callus at fourth week of growth

Mol Biol Rep (2014) 41:1857–1870 1859

123

operations, data acquisition and processing being per-

formed by EmPower2 chromatographic data software.

Quantification was performed by injecting standards of

known concentration and establishing a calibration curve.

Isolation of genomic DNA, EOMT gene amplification,

cloning and sequencing

Genomic DNA was isolated from leaves and inflorescences

of the seven selected O. tenuiflorum chemotypes using a

modified procedure [27]. A sweet basil (Ocimum basili-

cum) EOMT complete coding sequence (AF435008) of

1,074 nucleotides was obtained from the nucleotide data-

base at NCBI and was used to design EOMT specific pri-

mer pair (Table 1). DNA amplification reactions were

assembled in 20 lL volume consisting of 50 ng of genomic

DNA, 1 9 Taq polymerase buffer, 2.0 mM MgCl2, 1 unit

of Taq DNA polymerase, 0.2 mM of each dNTP (Fer-

mentas GmbH), and 0.5 lM of primers EOMT-F and

EOMT-R (Table 1). The thermocycler was programmed at

95 �C for 4 min, 35 cycles at 94 �C for 30 s, 55 �C for

1 min, and 72 �C for 2 min followed by a final extension

step at 72 �C for 10 min. The PCR products were extracted

from the gels, cloned into pTZ57R/T vector using the In-

sTAclone PCR Cloning kit (Fermentas GmbH) and five

plasmids from independent clones were sequenced com-

mercially from both ends at Macrogen Inc., Seoul, South

Korea.

Isolation of RNA, cDNA synthesis, cloning

and sequencing

Total RNA was isolated from fresh leaves and inflores-

cences (250 mg) of the chemotype Ot2, using Tri-Reagent

(Molecular Research Center Inc.) as recommended by the

manufacturer. Ocimum tenuiflorum EOMT cDNA was

synthesized from 5 lg total RNA and amplified using the

GeneAmp Gold RNA PCR Reagent Kit (Applied

Biosystems) following the two-step RNA-PCR procedure

as recommended by the manufacturer. Sequence specific

primers EOMT-F and EOMT-R (Table 1) were used in

both steps; thermocycling parameters during the second

step for amplification of cDNA were similar to that used

for the amplification of genomic DNA. Cloning and

sequencing was performed as mentioned earlier.

Sequence assembly and in silico data analyses

The complementary strands were assembled using Se-

quencher 4.8 (Gene Codes Corporation) and compared

with those available in GenBank databases using BLASTN

program at NCBI. All the seven O. tenuiflorum EOMT

genomic DNA sequences (EU622042–EU622048) and the

cDNA sequence of Ot2 (EU622049) were submitted to

GenBank after proper annotation. GENSCAN web server

and GENSCAN predictions were used to predict intron–

exon boundaries on the genomic DNA whereas FSPLICE

and Spidey were used for detection of intron and exon in

the sequences. The genomic DNA sequences were com-

pared with the cDNA sequence by multiple sequence

alignment (MSA) using ClustalX2 [28].

The ORF finder at NCBI was used to obtain the open

reading frames for each sequence in all six possible reading

frames and swissblast was used to obtain information on

encoded proteins. Transeq and BCM search launcher was

used for in silico translation of the nucleotide sequences

into amino acid sequences. Similarity search was per-

formed using BLASTP at NCBI, and protein sequences

having a percentage similarity of 54 and above were

retrieved, to include Medicago sp. and other species, and

aligned by ClustalX2 [28]. The aligned sequences were

bootstrapped 1,000 times using seqboot program of Phylip

ver 3.68 [29] and the Jones–Taylor–Thornton model [30]

was used to compute a distance matrix. Neighbour joining

method of Saitou and Nei [31] was used and a majority rule

consensus tree was selected.

Table 1 Sequences of primers

and UPL probes used in the

present study

F forward, R reverse, P probe

Amplification type Primer/probe name Primer/probe sequence (50–30)

EOMT genomic and cDNA EOMT-F TGTCGACAGAGCAACTTCTT

EOMT-R GGATAAGCCTCTATGAGAGACC

Sequencing primers internal IS-F TCCCACTTTCACAAACCCAT

IS-R ACAACATGTGGGAGGTCAATA

qPCR—EOMT UPL-EOMT-F GCTTGGAAAGCACCGATAAC

UPL-EOMT-R TGCAGAAGGGATAGACTGGAA

qPCR—Actin UPL-AC-F TCTATAACGAGCTTCGTGTTG

UPL-AC-R GAGGTGCTTCAGTTAGGAGGAC

EOMT probe (UPL probe # 25) EOMT-P TGGAGGAG

Actin probe (UPL probe # 9) Act-P TGGTGAATG

1860 Mol Biol Rep (2014) 41:1857–1870

123

The deduced protein sequences for each chemotype

were further analyzed using ScanSite to know their theo-

retical molecular weights, isoelectric points and multiple

phosphorylation states. Radar and REP were used to check

possible presence of any repeats or specific pattern in the

deduced protein sequences. The protein sequences were

further used for motif prediction using PROSITE and

conserved domains were identified using InterProScan.

Protein domain families were generated with ProDom and

TrEMBL. MotifScan was used to identify catalytic

domains and analyze any motif rearrangement, ATP-GTP

binding motif, class of the methyltransferase catalytic

domain and metal binding domain. Several databases in

MotifScan [32] were used for complete analyses of the

conserved domains. Automated homology model building

of the major domains was performed using the protein

structure modelling program MODELLER [33]. The input

for MODELLER consisted of the aligned sequences of

2QYO (isoflavone O-methyltransferase) and EOMT.

Energy minimization was performed by the steepest des-

cent followed by the conjugate gradient method using a

20 A non-bonded cut-off and a constant dielectric of 1.0.

Evaluation of the predicted model involved analysis of the

geometry and the stereochemistry of the model. The reli-

ability of the model structure was tested using the

ENERGY commands of MODELLER and validated using

the program PROSA [34].

Quantitative real-time PCR

Total RNA was isolated as previously mentioned from all

the seven O. tenuiflorum chemotypes at the four specified

stages of development and callus. The RNA extracts were

treated with deoxyribonuclease I and five micrograms of

the RNA was used for the first-strand cDNA synthesis

using the RevertAid H Minus First Strand cDNA Synthesis

Kit (Fermentas GmbH) as recommended by the manufac-

turer. The synthesized cDNAs were quantified on a Bio-

Photometer (Eppendorf AG). The qPCR experiments were

performed on a Applied Biosystems 7500 Real Time PCR

system using locked nucleic acid (LNA) based short

hydrolysis probes obtained from Universal ProbeLibrary

(Roche Diagnostics GmbH) [35]. The EOMT cDNA

sequence of Ot2 obtained in the present study (EU622049)

was used to design the probe and the primer pairs using the

ProbeFinder software in the UPL Assay Design Center

[36]. Actin (Genbank Accession No. AB002819) was used

as the endogenous control reference gene [37]. The probes

and primer sequences for qPCR of EOMT and Actin are

provided in Table 1. All qPCR were performed in 20 lL

reaction volume using 1 9 FastStart TaqMan Probe Master

[Rox] (Roche Diagnostics GmbH) and 100 ng cDNA. The

96-well optical reaction plates were first incubated at 50 �C

for 2 min, then at 95 �C for 10 min followed by 40 cycles

of 95 �C for 15 s and 60 �C for 1 min. All qPCR experi-

ments were run in three technical replicates with cDNAs

synthesized from duplicate biological samples. Instrument

operation, data acquisition and processing were performed

using sequence detection system v 1.2.2 software. Gene

expression levels were computed relative to the expression

of the reference gene Actin using the 2-DDCT method [38].

Results

Screening and selection of plant materials

The preliminary analysis of the MTBE extracts using GC–

MS provided a snapshot of the several volatile compounds

present among the 18 randomly chosen O. tenuiflorum

plants (Supplementary Table S2). Hotelling’s T2 distribu-

tion was performed after quantification of eugenol, chavi-

col, methyleugenol and methylchavicol to discriminate

among the chemotypes (Fig. 2). Principal component 1

accounts for 55 % of the variation and discriminates the

chemotypes containing only eugenol and methyleugenol

(from the rest chemotypes containing other volatiles as

shown by the score plot (Fig. 2a). Principal component 2

accounts for 33 % of the variation and separated the

chemotypes with higher (3–4:10) eugenol: methyleugenol

ratio (Ot1, Ot2, Ot3, Ot5, Ot6, Ot7 and Ot8) from other

chemotypes (Ot11, Ot12, Ot14 and Ot15) having a com-

paratively lower (1:10) ratio of the same metabolites

(Fig. 2a). The Hotelling’s ellipse graphically indicates the

correlation between the variables (samples) and only one

sample (Ot18) was found as an outlier in the present study.

The above observation was also confirmed from the load-

ing plot (Fig. 2b) that detects the metabolites responsible

for the separation of the chemotypes. Seven particular

chemotypes (Ot1, Ot2, Ot3, Ot5, Ot6, Ot7 and Ot8) that are

rich in eugenol and methyleugenol but devoid of chavicol

and methylchavicol were selected based on PCA results for

further studies.

Developmental stage specific detection of eugenol,

isoeugenol and methyleugenol

Callus samples, on their fourth week of growth, leaf and

inflorescence collected at four different developmental

stages from the seven selected chemotypes of O. tenuiflo-

rum were analyzed by GC–MS to quantitate eugenol, iso-

eugenol and methyleugenol. The total ion chromatograms

shows complete separation of the reference standards of

eugenol, methyleugenol and isoeugenol with retention

times of 11.51, 12.26 and 12.94 min respectively (Sup-

plementary Fig. S2). The m/z values of eugenol and

Mol Biol Rep (2014) 41:1857–1870 1861

123

1862 Mol Biol Rep (2014) 41:1857–1870

123

isoeugenol was 164, and that of methyleugenol was 178.

Caryophyllene (retention time 10.72 min, m/z 41) was also

detected in all samples from all developmental stages

(Supplementary Fig. S2). Both eugenol and methyleugenol

attained maximum concentration during pre-flowering

stage; eugenol content decreased in all the chemotypes

during the subsequent stages (Fig. 3a) whereas, methyl-

eugenol content decreased during flowering stage and

marginally increased during post-flowering stages

(Fig. 3c). Interestingly, isoeugenol concentration showed

maxima during the juvenile stages, followed by sharp

decrease in the latter stages (Fig. 3b). Among the chemo-

types studied Ot2 had the highest whereas Ot7 had the

lowest concentration of the three compounds. The metab-

olites were present at a basal level in the callus cultures of

all the chemotypes.

Analysis of phenylpropanoid and phenylpropenes using

UPLC

The HPLC procedure of Tan et al. [26] was successfully

transferred to UPLC with minor modifications in the

composition of the mobile phases. Separation of chro-

matographic peaks of all the standards was obtained within

a separation time of 6 min (Supplementary Fig. S3i). For

methodological reasons, the present study was restricted to

UV absorbing free intracellular and alkali hydrolysable cell

wall released compounds only.

Four individual phenylpropanoids (caffeic acid, vanillin,

trans-ferulic acid and isoeugenol) were detected in the cell

wall released fraction of O. tenuiflorum (Ot1) after alkali

hydrolysis (Fig. 4a). Five individual phenylpropanoids

(caffeic acid, vanillin, trans-ferulic acid, cinnamyl alcohol

and trans-cinnamic acid) could be determined from the free

intracellular fraction of O. tenuiflorum (Fig. 4b). The

identified compounds showed extreme variations at dif-

ferent developmental stages with the flowering stage hav-

ing the least accumulation. By contrast, several of the

unidentified compounds with retention times of 1.88, 2.03,

2.63 and 3.32 in the cell wall released fractions (Supple-

mentary Fig. S3 ii–vi) and 3.13, 3.33, 3.43 and 3.78 min in

the intracellular fraction (Supplementary Fig. S3 vii–xi)

increased/decreased substantially during different devel-

opmental stages. The most constitutively abundant com-

pound in the cell wall released fraction having the retention

time of 3.43 min showed two fold increase during pre-

flowering, postflowering and callus stages compared

to juvenile and flowering stages (Supplementary Fig. S3

vii–xi).

Analyses of EOMT gene structure and organization

The two overlapping sequences for each chemotype

selected for the study were assembled. Sequence compar-

ison with available sequences in GenBank using BLASTN

revealed extremely high similarity with O. basilicum

b Fig. 2 Score plot a discriminating 18 chemotypes (Ot1–Ot18) of O.

tenuiflorum by using GC/MS based metabolic profiling coupled to

PCA. The ellipse represents Hotelling’s T2 with 95 % confidence in

the score plots. PC1 discriminates eugenol-methyleugenol containing

chemotypes from the other chemotypes and explain 55 % variance,

while PC2 explains 33 % variance and discriminates chemotypes with

higher eugenol: methyleugenol ratio from those with lower ratio of

the same metabolites. Loading plot b showing the metabolites

responsible for the above separation

0

5

10

15

20

25

Eug

enol

con

c. (n

g g-1

FW)

Chemotypes

Juvenile PrefloweringFlowering PostfloweringCallus

0

10

20

30

40

50

60

Isoe

ugen

olco

nc (n

g g-1

FW)

Chemotypes

Juvenile PrefloweringFlowering PostfloweringCallus

0

5

10

15

20

25

30

35

Ot1 Ot2 Ot3 Ot5 Ot6 Ot7 Ot8

Ot1 Ot2 Ot3 Ot5 Ot6 Ot7 Ot8

Ot1 Ot2 Ot3 Ot5 Ot6 Ot7 Ot8

Met

hyle

ugen

ol c

onc.

(ng

g-1FW

)

Chemotypes

Juvenile PrefloweringFlowering PostfloweringCallus

a

b

c

Fig. 3 Accumulation of eugenol (a), isoeugenol (b) and methyleu-

genol (c) at different developmental stages in the seven selected

chemotypes of O. tenuiflorum and from in vitro grown callus samples.

Concentrations of the metabolites are expressed in ng g-1 fresh

weight (FW). Data represent the means ± relative standard deviation

(RSD) of three independent extractions of essential oils through

Clevenger apparatus, each derived from duplicate GC–MS readings

Mol Biol Rep (2014) 41:1857–1870 1863

123

EOMT, CVOMT and more than 80 % similarity with sev-

eral O-methyltransferases. FSPLICE and Spidey confirmed

the presence of an intron of 90 bases from position 719 to

809 on all the genomic DNA sequences and this was in

harmony with its absence in the cDNA sequence of O.

tenuiflorum and O. basilicum as shown by the nucleotide

MSA (Fig. 5). The 50 and 30 donor junction sequences at

the splice junction were identified and confirmed by

GENESCAN. The percentages of G?C and A?T in exons

and introns were determined to be 46.0, 54.0 and 33.2, 66.8

respectively. The EOMT cDNA contained a 603 bp open

reading frame (ORF) and the genomic DNA sequences

except Ot7 contained 843 bp ORF that encoded a protein

of 200 amino acid residues corresponding to a molecular

mass of 22.49 kDa with a theoretical pI value of 8.38. The

chemotype Ot7 had a different reading frame and the ORF

was of 705 bp (Table 2) that encoded a protein of 154

amino acids with a molecular mass of 17.39 kDa and

theoretical pI value of 6.39. Analysis of the genomic DNA

deduced protein sequences using Radar and REP did not

show any specific repeat or pattern.

MSA analysis of the deduced protein sequences from all

genomic DNA sequences suggested that all the predicted

proteins have the same sequence except the chemotype Ot6

which has a valine in place of leucine at position 189

(Fig. 6). The translated protein sequences had two major

motifs, the dimerization superfamily (consisting of 48

amino acids, from position 8 to 56) and

Fig. 4 Histogram showing fold

changes of cell wall released

(a) and free intracellular

(b) phenylpropanoids identified

by UPLC-TUV from the O.

tenuiflorum chemotype Ot1 at

different stages of development.

Data represent the

means ± relative standard

deviation (RSD) of three

independent extractions

1864 Mol Biol Rep (2014) 41:1857–1870

123

methyltransferase_2 superfamily (consisting of 120 amino

acids, from position 74 to 194) which are joined together

through a loop of 18 amino acids (Fig. 6). The O. tenui-

florum EOMT belonged to the DNMT-2 class of methyl-

transferase. All the O. tenuiflorum EOMT genomic DNA

sequences except Ot7 as well as the cDNA sequence had

15 catalytic sites consisting of eight different catalytic

domains, viz. ASN_GLYCOSYLATION (N-glycosylation

site), CK2_PHOSPHO_SITE (Casein kinase II

phosphorylation site), MYRISTYL (N-myristoylation site),

PKC_PHOSPHO_SITE (Protein kinase C phosphorylation

site), SAM_BIND (Sterile Alpha Motif and some other

nucleotide binding motif), Dimerisation (Dimerisation

domain), Nramp (Natural resistance-associated macro-

phage protein) and Methyltransf_2 (O-methyltransferase)

(Table 2). Chemotype Ot7 lacked both the dimerisation

domains completely and had a single PKC_PHO-

SPHO_SITE. MotifScan did not show the presence of any

Fig. 5 Comparison of the seven O. tenuiflorum EOMT genomic

DNA sequences (Ot1-EU622042, Ot2-EU622043, Ot3-EU622044.

Ot5-EU622045, Ot6-EU622046, Ot7-EU622047 and Ot8-

EU622048), cDNA sequence of Ot2-EU622049 and cDNA sequence

of O. basilicum (AF435008). Asterisks indicate identical nucleotides

in all sequences. Start and stop codons are indicated by green and

pink arrowheads respectively. The methyltransferase domain (MT) is

shadowed

Mol Biol Rep (2014) 41:1857–1870 1865

123

ATP/GTP/metal binding domain, leucine rich region or any

signal peptide. The PDB file provided the homology model

of EOMT that showed two distinct domains consisting of

Methyltransferase-2 towards the N-terminus and Dimeri-

sation towards the C-terminus (Fig. 7). A necessary pre-

requisite to understand the molecular function of any

protein, is deciphering its 3D structure. To create a 3D

structure of EOMT, a BLASTP search was performed in

protein databases for proteins with similar sequence and

known 3D structure. On the basis of blast results isoflavone

O-methyltransferase (2QYO) was selected as the template.

The 3D structure generated by MODELLER, was validated

with PROSA (z score of -5.7, Supplementary Fig. S4) and

the results were in the range of native conformations of

other experimentally determined protein structures of the

same size [34]. Validity of the generated 3D structure was

further confirmed by PROCHECK (Supplementary Fig.

S5). The 3D structures of EOMT of the chemotypes Ot2

and Ot7 were shown to be clearly superimposed with the

template 2QYO as visualized through UCSF Chimera

(https://www.cgl.ucsf.edu/chimera/) in Supplementary Fig.

S6.

The phylogenetic tree presented in Fig. 8 was obtained

by comparing the deduced amino acid sequences of the

seven O. tenuiflorum chemotypes with other O-methyl-

transferses sharing at least 54 % similarity obtained by

BLASTP. The orcinol O-methyltransferase (OOMT) from

Rosa bracteata was used as out-group. The seven O. ten-

uiflorum predicted EOMT protein sequences clustered into

a single clade, although Ot7 is less closely related to the

other chemotypes. Strong sequence similarity between O.

tenuiflorum EOMT and O. basilicum EOMT and CVOMT

sequences (89–96 %) indicate that these sequences are

likely to be orthologous.

Table 2 Analysis of EOMT genomic DNA sequences of the seven chemotypes of O. tenuiflorum and the cDNA sequence of chemotype Ot2

using InterProScan

Chemotypes

Ot1 Ot2 Ot3 Ot5 Ot6 Ot7 Ot8 Ot2 cDNA

NCBI Accession No. EU 622042 622043 622044 622045 622046 622047 622048 622049

Sequence length 1,043 1,030 1,040 1,066 1,070 1,051 1,044 979

ORF position 14–1,025 1–1,012 14–1,025 14–1,025 14–1,025 151–1,024 14–1,025 15–617

ORF length 843 843 843 843 843 705 843 603

(G?C) % 46.0 45.0 46.0 45.0 46.0 46.0 45.0 46.0

Names and numbers of catalytic domains

ASN_GLYCOSYLATION 1 1 1 1 1 1 1 1

CK2_PHOSPHO_SITE 3 3 3 3 3 3 3 3

MYRISTYL 3 3 3 3 3 3 3 3

PKC_PHOSPHO_SITE 2 2 2 2 2 1 2 2

SAM_BIND 1 1 1 1 1 1 1 1

Dimerisation 2 2 2 2 2 – 2 2

Methyltransf_2 2 2 2 2 2 2 2 2

Nramp 1 1 1 1 1 1 1 1

The full forms of all the catalytic domains are mentioned in the text

Fig. 6 Alignment of deduced amino acid sequence from the seven

EOMT genomic DNAs of O. tenuiflorum. The asterisks indicate

identical amino acids in all sequences and the missing asterisks at

position 189 point out a change from leucine to valine in chemotype

Ot6. Shadows at the bottom specify the position of dimerisation and

methyltransferase-2 domain

1866 Mol Biol Rep (2014) 41:1857–1870

123

EOMT expression at different developmental stages

To investigate the transcript profiling pattern of EOMT,

qPCR analysis of steady-state mRNA levels were carried

out from leaves and inflorescences as well as calli of the

seven chemotypes of O. tenuiflorum. EOMT transcripts

were dynamic, found to be differentially expressed in a

developmental stage specific up- or down-regulated man-

ner and varied considerably among the chemotypes

(Fig. 9). Transcripts from calli of all chemotypes displayed

the least accumulation of EOMT cDNAs and hence tran-

scripts from Ot1 callus were used as calibrator to determine

relative gene expression levels.

The EOMT transcripts, in general, accumulated at high

levels in juvenile plants and increased to even higher levels

during preflowering in all the seven chemotypes. The

chemotype Ot2 showed the highest transcript accumula-

tion, whereas Ot7 had the lowest (Fig. 9). The other

chemotypes had an intermediate abundance of EOMT

transcript. The abundance of the transcripts sharply

decreased during flowering stages and further declined at

postflowering stages in all the chemotypes. A cumulative

gene expression data is provided in Supplementary Table

S3.

Discussion

The O-methyltransferases are ubiquitous and widely con-

served during evolution [12] and are classified based on

their functions [15]. The crystal structures of several

methyltransferases of isoflavone biosynthesis had been

worked out in detail [39], but limited information is

available on the structures of EOMT genes and their

expression patterns [16, 22]. RNA gel blot analysis showed

higher expression of EOMT and CVOMT genes in smaller

Fig. 7 The predicted 3D structure of Ot2 EOMT shown as colour-

ramped ribbon diagram with dimerisation domain (red) towards the

N-terminus and methyltransferase domain (green) towards the

C-terminus shown by legends on the figure. (Color figure online)

Fig. 8 Relatedness among the predicted amino acid sequences of

EOMT from O. tenuiflorum chemotypes to other O-methyltransfer-

ases of other species, as indicated by percentage similarity over the

whole sequence. GenBank Accession No used are: O. basilicum

EOMT (Q93WU3), O. basilicum CVOMT (BAG83234), Medicago

truncatula isoflavon O-methyltransferase (IOMT, ABD83947), Men-

tha piperita Flavon O-methyltransferase (FOMT, AAR09598), Rosa

marretii orcinol O-methyltransferase (OOMT, CAJ65641) and Rosa

bracteata OOMT (CAJ65609) that was used as an outgroup. The

figures on branch points denote the bootstrap values

Fig. 9 Relative EOMT cDNA concentration assessed by qPCR at

different developmental stages and callus of the seven chemotypes of

O. tenuiflorum. Data were normalized with Actin cDNA and the

cDNA from Ot2 callus was used as calibrator to determine gene

expression levels. Bars represent relative standard deviations

Mol Biol Rep (2014) 41:1857–1870 1867

123

(0.5 and 1.0 cm long) leaves as compared to larger (3 cm

long) leaves [16]. In the present study the cDNA as well as

genomic DNA of EOMT gene were isolated, sequenced

and analyzed using bioinformatics tools, with emphasis on

the structural and functional analysis of the gene.

The in silico analysis of the O. tenuiflorum EOMT

sequences showed that it belonged to the DNA methyl-

transferase 2 (DNMT2) class. The predicted EOMT protein

had eight catalytic domains of which the major were two

copies of methyltransferase_2 domain that is responsible

for O-methylation. The EOMT genomic DNA sequence of

chemotype Ot7 had a reduced coding region, due to the

absence of both dimerisation domains. These domains play

important roles in related protein–protein interactions to

generate functional diversity among the proteins [40]. The

chemotype Ot7 also had a single PKC_PHOSPHO_SITE

domain as compared to two in the other chemotypes. These

protein kinase enzymes possess a catalytic subunit that

transfer the gamma phosphate of ATP to a C-terminal basic

amino acid residue like serine or threonine, resulting in a

change in conformation that alter the protein function [41].

The absence of these two catalytic domains as well as

reduced expression of EOMT transcripts in the chemotype

Ot7 might be reflected in the low accumulation of meth-

yleugenol as compared to the other chemotypes. Difference

in methyleugenol content may also be due to differences in

eugenol availability at substrate level, and may exhibit a

substrate level control. It is interesting to note that though

the amount of eugenol and isoeugenol in Ot7 was slightly

less than Ot6 and Ot8 at all the developmental stages; the

reduced accumulation of methyleugenol in Ot7 compared

to the other chemotypes indicates low enzymatic O-

methylation.

The other catalytic domains, Nramp (a membrane pro-

tein with consensus transport signatures), SAM_BIND (a

70 amino acid protein that participate in protein–protein,

protein–lipid and protein–RNA interaction), MYRISTYL

(an irreversible co-translational protein modification where

a myristoyl group derived from myristic acid is attached to

an N-terminal amino acid of a nascent polypeptide),

ASN_GLYCOSYLATION (attaches glycosyl groups to

protein and enhances its activity) and CK2 phosphorylation

(phosphorylate acidic proteins like casein) existed uni-

formly in all the chemotypes.

To obtain a wide spectrum of metabolites related to the

present study, both GC–MS and UPLC were considered.

GC–MS allowed rapid screening and identification of the

chemotypes rich in eugenol and methyleugenol but com-

pletely devoid of chavicol and methylchavicol. The

screening of the proper chemotypes was a requirement for

this study to be sure enough to exclude chavicol-methylc-

havicol containing chemotypes, since at the transcript and

gene level it is very difficult to differentially amplify

EOMT from CVOMT sequences [16]. PCA, the clustering

method that acts to reduce dimensionality of multivariate

data without altering variance [42] was employed in the

present study. The principal components displayed on a

score plot provide the relatedness of the samples included

for the study. The PCA data was scaled to produce a

covariance matrix where the loading plot retained the scale

of the original data and displayed the specific metabolites

responsible for the separation of the principal components

[42]. The developmental stage specific studies showed

copious amounts of isoeugenol in the juvenile stage and its

concentration sharply decreased during the later develop-

mental stages. This indicates a carbon flux from isoeugenol

to eugenol during the transition from juvenile to pre-

flowering stages. In contrast, eugenol and methyleugenol,

that were less abundant during the juvenile stage, accu-

mulated highest in the preflowering stage, but decreased in

the later developmental stages.

The phenylpropanoid pathway is responsible for the

synthesis of a wide range of secondary metabolic com-

pounds having roles in plant protection. Separation of

various phenylpropanoids from plants often becomes dif-

ficult due to the intermolecular interactions of the –OH

groups between the individual compounds [43], wide

structural variation of the compounds and formation of

dimers and trimers [44]. The advent of UPLC has drasti-

cally reduced retention times for many plant metabolites

[45, 46]. Simultaneous separation and detection of six

phenylpropanoids from O. tenuiflorum were possible using

UPLC in the present study. Phenylpropanoids like ferulic

acid and hydroxycinnamates are non-lignin components of

primary cell wall of many plants and appear to be directly

linked to growth and enhanced fitness of plants even under

stressful conditions via a trade-off based mechanism [47].

A fourfold variation in ferulic acid contents was observed

among the cell wall released phenylpropanoids; the pre-

flowering and postflowering stages displayed higher accu-

mulations, while juvenile stage had the minimum

accumulation. Ferulic acid, in intracellular fraction

remained almost unaltered throughout the different devel-

opmental stages. On the other hand trans-cinnamic acid,

that was present in very high amounts in the intracellular

fraction during preflowering and postflowering stages in O.

tenuiflorum, was totally absent in cell wall released frac-

tions in all developmental stages. Since many of the dif-

ferentially accumulated phenylpropanoids in the present

investigation remained largely unidentified due to the lack

of reference standards and the absence of a mass spec-

trometer, their role in plant development remain unclear

and warrant further investigations.

Improved qPCR sensitivity and specificity for gene

expression studies was achieved by using LNA based short

hydrolysis probes that discriminates single base

1868 Mol Biol Rep (2014) 41:1857–1870

123

mismatches. The EOMT transcript levels quantified in

leaves and inflorescences of O. tenuiflorum at different

stages of development using qPCR in the present study,

revealed high developmental stage specificity of EOMT

expression. Significant differences in expression patterns

were observed among the chemotypes, reflecting altered

capacity to build-up the final metabolite methyleugenol.

The higher level of EOMT transcripts during juvenile and

preflowering stages and slightly lower level at flowering

stage could be correlated to higher contents of eugenol and

methyleugenol in the respective developmental stages of

all chemotypes. Conversely, the remarkable decrease of

EOMT transcripts at postflowering stages of several

chemotypes indicate extensive transcriptional reprogram-

ming associated with decreased accumulation of the

metabolites.

Acknowledgments This work was supported by Departmental

Grants of BIT Mesra. The authors are thankful to BTISNET SubDIC

(BT/BI/04/065/04) for providing facilities for bioinformatics analyses

and the Government of Jharkhand, Department of Agriculture (5/

B.K.V/Misc/12/2001) for providing infrastructure development fund.

Fellowships were provided to IKR by BIT-Mesra and IH by CSIR [9/

554 (13) 2007-EMR-I].

References

1. Simon JE, Morales MR, Phippen WB, Vieira RF, Hao Z (1999)

Basil: a source of aroma compounds and a popular culinary and

ornamental herb. In: Janick J (ed) Perspectives on new crops and

new uses. ASHS Press, Alexandria, pp 499–505

2. WHO monographs on selected medicinal plants (2002) Folium

Ocimi Sancti. 2:206–216

3. Agnieszka K, Kurowska A, Danuta K (2005) Composition of the

essential oil of Ocimum sanctum L. grown in Poland during

vegetation. J Essent Oil Res 17:217–219. doi:10.1080/10412905.

2005.9698880

4. Lange BM, Wildung MR, Stauber EJ, Sanchez C, Pouchnik D,

Croteau R (2000) Probing essential oil biosynthesis and secretion

by functional evaluation of expressed sequence tags from mint

glandular trichomes. Proc Natl Acad Sci USA 97:2934–2939.

doi:10.1073/pnas.97.6.2934

5. Kothari SK, Bhattacharya AK, Ramesh S (2004) Essential oil

yield and quality of methyl eugenol rich Ocimum tenuiflorum L.f.

(syn. O. sanctum L.) grown in south India as influenced by

method of harvest. J Chromatogr A 1054:67–72. doi:10.1016/j.

chroma.2004.03.019

6. Vieira RF, Grayer RJ, Paton A, Simon JE (2001) Genetic

diversity of Ocimum gratissimum L. based on volatile oil con-

stituents, flavonoids and RAPD markers. Biochem Syst Ecol

29:287–304. doi:10.1016/S0305-1978(00)00062-4

7. Jirovetz L, Buchbauer G, Shafi MP, Kaniampady MM (2003)

Chemotaxonomical analysis of the essential oils aroma com-

pounds of four different Ocimum species from southern India. Eur

Food Res Technol 217:120–124. doi:10.1007/s00217-003-0708-1

8. Vina A, Murillo E (2003) Essential oil composition from twelve

varieties of Basil (Ocimum spp.) grown in Colombia. J Braz

Chem Soc 14:744–749. doi:10.1590/S0103-50532003000500008

9. Dixon RA, Achnine L, Kota P, Liu C-J, Reddy MSS, Wang L

(2002) The phenylpropanoid pathway and plant defence—a

genomics perspective. Mol Plant Pathol 3:371–390. doi:10.1046/

j.1364-3703.2002.00131.x

10. Hahlbrock K, Scheel D (1989) Physiology and molecular biology

of phenylpropanoids metabolism. Annu Rev Plant Physiol Plant

Mol Biol 40:347–369. doi:10.1146/annurev.arplant.40.1.347

11. Vogt T (2010) Phenylpropanoid biosynthesis. Mol Plant 3:2–20.

doi:10.1093/mp/ssp106

12. Ibrahim RK, Bruneau A, Bantignies B (1998) Plant O-methyl-

transferases: molecular analysis, common signature and classifi-

cation. Plant Mol Biol 36:1–10. doi:10.1023/A:1005939803300

13. Prakash P, Gupta N (2005) Therapeutic uses of Ocimum sanctum

Linn (Tulsi) with a note on eugenol and its pharmacological

actions: a short review. Indian J Physiol Pharmacol 49:125–131

14. Obeng-Ofori D, Reichmuth CH (1997) Bioactivity of eugenol, a

major component of essential oil of Ocimum suave (wild) against

four species of stored product Coleoptera. Int J Pest Manag

43:89–94. doi:10.1080/096708797229040

15. Wang J, Pichersky E (1999) Identification of specific residue

involved in substrate discrimination in two plant O-methyl-

transferases. Arch Biochem Biophys 368:172–180. doi:10.1006/

abbi1999.1304

16. Gang DR, Lavid N, Zubieta C, Chen F, Beuerle T, Lewinsohn E,

Noel JP, Pichersky E (2002) Characterization of phenylpropene

O-methyltransferases from sweet basil: facile changes of sub-

strate specificity and convergent evolution within a plant O-

methyltransferase family. Plant Cell 14:505–519. doi:10.1105/

tpc.010327

17. Koeduka T, Fridman E, Gang DR, Vassao DG, Jackson BL, Kish

CM, Orlova I, Spassova SM, Lewis NG, Noel JP, Baiga TJ,

Dudareva N, Pichersky E (2006) Eugenol and isoeugenol, char-

acteristic aromatic constituents of spices, are biosynthesized via

reduction of a coniferyl alcohol ester. Proc Natl Acad Sci USA

103:10128–10133. doi:10.1073/pnas.0603732103

18. Yamazaki M, Nakajima J, Yamanashi M, Sugiyama M, Makita

Y, Springob K, Awazuhara M, Saito K (2003) Metabolomics and

differential gene expression in anthocyanin chemo-varietal forms

of Perilla frutescens. Phytochemistry 62:987–995. doi:10.1016/

S0031-9422(02)00721-5

19. Carrari F, Baxter C, Usadel B, Urbanzyk-Wochniak E, Zanor MI,

Nunes-Neri A, Nikiforova V, Centero D, Ratzka A, Pauly M,

Sweetlove LJ, Fernie AR (2006) Integrated analysis of metabolite

and transcript levels reveal the metabolite shifts that underlie

tomato fruit development and highlight regulatory aspects of

metabolic network behavior. Plant Physiol 142:1380–1396.

doi:10.1104/pp.106.088534

20. Jumtee K, Bamba T, Okazawa A, Fukusaki E, Kobayashi A (2008)

Integrated metabolite and gene expression profiling revealing

phytochrome A regulation of polyamine biosynthesis of Arabi-

dopsis thaliana. J Exp Bot 59:1187–1200. doi:10.1093/jxb/ern026

21. Roessner U, Bowne J (2009) What is metabolomics all about?

Biotechniques 46:363–365. doi:10.2144/000113133

22. Iijima Y, Davidorich-Rikanati R, Fridman E, Gang DR, Bar E,

Lewinsohn E, Pichersky E (2004) The biochemical and molecular

basis for the divergent patterns in the biosynthesis of terpenes and

phenylpropenes in the peltate glands of three cultivars of Basil.

Plant Physiol 136:3724–3736. doi:10.1104/pp.104.051318

23. Tyssø V, Esbensen K, Martens H (1987) UNSCRAMBLER, an

interactive program for multivariate calibration and prediction.

Chemometr Intell Lab 2:239–249. doi:10.1016/0169-7439(87)

80102-8

24. Murashige T, Skoog F (1962) A revised medium for rapid growth

and bioassays with tobacco tissue cultures. Physiol Plantarum

15:473–497. doi:10.1111/j.1399-3054.1962.tb08052.x

Mol Biol Rep (2014) 41:1857–1870 1869

123

25. Santiago R, Butron A, Arnason JT, Reid LM, Sauto XC, Malvar

RA (2006) Putative role of pith cell wall phenylpropanoids in

Sesamia nonagrioides (Lepidoptera: Noctuidae) resistance.

J Agric Food Chem 54:2274–2279. doi:10.1021/jf0524271

26. Tan J, Bednarek P, Liu J, Schneider B, Svatos A, Hahlbrock K

(2004) Universally occurring phenylpropanoids and species spe-

cific indolic metabolites in infected and uninfected Arabidopsis

thaliana roots and leaves. Phytochemistry 65:691–699. doi:10.

1016/j.phytochem.2003.12.009

27. Haque I, Bandopadhyay R, Mukhopadhyay K (2008) An opti-

mised protocol for fast genomic DNA isolation from high sec-

ondary metabolite and gum containing plants. Asian J Plant Sci

7:304–308. doi:10.3923/ajps.2008.304.308

28. Larkin MA, Blackshields G, Brown NP (2007) Clustal W and

Clustal X version 2.0. Bioinformatics 23:2947–2948. doi:10.

1093/bioinformatics/btm404

29. Felsenstein J (2002) Quantitative characters, phylogenies, and

morphometrics, In: MacLeod N (ed) Morphology, shape and

phylogenetics. Systematics Association 64:27–44. doi:10.1201/

9780203165171.ch3

30. Jones DT, Taylor WR, Thornton JM (1992) The rapid generation

of mutation data matrices from protein sequences. Comput Appl

Biosci 8:275–282. doi:10.1093/bioinformatics/8.3.275

31. Saitou N, Nei M (1987) The neighbour–joining method: a new

method for reconstructing phylogenetic trees. Mol Biol Evol

4:406–425

32. Naughton BT, Fratkin E, Batzoglou S, Brutlag DL (2006) A

graph-based motif detection algorithm models complex nucleo-

tide dependencies in transcription factor binding sites. Nucleic

Acids Res 34:5730–5739. doi:10.1093/nar/gkl585

33. Sali A, Blundell T (1993) Comparative protein modelling by

satisfaction of spatial restraints. J Mol Biol 234:779–815. doi:10.

1006/jmbi1993.1626

34. Wiederstein M, Sippl MJ (2007) ProSA-web: interactive web

service for the recognition of errors in three-dimensional struc-

tures of proteins. Nucleic Acids Res 35:407–410. doi:10.1093/

nar/gkm290

35. Rein RS, Mauritz RP, Geyer M (2006) Universal ProbeLibrary: a

new concept for streamlining gene expression analysis with

qPCR. Nat Method Appl Notes. doi:10.1038/an1341

36. Horst I, Peterhansel C (2007) Quantification of Zea mays mRNAs

by real-time PCR using the Universal Probe Library. Biochemica

1:8–10

37. Paolacci AR, Tanzarella OA, Porceddu E, Ciaffi M (2009)

Identification and validation of reference genes for quantitative

RT-PCR normalization in wheat. BMC Mol Biol. doi:10.1186/

1471-2199-10-11

38. Livak KJ, Schmittgen TD (2001) Analysis of relative gene

expression data using real-time quantitative PCR and the 2T-DDC

method. Methods 25:402–408. doi:10.1006/meth.2001.1262

39. Wang X (2011) Structure, function, and engineering of enzymes

in isoflavonoid biosynthesis. Funct Integr Genomics 11:13–22.

doi:10.1007/s10142-010-0197-9

40. Marchler-Bauer A, Anderson JB, Chitsaz F (2009) CDD: specific

functional annotation with the conserved domain database.

Nucleic Acids Res 37:205–210. doi:10.1093/nar/gkn845

41. Mellor H, Parker PJ (1998) The extended protein kinase C

superfamily. Biochem J 332:281–292

42. Choi YH, Tapias EC, Kim HK, Lefeber AWM, Erkelens C,

Verhoeven ThJJ, Brzin J, Zel J, Verpoorte R (2004) Metabolic

discrimination of Catharanthus roseus leaves infected by phy-

toplasma using 1H-NMR spectroscopy and multivariate data ana-

lysis. Plant Physiol 135:2398–2410. doi:10.1104/pp.104.041012

43. Klejdus B, Vacek J, Lojkova L, Benesova L, Kuban V (2008)

Ultrahigh-pressure liquid chromatography of isoflavones and

phenolic acids on different stationary phases. J Chromatogr A

1195:52–59. doi:10.1016/j.chroma.2008.04.069

44. Quirantes-Pine R, Funes L, Micol V, Segura-Carretero A, Fern-

andez-Gutierrez A (2009) High-performance liquid chromatog-

raphy with diode array detection coupled to electrospray time-of-

flight and ion-trap tandem mass spectrometry to identify phenolic

compounds from a lemon verbena extract. J Chromatogr A

1216:5391–5397. doi:10.1016/j.chroma.2009.05.038

45. Yoshida T, Majors RE (2006) High-speed analyses using rapid

resolution liquid chromatography on 1.8-lm porous particles.

J Sep Sci 29:2421–2432. doi:10.1002/jssc.200600267

46. Haque I, Kumar M, Mukhopadhyay K (2009) A rapid and simple

UPLC-MS-MS based simultaneous determination of the medici-

nally important E- and Z-guggulsterone from oleo-gum resins of

naturally occurring Commiphora wightii plants. Chromatographia

70:1613–1619. doi:10.1365/s10337-009-1347-x

47. Foyer CH, Noctor G, van Emden HF (2007) An evaluation of

making specific secondary metabolites: does the yield penalty

incurred by host plant resistance to insects result from competi-

tion for resources? Int J Pest Manag 53:175–182. doi:10.1080/

09670870701469146

1870 Mol Biol Rep (2014) 41:1857–1870

123