Date post: | 21-Dec-2015 |
Category: |
Documents |
Upload: | tyler-allen-ward |
View: | 223 times |
Download: | 0 times |
Characterization of antithrombin-specific RNA aptamers for use
in anticoagulant therapy
Yolanda M. Fortenberry, Ph.D.Yolanda M. Fortenberry, Ph.D.Hematology 2014 ConferenceHematology 2014 Conference
Johns Hopkins University School of Johns Hopkins University School of MedicineMedicine
What are aptamers?What are aptamers? Synthetic ssDNA or RNA molecules.Synthetic ssDNA or RNA molecules. They bind with high affinity and They bind with high affinity and
specificity to their target protein (Kspecificity to their target protein (KDD in the nM to pM range).in the nM to pM range).
They are similar to monoclonal They are similar to monoclonal antibodies.antibodies.
They form an elaborate three They form an elaborate three dimensional structure. dimensional structure.
Initial Aptamers (1990)Initial Aptamers (1990) Tuerk C., Gold L., Systematic evolution of ligands by Tuerk C., Gold L., Systematic evolution of ligands by
exponential enrichment: RNA ligands to exponential enrichment: RNA ligands to bacteriophage T4 DNA polymarase. Science 1990; bacteriophage T4 DNA polymarase. Science 1990; 249:505-10249:505-10
Ellington Ad, Szostak JW. In vitro selection of RNA Ellington Ad, Szostak JW. In vitro selection of RNA molecules that bind specific ligands, Nature 1990 molecules that bind specific ligands, Nature 1990 346:818-22346:818-22
Currently there are over 2000 manuscripts Currently there are over 2000 manuscripts published on aptamerspublished on aptamers
Aptamers vs. Monoclonal Aptamers vs. Monoclonal AntibodiesAntibodies
In vitro selectionIn vitro selection Target range (i.e. toxins and other Target range (i.e. toxins and other
molecules that do not elicit immune molecules that do not elicit immune responses)responses)
Low molecular weight mass and structural Low molecular weight mass and structural flexibilityflexibility
Low immunogenic potentialLow immunogenic potential Produced by chemical or enzymatic Produced by chemical or enzymatic
reactionsreactions
Aptamers as tools in Aptamers as tools in diagnostic and analytical diagnostic and analytical
applicationsapplications Affinity ChromatographyAffinity Chromatography Capillary ElectrophoresisCapillary Electrophoresis In vitroIn vitro and and in vivoin vivo diagnostic tools diagnostic tools Targeting intracellular target moleculesTargeting intracellular target molecules Drug DiscoveryDrug Discovery TherapyTherapy Protein PurificationProtein Purification DiagnosticsDiagnostics ELISAELISA Western BlottingWestern Blotting
Examples of RNA aptamers Examples of RNA aptamers in clinical trialsin clinical trials
Macugen (age related macular Macugen (age related macular degeneration/diabetic macular degeneration/diabetic macular edema/proliferative diabetic retinopathy)edema/proliferative diabetic retinopathy)
E10030 and ARC1905 (Neovascular age related E10030 and ARC1905 (Neovascular age related macular degeneration-awaiting Phase III)macular degeneration-awaiting Phase III)
RB006 (Coronary artery disease-awaiting Phase RB006 (Coronary artery disease-awaiting Phase II)II)
ARC19499 (Hemophilia-Phase I/II)ARC19499 (Hemophilia-Phase I/II) AS1411 (Renal cell carcinoma/non-small cell AS1411 (Renal cell carcinoma/non-small cell
lung cancer – awaiting Phase IIIlung cancer – awaiting Phase III
SELEX (Systematic Evolution of SELEX (Systematic Evolution of Ligands by Exponential Ligands by Exponential
EnrichmentEnrichment
Binding Curves of Aptamer Binding Curves of Aptamer LibrariesLibraries
0.01 0.1 1 100.00
0.25
0.50
0.75
1.00
R10R5
R0
R2
PAI-1 (M)
Cor
rect
edFr
acti
on B
ound
0.01 0.1 1 100.00
0.25
0.50
0.75
1.00
R10-14R10-4R10-2
PAI-1 (M)C
orre
cted
Frac
tion
Bou
nd
Goal:Goal: To design novel RNA-To design novel RNA-based anticoagulant based anticoagulant
aptamers that mimic the aptamers that mimic the activity of LMWHs by activity of LMWHs by accelerating factor Xa accelerating factor Xa
inhibition by AT, and design inhibition by AT, and design antidote aptamers that will antidote aptamers that will reverse the anticoagulant reverse the anticoagulant
effect.effect.
Figure from Enzyme Research laboratories Catalog
Glycosaminoglycan: Glycosaminoglycan: HeparinHeparin
Heparin accelerates the inhibition of Heparin accelerates the inhibition of the coagulation proteases thrombin the coagulation proteases thrombin and factor Xa by antithrombin (AT).and factor Xa by antithrombin (AT).
Heparin is an important therapeutic Heparin is an important therapeutic anticoagulantanticoagulant
Heparin is effective and inexpensiveHeparin is effective and inexpensive Protamine sulfate reverses the effect Protamine sulfate reverses the effect
of heparinof heparin
Heparin: LimitationsHeparin: Limitations
Patients require constant laboratory monitoringPatients require constant laboratory monitoring It binds non-specifically to other plasma It binds non-specifically to other plasma
proteinsproteins It is neutralized by platelet factor-4It is neutralized by platelet factor-4 It induces thromobocytopenia in some patientsIt induces thromobocytopenia in some patients Some patients are at risk for recurrent Some patients are at risk for recurrent
thrombotic events that may be caused by the thrombotic events that may be caused by the inability of AT-heparin to inhibit thrombin bound inability of AT-heparin to inhibit thrombin bound to fibrinto fibrin
Low Molecular Weight Low Molecular Weight Heparin (LMWH)Heparin (LMWH)
Lower average molecular weight Lower average molecular weight than heparinthan heparin
Made by enzymatic or chemical Made by enzymatic or chemical controlled hydrolysis of controlled hydrolysis of unfractionated heparinunfractionated heparin
No ANTIDOTENo ANTIDOTE
Antithrombin-thrombin/factor Antithrombin-thrombin/factor Xa-heparinXa-heparin
Li et al, 2004, Nature
Effect of RNA Aptamer 7-4.16 to Accelerate AT-Protease
InhibitionReaction Condition
Aptamer 7-4.16 or heparin (nM)
K2 X 105
(M-1 s -1)
Fold-acceleration
AT+ FXa + Aptamer 7-4.16
50 4.2 83
AT+ FXa + Aptamer 7-4.16
500 25 510
AT+ FXa + Heparin
40 20 400
AT+ thrombin +Aptamer 7-4.16
500 0.11 3.4
FeClFeCl33-induced Saphenous Vein -induced Saphenous Vein Thrombosis in Wild Type C57B6 Mice*Thrombosis in Wild Type C57B6 Mice*
*Injury: 10% FeCl3 on 2 x 5 mm filter paper for 2 min, mice treated with saline, unfractionated heparin (300 U/Kg) or RNA aptamer 7-4.16 (3 and 6 pmol/g)*
RB006/RB007 – RB006/RB007 – Aptamer/Antidote pairAptamer/Antidote pair
• Binds to factor IXa.
• It blocks the factor VIIa/Ixa catalyzed conversion of factor X to Xa.
• Anticoagulant• Awaiting phase III
trails (so far the results are very positive).
Antidote controlled aptamerAntidote controlled aptamer
Oligonucleotides to AT Oligonucleotides to AT Specific RNA AptamerSpecific RNA AptamerTable 2: Synthesized Complimentary Oligonucleotides to Aptamer 7-4.16 Ap7-4.16: AAGAAGGCGAUAGAAGGCGAUGCGCUGCGAAUCGGGAGCGGCGAUA 3’ ATanti-1:-----------CCGCTATCTTCCGC------------------------------------------------------------- ATanti-2: -------------------------------CCGCTACGCGACGCTT----------------------------------- ATanti-3:------------------------------------------------------ACGCTTAGCCCTCGCCG------------ ATanti-4:---------------------------------------------------------------------------CTCGCCGCTAT----
Effect of RNA Aptamer 7-4.16 to Accelerate AT-Protease
InhibitionReaction Condition
Aptamer 7-4.16 or heparin (nM)
K2 X 105
(M-1 s -1)
Fold-acceleration
AT+ FXa + Aptamer 7-4.16
50 4.2 83
AT+ FXa + Aptamer 7-4.16
500 25 510
AT+ FXa + Heparin
40 20 400
AT+ FXa +Aptamer 7-4.16 + Antidote oligo
500 8.0 300
FeClFeCl33-induced Saphenous Vein Thrombosis in -induced Saphenous Vein Thrombosis in Wild Type C57B6 Mice*Wild Type C57B6 Mice*
Conclusions (1)Conclusions (1) AT RNA aptamer 7-4.16 accelerates the AT-factor Xa
inhibition reaction in vitro and in preliminary studies, promotes an anticoagulant response in vivo using a vascular injury model.
AT RNA aptamer 7-4.16 does mimic the action of heparin in terms of accelerating the AT-Xa inhibition reaction, but it has no effect to accelerate the AT-thrombin inhibition reaction.
AT RNA aptamer 7-4.16 may not bind at the heparin-binding site, could it bind at the AT-Xa-specific exosite?
AT RNA aptamer 7-4.16 binds relatively poorly to AT, and newer RNA aptamers based on this format are needed.
Antidote oligonucleotide is able to partly reverse the effect of AT RNA aptamer 7-4.16
Figure from Enzyme Research laboratories Catalog
Plasminogen Activator Plasminogen Activator Inhibitor (PAI-1)Inhibitor (PAI-1)
Serine protease inhibitor (Serpin)Serine protease inhibitor (Serpin) Rapid, specific inhibitor of uPA and tPARapid, specific inhibitor of uPA and tPA
Can also inhibit plasmin, trypsin, thrombin, APCCan also inhibit plasmin, trypsin, thrombin, APC Short half life, rapidly converted to latent formShort half life, rapidly converted to latent form Stabilized by binding to vitronectin (VN)Stabilized by binding to vitronectin (VN) Normally expressed in liver, SMC, adipocytes, Normally expressed in liver, SMC, adipocytes,
platelets, endothelial cell, fibroblastplatelets, endothelial cell, fibroblast Pathological conditions– tumor cells, Pathological conditions– tumor cells,
endothelial cells, cardiovascular disease, endothelial cells, cardiovascular disease, obesity, metabolic syndromeobesity, metabolic syndrome
Develop RNA aptamers to the Develop RNA aptamers to the various functional domains of various functional domains of
PAI-1PAI-1
Vitronectin binding domainVitronectin binding domain Heparin binding domainHeparin binding domain Lipoprotein-related protein binding Lipoprotein-related protein binding
domaindomain Reactive Center loop regionReactive Center loop region
PAI-1’s different PAI-1’s different conformationsconformations
Negative SELEX Method Negative SELEX Method using tPA-PAI-1 complexusing tPA-PAI-1 complex
Biochemical Journal 2011 438, 39-51 - Kenneth A. Botkjaer, Sarah Fogh and others.Biochemical Journal 2011 438, 39-51 - Kenneth A. Botkjaer, Sarah Fogh and others.
PAI-1 aptamer sequences PAI-1 aptamer sequences from negative selectionfrom negative selection
PAI-1 antagonistPAI-1 antagonist
Monoclonal antibodiesMonoclonal antibodies PeptidesPeptides Low molecular weight inhibitors (PAI-Low molecular weight inhibitors (PAI-
039)039) Chemical suppressorsChemical suppressors AptamersAptamers
R10-4 Disrupts PAI-1/tPA R10-4 Disrupts PAI-1/tPA complexcomplex
PA
I-1
tPA
R10-4 (nM)
0 250 500 1000tPA/PAI-1 complex
Cleaved PAI-1
R10-4 Disrupts PAI-1/tPA R10-4 Disrupts PAI-1/tPA complexcomplex
PA
I-1
tPA
R10-4 (nM)
0 250 500 1000
tPA/PAI-1 complex
Cleaved PAI-1
tPA
R10-4 inhibits PAI-1’s ability R10-4 inhibits PAI-1’s ability to inhibit tPAto inhibit tPA
ConclusionsConclusions We have developed RNA aptamers that We have developed RNA aptamers that
disrupts PAI-1’s antiproteolytic activity.disrupts PAI-1’s antiproteolytic activity. R10-4 prevents PAI-1 from interacting with R10-4 prevents PAI-1 from interacting with
tPA.tPA. R10-4 converts PAI-1 to a substrateR10-4 converts PAI-1 to a substrate R10-4 is less effective at inhibiting PAI-1 in R10-4 is less effective at inhibiting PAI-1 in
the presence of vitronectinthe presence of vitronectin R10-4 is able to increase fibrinolysisR10-4 is able to increase fibrinolysis
AcknowledgementsAcknowledgements
Jared Demare BS (Virginia Tech)Jared Demare BS (Virginia Tech) Stephanie Brandal MSStephanie Brandal MS Alisa Wolberg, PH.D. (UNC-Chapel Alisa Wolberg, PH.D. (UNC-Chapel
Hill)Hill) Laura Gray (UNC-Chapel Hill)Laura Gray (UNC-Chapel Hill)