haracterization of a Cryptosporidium parvum protein that binds single-stranded-strand telomeric DNA�
hang Liua,∗, Liangjie Wanga, Cheryl A. Lanctob, Mitchell S. Abrahamsenb
Li Ka Shing Faculty of Medicine, The University of Hong Kong, 105 Estate Building, 10 Sassoon Road, Hong Kong, ChinaDepartment of Veterinary PathoBiology, College of Veterinary Medicine, University of Minnesota, 295 Animal Science/Veterinary Medicine,988 Fitch Avenue, St. Paul, MN 55108, USA
r t i c l e i n f o
rticle history:eceived 21 November 2008eceived in revised form 22 January 2009ccepted 26 January 2009vailable online 4 February 2009
eywords:ryptosporidium parvumingle-stranded G-strandelomeric DNA binding protein
a b s t r a c t
We have initiated a project to characterize telomere-associated proteins of Cryptosporidium parvum.Searching public databases with C. parvum expressed sequence tag (EST) sequences revealed one ESTsequence that is highly similar to Gbp1p of Chlamydomonas reinhardtii (Cr Gbp1p), a protein that bindssingle-stranded telomeric DNA. This EST was used to clone a gene encoding a 198 amino acids long protein(CpGbp). Sequence analysis suggested that CpGbp contains two RNA recognition motif (RRMs) domainslinked with a short hinge region. RT-PCR analysis showed that the mRNA expression of CpGbp was up-and down-regulated significantly comparing to that of CpDNAPol, suggesting a potential role of CpGbpplaying in the parasite’s life cycle. In Western blot analysis, monoclonal antibody against recombinantCpGbp identified one band (∼23 kDa) specifically from cell extracts of C. parvum sporozoites. Confocalmicroscopy analysis with anti-CpGbp antibody localized CpGbp proteins to the nucleus, consistent withits potential role in telomere length regulation. In electrophoretic mobility shift assays (EMSAs), recom-
binant CpGbp bound oligonucleotide TG3 that bears three copies of C. parvum telomeric DNA G-strandrepeat “TTTAGG”, but not C-strand or double-stranded telomeric DNA sequences. To map the bindingdomain and to define the binding site of CpGbp, we constructed four CpGbp deletion mutants and syn-thesized ten TG3 mutants and tested their binding affinities by EMSAs. We found that only the RRMdomain at N-terminus has oligonucleotide-binding ability in vitro. And the minimal sequence necessary
TTAGc DNA
for CpGbp’s binding is “GTsingle-stranded telomeri
. Introduction
Cryptosporidium parvum is one of several protozoan genera inhe phylum Apicomplexa. This obligate intracellular parasite pri-
arily infects the microvillous border of the intestinal epitheliumnd, to a lesser extent, of the extraintestinal epithelia, causingcute gastrointestinal disease in a wide range of mammalian hosts1]. C. parvum has a complex life cycle that is composed of mul-iple exogenous and endogenous developmental stages [1]. Thexogenous stage consists of oocyst, each of which contains fourporozoites. After infection, each sporozoite parasitizes epithelial
ells and differentiates into a trophozoite. Asexual multiplicationcalled schizogony or merogony) is composed of a cycle of tropho-oite, type I meront and type I merozoite. Type I merozoite can alsonitiate the sexual multiplication (called gametogony) and proceed
� Note: Nucleotide sequence data reported in this paper are available in theenBankTM under the accession number: AY189527.∗ Corresponding author. Tel.: +852 9806 2110; fax: +852 2816 2293.
through a series of developmental stages including type II meront,type II merozoite, microgamont or macrogamont, and correspond-ing microgamete or macrogamete which fertilize to produce matureoocyst that sporulates in situ. C. parvum can undergo asexual andsexual replication in a rapid and unlimited manner in vivo. Since C.parvum’s genome consists of eight linear chromosomes, an effec-tive mechanism to replicate its chromosome ends and maintaintelomeric length is essential.
The extremities of eukaryotic chromosomes are composed ofspecialized DNA–protein complexes called telomeres, which con-tains both telomeric DNA and telomere binding proteins [2]. Themost important function of telomeres is to maintain the integrityof linear chromosomes [3], protect chromosome ends from degra-dation [3] and facilitate complete DNA replication (reviewed in[4]). Telomeric DNA can be divided into three different domains,the telomere associated sequences, double-stranded (ds) telom-
ere repeats and the 3′ single-stranded (ss) guanine-rich strand(G-strand) overhang [5]. The DNA strand complementary to theG-strand is termed C-strand. The double-stranded DNA and single-stranded DNA regions present in telomeres vary considerably inlength across eukaryotes, with the double-stranded DNA region
ypically occupying >90% of the total telomere length (see review6]. The 3′ single-stranded overhang has been observed in differ-nt eukaryotic kingdoms. It is involved in forming both t-loops [7]nd stable G-quadruplex structures [8,9] and has been proposed toarticipate in a regulatory mechanism for packaging and protectingelomere ends (for review, see [10]).
Several families of single-stranded telomeric DNA binding pro-eins have been identified. One family of the proteins have beenstablished through the identification and biochemical character-zation of their respective single-stranded DNA Binding DomainsDBDs) (reviewed in [6]). These proteins have many functionsncluding protecting conserved 3′ single-stranded telomere over-ang from inappropriate processing and misrecognition as DNAamage [11]; regulating telomerase activity [12,13], coordinatinghe synthesis of lagging strand [14], determining the terminatingequence produced by lagging strand resection [11] and regulating-quadruplex structures at telomere ends [8,9,15]. Another groupf proteins are found to contain RNA binding domain (RBD) or RNAecognition motif (RRM). These group of proteins, represented byeterogeneous nuclear ribonucleoproteins (hnRNP), have centraloles in DNA repair, telomere biogenesis, cell signaling and regulat-ng gene expression at both transcriptional and translational levelsreviewed in [16]). Several observations suggest that hnRNPs aremportant for telomere biology. Firstly, hnRNP A1, D, C1/C2 are capa-le of interacting with the human telomerase holoenzyme [17–19].econdly, hnRNPs A1, A2-B1, D and E and hnRNP homologous pro-eins from other organisms can associate with the single-strandedelomeric sequence in vitro [20–22]. Thirdly, hnRNPs includinghose found to associate with telomerase and telomeres are inte-ral components of the nuclear matrix [23–25]. And last, shortelomeres in hnRNP A1 deficient mouse CB3 cells are elongatedfter reconstituting hnRNP A1 expression [19]. A model for het-rogeneous nuclear ribonucleoproteins in telomere and telomeraseegulation has also been proposed based on these observations [26].
Previously, we isolated and characterized C. parvum telomericNA sequences [27] and C. parvum telomerase gene (unpublishedata), suggesting that C. parvum utilize a conserved telomerase-ased mechanism for its telomeric DNA replication. We are thus
nterested to understand how the replication and length mainte-ance of telomeric DNA are regulated through C. parvum’s complex
ife cycle. In addition, considering the resemblance of C. parvumo cancer cells in terms of unlimited cellular proliferation, we arelso interested to investigate whether or not telomerase and itsssociated proteins represent potential drug targets for inhibiting. parvum‘s proliferation, similar to those human proteins proposeds anticancer targets [28]. Due to current technical difficulty inbtaining sufficient amount of C. parvum cell extracts for direct bio-hemical characterization, we adopted a sequence-based approacho systematically identify and characterize C. parvum sequenceshat are similar to previously characterized telomere associatedroteins with sequences generated from a pilot study [29] of thehole genome sequencing project of C. parvum [30]. In the cur-
ent study, we report the biochemical characterization of a putativeingle-stranded telomeric DNA binding protein that shows highegree of similarity to the single-stranded telomeric DNA bindingrotein Gbp1p of Chlamydomonas reinhardtii (Cr Gbp1p) [21,31], andeveral human hnRNPs.
. Materials and methods
.1. Reagents
C. parvum oocysts (Iowa isolate) were originally obtained from. Sterling, University of Arizona, Tucson. Oligonucleotides wereynthesized at the Integrated DNA Technologies, Inc. (Coralville, IA,SA) and Tech Dragon Ltd. (Hong Kong).
arasitology 165 (2009) 132–141 133
2.2. Preparation of cell extracts from C. parvum and humanadenocarcinoma cell line (HCT-8)
C. parvum oocysts (5 × 108) stored in potassium dichronate werewashed five times by centrifugation at 3500 × g for 10 min at 4 ◦Cin phosphate-buffered saline (PBS). After the final wash, oocystswere resuspended in 500 �l CHAP’s buffer (1 mM Tris–HCL, pH7.5; 1 mM MgCl2; 1 mM EGTA; 0.1 mM benzamidine; 5 mM �-mercaptoethanol; 0.5% CHAPS; 10% glycerol). The suspension waslysed in a FRENCHPRESS mini-cell (FRENCH® PRESS, SLM Instru-ments, Inc., Rochester, NY) twice at 20,000 psi. Cell debris wasremoved by centrifugation at 12,000 × g for 30 min, and the super-natant was aliquoted and stored at −70 ◦C until use. Human HCT-8cells were cultured and infected with C. parvum oocysts (5 × 108) aspreviously described [32–34]. C. parvum-infected HCT-8 cells werethen collected, resuspended in 500 �l CHAPS buffer and lysed in aFRENCHPRESS mini-cell described above. Cell debris was removedby centrifugation at 12,000 × g for 30 min, and the supernatant wasaliquoted and stored at −70 ◦C until use.
2.3. Cloning and sequence analysis of CpGbp gene
This work was carried out before the C. parvum whole genomesequencing project [30] was initiated. Briefly, a C. parvum EST(AA532259) sequence was found similar to that of Cr Gbp1 throughdatabase search. Oligonucleotide primers (CpGbp3 and CpGbp4)were designed based on this EST sequence to amplify a 410 bplong C. parvum genomic DNA fragment by PCR. The fragment waslabelled by nick translation and used as probe to screen a genomicDNA library constructed with BamHI-restricted genomic DNA frag-ments [35] in lambda DASH vector (Stratagene, La Jolla, CA). Apositive phage clone was identified after screening the library andDNA from the phage clone was purified using QIAGEN lambdastarter kit (QIAGEN, Chatsworth, CA) following the manufacturer’srecommendations. The DNA was digested with XbaI, and sub-cloned into plasmid pBluescript SK II+ (Stratagene, La Jolla, CA).Southern blot analysis identified one clone that hybridized withthe probe and carried a 6 kb-long XbaI-restricted DNA fragment.The DNA fragment was then sequenced using a primer walkingstrategy to obtain the full length of the target gene, which wasfurther confirmed by the C. parvum whole genome sequenceswhen they became available. Sequence editing and assembly wereperformed using EditSeq and SeqMan (DNASTAR, Inc., Madison,WI). Public databases, including GenBank, EMBL, PIR, SWISS-PROT,PROSITE and Profile Library (as part of GCG Wisconsin Package Ver-sion 10.1, Genetics Computer Group, Madison, WI) were searchedfor similarity of CpGbp to known sequences and motifs usingprograms BLAST, MOTIFS and PROFILESCAN (GCG). The 3D struc-tures of the peptides were predicted using 3D-JIGSAW website(http://bmm.cancerresearchuk.org/∼3djigsaw/), and the predictedstructure was viewed using RasMol (Version 2.7.4.2).
2.4. Semi-quantitative RT-PCR
Culturing HCT-8 cells, Infection of HCT-8 cells with C. parvumsporozoites, isolation of total RNA from mock or C. parvum-infectedHCT-8 cells and quantitative RT-PCR experiments were preformedas previously described [35,36]. Briefly, RNA was isolated frommock or C. parvum-infected HCT-8 cells at 6, 12, 24, 48 and 72 hpost-infection (pi) from three sets of independent time-courseexperiments. The reverse transcription was performed in exactly
the same way described before. For each PCR reaction used toamplify CpGbp or CpDNAPol genes, 2 �l cDNA product was incu-bated with 1 �M specific primers (Table 1) in a reaction setupthat was otherwise identical to that described previously. ThecDNA product was diluted 50 times in each PCR reaction used
134 C. Liu et al. / Molecular & Biochemical Parasitology 165 (2009) 132–141
Table 1Oligonucleotides used in this study for protein expression and RT-PCR experiments.
Primers Sequences (5′ → 3′) Note
CpGbp1 CGCGGATCCATGGTATCTGATAAAAACTGC Forward primer for cloning protein PC0CpGbp3 CATGGAAGGCAAAGTGG RT-PCR forward primerCpGbp4 CGCAAGATTCTAAAGGACCAA RT-PCR reverse primerCpDNAPol1 TGCATCCAACGTAACCAGAAATA RT-PCR forward primerCpDNAPol2 CGCAAGCTGTCGTATCTCAAGTT RT-PCR reverse primerCpGbp5 CCCAAGCTTCCAAAGTGACCAAAAGG Reverse primer for cloning PC0CpGbp6 CGCGGATCCACTGCCGTGTTTATGTTG Forward primer for cloning PC1 and PC3CpGbp7 CCCAAGCTTTTCACGATCCTCACGCACAA Reverse primer for cloning PC1CpGbp8 CGCGGATCCGAGGAAAATAAAGGAAAGCAAGTC Forward primer for cloning PC2CpGbp9 CCCAAGCTTTAACCAATATCTCGCGACCATCTA Reverse primer for cloning PC2 and PC4C TTTCC A
he BamHI site (GGATCC) and the HindIII site (AAGCTT) introduced into each oligon
o amplify 18S rRNA, which is of much greater abundance inhe total RNA. For positive control, 200 ng of C. parvum genomicNA was used as template. PCR amplification was carried out
n a PerkinElmer Model 2400 thermocycler (PerkinElmer) for 24ycles of 94 ◦C for 30 s, 57 ◦C for 30 s and 72 ◦C for 1 min. The PCRroducts were separated on a 5% non-denaturing polyacrylamideel, and specific products were detected using a PhosphorimagerMolecular Dynamics, Foster City, CA) and quantified using Image-uant (Molecular Dynamics). The signal intensities for CpGbpnd CpDNAPol mRNAs were first normalized to that of 18S rRNAetected from the same RNA sample. The normalized mRNA levelt each time point was then normalized to the maximal mRNAevel in the same set of time-course experiment and representeds percentage of the maximal level.
.5. Monoclonal antibody production
Six-week-old female Balb/c mice were immunized intraperi-oneally with 100 �g recombinant CpGbp protein emulsified inunter’s Titer Max (Sigma). The procedure was repeated twice at–4-week intervals without adjuvant. Another immunization wasepeated 4 days prior to harvesting the spleen cells. Hybridomasere generated as previously described [37]. The supernatants were
creened on 96-well ELISA plates coated with recombinant proteint 250 �g/well at room temperature. The plates were first blockedor 1 h in blocking buffer (PBS with 2% BSA and 0.1% Tween 20), thenncubated with primary supernatants for 2 h. Alkaline phosphataseAP) conjugated goat anti-mouse IgG (Jackson ImmunoResearch,:300 in blocking buffer) and substrate were added and incubatedt 37◦ and room temperature for 1 h, respectively, following theanufacturer’s recommendations. The plates were read at 405 nm
n a THERMO MAX microplate reader (Molecular Devices, Sunny-ale, CA). Five hybridomas whose readings were three times higherhan background were further screened with Western blot. Twof the primary clones were selected and subcloned by limitingilution, and then expanded and adapted into RPMI 1640 media10 mM HEPES, 20% fetal calf serum, 2 mM l-glutamine, 1 mModium pyruvate, 0.1 mM MEM non-essential amino acids, 1× MEMitamins and minerals, 50 U/ml penicillin G, 50 U/ml streptomycin,nd 0.25 �g/ml amphotericin B [Fungizone] pH 7.2). Monoclonalntibodies from two subclones were determined to be IgG1 usingouse Monoclonal Antibody Isotyping Kit (Sigma) and were used
n the following assays.
.6. Recombinant protein expression and Western blot analysis
Recombinant full-length CpGbp protein (C0) and four deletionutants of CpGbp (C1–4) were expressed using the QIAexpression-
st system (QIAGEN, Chatsworth, CA, USA). Briefly, primers wereesigned using Lasergene software (DNASTAR). A BamHI (GGATCC)
Reverse primer for cloning PC3Forward primer for cloning PC4
tide are underlined.
site and a HindIII (AAGCTT) site were introduced into the forwardand reverse primers, respectively, to facilitate the cloning of theDNA fragments into the expression vector. The list of the primersand the protein constructs they intended to amplify are shown inTable 1. The relative positions of these primers on the CpGbp cod-ing sequences are shown in Fig. 4A. The primers (0.2 �M) were firstused to amplify the corresponding DNA fragments from C. parvumgenomic DNA (100 ng) by PCR. The PCR products were then clonedinto pCR®2.1-TOPO vector using TOPO TA Cloning® Kits (Invitrogen,Carlsbad, CA, USA). The plasmids were purified and double-digestedwith restriction enzymes BamHI and HindIII (New England Biolabs,Ipswich, MA, USA). The inserts were then purified and cloned intovectors pQE30 and pQE32 (QIAGEN). All plasmid constructs weresequenced to ensure they contain the correct coding sequences.The plasmid constructs were then transformed into E. coli hoststrain M15 [pREP4]. Protein expression and protein purificationwere performed following the manufacturer’s recommendations.The purified proteins were desalted using Microcons® Ultracel YM-10 and YM-3 centrifugal devices (Millipore, Billerica, MA, USA),quantified using Biorad protein assay kit II (BioRad Laboratories,Hercules, CA, USA) and then analyzed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) with 5% stacking geland 15% resolving gel at 100 V for 100 min.
For Western blot analysis, cell extracts lysed in CHAPS bufferwere mixed with an equal volume of loading buffer (50% glycerol,5% sodium dodecyl sulfate, 4% �-mercaptoethanol, 250 mM TrispH 6.8) and boiled for 5 min. Proteins were fractionated by SDS-PAGE (5% stacking gel and 12% resolving gel) and transferred tonitrocellulose membrane using a Hoeffer transblot apparatus (Hoe-fer Scientific Instruments, San Francisco, CA). The membrane waswashed with 5% acetic acid for 5 min, blocked with 100% horseserum for 30 min, and incubated with primary antibody for 1 hon a 25-lane blotting apparatus (Immunonetics, Cambridge, MA).The bound antibody was detected using alkaline phosphatase-conjugated goat anti-mouse IgG (Jackson ImmunoResearch, WestGrove, PA) and nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma, St. Louis, MO) following manufacturer’srecommendations.
2.7. Confocal microscopy examination
To mount parasite cells on chamber slides, C. parvum oocystswere washed five times, resuspended in PBS at 108 ml−1 and sub-jected to excystation as described previously [38]. Then 50 �l ofparasite suspension was added to each well of the slides, air-dried
and stored at −70 ◦C. For immuno-staining, the slides were thawedat room temperature for 30 min, blocked in 50 �l 5% goat serumfor 30 min and then incubated with primary antibodies for 30 min.After washing four times with fresh PBS, the slides were incu-bated with 100 �l Cy3 conjugated goat anti-mouse IgG (Jackson
ical P
Iw4ssLtCf
2
lmctopcr[Ad0cNBa
FhCrR
C. Liu et al. / Molecular & Biochem
mmunoResearch) in a dark humid chamber for 30 min. The slidesere washed in PBS again for four times and incubated with 100 �l�M TOTO3 (Molecular Probes, Inc., OR) in the dark for 30 min. The
lides were then mounted with Gel Mount (Fisher Scientific) andtored at −70 ◦C. The stained slides were examined using a Confocalaser Scanning Microscope (CLSM: Model 1000, BioRad) attachedo a Nikon fluorescence microscope. Images were obtained usingomos software (version: 6.05.8; Comos BioRad, Hercules, CA) andurther processed using NIH Image software (version 1.59).
.8. Electrophoretic mobility shift assays (EMSAs)
The gel shift assays were performed using LightShift® Chemi-uminescent EMSA Kit (Pierce, Rockford, IL, USA) following the
anufacturer’s recommendations. The 5′ biotin-labelled oligonu-leotides were synthesized by Tech Dragon Ltd. (Hong Kong). Aypical binding reaction contains 0.1 pmole of 5′ biotin labelledligonucleotides, 1.0 �g of purified recombinant proteins, 1 �g ofoly(dI-dC), with or without the unlabelled oligonucleotides asompetitors at an abundance of 500-fold. The reaction was car-ied out in a final volume of 20 �l of binding buffer (10 mM TrispH 7.5], 50 mM KCl, 1 mM DTT) for 20 min at room temperature.nd then the mixtures were fractionated on a 13% non-enaturing polyarylamide gel (30:1 acrylamide/bisacrylamide) in
.5×Tris–borate–EDTA (TBE) at 100 V for 90 min. The protein–probeomplexes were transferred to a Biodyne® B Pre-Cut Modifiedylon membrane (0.45 �m, Pierce) using BIO-RAD Mini Trans-lot® Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA)t 100 V for 45 min. The complexes were then cross-linked to the
ig. 1. Sequence analysis of CpGbp protein. (A) Multiple sequence alignment of CpGbpnRNA-binding protein M4, sw: S35532) and Saccharomyces cerevisiae (Sc, Gbp2, sw: P25-terminus sequences of Hs and Sc homologs are not shown. The RRMs and their RNP1epresented by “.”. Identical, conserved and similar amino acids are shaded in black, darkRM regions and the two motifs RNP1 and RNP2 are indicated with thin and thick lines o
arasitology 165 (2009) 132–141 135
membrane using a 3UVTM Transilluminator, Model LMS-20E (UVP,Upland, CA, USA) at wave-length 302 nm for 10 min. The fluores-cence signal was detected using a BIO-RAD Gel Doc XR system(BIO-RAD Laboratories, Segrate, Milan, Italy).
3. Results
3.1. CpGbp contains two RNA recognition motifs
It has been difficult to obtain sufficient amount of parasiteextracts to directly isolate proteins that associate with telom-eres using biochemical methods. Consequently, to isolate proteincomponents of C. parvum telomere, we used sequences of knowntelomere associated proteins to search the C. parvum sequencedatabases [29,39,40]. An EST (AA532259) was found similar to C.reinhardtii Gbp1p (Cr Gbp1p, PIR: S46234), which is a putativetelomere-binding protein [21,31] that contains two RNA recogni-tion motifs (RRMs). Further examination of the C. parvum wholegenome sequence identified a corresponding open reading frame(ORF, nucleotides 495–1088) of 594 bp, which encodes a puta-tive protein of 198 amino acids (M.W. = 22.986 kDa and pI = 6.77).The predicted coding region is preceded by an in frame stopcodon, which help us to identify the immediately downstream, in-frame ATG codon as the start codon. The entire 594 bp sequence
was used to search public databases and was found similar tomany previously identified RRM-containing proteins. Consistentlywith earlier analysis of the EST, the ORF displayed the highestdegree of similarity to Cr Gbp1p (score 119, p(n) = 2e−26, Iden-tify: 77/208[37%], Positives: 102/208[49%], Gap: 17/208[8%]), and
and its homologs from C. reinhardtii (Cr, Gbp1p, pir: S46234), Homo sapiens (Hs,555). All sequences are aligned using program Pileup (GCG). The N-terminus andand RNP2 motifs are shown with thin and thick lines, respectively. Deletions aregray and light gray, respectively. (B) Alignment of the RRM1 and RRM2 of CpGbp.
n the top, respectively, as in (A).
1 ical Parasitology 165 (2009) 132–141
tCisgCtaa9aaRsgaha[(tr
3p
poaPmwstosfpsta
iaCRts(uojawAlAltrtdttg
Fig. 2. The mRNA expression of CpGbp was significantly regulated through the par-asites’ intracellular development in RT-PCR assays. (A) Total RNA was isolated frommock-infected (“M”) and C. parvum-infected (“I”) HCT-8 cells at the time pointspost-infection (pi). The mRNA levels of three genes, CpGbp (upper panel), CpDNAPol(middle panel) and 18S rRNA (lower panel) were analyzed. Positive control (P): C.parvum genomic DNA; Negative control (N): No PCR template; RTase: reverse tran-scriptase; “+”: RTase present in the RT reaction; “−”: RTase absent in the RT reaction.(B) The intensity of CpGbp and CpDNAPol signals were quantified, normalized andrepresented as percentage of the maximal intensity in the same time-course exper-
36 C. Liu et al. / Molecular & Biochem
hus was named CpGbp. Multiple sequence alignment of CpGbp,r Gbp1 and proteins from lower and higher eukaryotes are shown
n Fig. 1A. The alignment suggested that CpGbp is intronless, con-istent with previous observation that the majority of C. parvumenes do not contain introns [30]. Profile analysis revealed thatpGbp contained two RRMs, namely RRM1 and RRM2, respec-ively. Each of the RRMs contains two RNP submotifs, namely RNP1nd RNP2 [41,42]. In RRM1 (amino acids 9–79), RNP1 locates atmino acids 47–54 (“RGCGVVEY”), and RNP2 locates at amino acids–14 (“VYVGNL”). In RRM2 (amino acids 124–194), RNP1 locatest amino acids 162–169 (“RGIATIVF”) and RNP2 locates at aminocids 124–129 (“VFVTNL”). The two RRMs, including the RNP1 andNP2 sequences, are also highly similar to each other (Fig. 1B),uggesting CpGbp may have arisen from the duplication of a sin-le ancient RRM domain. Between the two RRM domains, is a 44mino acids hinge region (amino acids 80–123) (Fig. 1A). Such ainge region has been identified in many RRM containing proteinsnd was found to play an important role in protein dimerization43]. This region of CpGbp contains two copies of tripeptide “RED”amino acids 80–85), and is very rich in arginine (R, 20.5%), similaro that of Cr Gbp1p. The function importance of these amino acidsemains to be determined.
.2. Expression of CpGbp mRNA is significantly regulated duringarasites’ intracellular development
To determine how the expression of CpGbp is regulated througharasite’s intracellular development, we analyzed the mRNA levelf CpGbp, CpDNAPol (C. parvum DNA polymerase gene, AQ855720)nd 18S rRNA at 6, 12, 24, 48, and 72 h post-infection (pi) by RT-CR as previously described [35,36,32]. CpDNAPol was used as aolecular marker for parasite’s DNA replication, while 18S rRNAas used as an internal control for quantitation. Previous study [44]
howed that at 6 h pi, oocysts are still undergoing excystation, andhe resulted sporozoites are entering host cells. The mRNA levelbserved should be similar to that of the sporozoites, the quiescenttage (G1 phase). From 6 to 12 h pi, parasites complete the transitionrom their exogenous stage to endogenous stages. At 12 and 24 hi, the majority of parasites are at their tropozoite or merozoitetages. After 24 h, almost all stages of parasites can be observed inhe culture as a result of the asynchronized parasite developmentnd proliferation [44].
Total RNA was isolated from mock-infected and C. parvum-nfected HCT-8 cells and was subjected to quantitative RT-PCRnalysis (Fig. 2A) using primers specific for CpGbp (top panel),pDNAPol (middle panel) and 18S rRNA (bottom panel). The totalNA from C. parvum-infected HCT-8 were subjected to reverseranscription with (RTase “+”) or without (RTase “−”) reverse tran-criptase. No signal was detected in the mock-infected RNA sampleslanes under “M”), demonstrating the specificity of all primerssed. Each of the C. parvum-infected RNA samples was also freef contaminating C. parvum genomic DNA, as samples not sub-ected to reverse transcription (lanes under “−” for RTase) did notmplify any products. The mRNA levels (lanes under “+” for RTase)ere quantified and normalized as described previously [35,36,32].lthough the overall patterns of CpGbp gene expression are simi-
ar, we observed high variations in CpGbp expression at 48 h pi.s a result, the normalized mean expression for 48 h pi was calcu-
ated from results of only two representative experiments, whilehe mean expression of other time points were calculated fromesults of three independent experiments. As shown in Fig. 2B,
he expression level of CpGbp was highest at 6 h pi, it was thenown-regulated at 12 h pi and then up-regulated at 24 h pi. In con-rast, CpDNAPol showed a rather steady expression through 6 h pio 24 h pi, it was then significantly up-regulated at 48 h pi, sug-esting that the parasites might undergone active DNA replication
iment. The means and standard deviations shown with error bar were calculatedfrom three sets of independent experiments, except for the ones at 48 h pi, whichwere calculated from results of only two representative experiments.
at 48 h pi. The expressions of both genes were decreased to theminimal level at 72 h pi, possibly resulting from the death of mostparasites in HCT-8 cells at this time point. The high expression levelof CpGbp at the 6 and 24 h pi and the low expression level of CpGbpat 12 and 48 h pi suggesting that CpGbp might play distinct func-tions in parasite’s exogenous or endogenous developmental stages.It should be emphasized the expression of CpGbp and CpDNAPolshould not be over-interpreted because the HCT-8 cells do not sup-port synchronized parasites’ development. And consequently, theexpression level at 12, 24 and 48 h pi are likely to represent theaverage expression levels of multiple parasite stages for the gene.
3.3. CpGbp protein is expressed in vivo
To determine if CpGbp protein is expressed in vivo, recombinantCpGbp was expressed and used to raise polyclonal and mono-clonal antibodies to perform Western blot analysis on extracts of C.parvum sporozoites and C. parvum-infected HCT-8 cells. As shownin Fig. 3A, anti-CpGbp monoclonal antibody did not react with anyprotein in the extracts of untransformed bacterial (M15) (lane 1).A strong band of ∼24 kDa was seen in the lane of recombinant
CpGbp (lane 2), indicating that anti-CpGbp strongly reacted withCpGbp. Anti-CpGbp reacted with one protein from cell extracts of C.parvum sporozoites (lane 3). This band corresponds to a protein hav-ing a MW of approximately 23 kDa, consistent with the predicted
C. Liu et al. / Molecular & Biochemical Parasitology 165 (2009) 132–141 137
Fig. 3. CpGbp protein is expressed in vivo and localizes predominantly in the nucleus. (A) CpGbp protein is expressed in sporozoites and C. parvum-infected HCT-8 cellsin Western blot analysis. Purified recombinant CpGbp protein, extracts from C. parvum sporozoites and C. parvum-infected or mock-infected HCT-8 cells were subjected toWestern blot analysis using anti-CpGbp antibody. The compositions of each lane are shown on the top of the gel. The protein size standards are displayed on the left of thegel. Lane 1: extracts of bacteria host E. coli strain M15 that does not contain the recombinant vector; lane 2: purified recombinant CpGbp protein; lane 3: extracts of C. parvumsporozoites; lane 4: extracts of C. parvum-infected HCT-8 cells; and lane 5: extracts of mock-infected HCT-8 cells. The protein bands detected in the C. parvum sporozoitesa ein prm tainedl r and
Mtcastisaspt4Wsa
3
pfsojd
nd C. parvum-infected HCT-8 cells are indicated with arrow heads. (B) CpGbp proticroscopy. The three panels are three different views for the same slide immuno-s
abelling, respectively, while the lower panel is the superimposed views of the uppe
W for CpGbp protein. The protein showed slightly faster elec-rophoretic mobility than that of the recombinant CpGbp, whichan be explained by the fact that the recombinant CpGbp containshistidine tag which adds additional twelve amino acids to the
equence. Interestingly, anti-CpGbp reacted with two proteins inhe extracts of C. parvum-infected HCT-8 cells (lane 4). The mobil-ty of one band is similar to that detected with anti-CpGbp in theporozoites (lane 3), while the other one had slower mobility. Sincenti-CpGbp did not react with any HCT-8 cellular proteins withimilar mobility (lane 5), the lower band might represent CpGbprotein, while and the upper one might represent a CpGbp proteinhat had undergone post-translational modifications (see Section). Replacing anti-CpGbp with control hybridoma media in similarestern blot analysis did not show any bands (result not shown),
uggesting that there is no cross-reaction between the secondaryntibody and cell extract.
.4. CpGbp protein predominantly localizes in the nucleus
To determine where CpGbp protein locates in the cell, C.arvum sporozoites were subjected to immuno-staining and con-
ocal microscopy analysis. The sporozoite cells, immobilized onlides, were incubated first with primary antibodies (anti-CpGbp)r blocking solution, then with secondary goat anti-mouse IgG con-ugated with fluorescence dye Cy3, and finally with fluorescenceye TOTO3 that stains only DNA. We used anti-65.10 served as
edominantly locates in the nucleus as examined by immuno-staining and confocalwith anti-CpGbp. The upper and middle panels show Cy3 and TOTO3 fluorescencemiddle panels. The bar in each panel indicates 2 �m.
a control for parasite proteins that do not localize in the nucleus(data not shown). The antigen 65.10 has been found to localize at“apical complex”, a special structure at one end of the sporozoitecells (C. Lancto, unpublished data). As shown in Fig. 3B, anti-CpGbpimmuno-stained its antigen in sporozoites to red (upper panel).TOTO3 stained DNA in the nucleus to blue (middle panel). Over-laying the upper and middle panels revealed purple spots (lowerpanel), suggesting the co-localization of CpGbp protein and nuclearDNA. Notably, the TOTO3 spots (blue) appeared larger than Cy3spots (red, lower panel), suggesting that CpGbp was associated withonly a subset of total nuclear DNA. A negative control with block-ing solution containing no primary antibody did not reveal any Cy3labelling, suggesting that there is no cross-reaction between thesecondary antibody and sporozoite proteins (data not shown).
3.5. Expression of CpGbp mutants
Since CpGbp protein has two RRM domains, we then ask if thefull-length CpGbp protein (C0) and each of CpGbp’s RRM domainscan bind oligonucleotides, and whether the hinge region plays anyrole in the RRM domain’s binding ability. To answer this question,
we constructed four deletion mutants of CpGbp: C1–4. A schematicrepresentation of the domain structures of C0–4 and the locationsof primers used to amplify them are shown in Fig. 4A. C1 and C2contain just the RRM1 and RRM2 domains, respectively, while C3and C4 contain the RRM1 and RRM2 domain plus the hinge region,
138 C. Liu et al. / Molecular & Biochemical Parasitology 165 (2009) 132–141
Fig. 4. Expression of recombinant CpGbp and its deletion mutants. (A) Schematicrepresentation of the structure of the four protein constructs (C1–4) comparing tothat of the full-length CpGbp protein (C0). The structure of CpGbp consists of RRM1(open square), RRM2 (closed square) and the hinge region (the line). The expectedmolecular weights of C0–4 are shown in parentheses after the names. The primersu(fis
rmlt
3s
wCtC“mtw(obtctwGentC
Table 2Biotin labelled oligonucleotides used in the gel shift assays and the summary of theassay results.
TG1 CCAGCCATGACCTTTAGG −TG2 CCAGCCTTTAGGTTTAGG −TG3 TTTAGGTTTAGGTTTAGG ++TGl1 CTTAGGTTTAGGTTTAGG ++TGl2 CCTAGGTTTAGGTTTAGG ++TGl3 CCAAGGTTTAGGTTTAGG ++TGl4 CCAGGGTTTAGGTTTAGG ++TGl5 CCAGCGTTTAGGTTTAGG +TGr1 CCAGCGTTTAGGTTTAGC +TGr2 CCAGCGTTTAGGTTTACC −TGr3 CCAGCGTTTAGGTTTCCC −TGr4 CCAGCGTTTAGGTTCCCC −TGr5 CCAGCGTTTAGGTCCCCC −Arbitrary binding affinity of PC0 for the oligonucleotides are shown. “++”, “+” and “−”indicate strong, weak and no binding affinity, respectively. The minimal sequences
sed to amplify the corresponding coding sequences and their relative positionsarrows) on the sequences of C0–4 are also shown. (B) SDS-PAGE gel shows puri-ed recombinant proteins (C0–4). M: molecular weight standard. The sizes of thetandards are shown to the left of the gel.
espectively. Expressions of the wild type and the four proteinutants are shown in Fig. 4B. The sizes of these proteins were simi-
ar to those estimated from their coding sequences, suggesting thathe recombinant proteins were expressed correctly as expected.
.6. CpGbp binds oligonucleotide bearing telomeric DNA repeatpecifically in vitro
To test CpGbp’s ability to bind single-stranded telomeric DNA,e synthesized two eighteen-base long oligonucleotides (TG3 andA3, Table 2). The TG3 oligonucleotide consists of three copies ofhe C. parvum G-strand telomeric repeat “TTTAGG” [45], while theA3 oligonucleotide contains three copies of the complementaryCCTAAA” repeat, representing the C-strand sequence. Further-ore, we annealed TG3 and CA3 to form the double-stranded
elomeric DNA fragment (TG/CA)3. C0 and these oligonucleotidesere then subjected to EMSAs. As shown in Fig. 5A, C0 bound TG3
lane 2, arrow head, “I”). The binding was specific as the additionf competitors outcompeted the labelled TG3 (lane 3). However, C0ound neither CA3 nor (TG/CA)3 (data not shown). Since TG3 con-ains three copies of the telomeric repeats, we then asked if CpGbpould bind oligonucleotides containing less number of copies ofhe telomeric repeat. Two additional oligonucleotides TG1 and TG2ere synthesized (Table 2). TG1 contains a sequence “CCAGCCAT-
ACC” on the 5′ end plus one copy of the “TTTAGG” repeat on the 3′
nd. The 5′ sequences had been shown not to bind C0 before (dataot shown). TG2 is composed of the first six nucleotides in TG1 pluswo copies of the “TTTAGG” repeat (Table 2). As shown in Fig. 5A,0 did not bind TG1 and TG2 in EMSAs (lanes 5 and 8).
required for CpGbp’s binding are underlined. The critical guanine nucleotides in TGl5and TGr1 are bolded. The mutation of the critical guanine to cytosines in TG2 andTGr2 are bolded and italicized.
3.7. Only one RRM domain of CpGbp has the ability to bindoligonucleotides in vitro
The EMSAs were then performed to test the possible bindingof all pairs of mutant proteins [C1–4] and oligonucleotides [TG3,TG2, TG1, CA3 and (TG/CA)3]. The main binding properties of C3(Fig. 5B, lane 2, arrow heads, “II” and “III”) and C1 (Fig. 5C, lane 2,arrow head, “IV”) were similar, and only the typical binding resultsfor C3 are presented hereafter. As shown in Fig. 5B, C3 bound TG3and formed two complexes (lane 2, arrow heads, II and III). Com-plex III is the major protein–oligonucleotide complex and likelycontains one molecule of C3 and TG3. The composition of com-plex II remains to be determined. In comparison, C3 did not bindTG2 (Fig. 5B, lane 5) and TG1 (Fig. 5B, lane 8), similar to thoseobserved for C0 (Fig. 5A, lanes 5 and 8). The binding of C3 and TG3were specific as the addition of cold TG3 outcompeted the labelledTG3 (lane 3). We observed another band (Fig. 5A and 5B, lanes 1, 4and 7, indicated by “*”) for binding reactions that only contain theoligonucleotides. They likely represented a high-degree structureof the oligonucleotides, such as G-quadruplex [46]. Interestingly,the bands were no longer visible in binding reactions that con-tained proteins C0/C1/C3. Whether C0/C1/C3 bound and up-shiftedthe structure or they had disrupted the structure remains to bedetermined. Another weak band (Fig. 5B, lanes 5, 6, 8 and 9, indi-cated by “>”) was also visible. However, because competitors couldnot outcompete them, they likely represented certain non-specificprotein–oligonucleotide complexes. In contrast, we could not detectthe binding of C2 and C4 to TG3 (Fig. 5C, lanes 4 and 6, respectively).And C2 and C4 were not studied further. Based on these results,we concluded that the RRM1 domain can bind oligonucleotidesindependently in vitro, while the RRM2 cannot.
3.8. The minimal sequence required for CpGbp to bind is“GTTTAGGTTTAG”
As described above, all of C0, C1 and C3 can bind TG3 but notTG2. TG3 contains three copies of the “TTTAGG” repeat. Depend-ing on the exact sequence recognized by CpGbp, TG3 might contain
multiple CpGbp-binding sites. We then asked what the minimalsequence is required for C0/C1/C3 to bind. We used TG3 as a start-ing point and mutated the first six nucleotides (TTTAGG) additivelyto the corresponding nucleotides in TG2 (CCAGCC). These mutant
C. Liu et al. / Molecular & Biochemical P
Fig. 5. Electrophoretic mobility shift assay (EMSA) of the full-length recombinantCpGbp (C0) and deletion mutants C1–4 with oligonucleotides TG3, TG2 and TG1.(A) Protein construct C0 was tested for its ability to bind Biotin labelled oligonu-cleotides TG3 (lanes 1–3), TG2 (lanes 4–6) and TG1 (lanes 7–9) by EMSAs. For eachpair of protein and oligonucleotide, the assay results of three reactions: (i) labelledoligonucleotide alone (lanes 1, 4 and 7); (ii) labelled oligonucleotide plus protein(lanes 2, 5 and 8); and (iii) labelled oligonucleotide plus protein and unlabelledcompetitor (lanes 3, 6 and 9) are presented. The protein–oligonucleotide complex(I) is indicated by arrow head. “*” Indicates a possible high-degree structure formedby TG3, TG2 and TG1. (B) Protein construct C3 were tested for it ability to bind TG3,TG2 and TG1. The experiments were designed and presented in the same way asthose described in panel A. Two protein complexes (II and III) are indicated witharrow heads. “*” Indicates a possible high-degree structure formed by TG3, TG2 andTG1. “>” Indicates possible non-specific protein–oligonucleotide complexes. (C) Pro-tein constructs C1, C2 and C4 were tested for their abilities to bind biotin labelledoTr“
owCTwsC
ligonucleotides TG3. Lane 1: TG3 alone; lanes 2, 4 and 6: protein C1, C2 and C4 plusG3, respectively; lanes 3, 5 and 7: protein C1, C2 and C4 plus TG3 and competitor,espectively. The protein–oligonucleotide complex (IV) is indicated by arrow heads.*” Indicates a possible high-degree structure formed by TG3, TG2 and TG1.
ligonucleotides were named TGl1–5, respectively (Table 2). Weere trying to find the nucleotide whose mutation would ablate
pGbp’s binding, which would establish its absolute requirement.he binding ability of C0 to each of these mutant oligonucleotidesas tested by EMSAs and the results are summarized in Table 2. In
ummary, TGl4 bound C0 strongly (Fig. 6, lane 2), while TGl5 bound0 very weakly (Fig. 6, lane 4), while TG2 did not bind C0 at all (Fig. 6,
arasitology 165 (2009) 132–141 139
lane 6). It should be pointed out that the binding were specific asunlabelled TG3 efficiently outcompeted the labelled TG3 (data notshown). Comparing these binding results with the sequences ofTGl4, TGl5 and TG2 (Table 2), we found that the guanine nucleotideat position 6 is critical for CpGbp’s binding. The mutation of thisguanine (underlined) in TGl5 (CCAGCGTTTAGGTTTAGG) to a cyto-sine (underlined) in TG2 (CCAGCCTTTAGGTTTAGG) ablated C0’sbinding.
We then used TGl5 as a starting point and mutated the sixnucleotides at the 3′ end to a cytosine additively. These mutantoligonucleotides are named TGr1–5 (Table 2). Similarly, EMSAswere used to test the binding of C0 and TGr1–5 and the results aresummarized in Table 2. In short, C0 bound TGr1 (Fig. 6, lane 8) butneither TGr2 (Fig. 6, lane 10) nor TGr3–5 (data not shown). Com-paring these binding results with the sequences of TGr1 and TGr2(Table 2). We concluded that the guanine nucleotide at position 2from the right is critical. A mutation of the guanine (underlined) inTGr1 (CCAGCGTTTAGGTTTAGC) to a cytosine (underlined) in TGr2(CCAGCGTTTAGGTTTACC) ablated C0’s binding ability (Fig. 6, lane10). Taken together, the minimal sequence required for C0’s bindingis “GTTTAGGTTTAG”, which contains exactly two copies of the hex-amer “GTTTAG”. A simple model summarizing these observationsis shown in Fig. 7.
4. Discussion
Due to the unavailability of sufficient amount of parasite mate-rials derived from any specific developmental stage, isolatingparasite’s telomere-associated proteins by pull-down experimentsare still technically challenging. As a result, isolating genes basedon their similarities to previously known genes in other organismsand then characterizing these genes in vitro remains the primaryapproach to study C. parvum telomere biology. CpGbp was originallyidentified based on its sequence similarity to Cr Gbp1p, a putativesingle-stranded telomere G-strand binding protein. The direct evi-dence supporting CpGbp being a single-stranded telomeric DNAbinding protein comes from its ability to bind specifically to single-stranded DNA that bears the sequence of C. parvum telomeric repeat(Figs. 5 and 6). In addition, three lines of observations are consistentwith its being a single-stranded telomeric DNA binding protein: (i)the similar of its sequence to those of other single-stranded telom-eric DNA binding proteins (Fig. 1); (ii) the significant regulationof its mRNA level through the parasite’s intracellular development(Fig. 2); and (iii) its localization in the nucleus (Fig. 3B).
Based on the results obtained from the gel shift assays of all pairsof protein constructs and oligonucleotides, we propose a simplemodel (Fig. 7A–C) explaining the binding characteristics of proteinsrepresenting the full-length CpGbp and its individual domains invitro. The sequence of CpGbp includes two RRM domains linkedby a hinge region. RRM1 has independent oligonucleotide-bindingability and the minimal sequence required for RRM1 to bind is “GTT-TAGGTTTAG” (Fig. 7A). Mutation of the guanine nucleotide on eitherside of the sequence ablated the protein binding (Fig. 6 and Table 2).In contrast, RRM2 does not bind the cognate oligonucleotide invitro (Fig. 7B). However, it is likely that the full-length CpGbp bindsthe oligonucleotide through RRM1 or RRM2 (Fig. 7C, left and rightpanels). To understand why RRM1 and RRM2 have distinct bind-ing abilities, we predicted the 3D structures of RRM1 and RRM2by homology modelling. The structure model of RRM1 (Fig. 7D)shows an anti-parallel beta sheet consisting of four amino acidstrands and two alpha helixes. In comparison, the structure model
of RRM2 (Fig. 7E) shows that the corresponding beta sheet structureis largely disrupted (arrows). Furthermore, the corresponding alphahelix (“*”) is significantly shortened comparing to that seen in thestructure model of RRM1. These differences might cause the loss ofthe oligonucleotide-binding ability of RRM2. However, we need to
140 C. Liu et al. / Molecular & Biochemical Parasitology 165 (2009) 132–141
F mine tb 3 andE e alo4 ed by
bapc
mr
Fttoi
ig. 6. Gel shift assay of protein construct C0 and various oligonucleotides to deterind various oligonucleotides mutants including TGl4 (lanes 1 and 2), TGl5 (laneslectrophoresis results of the EMSA reactions containing the labelled oligonucleotid, 6, 8 and 10) are presented. The protein–oligonucleotide complexes (I) are indicat
e cautious not to over interpret the results of the in vitro bindingssays to the in vivo condition. Our current data cannot exclude the
ossibility that RRM2 may also bind its cognate sequences in theontext of full-length CpGbp proteins.
As described earlier, it is reasonable to speculate that CpGbpight play important roles in multiple pathways, such as DNA
epair, telomere biogenesis, cell signalling and in regulating gene
ig. 7. A model explaining the oligonucleotide-binding of CpGbp and its deletion mutantso bind its cognate DNA sequence “GTTTAGGTTTAG” in vitro; (B) RRM2 does not bind its coghrough RRM1 (left panel) or RRM2 (right panel); (D) Molecular model of protein constrf the protein construct C4 consisting of the RRM2 domain and the hinge region. The disrndicated by “*”.
he minimal binding site of C0. Recombinant protein C0 was tested for its ability to4), TG2 (lanes 5 and 6), TGr1 (lanes 7 and 8) and TGr2 (lanes 9 and 10) by EMSAs.ne (lanes 1, 3, 5, 7 and 9) and the labelled oligonucleotide plus the protein (lanes 2,arrow heads.
expression at both transcriptional and translational levels, similarto those described for human hnRNP [16]. It is likely that binding
of single-stranded telomeric DNA only represents one of many cel-lular activities of CpGbp. CpGbp might also play its diverse rolesthrough various modifications such as post-translational modifi-cations. For example, Western blot analysis of C. parvum-infectedHCT-8 cells revealed two bands (Fig. 3A, lane 4). Computational
in vitro. (A) CpGbp contains two RRM domains. However, only RRM1 has the abilitynate DNA sequence; (C) the full-length CpGbp might bind its cognate DNA sequenceuct C3 consisting of the RRM1 domain and the hinge region; (E) Molecular modelupted amino acid strands are indicated by arrows and the shortened alpha helix is
ical P
at6a78bpt
rwimssstwatap
A
MGwc
R
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
[
C. Liu et al. / Molecular & Biochem
nalysis has identified many potential post-translational modifica-ion sites in CpGbp, including one N-glycosylation site (amino acids9–71), three protein kinase C phosphorylation sites (aa 3–5, 87–89nd 94–96), three casein kinase II phosphorylation sites (aa 55–57,1–73 and 133–135), one tyrosine kinase phosphorylation site (aa3–85) and one amidation site (aa 90–92). Additional studies wille required to determine whether CpGbp is phosphorylated in C.arvum cells at any particular stage of the life cycle and to ascertainhe significance of these modifications at any particular position.
The groups of proteins with RRM domains have displayed aange of mechanistic and functional diversity in its associationith nucleic acids. For example, Cr Gbp1p can qualitatively alters
ts binding characteristics upon dimerization, changing from aonomeric protein that binds RNA slightly better than single-
tranded DNA to a homodimer that has a strong preference foringle-stranded DNA and very little affinity for RNA. Certainly,imilar questions can be asked for CpGbp. And we can further inves-igate (1) CpGbp’s preference for RNA and single-stranded DNA; (2)hether or not CpGbp can dimerize and how the dimerization will
lter CpGbp’s cellular roles; (3) whether or not CpGbp can completehe functions of any its homologs in model systems. The studieslong these lines will provide valuable information regarding C.arvum telomere biology.
cknowledgements
We thank Dr. Anjali Kulkarni-Narla for assistance of Confocalicroscopy study, Dr. Stephen D. Johnston for and Professor Judith. Berman for many critical and constructive suggestions. This workas supported by grants from the Hong Kong Research Grant Coun-
il (HKU 7526/06M) to C.L. and NIH (AI-35479) to M.S.A.
eferences
[1] Fayer R. Cryptosporidium and cryptosporidiosis. Boca Raton, FL: CRC Press, Inc.;1997.
[2] Zakian VA. Telomeres: beginning to understand the end. Science 1995;270:1601–7.
[3] Sandell LL, Zakian VA. Loss of a yeast telomere: arrest, recovery, and chromo-some loss. Cell 1993;75:729–39.
[5] Henderson E. Telomere DNA structure. In: Blackburn EH, Greider CW, editors.Telomeres. Plainview, NY: Cold Spring Harbor Laboratory Press; 1995. p. 11–35.
[6] Croy JE, Wuttke DS. Themes in ssDNA recognition by telomere-end protectionproteins. Trends Biochem Sci 2006;31:516–25.
[7] Griffith JD, Comeau L, Rosenfield S, et al. Mammalian telomeres end in a largeduplex loop. Cell 1999;97:503–14.
[8] Paeschke K, Simonsson T, Postberg J, et al. Telomere end-binding proteins con-trol the formation of G-quadruplex DNA structures in vivo. Nat Struct Mol Biol2005;12:847–54.
[9] Fang G, Cech TR. The beta subunit of Oxytricha telomere-binding protein pro-motes G-quartet formation by telomeric DNA. Cell 1993;74:875–85.
10] de Lange T. Shelterin: the protein complex that shapes and safeguards humantelomeres. Genes Dev 2005;19:2100–10.
11] Hockemeyer D, Sfeir AJ, Shay JW, et al. POT1 protects telomeres from a transientDNA damage response and determines how human chromosomes end. EMBOJ 2005;24:2667–78.
12] Froelich-Ammon SJ, Dickinson BA, Bevilacqua JM, et al. Modulation of telom-erase activity by telomere DNA-binding proteins in Oxytricha. Genes Dev1998;12:1504–14.
13] Kelleher C, Kurth I, Lingner J. Human protection of telomeres 1 (POT1) isa negative regulator of telomerase activity in vitro. Mol Cell Biol 2005;25:808–18.
14] Chandra A, Hughes TR, Nugent CI, et al. Cdc13 both positively and negativelyregulates telomere replication. Genes Dev 2001;15:404–14.
15] Zaug AJ, Podell ER, Cech TR. Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro. Proc Natl Acad SciUSA 2005;102:10864–9.
16] Carpenter B, MacKay C, Alnabulsi A, et al. The roles of heterogeneous nuclearribonucleoproteins in tumour development and progression. Biochim BiophysActa 2006;1765:85–100.
[
[
arasitology 165 (2009) 132–141 141
[17] Eversole A, Maizels N. In vitro properties of the conserved mammalianprotein hnRNP D suggest a role in telomere maintenance. Mol Cell Biol2000;20:5425–32.
18] Ford LP, Suh JM, Wright WE, et al. Heterogeneous nuclear ribonucleoproteinsC1 and C2 associate with the RNA component of human telomerase. Mol CellBiol 2000;20:9084–91.
19] LaBranche H, Dupuis S, Ben-David Y, et al. Telomere elongation by hnRNP A1and a derivative that interacts with telomeric repeats and telomerase. Nat Genet1998;19:199–202.
20] Bandiera A, Medic N, Akindahunsi AA, et al. In-vitro dual binding activityof a evolutionarily related subgroup of hnRNP proteins. Mol Cell Biochem2005;268:121–7.
21] Johnston SD, Lew JE, Berman J. Gbp1p, a protein with RNA recognition motifs,binds single-stranded telomeric DNA and changes its binding specificity upondimerization. Mol Cell Biol 1999;19:923–33.
22] Kamma H, Fujimoto M, Fujiwara M, et al. Interaction of hnRNP A2/B1 isoformswith telomeric ssDNA and the in vitro function. Biochem Biophys Res Commun2001;280:625–30.
23] Gohring F, Fackelmayer FO. The scaffold/matrix attachment region binding pro-tein hnRNP-U (SAF-A) is directly bound to chromosomal DNA in vivo: a chemicalcross-linking study. Biochemistry 1997;36:8276–83.
24] Mattern KA, van dK I, Schul W, et al. Spatial organization of four hnRNP pro-teins in relation to sites of transcription, to nuclear speckles, and to eachother in interphase nuclei and nuclear matrices of HeLa cells. Exp Cell Res1999;246:461–70.
25] Weighardt F, Cobianchi F, Cartegni L, et al. A novel hnRNP protein (HAP/SAF-B) enters a subset of hnRNP complexes and relocates in nuclear granules inresponse to heat shock. J Cell Sci 1999;112:1465–76.
26] Ford LP, Wright WE, Shay JW. A model for heterogeneous nuclear ribonucleo-proteins in telomere and telomerase regulation. Oncogene 2002;21:580–3.
27] Liu C, Schroeder AA, Kapur V, et al. Telomeric sequences of Cryptosporidiumparvum. Mol Biochem Parasitol 1998;94:291–6.
28] Olaussen KA, Dubrana K, Domont J, et al. Telomeres and telomerase as targetsfor anticancer drug development. Crit Rev Oncol/Hematol 2006;57:191–214.
29] Liu C, Vigdorovich V, Kapur V, et al. A random survey of the Cryptosporidiumparvum genome. Infect Immun 1999;67:3960–9.
30] Abrahamsen MS, Templeton TJ, Enomoto S, et al. Complete genome sequenceof the apicomplexan, Cryptosporidium parvum. Science 2004;304:441–5.
31] Petracek ME, Konkel LM, Kable ML, et al. A Chlamydomonas protein that bindssingle-stranded G-strand telomere DNA. Embo J 1994;13:3648–58.
32] Schroeder AA, Brown AM, Abrahamsen MS. Identification and cloning of adevelopmentally regulated Cryptosporidium parvum gene by differential mRNAdisplay PCR. Gene 1998;216:327–34.
33] Upton SJ, Tilley M, Brillhart DB. Effects of select medium supplements on invitro development of Cryptosporidium parvum in HCT-8 cells. J Clin Microbiol1995;33:371–5.
34] Upton SJ, Tilley M, Brillhart DB. Comparative development of Cryptosporid-ium parvum in MDBK and HCT-8 cells under select atmospheres. Biomed Lett1994:265–71.
35] Schroeder AA, Lawrence CE, Abrahamsen MS. Differential mRNA display cloningand characterization of a Cryptosporidium parvum gene expressed during intra-cellular development. J Parasitol 1999;85:213–20.
37] Kishimoto TK, Warnock RA, Jutila MA, et al. Antibodies against humanneutrophil LECAM-1 (LAM-1/Leu-8/DREG-56 antigen) and endothelial cellELAM-1 inhibit a common CD18-independent adhesion pathway in vitro. Blood1991;78:805–11.
38] Kim K, Gooze L, Petersen C, et al. Isolation, sequence and molecular karyotypeanalysis of the actin gene of Cryptosporidium parvum. Mol Biochem Parasitol1992;50:105–13.
39] Strong WB, Nelson RG. Preliminary profile of the Cryptosporidium parvumgenome: an expressed sequence tag and genome survey sequence analysis.Mol Biochem Parasitol 2000;107:1–32.
40] Strong WB, Nelson RG. Gene discovery in Cryptosporidium parvum:expressed sequence tags and genome survey sequences. Contrib Microbiol2000;6:92–115.
41] Birney E, Kumar S, Krainer AR. Analysis of the RNA-recognition motif and RS andRGG domains: conservation in metazoan pre-mRNA splicing factors. NucleicAcids Res 1993;21:5803–16.
42] Burd CG, Dreyfuss G. Conserved structures and diversity of functions of RNA-binding proteins. Science 1994;265:615–21.
43] Cartegni L, Maconi M, Morandi E, et al. hnRNP A1 selectively interactsthrough its Gly-rich domain with different RNA-binding proteins. J Mol Biol1996;259:337–48.
44] Rasmussen KR, Larsen NC, Healey MC. Complete development of Cryptosporid-
ium parvum in a human endometrial carcinoma cell line. Infect Immun1993;61:1482–5.
45] Liu C, Abrahamsen MS. Identification of a putative telomeric repeat DNA bindingfactor of Cryptosporidium parvum. J Eukaryot Microbiol 1999;46:50S–1S.
46] Biessmann H, Mason J. Telomere maintenance without telomerase. Chromo-soma 1997;106:63–9.
