1
CHARACTERIZATION OF GENOMIC, SUBGENOMIC AND DEFECTIVE INTERFERING RNAS AND DEVELOPMENT OF MOLECULAR AND SEROLOGICAL DIAGNOSTIC
METHODS FOR CYTOPLASMIC CITRUS LEPROSIS VIRUS (CCLV) ISOLATED FROM PANAMA
By
ABBY SAID GUERRA-MORENO
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2007
2
© 2007 Abby Said Guerra-Moreno
3
Al igual que durante mis estudios de maestría, esta vez dedicaré este logro a cuatro seres inigualables. En primera instancia al Señor Todopoderoso por ser la luz en la oscuridad y mi fuente de inspiración. Igualmente dedico este triunfo a mi madre querida, quien es la persona más especial que jamás he conocido, que siempre me ha brindado su apoyo y comprensión en las desiciones que he tomado en esta, mi vida.Tambien quiero dedicar este gran logro de mi vida a dos seres que, a pesar del poco tiempo de conocerlos, han cambiado el rumbo de mi vida por completo: mi amada novia/prometida/esposa/amiga Signy y nuestro querido(a) hijo(a) que ya viene en camino. DIOS, Mally, Signy y mi Bebe, por siempre conmigo en mi corazon...
4
ACKNOWLEDGMENTS
My most sincere thanks go to the chair of my committee, Dr. Ronald Brlansky, for all of
his support, guidance and supervision during these years of my Ph.D. studies. I also desire to
express high gratitude to members of my supervisory committee Drs. Jane Polston, and Gloria
Moore, for their invaluable advice and patience. I will like to extend my special thanks to Dr.
Richard Lee who went beyond the call of duty and offered me 100% support since I came from
Panama in 2001 with no knowledge about this new language and lab techniques. Dr. K. L.
Manjunath requires special mention for his daily input and unwavering support. Almost
everything that I have learned during this process is thanks to him.
My family’s love, unconditional support, and encouragement demand special mention.
There are not enough words of kindness and gratitude to give them proper thanks. I will like to
express my gratitude to Mally, Lala, Golla and Berta.
The friends I have made while in Gainesville have been critical to my success. All of these
people, especially Alana, Choaa, Amandeep, Vicente, Denise, Oscar, Osvaldo, Bo, Jessica,
Sylvia and Kris now occupy a permanent niche in my heart, and I am eternally grateful to them
all. An sincere thanks to all of the members of the Plant Pathology Department for their heartfelt
help during all these years as graduate student. Dr. E. Hiebert deserves a special mention for his
daily mentoring in the lab.
Finally, I will like to express my eternal gratitude to my lovely “esposa/amiga/compañera”,
Signy, for her careful support, company (from far, but close to my heart) and love during the last
year of my Ph.D. studies. I can not leave behind, and also say thanks to my adorable kid that is
coming soon (Thais Rocio or Sebastian).
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES...........................................................................................................................7
LIST OF FIGURES .........................................................................................................................8
ABSTRACT...................................................................................................................................10
CHAPTER
1 LITERATURE REVIEW .......................................................................................................12
Citrus and Citrus Diseases Worldwide ...................................................................................12 Economic Importance of Citrus Leprosis and its Mite Vectors .............................................13 Symptoms of Citrus Leprosis .................................................................................................14 Historic Perspective and Impact of Citrus Leprosis Disease..................................................15 Geographical Distribution of Leprosis ...................................................................................17 Citrus Leprosis in Panama ......................................................................................................18 Virus Properties, Morphology and Cytopathological Effect ..................................................18 Host Range of Leprosis ..........................................................................................................20 Genetic Resistance to Leprosis...............................................................................................21 Transmission of Citrus Leprosis.............................................................................................22 Mite Vector’s Biology and Transmission...............................................................................23 Molecular Characterization of Leprosis Virus .......................................................................25 Methods of Detection for Leprosis .........................................................................................27 Management of Leprosis Disease...........................................................................................28 Purpose of the Current Research ............................................................................................30
2 MOLECULAR CHARACTERIZATION OF GENOMIC, SUBGENOMIC AND DEFECTIVE INTERFERING RNAS OF A PANAMANIAN ISOLATE OF CYTOPLASMIC CITRUS LEPROSIS VIRUS ....................................................................31
Introduction.............................................................................................................................31 Material and Methods .............................................................................................................33
Virus Samples..................................................................................................................33 Total Nucleic Acid Extraction and RNA Isolation..........................................................34 Analysis of Putative Viral Sequences from a cDNA Library..........................................34 Comparison of Putative Viral Sequences ........................................................................35 Primer Design..................................................................................................................35 Northern Blot Analysis Using DNA Probes....................................................................35 Further Sequencing of CCLV RNAs...............................................................................36 Determination of the 5’ and 3’ Ends of CCLV g- and sgRNAs......................................37 Analysis of the 5’ and 3’ UTRs of CCLV RNAs............................................................39 Cloning, Sequencing and Analysis of CCLV sg- and DI-RNAs.....................................39
6
Phylogenetic Relationships Among the ORFs of CCLV and Other Plant Viruses .........40 Prediction of the Transmembrane Domain of CCLV Putative Proteins .........................41 Sequence Analysis of CCLV Isolates From Panama and Brazil.....................................41
Results.....................................................................................................................................41 Analysis of Putative Viral Sequences From a cDNA Library.........................................41 Northern Blot Analysis Using DNA Probes....................................................................42 Further Sequencing of the CCLV Genomic RNAs .........................................................43 Analysis of CCLV Genomic RNAs ................................................................................44 Analysis of the 5’ and 3’ UTRs of CCLV RNAs............................................................45 Phylogenetic Relationships Among the ORFs of CCLV and Other Plant Viruses .........45 Sequence Analysis of CCLV Isolates From Panama and Brazil.....................................46 Cloning, Sequencing and Analysis of CCLV sg- and DI-RNAs.....................................46
Discussion...............................................................................................................................48
3 MOLECULAR AND SEROLOGICAL DETECTION OF THE CYTOPLASMIC CITRUS LEPROSIS VIRUS (CCLV) USING RT-PCR PRIMERS TARGETING DIFFERENT CCLV GENES AND POLYCLONAL ANTISERA .......................................71
Introduction.............................................................................................................................71 Materials and Methods ...........................................................................................................72
Virus Source ....................................................................................................................72 Total Nucleic Acid Extraction and RNA Isolation..........................................................73 Primer Design..................................................................................................................73 Reverse Transcription (RT) and Polymerase Chain Reaction (PCR) .............................74 Protein Extraction............................................................................................................75 Cloning and Expression of CCLV p29 Protein ...............................................................75 Western Blot Detection of CCLV p29 ............................................................................76 Immuno Imprint Detection of CCLV Using Antibodies Against p29 ............................76 Enzyme-linked Immunosorbent Assay (ELISA) for CCLV ...........................................77
Results.....................................................................................................................................78 Reverse Transcription (RT) and Polymerase Chain Reaction (PCR) .............................78 Western Blot Detection of CCLV p29 ............................................................................79 Immuno Imprint Detection of CCLV Using Antibodies Against p29 ............................80 Enzyme-linked Immunosorbent Assay (ELISA) for CCLV ...........................................80
Discussion...............................................................................................................................81
4 GENERAL CONCLUSIONS.................................................................................................96
LIST OF REFERENCES.............................................................................................................100
BIOGRAPHICAL SKETCH .......................................................................................................116
7
LIST OF TABLES
Table page 2-1 Primers used for analysis of Cytoplasmic citrus leprosis virus (CCLV)...........................57
2-2 Nucleotide sequence comparison between Panamanian and Brazilian isolates of Cytoplasmic citrus leprosis virus (CCLV). .......................................................................58
3-1 Detailed description of the citrus samples collected from Chiriquí and Veraguas, Panama during July 2005 and used in DASI-ELISA assays .............................................86
3-2 Primers used for RT-PCR analysis of Cytoplasmic citrus leprosis virus (CCLV)............87
8
LIST OF FIGURES
Figure page 2-1 Symptoms of leprosis disease on citrus leaves.. ................................................................59
2-2 Symptoms of leprosis disease on citrus fruit and twigs.. ...................................................60
2-3 Northern blot analysis of total RNA extractions from citrus tissue using DIG-labeled DNA probe from ORF 1 CCLV RNA 1. ...........................................................................61
2-4 Northern blots using DNA probes from ORFs 3 and 4 of CCLV RNA 2. ........................62
2-5 Long distance RT-PCR amplification of CCLV g-RNAs.. ...............................................63
2-6 RT-PCR amplification of 5’ termini of decapped CCLV RNA 1 and 2............................64
2-7 Schematic genome (g-) and subgenomic (sg-) organization of CCLV RNAs...................65
2-8 Sequence alignment analysis of the 5’ and 3’ UTRs of CCLV g-RNAs. .........................66
2-9 Phylogenetic analysis between conserved motifs in CCLV ORF 1 RNA 1, ORF 3 RNA 2 and related plant viruses. .......................................................................................67
2-10 Graphic representation of the putative transmembrane domains found in ORFs 2 and 4 of CCLV RNA 2 using TMHMM computer software....................................................68
2-11 Schematic representation of the CCLV g- and DI-RNAs .................................................69
2-12 Junction sequence regions of CCLV DI-RNAs molecules................................................70
3-1 RT-PCR amplification of CCLV RNA 1 ORFs 1 and 2; and RNA 2 ORF 4....................88
3-2 RT-PCR detection of CCLV in samples collected from different countries.. ...................89
3-3 Western blot detection of CCLV p29 using polyclonal antibodies.. .................................90
3-4 Immuno Imprint detection of CCLV p29 in citrus samples collected from Potrerillos and Boquete, Panama using polyclonal antibodies developed in rabbits (R_p29-27).........91
3-5 Immuno imprint detection of CCLV p29 in citrus samples collected from Potrerillos and Boquete, Panama using polyclonal antibodies raised in chicken (C_p29-28).. ............92
3-6 DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potrerillos, Panama during July 2005...................................93
3-7 DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potrerillos, Panama during December 2006. ........................94
9
3-8 DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potrerillos, Panama during June 2007.. ................................95
10
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
CHARACTERIZATION OF GENOMIC, SUBGENOMIC AND DEFECTIVE INTERFERING RNAS AND DEVELOPMENT OF MOLECULAR AND SEROLOGICAL DIAGNOSTIC
METHODS FOR CYTOPLASMIC CITRUS LEPROSIS VIRUS (CCLV) ISOLATED FROM PANAMA
By
Abby Said Guerra-Moreno
December, 2007
Chair: Ronald H. Brlansky Major: Plant Pathology
Citrus leprosis is one of the most important viral diseases of citrus in Brazil, with more
than 21 % of the total citrus production cost (US$ 75 million/year) used for miticides to control
Brevipalpus mites that vector the virus. The disease has been present in South American
countries for almost a century. Leprosis disease is now an economically important emerging
disease of citrus in Central America and Mexico, and threatens citrus industries in North
America and the Caribbean Basin.
The sequence of the Cytoplasmic citrus leprosis virus (CCLV) isolated from Panama and
further characterization of the subgenomic (sg-) and defective interfering (DI-) RNAs associated
with this isolate are reported in this study. CCLV is a positive-sense bipartite RNA virus, which
shares low homology with the sequenced genomes of other positive-sense RNA viruses. The
bipartite nature of the CCLV genome was shown by Northern blot analyses using probes
targeting different regions of the CCLV genome and by sequencing of the genomic (g-), sg- and
DI-RNAs associated with CCLV. All of the g-, sg- and DI-RNAs were capped with a 5’
m7GpppN structure and had 3’ poly(A) tails. RNA 1 possessed two ORFs. ORF 1 encoded a
putative 276 kDa polyprotein containing domains similar to the Sindbis-like virus super group.
11
ORF 2 showed no similarity with other sequences in the GenBank. RNA 2 had four ORFs. While
ORFs 1, 2 and 4 showed no similarity with sequences in the GenBank, ORF 3 encoded a putative
31 kDa movement protein. Four sg-RNAs, ranging from 937 to 3389 nt, were identified in
CCLV-infected citrus tissue. There was one sg-RNA associated with RNA 1 and three sg-RNAs
associated with RNA 2. Smaller than full genome DI-RNAs, ranging from 1047 to 1886 nt, also
were found. CCLV is a unique virus sharing little homology with other reported viruses, and in
having 5’ m7GpppN-capped and a 3’ poly(A) tailed g-, sg- and DI-RNAs. The Panamanian
CCLV isolate shared more than 99.2 % nt identity with the sequences of CCLV sequences from
Brazil previously reported in the GenBank.
Molecular and serological assays for the detection of CCLV also are reported in this study.
Both RT-PCR primers and polyclonal antibodies against CCLV were designed based on the
properties of the highly expressed ORF 2 of RNA 1 and ORF 4 of RNA 2. Using the newly
developed RT-PCR diagnostic method, the CCLV was detected in samples with leprosis
symptoms collected from Panama, Brazil, Guatemala and Venezuela, but not from healthy
samples from Panama and Florida. Using polyclonal antibodies developed in rabbit and chicken,
raised against to a non-structural CCLV protein (ORF 2 RNA 1), CCLV was detected in
naturally infected citrus plants and also in Brevipalpus mites collected from infected citrus trees.
While serological methods are less sensitive than RT-PCR methods, the serological methods
presented in this study are more appropriate for large scale surveys. The implementation of the
molecular and serological procedures detailed here will be useful for epidemiological surveys as
well for use in certification and quarantine programs.
12
CHAPTER 1 LITERATURE REVIEW
Citrus and Citrus Diseases Worldwide
Citrus is one of the most economically important agribusinesses worldwide (Whiteside,
2000). There has been a significant increase in the production and consumption of sweet oranges
and other citrus types since the 1980’s. The annual production of citrus worldwide for the 2000 -
2004 period was estimated at over 105 million metric tons (MT) and sweet oranges constituted
more than half of the total production (UNCTAD, 2005). Although, citrus is produced in about
140 countries worldwide, the major producers (70%) are Brazil, the Mediterranean countries, the
United States, and China (USDA, 2004; UNCTAD, 2005).
In Florida, the citrus industry is estimated to have a US $9 billion-a-year economic impact
and is second only to tourism in importance (Florida Department of Citrus, 2003). There are
323,750 ha of citrus and more than 100 million citrus trees in Florida (Florida Agricultural
Statistics Service, 2003). The total US production of citrus was estimated at 15 million MT for
the 2003-2004 period (USDA, 2004). Approximately 90,000 Floridians work in the citrus
industry or in related businesses (FDACS; 2003; USDA, 2003). Florida production accounts for
74% of the total US citrus production; with California contributing 23% and Texas and Arizona
making up the remaining 3% (USDA, 2003).
Citrus is also important for the national economy of Panama. About 14,000 ha of citrus are
grown in Panama for fresh fruit and processed markets internally and for international trade
(Dominguez et al., 2001). The citriculture in Panama is based mainly on the cultivation of sweet
orange; with the production for the year 2005 estimated at 42,000 MT (FAO, 2006). The
increasing local demand for citrus has helped the growth of the Panamanian citrus industry in
recent years (MIDA, 2000). During the last 10 years, the area used for citrus production has
13
increased considerably, mainly in Chiriquí, Veraguas and Coclé provinces (Contraloría General
de la República de Panamá, 2003).
The Florida citrus industry has been threatened during the last two decades by several new
and emerging diseases. Citrus canker, caused by Xanthomonas axonopodis pv. citri, thought to
be eradicated in the 1980’s, was found again in South Florida in 1995 (Gottwald et al., 2001;
Graham et al., 2004). The most efficient vector of Citrus tristeza virus (CTV), the brown citrus
aphid, Toxoptera citricida was discovered in Florida in 1995 (Halbert & Manjunath, 2004;
Halbert et al., 2004) and spread endemic decline CTV strains. The psyllid vector of citrus
huanglongbing (citrus greening), Diaphorina citri, was first discovered in 1998 (Halbert &
Manjunath, 2004), and the causal agent Candidatus Liberibacter asiaticus, was first detected in
Florida in 2005 (Li et al., 2006). Other citrus diseases such as citrus leprosis, citrus variegated
chlorosis caused by Xyllela fastidiosa (Chang et al., 1993); citrus sudden death (CSD) and other
graft-transmissible disease of unknown etiology (Bassanezi et al., 2003) have occurred in Brazil
and caused great concern to the Florida citrus industry. Brevipalpus spp. mite vectors of citrus
leprosis are already present in Florida and other citrus producing states in the USA (Childers et
al., 2003b; Knorr, 1968; Knorr, et al., 1968). The introduction of citrus leprosis disease into the
United States could have a major economic impact.
Economic Importance of Citrus Leprosis and its Mite Vectors
Citrus leprosis disease is one of the most important viral diseases of citrus in Brazil
(Bastianel et al., 2006b; Rodrigues, 2000). The Brazilian citrus industry spends over US $75
million annually (about 21% of the total cost of citrus production) on miticides to control the
Brevipalpus spp. mites vector of leprosis (Omoto, 1998; Rodrigues et al., 2003; Rodrigues &
Machado, 2000). Leprosis disease is spread mainly through the movement of infected
Brevipalpus spp. mites in citrus groves (Teodoro & Reis, 2006). The flat anatomy of Brevipalpus
14
mites (also known as “flat or false spider mites”) helps its long distance dispersal by wind flows
(Bassanezi & Laranjeira, 2007; Rodrigues et al., 2003).
The economical importance of Brevipalpus is based on its high fecundity and survival
rates, asexual reproduction (thelytokous parthenogenesis), ubiquitous behavior, polyphagia, and
its ability to vector several viral diseases to citrus, coffee and ornamentals (Childers et al., 2001a;
Guerra-Moreno, 2004; Kitajima et al., 2003a; Rodrigues et al., 2003; Rodrigues, 2000; Teodoro
& Reis, 2006). The mites are cosmopolitan (Haramoto, 1969), and they are found in all citrus
producing areas worldwide, but they are considered a major pest in those countries where
leprosis is present (Bastianel et al., 2006b; Rodrigues, 2000).
Symptoms of Citrus Leprosis
Leprosis disease usually causes diagnositic symptoms on citrus leaves, fruit, twigs and
bark (Childers et al., 2001b; Lovisolo, 2001). In many places, leprosis outbreaks become severe,
causing defoliation and premature fruit fall as described for “lepra explosiva” in Argentina
(Childers et al., 2003b; Childers et al., 2001b; Frezzi, 1940).However, symptoms may vary
depending on citrus variety, region, and the stage of orchard development (Childers et al., 2001a;
Lovisolo, 2001; Rodrigues, 2000).
On green fruit, the lesions are initially yellow, becoming more brown or black as they age,
sometimes also becoming depressed. On mature fruit, lesions are 10-15 mm wide with a necrotic
center. Gum exudation is also observed occasionally on the lesion (Bitancourt, 1937; Lovisolo,
2001; Rossetti, 1996; 2001). Highly infected citrus fruit may contain up to 30 lesions covering
much of the fruit surface (Guerra-Moreno, 2004; Rodrigues, 2000). Leprosis is economically
important because of significant long-term tree decline, loss in production, and ultimately death
of the trees if mite control is not done (Bassanezi & Laranjeira, 2007; Bastianel et al., 2006b;
Rodrigues, 2000). Leprosis disease affects the appearance of citrus fruit and not only reduces the
15
fresh market value, but also the nutritional value of the fruit (Rodrigues, 2000). In infected citrus
fruits, lower levels of N, but higher levels of Ca, S and Fe have been documented compared to
healthy plants (Nogueira et al., 1996).
The leaf symptoms of leprosis are usually round lesions with a dark-brown or black central
spot about 2-7 mm in diameter, surrounded by a chlorotic halo, in which 1 to 3 brownish rings
frequently appear surrounding the central spot (Rodrigues, 2000). On bark and twigs, lesions can
be protuberant, cortical, and grey or brown in color. Lesions may coalesce on the twig or branch,
leading to the death of the twig or die back (Bitancourt, 1937; Frezzi, 1940; Rossetti, 2001).
Although leprosis lesions are usually characteristic, leaf symptoms may sometimes be
mistaken for lesions of citrus canker (Rossetti, 1980). The bark symptoms of leprosis may
sometimes be confused with “zonate chlorosis”; “false leprosis”, “African concentric ring blotch
of citrus”, psorosis or “genetic brown spot” (Lovisolo, 2001; Rodrigues, 2000). The
misidentification of the disease has reinforced the needs for quick and reliable diagnostic
methods to detect the virus.
Historic Perspective and Impact of Citrus Leprosis Disease
Leprosis disease has been called by several common names. In Florida, leprosis was
known as “scaly bark” because of symptoms on the bark and as “nail head rust” because of the
symptoms on the fruit (Fawcett & Lee, 1926; Knorr, 1973; Knorr & Price, 1958). In Argentina
the disease was called “lepra explosiva” because of the severity of the disease (Frezzi, 1940), and
in Brazil as “leprose or variola” (Bitancourt, 1937) because of the similarities of the symptoms
with the homonymous human disease.
For many years the etiology of leprosis disease was unknown and was erroneously
attributed to various pathogens (Childers et al., 2003b; Knorr, 1968; Rodrigues, 2000).
Interestingly, the first report of citrus leprosis came from Pinellas County, Florida, where the
16
disease was attributed to the fungus Caldosporium herbarum var. citricolum (Fawcett, 1911). In
Paraguay during the 1920’s, the disease was associated with the fungus Amylorosa aurantiarum
(Knorr, 1968). Later observations suggested that mite nymphs reared from virus-free eggs were
able to cause leprosis symptoms after feeding for several hours on uninfected citrus trees, as well
as mites taken from infected citrus trees (Knorr, 1968; Knorr, et al., 1968), suggesting that the
disease was caused by mite feeding damage or by a toxin injected into citrus by mites (Chagas &
Rossetti, 1980; Chagas et al., 1984; Knorr, 1968). However, mechanical and graft transmission
of leprosis, together with the electron microscopy evidence of rhabdovirus-like particles found in
leprosis-affected citrus tissue and in leprosis-infected B. phoenicis mites, discounted the idea that
leprosis was caused by mite toxins or by mite feeding (Colariccio et al., 1995; Rodrigues et al.,
2003). Further experimental transmission of leprosis using mites from infected plants supported
the idea that leprosis was caused by a pathogen, probably a virus, which was vectored by
Brevipalpus mites (Colariccio et al., 1995; Kitajima et al., 1972; Rossetti, 1996).
During the early 1900s, citrus leprosis had a serious negative impact on Florida citrus
production (Fawcett, 1911; Fawcett & Lee, 1926). After 1926, the incidence of leprosis in
Florida drastically declined. This decline coincided with the increased use of sulfur in the late
1920s as an effective miticide for controlling citrus rust mites (Knorr, 1968; Knorr et al., 1968).
Childers et al., (2001a; 2001b; 2003b) speculated that the freeze of December 1962 may have
been another contributing factor for the disappearance of the disease, because leprosis has not
been detected in Florida following that freeze. Other factors, such as grove management tactics,
changes in the mite’s ability to transmit the virus or changes in the pathogen virulence, may have
contributed to the disappearance of the disease in Florida (Childers et al., 2001a; Childers et al.,
2003b). For whatever reason, citrus leprosis no longer occurs in Florida (Childers et al., 2003b),
17
although the mite vectors are present in Florida, Texas and California (Childers et al., 2003b;
Childers et al., 2003c; Knorr, 1968).
The northward movement of leprosis from South America into Central America and
towards North America suggests that the disease could be reintroduced into Florida and other US
states (Childers et al., 2003b; Childers et al., 2003c; Guerra-Moreno et al., 2003; Guerra-
Moreno, 2004; Guerra-Moreno et al., 2005a; Knorr, 1968). Recently, more than 80 mite species,
including B. phoenicis, were detected in air cargo shipments of ornamental rooted plants and
cuttings arriving from Central American countries where citrus leprosis is present (Childers &
Rodrigues, 2005); highlighting the danger to the Florida and U.S. citrus and ornamental
industries.
Geographical Distribution of Leprosis
Citrus leprosis disease was first reported in Paraguay South America in the 1920’s and late
reports then was found in Argentina, Brazil, and Uruguay (Bitancourt, 1937; Childers et al.,
2001a; Childers et al., 2003b; Fawcett & Lee, 1926; Knorr et al., 1968; Rodrigues et al., 2003).
It is now emerging as a spreading disease in Venezuela (Childers et al., 2001a) and Panama
(Dominguez et al., 2001; Guerra-Moreno, 2004; Guerra-Moreno et al., 2005a; Guerra-Moreno et
al., 2005b). Recently the disease has been reported in Costa Rica (Araya-Gonzalez, 2000),
Guatemala (Palmieri et al., 2005), Honduras (Rodrigues et al., 2007), Nicaragua (Meza
Guerrero, 2003), Bolivia (Gómez et al., 2005), Mexico (Sánchez-Anguiano, 2005) and Colombia
(Leon M. et al., 2006). Citrus leprosis now poses a serious threat to citrus production in North
America and the Caribbean Basin. Symptoms of leprosis-like diseases have been reported from
citrus-producing areas of Asia and Africa (Fawcett & Lee, 1926; Knorr & Price, 1958; Rhoads &
DeBusk, 1931), but none of these reports have been confirmed to be leprosis (Lovisolo, 2001).
18
Citrus Leprosis in Panama
Citrus leprosis-like symptoms were first reported during the early 1990s in citrus orchards
in Boquete and Potrerillos, Chiriquí State, Panama (Botello, L., personal communication). The
presence of citrus leprosis virus in those areas was confirmed using transmission electron
microscopy (TEM) (Dominguez et al., 2001; Guerra-Moreno et al., 2003; Guerra-Moreno, 2004;
Guerra-Moreno et al., 2004). The disease may have been introduced by infected mites or
budwood in the 1980s through illegal importations from Brazil (Botello, L., personal
communication). Recommendations were made to eradicate the disease from Panama
(Dominguez et al., 2001; Fernandez, O. and Botello, L., personal communication). Other
scientists from Brazil and USA also made recommendations to avoid the spreading of the disease
by pruning and burning of the infected trees, application of miticides, and quarantine programs to
stop the movement of infected materials (Botello, L., personal communication; Childers et al.,
2001b; Guerra-Moreno, 2004). However, none of these recommendations were successfully
implemented, and leprosis has been observed in other provinces of Panama (Bernal, A., personal
communication).
Virus Properties, Morphology and Cytopathological Effect
Early in the 1970’s the observation of rod-like particles (40-50 nm × 100-110 nm) in the
nucleus and cytoplasm of leprosis-affected citrus tissue was reported (Kitajima et al., 1972). The
particles were associated with nuclear and endoplasmic reticulum membranes and at times
electro-lucent, amorphous viroplasms were found in the nuclei of infected cells. Based on the
particle shape and cytopathological effects observed in infected tissue, the virus was tentatively
placed into the Rhabdoviridae family (Kitajima et al., 1972; Rodrigues, 2000; Rodrigues &
Machado, 2000). In later TEM studies, the virus was reported to occur only in the cytoplasm
(Colariccio et al., 1995; Kitajima, 1974; Rodrigues, 2000). These virus particles were bacilliform
19
(50-60 nm × 100-110 nm) and found within cisternae of the endoplasmic reticulum with
electron-dense, vacuolated viroplasms in the cytoplasm. These two distinct cytological features
suggested that citrus leprosis maybe caused by two different viruses; one virus present in
cytoplasm only and the other virus present predominantly in the nucleus (Childers et al., 2001a;
Kitajima et al., 2003a). Also, it has been hypothesized that the virus may be located either in the
nucleus or the cytoplasm, depending on the early or late developmental stage of the virus,
respectively (Colariccio et al., 1995).
Based on virion morphology, subcellular localization, cytopathological effects and
sequence analysis, at least two different viruses have been associated with citrus leprosis
(Guerra-Moreno, 2004; Guerra-Moreno, et al., 2005; Kitajima et al., 1972; Kitajima et al, 1974;
Rodrigues, 2000 Locali-Fabris et al., 2006; Pascon et al., 2006). The Cytoplasmic citrus leprosis
virus (CCLV) with particles observed only in the cytoplasm, is seen most frequently, compared
to the nuclear citrus leprosis virus (NCLV) where particles accumulate mainly in the nucleus, but
some virions are also seen in the cytoplasm of infected citrus cells (Guerra-Moreno, 2004;
Guerra-Moreno et al., 2005a; Kitajima et al., 2003a; Kitajima et al., 2000; Kitajima et al., 1972;
Colariccio et al., 1995; Rodrigues, 2000). NCLV was reported initially in Brazil (Kitajima et al.,
1972); and since then has been reported only in São Paulo and Rio Grande do Sul States in Brazil
(Bastianel et al., 2006b) and in Boquete, Chiriquí State, Panama (Dominguez et al., 2001;
Guerra-Moreno et al., 2003; Guerra-Moreno, 2004; Guerra-Moreno et al., 2005a).
Although CCLV has not been purified and accumulate in low concentration in infected
citrus tissue (Rodrigues et al., 2003; Lovisolo et al., 2000), its physical properties was reported
more than a decade ago. CCLV is a thermopile virus that multiplies only if the day temperature
is above 24 ˚C and the night temperature is above 21˚C; the thermal inactivation point is 55-60
20
˚C; longevity in vitro is 6 days at 4˚ C and 3 days at room temperature as determined on
herbaceous host by Lovisolo et al., (1996; 2000). The CCLV dilution end point is 10-3 and it
maintains its infectivity for about 45 months in dried leaves. CCLV coulb be partially purified
from inoculated leaves of Chenopodium quinoa, starting from 24 hours after inoculation
(Lovisolo, 2001; Lovisolo et al., 2000).
The cytopathological effects caused by CCLV inside citrus cells are similar to those caused
by other plant pathogens (Dominguez et al., 2001; Guerra-Moreno, 2004; Kitajima et al., 1972).
Light micrographs show abnormal cytopathological effects including hypertrophy, hyperplasia
and necrosis in tissues infected with CCLV from Panama (Guerra-Moreno et al., 2003; Guerra-
Moreno, 2004). Virus particles have been found only in symptomatic tissue and the surrounding
asymptomatic tissue contained no virus particles (Guerra-Moreno et al., 2003; Guerra-Moreno,
2004; Kitajima et al., 1972; Kitajima et al., 1974).
Host Range of Leprosis
Leprosis was first documented in the late nineteenth century in Pinellas County, Florida
(Fawcett & Lee, 1926; Knorr, 1973; Rhoads & DeBusk, 1931). All of the twelve known natural
hosts of leprosis are in the genus Citrus (Chagas & Rossetti, 1980; Lovisolo, 2001; Lovisolo, et
al., 2000). All commercial citrus varieties are susceptible to leprosis and different reactions have
been detected within the citrus varieties (Rodrigues, 2000; Rodrigues & Machado, 2000). Sweet
orange is the most susceptible natural host, while mandarins, lemons and other hybrids such as
tangor “Murcott” (Citrus sinensis × C. reticulata) are less susceptible under natural conditions
(Bastianel et al., 2006a; Rodrigues, 2000; Rodrigues et al., 2007).
Several ornamental and herbaceous plants have been found with leprosis-like symptoms
under natural and greenhouse conditions (Bastianel et al., 2006b; De Andrade-Maia & Leite De
Oliveira, 2005; Lovisolo et al., 2000; Rodrigues et al., 2005). Also sweet orange varieties Natal
21
and Valencia were found having leprosis-like symptoms after being inoculated with infectious
Brevipalpus mites raised on Ageratum conyzoides, Commelina benghalensis, Bixa orellana or
Sida cordifolia (De Andrade-Maia & Leite De Oliveira, 2005); however the presence of CCLV
was not confirmed by TEM or RT-PCR analysis. The species B. orellana has been used largely
as windbreaks and hedge rows, while S. cordifolia, A. conyzoides and C. benghalensis are
considered weeds. There is a general concern that these plants may be alternative hosts for the
virus as well as hosts for the vector (Bastianel et al., 2006b; De Andrade-Maia & Leite De
Oliveira, 2005). Further, ornamental plants of the Geraniaceae, Solanaceae and Acanthaceae
families with leprosis-like symptoms have been identified, and virus-like particles were observed
in symptomatic tissue by TEM analysis (Nogueira et al., 2003). More studies are needed to
determine whether CCLV is present in these host plants and if Brevipalpus mites can vector the
virus to or from these plant species. Recently, another herbaceous plant, Solanum violaefolium,
was found with typical leprosis symptoms, and found to contain virus particles and gave positive
results by RT-PCR after infection with Brevipalpus mites maintained on infected citrus seedlings
(Rodrigues et al., 2005).
Genetic Resistance to Leprosis
Research toward understanding the genetic basis for resistance to leprosis is at an initial
stage. It is known that mandarin and citrus hybrids are less susceptible to leprosis. Under natural
conditions mandarin and others citrus hybrids have showed minimal leprosis lesions (Rodrigues,
2000; Rodrigues et al,. 2007). Recently, the progenies of crosses between “Pera” sweet orange
and tangor “Murcott” displayed a high level of resistance to citrus leprosis, suggesting that
inheritance of resistance may be controlled by a major gene or few genes (Bastianel et al.,
2006a), but plants have not been tested under field conditions.
22
Transmission of Citrus Leprosis
Mechanical transmission of CCLV has been reported by sap inoculation from infected
sweet orange leaves, fruit peel, and young bark and from symptomatic Cleopatra mandarin
leaves to herbaceous species such, as Chenopodium spp. and to Citrus sinensis cv. Caipira
(Lovisolo et al., 1996; Lovisolo et al., 2000). The herbaceous species that are susceptible
following mechanical inoculation belong to the Chenopodiaceae, Amaranthaceae, or
Tetragoniaceae families; in the order Centrospermae. Mechanical inoculation of the virus to
these herbaceous hosts resulted in necrotic local lesions developing 2-3 days later. However, it
has not been possible to inoculate the virus back to Citrus spp., even after partial purification
(Bastianel et al., 2006b; Lovisolo, 2001; Rodrigues et al., 2007).
Unsuccessful transmissions have been obtained by grafting techniques (Chagas et al.,
1984; Rodrigues et al., 2003; Rodrigues, 2000). Symptomatic leaf tissue grafted into healthy
young citrus plants developed leprosis-like lesions 4.5 to 13 months later (Chagas & Rossetti,
1980; Chagas & Rossetti, 1984; Chagas et al., 1984). However, symptoms on the receptor plants
remained adjacent to the symptomatic tissue grafted from the donor plant.
After mechanical and mite transmission, the appearance of typical leprosis symptoms
varied from few days to months (Kitajima et al., 2003a; Kitajima et al., 2000; Rodrigues, 2000;
Rodrigues et al., 2003). Leprosis symptoms on infected tissue appeared 17-20 days to 2 months
after inoculation with infected mites (Chiavegato & Salibe, 1984; De Andrade-Maia & Leite De
Oliveira, 2005; Kitajima et al., 2003a; Kitajima et al., 2000; Rodrigues et al., 2003). Recently,
mite transmission of NCLV from citrus to citrus was achieved; however, mechanical
transmission has been unsuccessful (Bastianel et al., 2006b). Transmission of leprosis through
seed has not been reported (Rodrigues, 2000).
23
Mite Vector’s Biology and Transmission
The false spider mites in the genus Brevipalpus (Acari: Tenuipalpidae) are considered the
vectors of the virus (Chagas et al., 1984; Rodrigues, 2000; Rodrigues & Machado, 2000;
Rodrigues et al., 2007). The association of leprosis with false spider mite (B. obovatus) was first
reported in Argentina (Frezzi, 1940); B. californicus was associated with leprosis in Florida
(Knorr, 1968; Knorr et al.,1968); while leprosis in Brazil was associated with B. phoenicis
(Musumeci & Rossetti, 1963). According to Haramoto (1969) and González (1975), Brevipalpus
mites are cosmopolitan and occur on citrus around the world.
The three species of Brevipalpus (B. phoenicis, B. californicus and B. obovatus) have been
collected from citrus in Florida (Childers et al., 2003b; Childers et al., 2003c; Kitajima et al.,
2003a; Knorr, 1968); while only B. californicus and B. phoenicis have been reported from Texas
(Childers, 1994; Denmark, 1984; French & Rakha, 1994b; Knorr, 1968). The mite B. phoenicis
was the most common tenuipalpid species in Central America and was found on 114 different
plants including traditional and non-traditional crop, trees as well as ornamental, medicinal and
weed plants (Ochoa et al., 1994). Lately, Brevipalpus spp. have been found on 928 plant species
belonging to 139 families (Childers et al., 2003c). Under field conditions, the mites’ preferred
habitat sites are fruit, due to fruit dented surfaces (Bastianel et al., 2006b; Childers et al., 2001a;
Reis et al., 2003; Rodrigues et al., 2003; Teodoro & Reis, 2004). As many as a thousand mites
can occur on a single citrus fruit infected with leprosis (Knorr, 1968). Nevertheless, citrus leaves
are the main reservoir of mites (Rodrigues, 2000). Citrus leaves are also the more suitable site for
the development of mites in captivity (Teodoro & Reis, 2006).
The transmission rates varied for the different mite developmental stages; the nymphal
stages of Brevipalpus mites were found to be more efficient as vectors of leprosis than adults by
Chagas et al., (1984); Chagas & Rossetti (1984). In contrast, Chiavegato et al., (1997);
24
Chiavegato & Salibe (1984) reported that all active stages of the Brevipalpus mites transmitted
the virus and that there were no differences in transmission efficiencies.
TEM have been used to look for virus-like particles in Brevipalpus mites (Rodrigues et al.,
1997). A large number of virus-like particles were observed in female B. phoenicis mites
collected from CCLV-infected tissue (Rodrigues et al., 1997). The quantity and location of these
particles suggested that the virus multiplies inside the vector, and that trans-stadial transmission
of the virus occurs in B. phoenicis. Conversely, mites originating from eggs contained no virus-
like particles and did not transmit the disease, indicating that the virus is not passed to the
progeny trans-ovarially (Rodrigues, 2000; Rodrigues & Machado, 2000). After mites acquire
virus, they retain the ability to transmit the virus for their lifetime (trans-stadial transmission),
even when feeding only on non symptomatic host plants and after successive molts (Rodrigues et
al., 2003; Rodrigues, 2000; Rodrigues et al., 1997).
Mites belonging to B. phoenicis species also have been reported to vector coffee ringspot
virus (putative member of the Rhabdoviridae family) in Coffea arabica and passionfruit green
spot virus (PFGSV) in passionfruit plants (Chagas et al., 2003; Childers & Derrick, 2003;
Childers et al., 2003c; Kitajima et al., 2003a; Kitajima et al., 2003b). However, neither of these
viruses could be transmitted to citrus, similarly CCLV could not be transmitted into either coffee
or passionfruit plants using Brevipalpus mites (Chagas et al., 2003; Kitajima et al., 2003a;
Kitajima et al., 2003b; Kitajima et al., 2000).
Mite populations in citrus orchards are dynamic and fluctuate around the year (Bassanezi
& Laranjeira, 2007; Bastianel et al., 2006b; Rodrigues, 2000). Citrus plants infected with
leprosis as well as mite populations tend to occur in clusters within citrus orchards (Bassanezi &
Laranjeira, 2007). In Brazil, Brevipalpus populations reach their peak during the dry season with
25
lower populations during the rainy season due mainly to the rain wash-off effect (Bassanezi &
Laranjeira, 2007; Bastianel et al., 2006b; Rodrigues, 2000). A similar situation is observed in
Panama (Guerra-Moreno, et al., unpublished results).
Molecular Characterization of Leprosis Virus
The characterization of citrus leprosis has been delayed since it has been difficult to purify
the virus (Lovisolo et al., 2000). Although citrus leprosis has been present in South America for
almost a century (Bitancourt, 1937; Frezzi, 1940), the molecular characterization has been done
until recently years. The presence of double-stranded RNA (dsRNA) in leprosis infected citrus
plants was reported (Colariccio et al., 2000). The same authors obtained purified extractions
from herbaceous hosts following mechanical transmission from citrus and reported three dsRNA
bands of molecular weights between 6 to 8 MDa. Molecular studies showing the presence of
RNAs only in the symptomatic tissue (Guerra-Moreno, 2004; Guerra-Moreno et al., 2005a) and
TEM analyses detecting no virus particles in the surrounding asymptomatic areas (Guerra-
Moreno, 2004; Kitajima et al., 1972; Kitajima, 1974) supported the earlier hypothesis that CCLV
has limited or non-systemic movement in citrus tissue (Kitajima et al., 2003a; Kitajima et al.,
2000; Rossetti, 1980; Rossetti, 1996).
Initial molecular characterization and the construction of cDNA libraries were performed
by different groups (Guerra-Moreno, 2004; Locali et al., 2003). In Florida, a total RNA
extraction of CCLV-infected citrus tissue was used to construct a cDNA library (Guerra-Moreno
et al., 2003; Guerra-Moreno, 2004; Guerra-Moreno et al., 2005a). Some putative CCLV genome
sequences were found which had similarities to other plant viruses. Hybridization studies
indicated a leprosis viral genome of about 10-12 kb. A DNA probe based on putative CCLV
sequence hybridized with the genomic RNA and a smaller RNA of about 1.5 kb in infected
tissues (Guerra-Moreno et al., 2003; Guerra-Moreno, 2004; Guerra-Moreno et al., 2005a). In
26
Brazil, a cDNA library was created using dsRNA isolated from lesions of CCLV-infected citrus
tissue and two gene segments encoding the putative movement protein and replicase genes were
identified (Locali et al., 2003). Diagnostic methods based on RT-PCR detection were developed
to amplify putative CCLV genome regions (Guerra-Moreno, 2004; Locali et al., 2003)
Recently, a few negative-stranded plant viruses such as Orchid fleck virus (OFV) and
Lettuce big-vein associate virus (LBVaV), with similarities in particle morphology and genome
organization to Rhabdoviridae have been characterized (Kondo et al., 2006; Kondo, 1998;
Sasaya et al., 2001; Sasaya et al., 2004). However, they differ from rhabdoviruses (single
component negative-sense RNA viruses) in having multipartite genomes. In LBVaV, both the
positive-sense and negative-sense RNAs are encapsidated but in separate virions (Sasaya et al.,
2002; Sasaya et al., 2004). In the light of these findings, a re-evaluation of the taxonomic
position of LBVaV was recommended. OFV has a bipartite, negative-sense RNA genome
(Kondo et al., 2006; Kondo et al., 2003; Kondo, 1998). Based on morphology of the virion
particle, vector transmission, genome structure and organization, it was recommended that OFV
and other associated plant viruses such as Coffee ringspot virus (CoRSV) (Chagas et al., 2003)
and Passionfruit green spot virus (PFGSV) (Kitajima et al., 2003b) as well as other viruses
causing diseases in ornamental plants be placed in a new genus Dichorhabdovirus in the family
Rhabdoviridae of the order Mononegavirales (Kitajima et al., 2003a; Kondo et al., 2006; Kondo
et al., 2003). The complete bipartite negative-sense RNA genome of OFV was recently
sequenced (Kondo et al., 2006), and its nucleotide sequence, genomic structure and organization
is different from the RNA genome of CCLV (Guerra-Moreno, 2004; Guerra-Moreno et al.,
2005a; Locali et al., 2003). The NCLV could provisionally be placed under same genus as OFV,
27
based on its similarity in virus particle (Guerra-Moreno, 2004; Kitajima et al., 2003a) until
further molecular studies clarify its position.
Methods of Detection for Leprosis
The lack of quick and accurate methods to identify leprosis-causing viruses and the
superficial similarity of leprosis symptoms with other bark scaling diseases has led to difficulty
in the identification of citrus leprosis (Colariccio et al., 2000; Lovisolo, 2001; Rossetti, 1996).
The diagnosis of CCLV has been mainly based on symptomatology (Lovisolo, 2001), with
confirmation by visualization of rhabdovirus-like particles in the cytoplasm by TEM (Colariccio
et al., 2000; Lovisolo et al., 2000; Rodrigues et al., 2000).
The use of herbaceous hosts that developed local lesions have been used for the detection
of CCLV has been reported (Lovisolo et al., 2000; Rodrigues, 2000). The use of Chenopodium
quinoa as a herbaceous indicator for the detection of CCLV takes as short of time as three days
after inoculation under appropriate conditions (Lovisolo et al., 2000). However, this assay can
not be back transmitted to citrus to verify that CCLV is, in fact, causing the local lesions.
The development of molecular information on CCLV has resulted in the development of
new, accurate and rapid molecular approaches for the detection of CCLV. RT-PCR methods
have been reported (Guerra-Moreno, 2004; Locali et al., 2003). Serological approaches also are
being developed. A CCLV protein (ORF2 of RNA 1) was expressed in bacteria and used to raise
CCLV-specific polyclonal antibodies in rabbits and chickens (Rangel et al., 2005). These
polyclonal antibodies have been used in double-antibody-sandwich-indirect ELISA (DASI-
ELISA) and in Western blot assays for diagnosis of CCLV in citrus plants and Brevipalpus mites
(Manjunath, et al., unpublished results).
28
Management of Leprosis Disease
Current management strategies for citrus leprosis are based on control of the mite vectos
by acaricides and removal of symptomatic plant tissue. Leprosis symptoms and Brevipalpus
mites are found in citrus groves through out the year (Bassanezi & Laranjeira, 2007; Rodrigues,
2000). Miticides are expensive, and may be ineffective because successful virus transmission
may have occurred prior to treatment (Gravena et al., 2005). Miticides must be applied up to
three or more times per year, after a field survey indicates that the mite population is at economic
threshold levels (Bassanezi & Laranjeira, 2007; Gravena et al., 2005; Omoto, 1998; Omoto et
al., 2003; Rodrigues, 2000; Rodrigues & Machado, 2000). However, a recent study revealed that
infected citrus plants tend to occur in clusters and that most of the time the Brevipalpus mites are
not observed on diseased plants (Bassanezi & Laranjeira, 2007). Changes in the methodology for
mites and leprosis sampling was recommended, since low levels of mite populations were not
detected using current methodology (Bassanezi & Laranjeira, 2007).
At present, miticides are the first option to control mite populations on highly infested
citrus orchards (Bassanezi & Laranjeira, 2007; Omoto, 1998; Rodrigues, 2000). Most of the
acaricides used to suppress Brevipalpus mites populations belong to the organoestamic group,
and mite resistance to these chemical has been well documented in several research studies
(Campos & Omoto, 2002; Campos & Omoto, 2006; Gravena et al., 2005; Omoto, 1998).
Hexythiazox (mite growth regulator; DuPont, Brazil) is one of the most used miticide to suppress
Brevipalpus populations in citrus areas in Brazil, but mites have quickly developed resistance
(Campos & Omoto, 2002; Omoto, 1998). The exact mode of action of Hexythiazox is not well
understood; however it kills the eggs before hatching and may kill the nymphal immature stages
(Brown, 2005). It has been suggested that resistance to Hexythiazox under field conditions may
29
be avoided by rotating with miticides that have different modes of action (Campos & Omoto,
2006).
Mite populations also can be suppressed by cultural and mechanical control strategies
(Bassanezi & Laranjeira, 2007; Childers et al., 2001a; Childers et al., 2001b; Rodrigues, 2000).
These strategies includes the reduction of symptomatic tissue by pruning of symptomatic
branche; planting windbreaks to help limit the spread of the mite vectors; control of weed hosts
of the mites; the use of healthy seedlings to replant orchards and minimizing the movement of
people, equipment and plant materials, such as budwood, fruit, and rooted plants in and out of
citrus orchards (Bassanezi & Laranjeira, 2007; Childers et al., 2001a; Childers et al., 2001b;
Guerra-Moreno, 2004; Kitajima et al., 2003a; Omoto, 1998; Palmieri et al., 2005). If leprosis is
not present in a region, the best management strategy is a strict quarantine (Omoto, 1998;
Rodrigues, 2000; Rodrigues & Machado, 2000). The use of windbreaks has been recommended
(Omoto, 1998; Rodrigues, 2000), however recent studies showed that some plants used as
windbreakers and hedge rows in Brazil could be hosts of CCLV (De Andrade-Maia & Leite De
Oliveira, 2005).
Natural products also have been used to control mite populations keeping them under the
threshold levels (Chen et al., 2006; Omoto; 1998; Reis et al., 2003; Rodrigues, 2000). Plant
extracts from species such as Luffa cylindrical, Allium sativum, Hedera helix and Datura metel
to repel or reduce the activity of Brevipalpus mites (Guirado et al., 2001), have been tested in
citrus orchards infected with Brevipalpus mites, but without good results. The use of biological
agents to control Brevipalpus mite populations is another strategy used to mitigate mite damage
and transmission of the leprosis virus. Predacious mite species belonging to the Phytoseiidae
family, which are naturally present in citrus orchards have a negative effect on Brevipalpus mite
30
populations (Chen et al., 2006; Reis et al., 2003; Rodrigues, 2000). Entomopathogenic fungi
such as Hirsutella thompsonii have been deployed with promising results as an alternative
strategy to control mites (Rossi-Zalaf & Alves, 2006).
Purpose of the Current Research
Leprosis threatens citrus production in North America and the Caribbean Basin as it moves
northward from South and Central America. Since little is known about the molecular properties
of CCLV, molecular information of this virus is critically needed for the development of better,
reliable and quick detection tools for this virus and for the development of better management
methods of the disease. The present research was undertaken to conduct a molecular
characterization of genomic, subgenomic and defective interfering RNAs of CCLV isolated from
Panama and use this information to develop rapid and reliable nucleic acid based and serological
methods to detect the virus. The rapid and reliable identification of the virus will be useful to
monitor and avoid the possible introduction and spreading of CCLV from infected countries into
North American, Caribbean countries, or possibly other continents. These diagnostic methods
will assist the economic production of citrus in countries where leprosis is present.
31
CHAPTER 2 MOLECULAR CHARACTERIZATION OF GENOMIC, SUBGENOMIC AND DEFECTIVE
INTERFERING RNAS OF A PANAMANIAN ISOLATE OF CYTOPLASMIC CITRUS LEPROSIS VIRUS
Introduction
Citrus leprosis is one of the most important viral diseases of citrus in Brazil, with more
than 21 % of the total citrus production cost (US$ 75 million/year) used for miticides to control
the Brevipalpus mite vector (Omoto, 1998; Omoto et al., 2003 ; Rodrigues et al., 2003;
Rodrigues, 2000; Rodrigues & Machado, 2000). For more than six decades, leprosis disease has
been present in Argentina, Brazil, Paraguay, and Uruguay (Bittancourt, 1937; Childers et al.,
2003a; Childers et al., 2001; Fawcett & Lee, 1926; Knorr, 1968; Rodrigues et al., 2003) and is
now an emerging and spreading disease in Venezuela (Childers et al., 2003b) and Panama
(Dominguez et al., 2001). There are also recent reports of citrus leprosis from Costa Rica
(Araya-Gonzalez, 2000), Guatemala (Palmieri et al., 2005), Honduras and Nicaragua (Meza
Guerrero, 2003), Bolivia (Gómez et al., 2005), Mexico (Sánchez-Anguiano, 2005) and Colombia
(Leon M. et al., 2006). Vectors of the virus have a broad host range and are present in most of
the citrus production areas around the world (Childers et al., 2003b; Childers et al., 2001; Knorr,
1968; Rodrigues et al., 2003). Citrus leprosis does not occur in North America and the Caribbean
Basin, but it poses a serious threat for introduction in these areas.
The first cytological study in Brazil (Kitajima et al., 1972) reported the presence of rod-
like particles (40-50 × 100-110 nm) in the nucleus and cytoplasm of virus-infected cells,
commonly associated with the nuclear and endoplasmic reticulum (ER) membranes. More recent
cytological studies of the leprosis disease (Colariccio et al., 1995; Kitajima et al., 2003a;
Kitajima et al., 1974) reported the presence of a different virus morphology: bacilliform,
membrane-bound virus-like particles (50-60 × 100-110 nm) within the cisternae of the ER with
32
electron dense, vacuolated viroplasms in the cytoplasm and no virions were seen in the nucleus.
This from of citrus leprosis virus, located in the cytoplasm and referred as Cytoplasmic citrus
leprosis virus (CCLV) appears to be more commonly found and geographically widespread than
form found in the nucleus and referred as nuclear citrus leprosis virus (NCLV) which was
reported in 1972 (Kitajima et al., 2003a). NCLV has been reported only in areas of São Paulo
and Rio Grande do Sul States in Brazil (Bastianel et al., 2006b) and Boquete, Chiriquí State,
Panama (Dominguez et al., 2001; Guerra-Moreno et al., 2003; Guerra-Moreno, 2004; Guerra-
Moreno et al., 2005a).
Even though CCLV was tentatively placed in the family Rhabdoviridae based on particle
morphology and host cytopathology (Colariccio et al., 1995; Dominguez et al., 2001; Kitajima et
al., 2003b; Kitajima et al., 1972; Rodrigues, 2000), the virion morphology and cytopathological
effects of CCLV and the NCLV are fully distinct. Recent studies suggest that a multipartite
positive-sense RNA virus is associated with leprosis disease (Guerra-Moreno et al., 2003;
Guerra-Moreno, 2004; Guerra-Moreno, et al., 2004; Guerra-Moreno et al., 2005a). Hybridization
assays using CCLV-specific probes failed to hybridize with the extracts from tissues infected
with the NCLV type further demonstrating that the leprosis disease symptoms are caused by two
distinct viruses (Guerra-Moreno, et al., 2004) and verified the micrographic observations of
Kitajima et al., (2003a) and Guerra-Moreno et al., (2003).
Hybridizations assays, RT-PCR assays and transmission electron microscopy (TEM)
studies have shown the association of a multipartite positive-stranded RNA virus with CCLV
(Guerra-Moreno et al., 2003; Guerra-Moreno et al., 2004; Guerra-Moreno et al., 2005a; Guerra-
Moreno et al., 2005b; Locali et al., 2003). In 2003, RT-PCR assays were reported by different
groups to diagnose CCLV based on the sequences of ORF 2 in RNA 1 (Guerra-Moreno et al.,
33
2003) and ORF 1 in RNA 1 and ORF 3 in RNA 2 (Locali et al., 2003). Partial sequence
characterization of ORF 2 of RNA 1 of CCLV and an estimated size for RNA 1 (about 10 kb)
was reported from a leprosis isolate collected in Western Panama in 2004 (Guerra-Moreno,
2004). Research was continued to obtain the complete CCLV sequence.
Many viruses, for example Brome mosaic virus (BMV), Citrus tristeza virus (CTV),
Tobacco mosaic virus (TMV), Tomato bushy stunt virus (TBSV), Tobacco rattle virus (TRV)
and Lettuce infectious yellows virus (LiYV) produce an array of smaller than genomic (g-) RNAs
including subgenomic (sg-) and defective interfering RNA (DI-RNA) species (Ayllon et al.,
1999; Domingo & Holland, 1997; Hilf et al., 1995; Holland & Domingo, 1998; Holland et al.,
1982; Roux et al., 1991; White et al., 1991). ). It is unknown whether sg- and DI-RNAs are
produced during CCLV infections.
The present study was undertaken to develop a better understanding of the etiology of
CCLV and to understand the nature of the g- and other RNA molecules associated with CCLV
and methods of replication. This information should facilitate the development of better
diagnostic methods which would help develop improved management of leprosis.
Material and Methods
Virus Samples
Leaves, fruits and twigs from leprosis affected sweet orange plants, Citrus sinensis (L).
Osbeck (Figures 2-1 and 2-2), in the field were collected from two locations in Western Panama:
Boquete and Potrerillos, Chiriquí State. Tissues from lesion and non-lesion areas were used for
total nucleic acid extractions. Similar samples were collected from asymptomatic trees in
Potrerillos and Boquete, Panama and from apparently healthy trees in Florida for use as negative
controls.
34
Total Nucleic Acid Extraction and RNA Isolation
The extraction of total nucleic acids from leaf, fruit and bark tissue was done in Panama.
About 2-5 g of tissue was powdered in liquid nitrogen and used for extraction following a
modified protocol of Morris & Dodds (1979). Briefly, the powdered tissue was transferred to a
50 ml beaker and the following reagents were added: 7 ml of 2 X STE, pH 6.8 (20 mM Tris, pH
6.8; 0.2 M NaCl; 2 mM EDTA, pH 8.0); 10 ml of phenol (equilibrated with 0.5 M Tris, pH 8.0);
1 ml of 10% SDS; and 0.1% bentonite. The mixture was stirred for 30 min at 4 °C, then
centrifuged at 8,000 g for 20 min at 4 °C. The upper aqueous phase was collected and adjusted to
10 ml with 1 X STE, pH 6.8, and precipitated by adding 0.1 volume of 3.0 M sodium acetate, pH
5.2, and 2.5 volumes of 95% ethanol and stored at -20 °C. The total nucleic acid extracts were
shipped to University of Florida, Gainesville, and stored at -80 oC.
The isolation of total RNA was performed by centrifuging about 4 ml of the total nucleic
acid extract at 17,000 g for 20 min at 4 ºC, and the pellet was resuspended in 100 µl of RNase-
free water. A QIAgen RNeasy Plant Mini Kit (QIAgen) was then used to extract total RNAs
according to the manufacture’s protocol.
The quality of RNA obtained from these samples was analyzed by agarose gel
electrophoresis and by RT-PCR using primers specific for the 18S ribosomal RNA (rRNA) using
primers K616 (5’-TATGCTTGTCTCAAAGATTAAG-3’) and K617 (5’-
TAATTCTCCGTCACCCGTC-3’). The concentration of the total RNA was determined by
measuring the absorbance at 260 nm (A260) in a SmartSpec 3000TM spectrophotometer (Bio-
Rad), according to manufacturer’s protocol, and the average ratio A260/A280 was about 1.9.
Analysis of Putative Viral Sequences from a cDNA Library
In a previous study, the total RNA extracts from leprosis fruit lesions were used for the
construction of a cDNA library using the SmartTM cDNA Library Construction Kit (Clontech),
35
and selected λ phage clones were submitted for sequencing using universal reverse and forward
primers (Guerra-Moreno, 2004). Later, selected clones also were sequenced using CCLV-
specific forward and reverse primers (Table 2-1).
Comparison of Putative Viral Sequences
Clone sequences were analyzed using the Basic Local Alignment Search Tool (BLAST)
(Altschul et al., 1997) and compared to sequences deposited in GenBank at both the nucleotide
(nt) and amino acid (aa) levels. Sequences showing high levels of homology with plant
sequences were discarded. The remaining sequences without similarities with known plant
sequences were aligned using SEQUENCER version 4.5 software (Gene Codes Corporation).
Contig maps were created and analyzed.
Primer Design
Based on putative viral sequences, several sets of forward and reverse primers were
designed (Table 2-1). The primers were synthesized by Integrated DNA Technologies, Inc
(http://www.idtdna.com/).
Northern Blot Analysis Using DNA Probes
Three clones containing putative CCLV sequences in the vector pTriplEx2 (Figures 2-3
and 2-4) were used for synthesis of Digoxigenin (DIG)-labeled DNA probes by PCR using
universal primers according to manufacturer’s protocol (Roche Applied Science). Approximately
5 µg each of the total RNA extractions of tested samples were subjected to electrophoresis on a
1.2% agarose gel containing 2% formaldehyde in 1 X MOPS buffer, pH 7.0 (20 mM MOPS, 5
mM sodium acetate, 2 mM EDTA), and electrophoresced at 70 volts for 4 h. The gels were
stained with ethidium bromide (0.5 µg ml-1) for visualization of rRNAs as loading controls. The
electrophoresced RNAs were transferred from the agarose gels to a positively-charged nylon
membrane by capillary transfer. Hybridization was carried out using 100 ng of DIG-labeled
36
DNA probe in 5 ml of hybridization buffer. After incubating the membrane with anti-DIG
antibody alkaline phosphatase conjugate, the probe was visualized by chemiluminescent
detection using CDP-Star according to the manufacturer’s protocol (Roche Applied Science).
Further Sequencing of CCLV RNAs
Cloned sequences that belonged to a previously created cDNA library (Guerra-Moreno,
2004) were subjected to a detailed screening and some were found to contain putative viral
sequences. Based on similar hybridization patterns seen with probes 1 (Guerra-Moreno, 2004)
and 2 from plasmids AGpl-1-C09 and AGpl-2-F08 (Figure 2-3), respectively, primers Kpr745
and Kpr659 (Table 2-1) were designed and used for RT-PCR analysis.
First, the RT reaction was performed using the ThermoScript Reverse Transcriptase kit
(Invitrogen), according to the manufacturer’s instructions. In sterile 0.5 ml PCR tubes the
following reagents were added: 3.0 µg of total RNA extract, 1 µl of Kpr-745 and Kpr-659
primers (10 µM each), 10 mM dNTP Mix and RNase-free water to 12 µl. The tube contents were
mixed, incubated at 65 ºC for 5 min and transferred to ice immediately. A mixture containing 4
µl of 5 X cDNA synthesis buffer, 1 µl of 0.1 M DTT, 1 µl RNaseOUT (40 U µl-1) and 1 µl of
ThermoScript RT enzyme (15 units µl-1) was added to each tube. The mixture was incubated at
60 ºC for 1 h. The reaction was terminated by a final incubation at 85 ºC for 5 min. One µl of E.
coli RNase H (2 U μl-1) was added to the tube, and the tubes were incubated at 37 °C for 20 min
to remove the complementary RNA strand. The generated cDNA strand was either immediately
used or stored at -20 ºC for further use.
The PCR reaction was performed using the MasterAmp™ Extra-Long PCR Kit
(Epicentre). The PCR reaction mixture consisted of 4 µl of first strand cDNA, 1 µl of each
CCLV-specific primers [Kpr-745 and Kpr-659 (10 µM each)]; 1 µl MasterAmp Extra-Long
DNA Polymerase Mix and sterile water to a reaction volume of 25 ml. Then, an aliquot of 25 µl
37
of the MasterAmp Extra-Long PCR 2 X Pre-Mix was added to the mixture. Amplification
parameters included an initial denaturation cycle at 94 ºC for 3 minutes; follow by 15 cycles of
94 ºC for 15 seconds and 68 ºC for 8 min; then 15 cycles of 92 ºC for 20 seconds and 68 ºC for 8
min (with 20 seconds increase in time every round or cycle); followed by a final incubation at 68
ºC for 10 minutes. Ten µl of each of the RT-PCR products were electrophoretically separated on
0.8 % agarose in 1 X TAE buffer (40 mM Tris-Acetate and 1 mM EDTA, pH 8.0) at 100 volts
for 55 minutes, and stained with ethidium bromide. The RT-PCR-amplified products were
visualized using a Bio-Rad Gel-Doc imaging system.
The amplified products of approximately 6.6 kb were column purified using the QIAquick
Gel Extraction Kit, following the manufacturer’s instructions (QIAgen). The purified RT-PCR
product was cloned into pCR-XL-TOPO vector (Invitrogen) and sequenced using the genome-
walking method (Fazeli & Rezaian, 2000; Livieratos et al., 1999a). Sequence information from
the cloned RT-PCR products were used to design new CCLV primers to obtain the remaining
sequences from those clones. The CCLV sequences were confirmed by amplifying the genomic
region of several CCLV clones from independent RT-PCRs using CCLV specific primers (Table
2-1).
Similarly, the region between clones AGpl-1-A01 and AGpl-2-D08 (probes 3 and 4;
Figure 2-7) that also showed comparable hybridization patterns was amplified (about 1050 nt) by
using Kpr-671 and AGpr-04 primers (Table 2-1). The MasterAmp™ Extra-Long PCR Kit
(Epicentre) was used to perform the PCR assay. The products were cloned and sequenced as
described previously using primers Kpr745 and Kpr659 (Table 2-1).
Determination of the 5’ and 3’ Ends of CCLV g- and sgRNAs
The 5’ and 3’ ends of the g- , sgRNAs and DI-RNAs were obtained by using two different
techniques; the SMART RACE cDNA amplification kit (BD Bioscience) and the GeneRacer kit
38
(Invitrogen). CCLV-specific primers AGpr06, Kpr659, Kpr658, AGpr32, AGpr20, Kpr643,
Kpr670 and Kpr671 (Table 2-1) were used individually with the SMART II and CDSIII oligos
for ‘RACE ready’ using the SMART RACE cDNA amplification kit (BD Bioscience) to
generate the first strand cDNA. The PCR amplification of both the 5’- and 3’-ends were
completed using 1 µl of universal primer and 1 µl of CCLV-specific primer following the
manufacture’s protocols. The PCR products were purified (QIAquick Gel Extraction Kit,
QIAgen), cloned (TOPO TA cloning kit, Invitrogen) and sequenced.
The GeneRacer method (Invitrogen) was used to determine the 5’ end of capped sequences
and the 3’ end of CCLV RNAs. Briefly, the total RNA preparation was dephosphorylated and
decapped, followed by ligation with an RNA adapter oligonucleotide according to the
manufacturer’s protocols. The cDNA synthesis was performed using Thermoscript reverse
transcriptase (Invitrogen) at 60 oC for 55 min with CCLV-specific primers AGpr-06, Kpr-659,
Kpr-658 AGpr-32, AGpr-20, Kpr-643, Kpr-670 and Kpr-671 (Table 2-1) in separate reactions.
The PCR amplifications were conducted using Taq DNA Polymerase recombinant kit
(Invitrogen) and the provided 5’ universal primer and a CCLV-specific primer. Control HeLa
total RNA extractions (positive control from Invitrogen) and water control (negative control)
also were used in RT-PCR assays. Selected PCR products were gel purified, cloned (TOPO TA
cloning kit, Invitrogen), and sequenced.
Gradient and nested RT-PCR reactions were performed to obtain a better definition of the
DNA bands. RT-PCR amplifications using GeneRacer 5’ Primer in combination with Kpr-731
and AGpr-34 (Table 2-1), belonging to RNA 1, were optimized by performing a gradient PCR at
different annealing temperatures (55, 60 and 65 ºC). Sequences from RNA 2 also were obtained
by performing gradient and nested RT-PCR assays as follows: GeneRacer 5’ Primer in
39
combination with AGpr-32 and AGpr-37 (Table 2-1) were performed by gradient PCR at
different annealing temperatures (55, 60 and 65 ºC). The PCR products were analyzed by
agarose gel electrophoresis (Sambrook et al.; 1989). Discrete bands were gel purified (QIAgen),
cloned (TOPO TA cloning kit, Invitrogen) and sequenced.
Analysis of the 5’ and 3’ UTRs of CCLV RNAs
The sequence from the 5’ and 3’ UTRs of RNAs 1 and 2 were analyzed for secondary
structure and similarities. First, the sequences of the 5’ and 3’ UTRs of both RNAs 1 and 2 were
aligned and analyzed using the programs CLUSTAL_X version 1.83.1 (Thompson et al., 1997;
Thompson et al., 1994) and GenDoc version 3.2 (Nicholas & Nicholas, 1997). Later, these
sequences were submitted to the Mfold website (Mathews et al., 1999) and also loaded into the
RNAdraw software version 1.1 (Matzura & Wennborg, 1996) for predicting the putative
secondary structure of the RNAs.
Cloning, Sequencing and Analysis of CCLV sg- and DI-RNAs
The GeneRacer and the SMART RACE cDNA amplification kits were used to obtain the
sequences of both sgRNAs and DI-RNAs. To obtain the sgRNA and DI-RNA sequences, the RT
step was done using 5’ GeneRacer and Oligo dT primers according to the manufacturer’s
protocols. The PCR amplification for sgRNAs was done by using the provided 5’ universal
primer and CCLV-specific reverse primers Kpr-659, AGpr-22, AGpr-09 and Kpr-671 (Table 2-
1), respectively, for sgRNA 1, 2, 3 and 4. Finally, the sequences of the DI-RNAs were obtained
by using an oligo dT primer in conjunction with primers for the 5’-most end of both RNA 1 and
2 [AGpr-12 and AGpr-41 (Table 2-1), respectively, for RNA 1 and 2]. RT-PCR products of the
expected size were cloned and sequenced. These clones were aligned using SEQUENCER
version 4.5 software (Gene Codes Corporation) and visually analyzed to determine the length,
40
the 5’ and 3’ ends and the nt sequences at the junction sites of the recombinant DI-RNA
molecules.
Phylogenetic Relationships Among the ORFs of CCLV and Other Plant Viruses
The sequences of CCLV RNAs were edited and assembled using SEQUENCHER program
and further analyzed at both the nt and aa level using BLAST, ExPASy and Pfam programs
(Altschul et al., 1997; Finn et al., 2005). Multiple alignments of aa sequences of the
methyltranferase, RNA helicase and RNA-dependent RNA polymerase (RdRp) motifs of ORF 1
from RNA 1, and the putative movement protein (ORF 3 of RNA 2) and protein sequences of
related viruses were generated by using the program CLUSTAL_X version 1.83.1 (Thompson et
al., 1994). The aa sequence alignments were corrected using MacClade version 4.08 OS X.
Aligned aa sequences were exported using parsimony (PAUP) format to PAUP version 4.0 β10
for phylogenetic tree construction. Parsimony with heuristic phylogenetic trees were constructed
using the aligned aa sequences, and bootstrap confidence values were calculated based on 10,000
replicates. Virus abbreviations and NCBI accession numbers of the sequences used are as
follows: Alfalfa mosaic virus (AlMV), 75586; Barley stripe mosaic virus (BSMV), 55585711,
19744918 and 1016774; Beet soil-borne virus (BSBV), 2791890; Beet virus Q (BVQ), 3549698;
Beet yellows virus (BYV), 6492368; Broad bean necrosis virus (BBNV), 3928743; BMV, 58729
and 331499; Carrot mottle mimic virus (CMoMV), 9628911; Cucumber green mottle mosaic
virus (CGMMV), 19908647 and 61237518; Cucumber mosaic virus (CMV), 7242505; Cucurbit
yellow stunting disorder virus (CYSDV), 30691648; Fragaria chiloensis latent virus (FCILV),
56692629; Grapevine leafroll-associated virus 2 (GLRaV-2), 3123911; Hibiscus virus S (HVS),
33307858; Indian peanut clump virus (IPCV), 30023940 and 1430839; LIYV), 641982; Oat
golden stripe virus (OGSV) 6018639, 6018640 and 9635456; Olive latent virus 2 (OLV-2),
20178604; Parietaria mottle virus (PMoV), 46393297; Peanut clump virus (PCV), 20178596;
41
Pepper ringspot virus (PepRSV), 0178599 and 20178600; Prunus necrotic ringspot virus
(PNRSV), 13785187; Raspberry bushy dwarf virus (RBDV), 419117; Soil-borne wheat mosaic
virus (SBWMV), 7634687; Sorghum chlorotic spot virus (SgCSV), 21427640; Spring beauty
latent virus (SBLV), 22550378; and TRV, 42733084.
Prediction of the Transmembrane Domain of CCLV Putative Proteins
The nt sequences of CCLV RNAs were converted to aa sequences (ExPASy Translate
Tool, http://ca.expasy.org/tools/dna.html) and loaded into the TMHMM program (Krogh et al.,
2001; Moller et al., 2001) for predicting the transmembrane domain helices in all CCLV
proteins. Output graphic results were visually analyzed.
Sequence Analysis of CCLV Isolates From Panama and Brazil
At the time of this research, CCLV genome sequences were deposited in the GenBank.
Sequences from two Brazilian isolates (Pascon et al., 2006; Locali et al., 2006) and a
Panamanian (this study) isolates were analyzed using CLUSTAL_X version 1.83.1 (Thompson
et al., 1994) and multiple alignments of nt sequences were generated. The nt alignments were
submitted to GeneDoc version 3.2 (Nicholas & Nicholas, 1997), and the sequence alignments
were visually checked, corrected and analyzed.
Results
Analysis of Putative Viral Sequences From a cDNA Library
The cDNA library was constructed from extracts from Potrerillos which contained only
CCLV particles as verify by TEM (Guerra-Moreno, 2004). Most of the sequences overlapped
with other sequences and grouped into one of the four contigs: contig 1 (ORF 2 RNA 1, Figure
2-7) consisted of a total of 41 clones comprising 1121 nt with a putative ORF of 789 nt (263 aa)
(Guerra-Moreno, 2004); contig 2 (ORF 4 RNA 2, Figure 2-7), which consisted of 38 clone and
was 985 nt long and contained a putative ORF of 642 nt long (214 aa); contig 3 (ORF 1 RNA 1,
42
Figure 2-7) which consisted of three clones, was 325 nt long, and showed similarity with the
RdRp of many positive-stranded RNA viruses including Furo-, Tobamo-, Tobra-, Hordei- and
Pomovirus in BLAST analysis. The sequence from clone AG2-D08 (ORF3 RNA 2; Figure 2-7)
was 180 nt long and showed similarities with the movement proteins from different virus
families including Bromo-, Furo- and Umbraviridae.
Northern Blot Analysis Using DNA Probes
A 325 bp DIG-labeled DNA probe, based on the putative CCLV sequence from clone
AGpl-2-F08 (probe 2, Figure 2-7) was used for Northern blot analysis. This probe hybridized
with two RNAs of approximately 9.0 and 1.0 kb in RNA extracts from leprosis symptomatic
tissue from Potrerillos (Figure 2-3, lanes 1-2), but not with RNA extracts from similar tissue
collected from Boquete (Figure 2-3, lane 5). RNA extracts from non-symptomatic tissues
surrounding lesion areas from the same trees contained predominately the 1.0 kb RNA (Figure 2-
3, lanes 3-4) after 10 minutes exposure. The 9 kb RNA was visible only after a long exposure (50
minutes). The DNA probe generated from clone AGpl-2-F08 did not hybridize with the 1.5 kb
RNA molecule recognized by the AG1-C09 probe (Guerra-Moreno, 2004). A PCR product from
the plasmid AGpl-2-F08 was used as positive control (Figure 2-3, lane 6). The banding patterns
obtained with a probe from clone AG1-C09 were similar to those obtained with probe 1 from
plasmid AGpl-1-C09 (Guerra-Moreno, 2004).
A 691 bp DNA probe from clone AGpl-1-A01 (probe 4, Figure 2-7) hybridized with RNAs
of approximately 4.7, 3.0, 1.5 and 0.8 kb in extracts from CCLV-infected samples from
Potrerillos (Figure 2-4, panel A). RNA extracts from the non-lesion area of symptomatic leaves
showed no hybridization at 5 min exposure, but a longer exposure of 50 min showed a banding
pattern similar to the RNA extracts from lesions from symptomatic leaves. Using the DNA probe
3 generated from the clone AGpl-2-D08 (Figure 2-7), RNAs of about 4.7, 1.5, and 0.8 kb (Figure
43
2-4, panel B) were recognized and were similar in size to those found when probe 3 specific for
clone AGpl-1-A01 (Figure 2-7) was used. However, probe 3 from clone AGpl-D08 did not
hybridize with the 3.0 kb RNAs which hybridized with probe 4.
Sequences from contig 1 and 2 (Figure 2-3) were shown to have similar hybridization
patterns and were grouped together (Guerra-Moreno, 2004). Similarly, the sequences from contig
3 and 4 were grouped together based on the similarities of their Northern Blots (Figure 2-4).
Further Sequencing of the CCLV Genomic RNAs
After performing the long distance RT-PCR assays, larger RT-PCR products were
obtained. A 6.6 kb long amplified product (belonging to RNA 1) was obtained using CCLV-
specific primers Kpr-745 and Kpr-659 (Figure 2-5, lane 4). Based on the nucleotide sequences of
the fragments, new CCLV-specific primers were designed and used to obtain the internal
sequences of several clones. Similarly, the internal regions of the 1050 nt RT-PCR products
(belonging to RNA 2) were obtained using Kpr-671 and AGpr-04 primers (Figure 2-5, lane 2).
Additionally, the 5’ and 3’ termini of both RNAs 1 and 2 were obtained by using two
methods [the SMART RACE cDNA amplification kit (BD Bioscience) and the GeneRacer kit
(Invitrogen)]. Amplification using only GeneRacer assays generated unspecific (smear-like)
banding patterns of the target samples (Figure 2-6, panel A, lanes 1-5), however a clear band of
the positive HeLa mRNA control was obtained (Figure 2-6, panel A, lane 6). After gradient and
nested PCR assays using cDNAs generated by the GeneRacer assays, a better definition of the
amplified products from RNA 1 (Figure 2-6, panel B; lanes 1 – 3; 317 bp; and Figure 2-6, panel
C, lanes 4 – 6; 132 bp) and RNA 2 (Figure 2-6, panel C, lanes 1 – 3; 1520 bp; and Figure 2-6,
panel C, lanes 4 – 6; 1000 bp) was obtained.
44
Analysis of CCLV Genomic RNAs
The full length sequences of both CCLV RNA 1 and RNA 2 from the Panama isolates
were obtained (GenBank accession number: DQ388512 and DQ388513) and analyzed for
potential ORFs (Figure 2-7). Both 5’ m7GpppN-cap and 3’ poly(A) tail structures were found at
the termini of both CCLV g-RNAs 1 and 2, as well as for all sgRNAs and DI-RNAs. The length
of the poly(A) tail was determined to be between 35 and 70 nt. The sequences of the g-RNA,
sgRNA and DI-RNAs had a 5’ non-template guanine (G) as the first nt.
The CCLV RNA 1 (8730 nt; 43 % GC content) contained two ORFs of 7,539 and 792 nt
long (Figure 2-7). ORF 1 codes for a putative 276 kDa polyprotein of 2,512 aa containing
domains similar to those of the super group of Sindbis-like viruses (Karasev, 2000; Koonin &
Dolja, 1993; Rozanov et al., 1992) with putative methyltransferase (located at aa position 126 -
528), OTU-like cysteine protease (located at aa position 689 - 797), RNA helicase (located at aa
position 1558 - 1841), and RdRp motifs (located at aa position 2062 - 2494) (Figure 2-7). Using
the Pfam and BLAST programs, another domain scored higher than the gathering threshold
(Bateman et al., 2004; Finn et al., 2005). This ORF 1 domain is termed the FtsJ-like
methyltransferase (located at aa position 991 - 1050). The ORF 2 of RNA 1 codes for a putative
protein of 263 aa (about 29 kDa) which showed no similarity with known virus proteins by
BLAST analysis. ORF 1 was highly transcribed through a sgRNA in leprosis infected plants
(Guerra-Moreno, 2004) and large number of clones (41 out of 300 clones) contained sequences
belonging to this ORF.
The CCLV RNA 2 (4969 nt; 40 % GC content) contains four ORFs based on Northern blot
analysis (Figure 2-3 and 2-4), sequencing and computer analysis (Figure 2-7). The four ORFs
were 393, 1614, 537 and 279 nt long and coded for putative proteins of 15, 60, 31 and 24 kDa,
respectively (Figure 2-7). While ORFs 1, 2 and 4 of RNA 2 showed no similarity with sequences
45
in the GenBank, ORF 3 encoded a putative 31 kDa viral movement protein (MP) which showed
similarities to the MP of plant viruses belonging to the Furo-, Bromo-, Tombus-, Umbra- and
Ilarvirus genera. The ORF 4 of RNA 2 was highly transcribed through a sgRNA in tissue
infected with the virus (Figure 2-4) and large numbers of clones (39 out of 300 clones) had
sequences that aligned into ORF 4.
The TMHMM program did not predict any transmembrane domain helices for either ORF
1 or 2 of RNA 1. However, ORFs 2 and 4 of RNA 2 had predicted transmembrane domains
(Figure 2-10). The ORF 2 of RNA 2 has a putative transmembrane domain at aa position 485 to
511; whereas ORF 4 of RNA 2 contains 4 predicted transmembrane domains at aa position (I) 46
– 63, (II) 83 – 105, (III) 151 – 170, and (IV) 151 – 170.
Analysis of the 5’ and 3’ UTRs of CCLV RNAs
The CCLV 5’ and 3’ UTRs were aligned using CLUSTAL_X, then exported to GeneDoc.
RNAs 1 and 2 contain 5’ UTRs of 107 and 65 nt, respectively. The 3’ UTRs of RNAs 1 and 2
contain 229 and 234 nt, respectively. The 5’ UTRs differ in length and do not share a long
homologous region (Figure 2-8, panel A). The complementarity between the 5' and 3’ UTRs of
the CCLV genome is low (lower than 15 % identity). However the 3’ UTRs of RNAs 1 and 2 are
similar in length (5 nt difference), contain a long homologous region (Figure 2-8, B), and share
85 % identity. The Mfold website and the RNAdraw version 1.1 did, not predict any putative
secondary structure at the 5’ and 3’ termini of either RNA 1 or 2.
Phylogenetic Relationships Among the ORFs of CCLV and Other Plant Viruses
The methyltransferase (Figure 2-9, A), RNA helicase (Figure 2-9, B) and RdRp (Figure 2-
9, C) domains of ORF 1 of CCLV RNA 1 showed low similarities with corresponding domains
of plant viruses belonging to Tobamo-, Clostero-, Tobra-, Furo-, Hordei-, Pomo- and other
positive-sense RNA viruses, but were not highly similar to any of these virus families. The
46
putative MP (ORF 3 of RNA 2) of CCLV (Figure 2-9, D) showed low similarities with MP
domains of viruses belonging to the Furo-, Bromo-, Tombus-, Umbra-, and Ilarvirus genera, but
did not cluster with the MP sequences from these viruses.
Sequence Analysis of CCLV Isolates From Panama and Brazil
Sequence analysis of the three genomic CCLV present in the GenBank confirmed that all
three sequences belong to the same virus species with >99.2 % identity (Table 2-2). The most
frequent nucleotide substitution was the change from cytosine to thymine (approximately 33 %).
The lengths of the 5’ and 3’ UTRs were also identical. The start and the stop codons of each
ORF were located at similar positions. The nucleotide composition, the GC contents and other
features are summarized in Table 2-2.
Cloning, Sequencing and Analysis of CCLV sg- and DI-RNAs
The sequences of four 3’ end co-terminal sgRNAs and several DI-RNAs that aligned into
10 groups also were obtained (Figure 2-7 and 2-11). The presence of sgRNA molecules was
confirmed based on hybridization assays using probes for ORF 2 RNA 1(Guerra-Moreno, 2004)
and ORF 3 and 4 RNA 2 (Figure 2-4). These smaller than genome RNA molecules were
observed on Northern blots using RNA extracted from CCLV-infected tissue from Panama. The
sequences from four sgRNA molecules ranging from 937 to 3389 nt long were obtained and
analyzed. SgRNA 1 is 1068 nt in length (Figure 2-7), showed more than 99% identity with the 3’
end of RNA 1. It containing 46 nt upstream of the start codon and was present in high
concentrations in infected tissue (Guerra-Moreno et al., 2005a). No RNA fragments
corresponding to the hypothetical sgRNAs for the RdRp were obtained using either the
GeneRacer or SMART RACE cDNA amplification approaches, even after several attempts. The
length of the sgRNAs 2, 3 and 4 were 937, 1751 and 3389 nt, respectively, and showed more
than 99% identity with the 3’ end of CCLV g-RNA 2 (Figures 2-4 and 2-7). The SgRNA 4 is
47
highly expressed in infected tissue as seen in Northern blots (Figure 2-4). The SgRNAs 2 and 3
had 8 nt upstream of the start codon, whereas sgRNA 4 contained a longer (58 nt) 5’ UTR. The
sgRNAs 1 and 3 started with the same 3 nt (ATG) at the 5’ end; while the sgRNAs 2 and 4 had
the first 4 nt (ATTG) in common.
The presence of additional RNAs that differed in size and hybridization patterns from the
CCLV g- and sgRNA was observed in RNA extracts using probes specific for a region near to
the 5’ end of CCLV genome (Figures 2-3 and 2-4). These RNAs were cloned, sequenced and
analyzed by computer programs. These RNA molecules were classified as DI-RNAs, because
they contain both the 5’ and 3’ end of the virus (CCLV), and they lacked a large portion of the
genomic central region sequence (Figure 2-11). The DI-RNA molecules which ranged from 1047
to 1886 nt (Figure 2-11) were found in citrus tissue infected with CCLV. These DI-RNAs
aligned into 10 different groups (Figure 2-11) and were classified as follows: (I) DI-RNAs with
the 5’ termini of RNA 1 and the 3’ termini of RNA 2 (Figure 2-11; DI-1 and DI-2;), and their 5’
end codes for part of the methyltransferase domain of ORF1 of RNA 1; (II) DI-RNAs containing
both the 5’ and 3’ end of RNA 2 (Figure 2-11; DI-3 – DI-7, DI-9 and DI-10) and their 5’ end
codes for the whole ORF1 of RNA 2; and (III) DI-RNAs having the 5’ end of RNA 2 and the 3’
end of RNA 1 (Figure 2-11; DI-8); and its 5’ end codes for the full ORF1 of RNA 2. A particular
feature of the DI-10 group was that the DI-RNA contained an extra central insert of 74 nt, with
the insert contained a reverse and complementary sequence derived from g-RNA 2 (from nt 1344
to 1417). The junction areas of all the CCLV DI-RNAs, except DI-1, were flanked by short (3 to
12 nt) direct or reverse repeats (Figure 2-12). Computer analysis of the sequences up- and
downstream of the junction site in these CCLV DI-RNAs did not show the presence of extensive
48
secondary structure. The CCLV DI-RNA molecules showed more than 99 % nucleotide identity
with their respective CCLV g-RNAs (Table 2-2).
Discussion
This study reports the first complete sequence of a CCLV isolate from Panama. CCLV is a
positive-sense bipartite RNA virus which shares low similarity with other positive-sense RNA
virus groups. This was shown by Northern blot analysis using probes targeting different regions
of the CCLV genome (Figures 2-3 and 2-4) and by sequence analysis of the g-, sg- and DI-RNAs
associated with CCLV (Figures 2-7 and 2-11). Previously, a cDNA was constructed using total
RNA extracts from leprosis infected samples collected from Potrerillos, Panama which were
confirmed to contain only cytoplasmic virus particles by TEM (Guerra-Moreno, 2004). Eighty
out of the 300 clones sequenced (26.67 %) from the cDNA library showed no significant
homology to known plant sequences. These sequences aligned mostly into four contigs.
Hybridization patterns in Northern blot analysis with probes from RNAs 1 and 2 (Figures
2-3 and 2-4) and sequence analysis of the RNA genome indicate that the CCLV is a bipartite
virus with a gene expression strategy consisting of 3’ co-terminal sgRNAs. This hypothesis was
confirmed by sequencing all of the CCLV sgRNAs; sgRNA 1 from RNA 1 and sgRNAs 2, 3 and
4 from RNA 2 (Figure 2-7). Genomic RNAs, sgRNAs and DI-RNAs had 5’ m7GpppN-caps and
3’ poly(A) tail structures at their 5’ and 3’ termini, respectively. It was previously reported that
CCLV genomic sequences started with a guanine (G) (Locali-Fabris et al., 2006; Pascon et al.,
2006). Controversially, in this study, it was found that the first 5’ nucleotide is a non-template G,
which belongs to the 5’ m7GpppN-cap structure. The sequence around the initiation codon of all
ORFs in RNA 1 and 2 corresponds only partially to the plant initiation consensus sequence
AACAAUGGC (Lutcke et al., 1987).
49
CCLV RNA 1 contains two ORFs. ORF 1 codes for a putative 276 kDa polyprotein of
2,512 aa containing domains similar to those of the super group of Sindbis-like viruses (Karasev,
2000; Koonin & Dolja, 1993; Rozanov et al., 1992) with putative methyltransferase, OTU-like
cysteine protease, RNA helicase and RdRp motifs (Figure 2-7). In addition, ORF 1 contains a
conserved domain related to the FtsJ-like methyltransferase.
The RNA methyltransferase domain is a unique characteristic found in the Alphavirus
superfamily (Rozanov et al., 1992; Ahola et al., 2000) which has been involved in capping of the
mRNA in the nucleus in eukaryotic systems (Ahola & Ahlquist, 1999; Ahola et al., 2000).
Therefore, many plant viruses that replicate in the cytoplasm, such as CCLV, must encode their
own methyltransferase (Ahola et al., 2000; Ahola et al., 1997).
The OTU-like family constitutes a new group of computer predicted cysteine proteases,
which share homology with the ovarian tumor gene (OTU) found originally in Drosophila spp.
(Steinhauer et al., 1989). Members include proteins from eukaryotes, viruses and the pathogenic
bacterium Chlamydia pneumoniae (Makarova et al., 2000). However, this is the first report of an
OUT-like cysteine protease family member in plant viruses. The FtsJ protein is a well conserved
heat shock protein present in prokaryotes, Achaea, and eukaryotes (Bugl et al., 2000).
The RNA helicase domain is widely found in virus families with positive-sense RNA
genomes sequences (Koonin & Dolja, 1993) and it is thought to be involved in double-strand
unwinding during replication of the viral RNAs (Ahola et al., 1997; Gomez de Cedron et al.,
1999). The RdRp domain is present in a broad range of positive-stranded RNA virus families
(Koonin & Dolja, 1993; Ward, 1993).
The ORF 2 of CCLV RNA 1 showed no similarity with known proteins using BLAST and
Pfam analyses. Based on the similarity of this protein with the CP of other positive-stranded
50
RNA viruses, it was hypothesized that ORF 2 could be involved in encapsidation of the viral
RNA (Locali-Fabris et al., 2006). Inmunodetection TEM assays using polyclonal antibodies
raised in rabbits and chickens against the product of ORF 2 RNA 1 failed to label virus particles
inside infected cells. Instead, they labeled a virus inclusion protein localized inside of the
viroplasm in the cytoplasm of infected cells (Brlansky et al., unpublished results). The same
polyclonal antibodies gave strong positive results when used in double-antibody-sandwich-
indirect ELISA (DASI-ELISA) assays with infected citrus and Brevipalpus mites (Manjunath et
al., unpublished results). These results suggest that ORF 2 of RNA 1 is an inclusion body protein
and not a structural protein (coat protein). The role this protein pays inside citrus and/or mite
cells, which need to be further studied.
The CCLV RNA 2 contains four ORFs. While ORFs 1, 2 and 4 show no similarity with
other sequences in the GenBank, ORF 3 encodes a putative viral MP, which showed similarities
with MP of other positive-sense RNA viruses belonging to Furo-, Bromo-, Tombus-, Umbra- and
Ilarvirus genera (Canto et al., 1997). On the other hand, plant RNA viruses with small genomes
are expected to make efficient use of their genome (Bustamante & Hull, 1998). However the role
of a long RNA sequence (1122 nt; Figure 2-7) that did not code for any protein, and is located
between ORF 1 and 2 in RNA 2 remains to be determined.
The 5’ and 3’ termini of CCLV were obtained using two different methodologies (SMART
RACE cDNA amplification and GeneRacer). Many plant and animal viruses contain genomes
ending with a poly(A) tail (Buck, 1996; Dreher, 1999). It was found, by sequencing several
clones from g-RNA, sgRNA and DI-RNAs, that they contain a poly(A) tail at the 3’ termini and
their length ranges from 35-70 nt and are similar to those reported for the host mRNAs (Ahlquist
& Kaesberg, 1979; Jacobson & Peltz, 1996; Thivierge et al., 2005). The GeneRacer results also
51
indicated the presence of a 5’ m7GpppN-cap in the g-, sg- and DI-RNAs. In eukaryotic systems,
many positive-strand RNA viruses contain a 5’ m7GpppN-cap and 3’poly(A) tail structures
similar to those present at the termini of most cellular mRNAs (Dreher & Miller, 2006; Thivierge
et al., 2005). These results indicated that CCLV is a bipartite positive-stranded RNA virus with
5’ m7GpppN-cap and a 3’ poly(A) tail on its g-, sgRNAs and DI-RNAs. Less than 20% of all
positive-stranded RNA plant viral genera have their g- and sgRNAs resembling host mRNAs
with a 5′-cap and poly(A) tail (Dreher & Miller, 2006; Fauquet et al., 2005; van Regenmortel,
2000). Many viruses with capped RNAs harbor elements that enhance cap-dependent translation,
independently of the nature of the 5’ and 3′ UTR (Dreher & Miller, 2006). These elements
apparently facilitate translation of the viral sgRNAs (Dreher & Miller, 2006; Ivanov et al., 1997).
The 5’ UTRs of CCLV RNAs 1 and 2 lack long regions of homology, however the 3’
UTRs of those RNAs have a homologous region with 85 % identity. Homologous regions at the
5' end are found commonly at the 5' ends of virus-complementary (negative-sense) RNA in
segmented positive-sense RNA viruses such as TRV and AlMV (Hamilton et al., 1987; van
Rossum et al., 1997) and are thought to play a role in the interaction of the viral RdRp with the 3'
termini region of viral RNA genome during replication (Duggal et al., 1994; van Rossum et al.,
1997). A computer-assisted secondary structure prediction did not reveal tRNA-like structures in
the 3’ termini of CCLV, but loops and hairpin-structures may form at both termini. The small
conserved sequence ATAAAA/TCT was found at the farthest 5’end region of CCLV RNAs; the
ATG sequence was found at the 5’ end of both sgRNA 1 and 3; and the sequence ATTG was
found at the 5’ end of sgRNA 1 and 4. These conserved sequences could play a role in
translation, negative-strand initiation and replication of CCLV g-, sg- and DI-RNAs as reported
52
for other virus systems (Dreher & Miller, 2006; Frolov et al., 2001; Gorchakov et al., 2004;
Hardy & Rice, 2005; Skulachev et al., 1999),.
No putative CCLV proteins were shown to have any transmembrane domains, except for
the ORFs 2 and 4 of RNA 2 (Figure 2-10). ORF 2 product was predicted to contain only one
transmembrane helical domain. ORF 4 had four predicted transmembrane domains suggesting
that this protein may be localized to the membranes. Its size (24 kDa; Figure 2-7), which is
comparable to other viral coat proteins (Albiach-Marti et al., 2000; Canto et al., 1997; Livieratos
et al., 1999); and its hydrophobic nature suggests that it could possibly be the CCLV coat
protein. Additional research is required to clarify the identity and cellular location of all CCLV
proteins.
Phylogenetic analysis of CCLV conserved motifs with other positive-sense RNA viruses
showed relationships with several other positive-sense plant RNA viruses (Ahola & Ahlquist,
1999; Ahola et al., 2000; Fazeli & Rezaian, 2000; Kaariainen & Ahola, 2002; Karasev, 2000;
Karasev et al., 1996; Makarova et al., 1999; Melzer et al., 2001; Merits et al., 1999; Savenkov et
al., 1998; Shirako et al., 2000; Ward, 1993). However, CCLV is distinctly different from other
known positive-sense, plant RNA viruses with respect to its genome organization, mechanism of
gene expression, as well as the presence of novel viral proteins. This suggests that CCLV may
belong to a new genus of positive-sense multipartite RNA viruses. It has been proposed that it be
tentatively placed in a new genus called Cycilevirus (Guerra-Moreno, et al., unpublished results)
These studies have revealed that citrus plants infected with CCLV had in addition to the
two viral g-RNAs, an array of less than full length genome RNA species. These RNA species
could be classified as follows: (a) four 3’ co-terminal sgRNAs and; (b) defective interfering
RNA species that have both the 5’ and 3’ end of either RNA 1 and/or 2, but lack the central
53
region. Many plant viruses including CTV, Sweet potato chlorotic stunt virus (SPCSV), TMV,
TRV, BMV, TBSV (Adkins & Kao, 1998; Albiach-Marti et al., 2000; Hernandez et al., 1996;
Hilf et al., 1995; Rubio et al., 2000; Wu & White, 1998) and CCLV encode for more than one
ORF on the viral g-RNA. However, it is known that only the first ORF of an eukaryotic mRNA
is translated by the plant host protein synthesis machinery (Miller & Koev, 2000). The ORF 1 of
both CCLV RNA 1 and 2 is believed to be translated from the g-RNAs, but the results here and
those of others (Miller & Koev, 2000; Skulachev et al., 1999) suggest that all downstream ORFs
on the bipartite g-RNA are expressed via sgRNAs as occurs in many other positive-stranded
RNA viruses (Dreher & Miller, 2006; Duggal et al., 1994; Miller & Koev, 2000; Skulachev et
al., 1999). This study revealed that CCLV has 4 sgRNAs ranging in length from 937 to 3389 nt.
The sgRNA 1 is used as the template for translating ORF 2 of RNA 1. The sgRNAs 2, 3 and 4
are used to generate the gene products of ORF 2, 3 and 4 of RNA 2, respectively. On another
hand, an additional fragment that was detected with the negative sense probe is probably a DI-
RNA molecule or the hypothetical sgRNA for the RdRp region. However, using the SMART
RACE cDNA amplification and the GeneRacer techniques, no sequences corresponding to the
hypothetical sgRNAs of RdRp were obtained. The data implies that the sgRNA for the RdRp
does not exist or is not capped or it accumulates at very low levels. The RdRp protein is most
likely expressed as a polyprotein from ORF 1 which is subsequently post-translationally
processed. Probes designed based on the sequences of the RdRp region would further elucidate
the presence or not of the RdRp sgRNAs in CCLV-infected citrus tissue.
The RNA fragments (about 1.5 kb) observed when the sequence for the RdRp protein was
used as a probe (Figure 2-3) could represent the presence of DI-RNA molecules, since it
hybridized with the probes from the 5’ as well the 3’ end of RNA 1. The RdRp is thought to be
54
expressed from the g-RNA only, and not from any sgRNAs. DI-RNAs were initially reported in
animal viruses (Holland et al., 1982), however later they also have been found associated with
several plant viruses, such as closteroviruses (Ayllon et al., 1999; Kreuze et al., 2002; Rubio et
al., 2000; Yang et al., 1997), cucumoviruses (Graves & Roossinck, 1995), potexviruses (White
et al., 1991), tombusviruses (Wu & White, 1998), tobraviruses (Hernandez et al., 1996) and
bromoviruses (Damayanti et al., 1999; Pogany et al., 1995). This is the first report of the
presence of naturally occurring DI-RNAs in citrus plants infected with CCLV (Figure 2-11).
These DI-RNAs are recombinant or chimeric molecules thought to be generated by aberrant
RNA synthesis during virus replication as occurs with other RNA viruses (Ayllon et al., 1999;
Wu & White, 1998). They were not generated from error prone RT or PCR reactions; as their
presence was confirmed by Northern blots and by sequence analyses.
Analysis of the sequences up- and downstream of the DI-RNAs junction sites revealed that
the borders were flanked by short direct and inverted repeats. The replicase driven-template
switching mechanism (Ayllon et al., 1999; Hernandez et al., 1996; Mawassi et al., 1995; Nagy &
Simon, 1997) best explains the generation of the DI-RNAs produced during CCLV infections.
The observation that some CCLV DI-RNAs (DI-1, DI-2 and DI-8; Figure 2-11) are recombinant
molecules between RNA 1 and 2 implies that both RNAs replicate using a similar mechanism,
and may use the same pool of the viral replicase complex.
DI-RNAs that interfere with symptom expression caused by the helper virus are called
defective interfering RNAs (DI-RNAs) (Li et al., 1989; Perrault, 1981). The alteration of
symptoms in CCLV infection caused by the presence of these DI-RNAs has not been studied.
However, the presence of DI-RNAs in high titers suggests that they may modify the expression
of symptoms caused by CCLV.
55
Taken together, these data provides further evidence that CCLV is a bipartite positive-
stranded RNA virus, with at least four co-terminal sgRNAs, several DI-RNAs, and does not
belong to the family Rhabdoviridae of the order Mononegavirales, even though it was considered
an unassigned member (Fauquet et al., 2005; van Regenmortel, 2000). CCLV should be placed
in a new virus group (Cycilevirus) based on the results of this study and other recent studies
(Locali-Fabris et al., 2006; Pascon et al., 2006). The CCLV sequences from Brazil and Panama
deposited in the GenBank share more than 99.2 % nucleotide identity. It has been hypothesized
that CCLV was first introduced into Panama during the middle 1980’s through illegal shipping
of infected budwood from Brazil (Botello L., personal communication). Based on the sequence
similarity of the CCLV isolates present in the GenBank, it is suggested that the Panamanian
isolate came from Brazil.
Despite the fact that a large amount of information about the molecular properties of
CCLV has been generated in the last decade, more studies are needed to better understand the
leprosis pathosystem. At the moment, only two CCLV proteins have similarities with proteins
from other plant viruses. The unique CCLV proteins may have dual functionality in the mite
vectors and /or citrus plants. Plant viruses encode suppressors of gene silencing to avoid the host-
silencing response (Brigneti et al., 1998; Ding et al., 2004; Li & Ding, 2006; Lu et al., 2004).
However, CCLV is adapted at overcoming the innate citrus plant defense system and causing
disease. Yet its gene silencing suppressor(s) are not known. Further studies are required to help
filling the gaps of knowledge about CCLV and citrus leprosis.
The nuclear type of leprosis virus (NCLV) has been reported less often than CCLV
(Bastianel et al., 2006b; Dominguez et al., 2001; Guerra-Moreno et al., 2003; Guerra-Moreno,
2004; Guerra-Moreno et al., 2005a). Even though the molecular information developed here
56
would facilitate the improvement of management strategies to be used in certification, quarantine
and eradication programs against the CCLV-citrus-mite pathosystem, there is a need for the
molecular characterization of the NCLV.
57
Table 2-1. Primers used for analysis of Cytoplasmic citrus leprosis virus (CCLV). Primer RNA Primer Sequence
Kpr658 RNA 1 5’_7804AAGGTCTGCGTGATATTAGCAAGCCTA7830_3’ Kpr659 RNA 1 5’_8228TATGGGTCGCTTCGGGAAGCCCATAC8203_3’ Kpr680 RNA 1 5’_1698TTGGTAACTATGAAGATGTTAG1719_3’ Kpr680r RNA 1 5’_1719CTAACATCTTCATAGTTACCAA1698_3’ Kpr681 RNA 1 5’_3182 ATCCTCAAATAGCGTGGTTAG 3162_3’ Kpr684 RNA 1 5’_2448TCTAACAAAGGTTCGAGGTTCATT 2471_3’ Kpr685 RNA 1 5’_2477CAATTAGAGCATAGCCATTATAG2500_3’ Kpr686 RNA 1 5’_3166GTTAGCGTATTCAAGGATTCTGGA3143_3’ Kpr687 RNA 1 5’_3688AACGTGCTGTGGTTGTGGAGAC3709_3’ Kpr688 RNA 1 5’_3849TGCTATTCAGATGTTGAGATAT3870_3’ Kpr689 RNA 1 5’_7733GAGTATCGTAACTTTCACTTTG7712_3’ Kpr690 RNA 1 5’_7780TCAATGGCCTGCATAATCTCAG7759_3’ Kpr708 RNA 1 5’_4321AAGCTGTCTACGAGTACAGGTCGTA4345_3’ Kpr709 RNA 1 5’_4427TCCTAAGAGGCTTAATGAGATGTAC4451_3’ Kpr710 RNA 1 5’_7066AATCCTGATCTCCTATCTTTAACGA7042_3’ Kpr711 RNA 1 5’_7038ACTCAACATGTGACTTGAACCAAAT7014_3’ Kpr712 RNA 1 5’_5091TTCTGCGTTGGCGATAAGAAGCAG5114_3’ Kpr713 RNA 1 5’_5155AGAAATTGTGTGATTTTGTCAACACT5180_3’ Kpr714 RNA 1 5’_6364ACCTATGACTGCATGATTCCTAGACT6339_3’ Kpr730 RNA 1 5’_396TTCTCCCATTGAGCTGCTCACGAATCTC369_3’ Kpr731 RNA 1 5’_316GAAGTGATAACCTCACTGTCGCTAACGA289_3’ Kpr732 RNA 1 5’_7520TGTTGACCCCGCTGAGGTCTTTAGAGTC7547_3’ Kpr745 RNA 1 5’_1602GATCCGTCTTTTCCTATTCCTGTAC1625_3’ AGpr06 RNA1 5’_1717AGTCGGGGTTTGGTGCACGTATTAGCT1690_3’ AGpr12 RNA 1 5’_1GATAAAACTGTCAAGTGATATACCACATT29_3 AGpr33 RNA 1 5’_131TTCAACGGTGCTATGTGTAGACATCTT105_3’ AGpr34 RNA 1 5’_225TGGTATGTGTCGCCGTGAACCTAGGTT199_3’ Kpr586 RNA 2 5’_4876CAACCTCGCCCAGCTGACAACG4855_3’ Kpr588 RNA 2 5’_4902AGAAATTAATCAAACTTGAGG4882_3’ Kpr643 RNA 2 5’_3702AGTTCACAGGCGGCTTGGTATACA3679_3’ Kpr670 RNA 2 5’_4130AGGCGCGCAGCTAACGTTAGGCAAAG4155_3’ Kpr671 RNA 2 5’_4386ACCAGAGCACCACAGATCCTGAAGAAG4360_3’ Kpr682 RNA 2 5’_3961GGTTAAGAAGAGTACTGGTC3980_3’ Kpr683 RNA 2 5’_4007GATAATCAAAGAAAACATCCTG4028_3’ AGpr04 RNA2 5’_3363AGACCGTTTGCATTCGGACTGACAA3339_3’ AGpr09 RNA2 5’_3339AGACCGTTTGCATTCGGACTGACAA3363_3’ AGpr18 RNA 2 5’_2261TATGAGGAGAGGCTTATAAAAGTCCAC2287_3’ AGpr19 RNA 2 5’_2670TCATGAAGATGATTAACATCAAAGCCTT2643_3’ AGpr22 RNA 2 5’_1980AACACTTCACCAATATGCTTCTGCCCAT1953_3’ AGpr27 RNA 2 5’_791GGATTTGTCTGCAATATCTACGGATCAA818_3’ AGpr32 RNA 2 5’_1605AGCTGAAATAGCGCCATTTGACAATAC1579_3’ AGpr35 RNA 2 5’_907TTGGGGCAAGCGGATTAAGGCTGGTTT881_3’ AGpr41 RNA2 5’_124TTGGGGCAAGCGGATTAAGGCTGGTTT98_3’
58
Table 2-2. Nucleotide sequence comparison between Panamanian and Brazilian isolates of Cytoplasmic citrus leprosis virus (CCLV).
a Nucleotide (nt). b Adenines. c The identity percentage expressed here is derived from comparing the nt sequence of the Panamanian and the Brazilian isolates.
RNA Accession number
Country origin
Length (nt)a
GC contain (%) Poly(A) tailb
Identity (%)c
DQ388512 Panama 8730 42.57 35-70 ------ DQ157466 Brazil 8730 42.50 ? 99.21
RNA 1
NC_008169 Brazil 8745 42.41 ? 99.26 DQ388513 Panama 4969 40.55 35-70 ------ DQ157465 Brazil 4975 40.52 ? 99.54
RNA 2
NC_008170 Brazil 4986 40.51 ? 99.58
59
Figure 2-1. Symptoms of leprosis disease on citrus leaves. A) Disease symptoms on a mature citrus leaf showing a large lesion. B) Citrus leaf with several small leprosis disease lesions. Lesions on leaves could cover more than 50% of the leaf surface. C) Citrus leaf with early leprosis symptoms. D) Close-up view of the lesion from Panel A; where small corky-like necrotic spot are observed in the surrounding area. All leaves were collected from sweet orange cv. Valencia trees from Potrerillos, Chiriquí State, Panama.
A B
C D
60
Figure 2-2. Symptoms of leprosis disease on citrus fruit and twigs. A) Typical leprosis symptoms on a mature fruit. Fruit lesions are concentric chlorotic rings with a necrotic and dark central area. B) Close-up view of a sunken leprosis lesion (arrow), that penetrates into the fruit peel. C) Leprosis symptoms on a necrotic and girdled twig. The twig was showing die-back symptoms. D) Multiple concentric rings on a leprosis-affected citrus twig. All these sweet orange cv. Valencia fruits and twigs were from Potrerillos, Chiriquí State, Panama.
61
Figure 2-3. Northern blot analysis of total RNA extractions from citrus tissue using DIG-labeled DNA probe from ORF 1 CCLV RNA 1. Total RNA extractions from different citrus leaf tissue were loaded in lanes 1 to 5. The citrus tissue samples were collected from Potrerillos, Panama and hybridized with a DNA probe for ORF 1 CCLV RNA 1. Lesion (lanes 1 and 2), and non-lesion areas (lanes 3 and 4) of symptomatic leaves were used. Leaves from healthy trees (lane 5) were used as a negative control. RT-PCR products using universal primers and clone AGpl-2-F08 (325 bp; lane 6) were used as positive controls. In each lane (1 to 5), 5 µg of total RNA extractions were loaded. Lane M represents 100 ng of RNA molecular weight marker I (Roche cat. # 1526529); marker sizes are indicated on the left of the picture. The g-RNA and putative DI-RNAs are shown by black arrows.
M 1 2 3 4 5 6
6948
4742 4742
2661
1821182115171517
10491049
gg--RRNNAA 11
DDII--RRNNAAss
62
Figure 2-4. Northern blots using DNA probes from ORFs 3 and 4 of CCLV RNA 2. Total RNA extracts from leprosis-affected citrus leaves (lanes 1) and fruits (lanes 2) were collected from Potrerillos, Chiriquí State, Panama. A) Banding patterns when ORF 3 was used as probe. B) Banding patterns of a probe made from ORF 4. Each lane was loaded with 5 µg of total RNA extractions from leprosis-symptomatic citrus tissue. The marker sizes are indicated on the left. The g- and sg-RNAs are shown by double headed black arrows. The sg-RNA 4 that is only observed in Panel A is shown by a single headed black arrow.
1 21 2
gg--RNA 2RNA 2
SgSg--RNA 4RNA 4
SgSg--RNA 3RNA 3
SgSg--RNA 2RNA 2
A B474247424742
266126612661
182118211821
151715171517
104910491049
63
Figure 2-5. Long distance RT-PCR amplification of CCLV g-RNAs. RT-PCR amplification done with total RNA extracted from Potrerillos, Chiriquí State, Panama. Thermoscript RT-PCR (Invitrogen) and MasterAmp Extra Long PCR (Epicentre) kits were used to amplify the regions between CCLV clones showing similar banding patterns in Northern blot analysis. Primers AGpr-04 and Kpr-670 (lane 1), and AGpr-04 and Kpr-671 (lane 2) were used to amplify the region between clones AGpl-1-A01 and AGpl-2-D08 from RNA 2. Similarly, primers Kpr675 and Kpr-658 (lane 3), and Kpr675 and Kpr-659 (lane 4) were used to amplify the region located between the clones AGpl-1-C09 and AGpl-2-F08 from RNA 1. Each lane was loaded with 10 µl of the RT-PCR reaction mixture. Lanes M and M* were loaded with 0.5 µg of 100 bp DNA ladder (Invitrogen) and 0.5 µg of λ DNA/Hind III fragments (Invitrogen), respectively.
M 1 2 3 4 M*
2322
6557
565
4361
600
20721500
23,130
64
Figure 2-6. RT-PCR amplification of 5’ termini of decapped CCLV RNA 1 and 2. RT-PCR amplifications were performed using total RNA extracted from leprosis-infected citrus tissue collected from Potrerillos, Chiriquí State, Panama. A) Shows the products of RT-PCR amplifications using GeneRacer 5’ primer in combination with Kpr-730 (RNA 1; lane 1), AGpr-20 (RNA 2; lane 2), AGpr-32 (RNA2; lane 3), AGpr-34 (RNA 1; lane 4), AGpr-20 (RNA 2; lane 5) and control primer B1 (HeLa cell; lane 6). Citrus leaves (lanes 1-3), fruits (lanes 4 and 5), HeLa total RNA extracts (positive control; lane 6) and water control (lane 7) were used in RT-PCR assays. B) Shows a gradient and nested PCR for RNA 1 using the cDNA (Panel A, lanes 1 – 5) from the GeneRacer assays. RT-PCR amplifications using GeneRacer 5’ Primer in combination with Kpr-731 (317 bp; lanes 1 - 3), and AGpr-34 (132 bp; lanes 4 - 6) were optimized by performing a gradient PCR at different annealing temperatures: 55 ºC (lanes 1 and 4); 60 ºC (lanes 2 and 5); 65 ºC (lanes 3 and 6). C) Shows a gradient and nested PCR for RNA 2 using the cDNA from the GeneRacer assays. RT-PCR amplifications using GeneRacer 5’ primer in combination with AGpr-32 (1520 bp; lanes 1 – 3; white arrow) and AGpr-37 (1000 bp; lanes 4 – 6; black arrow) were performed by gradient PCR at different annealing temperatures: 55 ºC (lanes 1 and 4); 60 ºC (lanes 2 and 5); 65 ºC (lanes 3 and 6). Each lane was loaded with 10 µl of the RT-PCR reactions. Lanes M were loaded with 0.5 µg of 100 bp DNA ladder (Fisher Scientific).
CB M 1 2 3 4 5 6 M 1 2 3 4 5 6
1000
2000
50010002000
500
A M 1 2 3 4 5 6 7
1000
2000
500
65
Figure 2-7. Schematic genome (g-) and subgenomic (sg-) organization of CCLV RNAs. Conserved methyltransferase, OTU-like cysteine transferase , FtsJ-like methyltransferase, RNA helicase and RdRP domains of ORF 1 RNA 1 are shown. The boxes show the coding regions with the final putative gene product identified. SgRNAs are indicated below its respective RNA. The black balloons at the 5’ end and the triple A located at the 3’ ends of both g- and sgRNAs correspond to the 5’ m7GpppN-cap structure and the poly(A) tails, respectively. The length of both g- and sgRNAs are showed. The location of the probes (1-4) used for Northern analysis are shown. The scale at the top corresponds to the length (in thousand nt).
ORF 1ORF 1
ORF 1ORF 1ORF 4ORF 4
ORF 3ORF 3ORF 2ORF 2
Conserved domains of ORF 1, RNA 1Conserved domains of ORF 1, RNA 1
Methyltransferase
OTU-like cysteine transferase
FtsJ-like methyltransferase
Helicase
RdRP
ORF 2ORF 2
CCLV RNA 1CCLV RNA 18730 nt
CCLV RNA 2CCLV RNA 24969 nt
**Probe 2Probe 2**Probe 1Probe 1
**Probe 3Probe 3 **Probe 4Probe 4
SgSg--RNA 1RNA 11068 nt
SgSg--RNA 2RNA 2937 nt
SgSg--RNA 3RNA 31751 nt
SgSg--RNA 4RNA 43389 nt
321 4 5 76 8 90
AAAAAA
AAAAAA
AAAAAA
AAAAAA
AAAAAA
AAAAAA
66
Figure 2-8. Sequence alignment analysis of the 5’ and 3’ UTRs of CCLV g-RNAs. A) Shows the complementarity between the 5' UTRs of CCLV RNAs 1 and 2. B) Shows the complementarity between the 3' UTRs of CCLV RNAs 1 and 2. Numbers at the beginning and the end of the lines indicate the position of the nucleotide in the genomic RNAs. Conserved nucleotide regions are shown as shaded boxes.
A
B
67
Figure 2-9. Phylogenetic analysis between conserved motifs in CCLV ORF 1 RNA 1, ORF 3 RNA 2 and related plant viruses. Unrooted dendograms showing phylogenetic relationships of the A) methyltransferase, B) RNA helicase, and C) RNA dependent RNA polymerase (RdRp) motifs in ORF 1RNA 1, and D) the putative movement protein in ORF 3 RNA 2 with proteins of related positive-stranded RNA viruses. The aa sequences of the conserved motifs and flanking sequences of ORF 1 RNA 1 and ORF 3 RNA 2 were aligned using Clustal_X Multiple Alignment Program and bootstrapped 100,000 times using the PAUP program (percent scores are shown at nodes). Horizontal branches are proportional to genetic distance. The scale bar corresponds to substitutions per aa site. The virus names, virus acronyms and accession numbers are described in the text.
100
83
77
74
99
BSMVBSMV
OGSVOGSV
BSBVBSBV
TRVTRV
SBLVSBLV
HVSHVS
CCLVCCLV100
changes
AIMVAIMV
FCILVFCILV
IPCVIPCV
100
83
77
74
99
BSMVBSMV
OGSVOGSV
BSBVBSBV
TRVTRV
SBLVSBLV
HVSHVS
CCLVCCLV100
changes
AIMVAIMV
FCILVFCILV
IPCVIPCV
99 9652
80
57
78
60
CCLVCCLVPMTVPMTV
BYVBYV
CYSDVCYSDV
RBDVRBDV
CGMVSCGMVSPepRSVPepRSV
BSMVBSMVPCVPCV
SBWMVSBWMV
BBNVBBNV
CMVCMV
BMVBMV50 changes
97
98
71
92
77
100 changes
BSMVBSMV
IPCVIPCV
BVQBVQ
OGSVOGSV
CGMMVCGMMV
PepRSVPepRSV
CCLVCCLV
GLRaVGLRaV--2 2
LIYVLIYV
99
100 changes
SgCSVSgCSV
OGSVOGSV
CCLVCCLV
OLVOLV--22
PNRSVPNRSV
BMVBMV
CMoMVCMoMV
A B
C D
68
Figure 2-10. Graphic representation of the putative transmembrane domains found in ORFs 2 and 4 of CCLV RNA 2 using TMHMM computer software. A) Transmembrane domain of ORF 2 RNA 2 located at the C terminal portion of this protein. B) Four transmembrane domains of ORF 4 RNA 2. The red bars and lines represent the location and the probability of the transmembrane domains. The blue and pink lines represent the putative cellular location of the protein segments.
Amino acid positions
Prob
abili
ty
Amino acid positions.
Prob
abili
ty
B
A
Amino acid positions
Prob
abili
ty
Amino acid positions.
Prob
abili
ty
B
A
69
Figure 2-11. Schematic representation of the CCLV g- and DI-RNAs. RNA 1 and 2 sequences
are represented as gray and black horizontal solid bars with coding region showed as open and filled boxes. The respective positions of CCLV ORFs, as well as the size of all DI-RNAs are shown. The dotted lines correspond to the deleted regions not present in the corresponding DI-RNAs, but appear in the parental g-RNAs. The black and grey balloons at the 5’ end and the triple A located at the 3’ ends of both g- and sgRNAs represent the 5’ m7GpppN-cap structure and the poly(A) tails, respectively. The scale at the top corresponds to the length (in thousand nt) of all CCLV RNAs. The red arrow represent a 74 nt inverted and complementary insert present in D10.
AAAAAA
AAAAAA
321 4 5 76 8 90
AAAAAA
AAAAAA
DI-1 1062 nt
DI-2 1047 nt
AAAAAA
DI-3 1464 nt
DI-4 1521 nt
RNA-1 8730 nt
RNA-2 4969 nt
AAAAAA
AAAAAADI-5 1609 nt
AAAAAA
DI-6 1818 nt
DI-7 1456 ntAAAAAA
AAAAAA
DI-8 1886 nt
AAAAAA
DI-9 1714 nt
AAAAAA
DI-10 1680 nt
70
Figure 2-12. Junction sequence regions of CCLV DI-RNAs molecules. The letters represents the sequences surrounding the junction sites in CCLV DI-RNAs. Capital letters correspond to the sequences which are present in the DI-RNAs up- and downstream of the junction site, while the lowercase letters correspond to the sequences which are absent in the DI-RNAs, but are present in the corresponding parental g-RNA molecules. Direct and reverse (and complementary) sequences surrounding the junction sites are underlined. The nucleotide position corresponds to those on the g-RNA 1 and 2. The dotted lines represent the sequences present in the g-RNAs molecules.
DI-1 TGAAGAAGTATAtctactctcatg …… ccgtcaactttgGTTGACACCTAC 3
DI-2 ACCCGAGGGGTAtcacgtcaagaa …… ccaacgaacaatTGAGGAAGCTTT 2
DI-3 TACTACTAGGGTttagtcctaata …… actggtgttatgCGGAGGGTTTTC 3
DI-4 ATACTACTAGGGtttagtcctaat …… ttgccaatagggCTTCTAGGGTGT 3
DI-5 TGGTCATTTGATtgctatttgact …… ttccatgtgtatGCTAAGGCTAAA 2
DI-6 GCGTTGGCTTCCaggttgatgccg …… aacgaacaattgAGGAAGCTTTAT 2
DI-7 CTGGTACGTATActactagggttt …… ctactggtgttaTGCGGAGGGTTT 3
DI-8 GCCGACCGGTTTgtatatattgta …… ctaaggactccgTTTCTGACTATG 1
DI-9 AACCATAATTGAtttgggagcgtt …… atagggcttctaGGGTGTCTACTG 3
DI-10 GGTTTAGTCCTAatagtattcatt …… aacaattgaggaAGCTTTATGCTG 1
DI-RNA Junction sites # of clones
822 4731
691 4614
1247 4753
1445
1484
1237
1464
1162
1246
1256 4621
4701
8321
4751
4616
4523
4695
71
CHAPTER 3 MOLECULAR AND SEROLOGICAL DETECTION OF THE CYTOPLASMIC CITRUS
LEPROSIS VIRUS (CCLV) USING RT-PCR PRIMERS TARGETING DIFFERENT CCLV GENES AND POLYCLONAL ANTISERA
Introduction
Leprosis disease is currently one of the most important viral diseases in Brazil (Locali-
Fabris et al., 2006; Pascon et al., 2006). The disease has been present in several South American
countries for over six decades (Kitajima et al., 2003; Rodrigues, 2000). Recent reports of leprosis
occurring in Central America and Mexico (Dominguez et al., 2001; Guerra-Moreno et al., 2005;
Kitajima et al., 2003; Meza Guerrero, 2003; Rodrigues et al., 2003; Rodrigues et al., 2007;
Sánchez-Anguiano, 2005) highlight its northward spread which poses the economic threat of this
disease to the USA and Caribbean Basin citrus industries where it does not occur (Childers et al.,
2003a; Guerra et al., 2005).
In the past diagnosis of leprosis has depended primarily on the assessment of typical
leprosis symptoms on leprosis-infected citrus trees and then confirmation of the presence of the
virus using transmission electron microscopy (TEM). The diagnosis of leprosis based on
symptoms alone is not reliable (Locali et al., 2003). Leaf symptoms may be confused with those
caused by other citrus pathogens, such as citrus canker (Xanthomonas axonopodis pv. citri)
while the bark/twig symptoms could be confused with those caused by Citrus psorosis virus
(Omoto, 1998; Rodrigues, 2000; Rossetti, 1980). The use of TEM for confirmation is time
consuming and costly; requiring trained technicians, high cost equipment and several days to
obtain results (Guerra-Moreno, 2004; Locali et al., 2003). There has been recent progress on the
molecular characterization of the Cytoplasmic citrus leprosis virus (CCLV) (Guerra-Moreno et
al., 2005; Locali-Fabris et al., 2006; Pascon et al., 2006). This information has proved to be
useful for the development of rapid diagnostic methods.
72
Even though the first report of virus-like particles being associated with leprosis was made
over 30 years (Kitajima et al., 1972), the virus has not been purified due to the low virus
accumulation in infected tissue (Lovisolo, 2001; Lovisolo et al., 2000) and the non- or limited
systemic behavior of the virus (Chagas & Rossetti, 1984; Guerra, 2004; Rodrigues, 2000;
Rossetti, 1996). These intrinsic characteristics of CCLV have hampered the molecular
characterization of the virus and the subsequent development of more sensitive diagnostic
methods.
The present study was undertaken to develop rapid and accurate molecular and serological
diagnostic methods for the detection of CCLV, the most prevalent virus associated with citrus
leprosis disease (Childers et al., 2001a; Childers et al., 2003; Kitajima et al., 2003b). Such
applications would be very useful for quarantine and certification programs, as well as gaining
additional information for the development of better management programs.
Materials and Methods
Virus Source
Leprosis infected sweet orange Citrus sinensis (L). Osbeck leaf, fruit and bark showing
typical leprosis symptoms were collected from two locations in Panama: Boquete and Potrerillos,
Chiriquí State (Table 3-1). Citrus tissue with leprosis lesions (chlorotic areas) as well as from
non-lesion (green) leaf areas, fruit and twigs was used for total nucleic acid extractions. In
addition, tissues from symptomatic leprosis and apparently healthy sweet orange trees were
collected from São Paulo and Minas Gerais States, Brazil; Santa Rosa State, Guatemala and
Maracay, Aragua State, Venezuela and used for total nucleic acid extractions. These samples
were kindly provided by Richard F. Lee, Maragarita Palmieri and Ezequiel Rangel, respectively.
Citrus leaves, fruits and twigs from trees without leprosis symptoms were collected as negative
73
controls from areas in Santiago, Veraguas State, Panama City, Panama, and the University of
Florida Citrus Research and Education Center (CREC), Lake Alfred, Florida.
Total Nucleic Acid Extraction and RNA Isolation
The extraction of total nucleic acids was done in the country of collection by using two to
five g of tissue which were powdered in a mortar and pestle after freezing with liquid nitrogen,
and the total nucleic acids were extracted using the protocol described by Rosner et al., ( 1986).
The extracts were shipped to University of Florida, Gainesville, FL. Total nucleic acids were
resuspended as follows: two to four ml aliquots of the total nucleic acid extracts were centrifuged
at 14,000 rpm for 20 min at 4 ºC. The pellet was resuspended in a total volume of 100 µl RNase-
free water which was then applied to the QIAgen RNeasy Plant Mini Kit (QIAgen) according to
manufacturer’s instructions. The final total RNA extraction was resuspended in 30 µl of DNase-
RNase-free water, and stored at -80º C for future use. The concentration of the total RNA was
determined by measuring absorbance at 260 nm (A260) in a SmartSpec 3000TM
spectrophotometer (Bio-Rad).
The RNA purity and integrity of the citrus RNA extracts were checked by electrophoresis
on a 1.0% agarose gel followed by ethidium bromide (0.5 µg ml-1) staining. In addition, the RNA
quality was assessed using primers K616 (5’-TATGCTTGTCTCAAAGATTAAG-3’) and K617
(5’-TAATTCTCCGTCACCCGTC-3’) for the detection of 18S ribosomal mRNAs by the RT-
PCR method as described previously (Guerra-Moreno, 2004).
Primer Design
Based on CCLV open reading frames (ORFs) with high levels of expressions, as seen in
Northern blots (Guerra-Moreno, 2004; Figure 2-7 in Chapter 2), several sets of forward and
reverse primers were designed for the RNA 1 ORF 2 and RNA 2 ORF 4 (Table 3-2). The primer
pairs Kpr-658 and Kpr-659 (RNA 1 ORF 2) and Kpr-670-671 (RNA 2 ORF 4) amplify 425 and
74
257 bp fragments, respectively. In addition, primer pairs Kpr-685 and Kpr-686 located between
the OTU-like cysteine protease and RNA helicase domains of the replicase protein in RNA1
ORF 2 (Figure 2-7 in Chapter 2) also were designed (Table 3-1). The primers were synthesized
by Integrated DNA Technologies, Inc (http://www.idtdna.com/).
Reverse Transcription (RT) and Polymerase Chain Reaction (PCR)
The total RNA extracts from citrus samples collected from Potrerillos and Boquete,
Chiriquí State, Panama were tested by RT-PCR using CCLV-specific primers sets Kpr-658-659,
Kpr-670-671 and Kpr-685-686 (Table 3-1). Primer set K616-617, which detects the 18S rRNAs,
was used as positive control and to determine the quality of the RNA extracts. The RT reaction
was performed using a ThermoScript Reverse Transcriptase kit (Invitrogen) according to
manufacturer’s instructions. In a sterile 0.5 ml PCR tube the following were added: 1.0 µg of
total RNA extraction, 1 µl of each CCLV-specific primer (10 µM each), 10 mM dNTP’s mix and
RNase-free water to 12 µl total volume. The tube contents were mixed, quickly centrifuged and
incubated at 65 ºC for 5 min, then immediately transferred to ice. A mixture containing 4 µl of
5x cDNA synthesis buffer, 1 µl of 0.1 M Dithiothreitol (DTT), 1 µl RNaseOUT (40 U µl-1) and 1
µl of ThermoScript RT enzyme (15 units µl-1) was added to the tube. The mixture was incubated
at 60 ºC for 1 h. The reaction was terminated by a final incubation at 85 ºC for 5 min. The
generated cDNAs were either used immediately or stored at -20 ºC for further use.
The PCR reaction mixture consisted of 2 µl of first strand cDNA, 5 µl 10X PCR buffer (50
mM KCL, 10 mM Tris-HCL pH 9.0 and 0.1% Triton X-100), 5 µl 25 mM MgCl2, 1 µl dNTP’s
(10 mM each), 1 µl each of primer set (10 µM of each), 1 U Taq DNA polymerase (Invitrogen)
and DNase and RNase free water to 50 µl total volume. The PCR amplification parameters were:
94 ºC for 3 min; then 30 cycles at 94º C for 30 s, 55º C for 30 s, 72º C for 45 s, followed by a
final incubation at 72 ºC for 10 min. Ten µl of each RT-PCR product was electrophoretically
75
separated on 1.0 % agarose in 1X TAE buffer (40 mM Tris-Acetate and 1 mM EDTA, pH 8.0),
at 100 volts for 55 minutes, and them stained with ethidium bromide. A Bio-Rad Gel-Doc
imaging system was used for visualization of the RT-PCR amplified products.
The total RNA extracts from citrus samples collected from Panama (Potrerillos and
Boquete), Brazil, Guatemala, Venezuela, and Florida were tested by RT-PCR using CCLV
specific primers sets Kpr-658-659 (Table 3-1). Plasmid AGpl-1-C09, having the complete RNA
1 ORF 2, was used as positive control for PCR. Primer set K616-617 (18S rRNAs) was used as
positive control and as quality control for the RNA extracts.
Protein Extraction
The total proteins from CCLV-infected citrus tissue (leaf and fruit), Brevipalpus mites and
healthy leaf and fruit tissue were extracted as described by Erny et al., (1992). Briefly, 0.5 g
fresh citrus tissue was cutting into small pieces and powdered after freezing in liquid nitrogen.
Thirty Brevipalpus spp. mites also were ground after freezing in liquid nitrogen. The powdered
tissue was mixed with 0.4 ml of plant extraction buffer (25 mM Tris-HCl pH 7.5; 10 mM NaCl;
10 mM MgCl2, 5 mM EDTA, 10 mM β-mercaptoethanol, and 1 mM PMSF), then transferred to
a 2.0 ml tube. The samples were centrifuged at 8,000 g for 20 min at 4 °C. The supernatant (0.2-
0.3 ml) was transferred to a fresh 1.5 ml tube, mixed with an equal volume of 2 X Laemmli
buffer (Laemmli, 1970) and incubated at 95 °C for 10 minutes. The extracted proteins were
stored overnight at -20 °C, shipped to University of Florida, Gainesville FL, and stored at -20 oC
until further use.
Cloning and Expression of CCLV p29 Protein
The complete ORF 2 of CCLV RNA 1 was cloned and used for the bacterial expression
and production of CCLV specific antibodies (Rangel et al., 2005). The soluble and insoluble
fraction of the bacterial expressed protein were processed and used as antigens to raise antibodies
76
in rabbits (R) and chickens (C) (Cocalico Biologicals, Inc.) (Manjunath et al., unpublished
results; Rangel et al., 2005).
Western Blot Detection of CCLV p29
The total protein extracts from infected and healthy citrus tissue were incubated for 10 min
at 95 °C and subject to Western blot detection using R_p29-27 and C_p29-28 polyclonal antibodies
(Manjunath et al., unpublished results; Rangel et al., 2005) according to a protocol described
elsewhere (Towbin et al., 1979). The samples were analyzed by 4-20% gradient SDS-PAGE.
Total proteins were transfered by electroblotting to a Polyvinylidene fluoride membrane (PVDF;
Millipore) using a Trans-Blot® Semi-Dry cell following manufacture’s protocol (Bio-Rad).
Immuno-blots were blocked for 2 h in 5% Bovine Serum Albumin (BSA; Fisher Scientific) in
TBS-T buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.05% Tween®-20). PVDF membranes
were carefully washed in TBS-T buffer 3 times for 5 min each between steps. After blocking,
immunoblots were incubated for 2 h with 1:10,000 dilution of R_p29-27 and C_p29-28 in TBS-T
buffer, individually; followed by 2 h incubation with 1:30,000 dilutions of anti-rabbit and anti-
chicken IgG alkaline phosphatase (AP) conjugate (Sigma) in TBS-T buffer, respectively.
Immuno-reactive proteins were visualized using Western Blue® stabilized substrate for alkaline
phosphatase (Promega). One μl of the CCLV p29 bacterial expressed protein (concentration of 1
μg ml-1) was used as positive control.
Immuno Imprint Detection of CCLV Using Antibodies Against p29
Leaf and fruit tissue of healthy and leprosis-affected citrus were washed with a solution
containing 1% chlorine. The tissue was rolled, then transversally or longitudinally cut with a
razor blade and pressed into a PVDF membrane (Millipore) for 5-10 s following standard
protocol (Helguera et al., 1997). The PVDF membranes were air-dried, then shipped to
University of Florida, Gainesville FL, and stored at 4 oC until further use. Membranes were
77
briefly wetted in 100% ethanol and transferred to a container containing TBS (without Tween
20) for 2 min. Then, membranes were subject to immuno-detection using R_p29-27 and C_p29-28
polyclonal antibodies (Manjunath et al., unpublished results) as described above for Western
blotting. The R_p29-27 and C_p29-28 antibodies were used in 1:10,000 dilutions. One μl of the
CCLV p29 bacterial expressed protein (concentration of 1 μg ml-1) was spotted on the PVDF
membrane as positive control.
Enzyme-linked Immunosorbent Assay (ELISA) for CCLV
Samples were collected from Potrerillos and Boquete, Chiriquí State; Santiago, Veraguas
State; and Panama City, Panama. Samples were subjected to double antibody sandwich indirect
(DASI) ELISA (Clark & Adams, 1977) using the R_p29-27, C_p29-28, R_p29-29 and C_p29-30
antibodies (Manjunath et al., unpublished results). The ELISA plates were coated with 200 μl of
antibodies R_p29-27 and R_p29-29 (as primary antibodies) diluted in coating buffer (14 mM
Na2CO3, 35 mM NaHCO3, 3 mM NaN3, pH 9.6) independently, followed by overnight
incubation at 4 °C. The primary antibodies were used at the dilution indicated: 1:5,000 (year
2005) or 1:10,000 (years 2006 and 2007, respectively). The plates were loaded with 200 μl
aliquots of the sample (with 3 to 5 replicas scattered throughout the plate) which has been
extracted in sample extraction buffer [PBST + 2% polyvinyl pyrrolidone (PVP-40, Sigma)] and
incubated for 2 hours at 37 °C. Two hundred μl of the secondary antibodies (C_p29-28 and C_p29-
30) diluted (1:5,000 for year 2005 and 1:10,000 for years 2006, 2007) in conjugate buffer [PBST
+ 2% PVP + 0.2% egg albumin (Sigma)] were added to each well and incubated for 2 h at 37 °C.
Two hundred μl of anti-rabbit or anti-chicken (depending on which antibody was used as the
secondary antibody) IgG alkaline phosphatase conjugate (Sigma) diluted 1:30,000 in conjugate
buffer was added to each well and incubated at 37 °C for 2 h. The substrate was p-nitrophenyl
phosphate (Sigma) (1 mg ml-1) in 0.1 M diethanolamine buffer, pH 9.8. ELISA plates were
78
thoroughly washed three times for 5 min between each step with phosphate-buffered saline
buffer (PBS-T; 10 mM Na2HPO4, 1.75 mM KH2 PO4, 13.7 mM NaCl, 2.65 mM KCl and 3 mM
NaN3, pH 7.4 containing 0.05 % Tween 20) and blotted by tapping upside down on tissue paper.
The plates were incubated in the dark at room temperature for 30-60 min. Fifty μl of 3M NaOH
was added to each well to stop the reactions 60 in after adding the substrate. The reaction was
read at 405 nm using an ELx800™ Absorbance Microplate Reader (BioTek). The CCLV p29
bacterial expressed protein (concentration of 1μg ml-1) was used as positive control, diluted in
the sample extraction buffer (1:750). The assays were repeated for three consecutive years
(2005-2007) using samples collected from Panama. The threshold value for a positive
measurement was set to an equal or greater than three times the average value of the healthy
control. Optical density (OD) measurements represent the average value of the replicated
readings with five and three replicas for samples collected and assayed in years 2005 and 2006-
2007, respectively.
In year 2006, leaf tissues from the non-lesion area of symptomatic citrus leaves were used
to monitor the virus titer and systemic movement in non-chlorotic areas. Using a razor blade, leaf
tissue from 2-4 mm and 4-6 mm from the lesion area was excised and included as samples in the
DASI-ELISA experiments.
Results
Reverse Transcription (RT) and Polymerase Chain Reaction (PCR)
RT-PCR products of the expected sizes (690, 425 and 257 bp) were obtained with extracts
from samples infected with CCLV collected from Potrerillos, Panama using primer pairs Kpr-
685-686 (RNA 1 ORF 1), Kpr-658-659 (RNA 1 ORF 2) and Kpr-670-671 (RNA 2 ORF 4),
respectively (Figure 3-1, panels A-C). No RT-PCR amplification was obtained with samples
extracted from Boquete or Santiago (Figure 3-1, panels A-C, lanes 4 and 5). The sample extracts
79
from Santiago were considered as healthy controls. The expected RT-PCR products (350 bp)
were amplified from all the citrus samples (Figure 3-1, panel D) using the primer set Kpr-616-
617 for the citrus 18 S rRNA.
A RT-PCR amplified product of 425 bp was obtained using primers pair Kpr-685-659 and
RNA extracts from Potrerillos (Panama), Brazil, Guatemala, and Venezuela (Figure 3-2, panel
A, lanes 1, 2, and 5-10). No amplification was obtained from healthy citrus or leprosis affected
samples collected from Boquete, Panama (Figure 3-2, panel A, lanes 3, 4, 11-13). The quality of
the total RNA extracts used for RT-PCR was evaluated by testing for RT-PCR amplification of
the 18S ribosomal RNA (Figure 3-2, panel B).
Western Blot Detection of CCLV p29
The antiserum produced against the CCLV p29 fusion protein reacted strongly and
specifically with a protein band of 29 kDa using infected citrus tissue from Panama. Polyclonal
antibodies R_p29-27 and C_p29-28 reacted with a protein band of about 29 kDa (Figure 3-3, panels
A and B, respectively) corresponding to p29 and detected in CCLV-infected citrus leaf and fruit
tissue collected from Potrerillos, Panama. No serological reactive protein bands were detected in
samples from NCLV-infected citrus leaf tissue collected from Boquete or with the healthy
controls collected from Panama City (Figure 3-3, panels A and B, lanes 7 and 8, respectively).
The antibody R_p29-27 had the highest titer. Two distinct bands (29 and 26 kDa, respectively)
were observed with both antibodies (R_p29-27 and C_p29-28) developed against the expressed
CCLV p29 (Figure 3-3, lanes 1-6). Protein degradation (smear-like patterns) was seen in most of
the samples (Figure 3-3, lanes 1-6), and is also seen with the expressed protein (positive control;
Figure 3-3, lanes +) where bands of a lower molecular weight than the expected 35 kDa protein
band were observed. The expressed p29 protein (35 kDa) is larger than the natural p29 protein,
because the His-tag located at its carboxyl termini.
80
Immuno Imprint Detection of CCLV Using Antibodies Against p29
Viral presence was detected in leaf and fruit tissue from leprosis-affected citrus using
R_p29-27 and C_p29-28 and the immuno imprint detection (Figures 3-4 and 3-5). Fruit imprint
blots produced a better color definition/reaction as compared with the leaf imprint blots (Figures
3-4 and 3-5, panels D-F and A-C, respectively). Antibodies developed in rabbits (R_p29-27) had
the highest titer (compare color strength between Figures 3-4 and 3-5). No reaction was detected
with NCLV-infected citrus tissue or healthy control tissue (Figures 3-4 and 3-5, panels H and I,
respectively). A strong positive reaction was observed with the positive control of the p29
expressed protein (Figures 3-4 and 3-5, panel G).
Enzyme-linked Immunosorbent Assay (ELISA) for CCLV
Brevipalpus mites collected from CCLV-infected citrus trees, as well citrus leaf, fruit and
twigs samples collected from Potrerillos were tested by DASI-ELISA using CCLV rabbit
antibodies (R_p29-27 and R_p29-29) for coating and chicken antibodies as secondary antibodies
(C_p29-28 and C_p29-30). The antibodies reacted specifically with symptomatic leprosis samples
from citrus and mite samples collected from symtmatic trees from Potrerillos (Figures 3-6, 3-7
and 3-8) but did not react with similar citrus samples collected from Boquete, healthy samples or
non-infected Brevipalpus mites (collected from Boquete) (Figures 3-6, 3-7 and 3-8). The
OD405nm values of the CCLV-infected samples and positive control (expressed protein) were at
least 5 fold higher than the OD405nm values from healthy controls. Lower OD405nm values (up to
50% reduction compared with OD405nm values from symptomatic areas) were obtained with
citrus samples excised 2-4 mm from the symptomatic areas (Figure 3-7), and OD405nm values
below the threshold and considered negative were obtained in non-systemic tissue samples
excised 4-6 mm from the symptomatic area (Figure 3-7). Both rabbit and chicken antibodies
reacted with infected tissue in DASI-ELISA.
81
Discussion
In this study molecular detection methods for CCLV are reported including RT-PCR
assays targeting different regions of the CCLV genome as well as serological assays including
DASI-ELISA, Western blotting and immuno imprinting. The RT-PCR and serological assays
designed based on the properties of the highly expressed RNA 1 ORFs 1 and 2, and RNA 2
ORFs 3 and 4 (Chapter 2). While screening of the cDNA library created with leprosis-affected
citrus tissue (Guerra-Moreno, 2004; Chapter 2) a large number of clones were found to contain
sequences from RNA 1 ORF 2 (41 out of 300 clones) and RNA 2 ORF 4 (39 out of 300 clones),
making them ideal targets for designing specific and sensitive diagnostic methods (Chapter 2).
Molecular approaches using RT-PCR targeting the movement protein (MP) and RNA dependent
RNA polymerase (RdRp) were reported recently (Locali et al., 2003). While, this RT-PCR assay
allows fast detection of the pathogen, the primers are targeted to conserved regions of the viral
genome which are not highly expressed in infected tissue. Primers designed for highly expressed
CCLV genes should result in more sensitive detection of CCLV. The new sets of primers
designed in this study belong to highly expressed ORFs (RNA 1 ORF 2 and RNA 2 ORF 4) and
will detected the virus, even when present in low titer.
It is remarkably clear that in Panama, the samples that were collected from areas with low
elevation [less than 500 meter above the sea level (masl)] were positice for CCLV by both RT-
PCR and serological assays; in contrats samples collected in areas with higher elevation (more
than 1200 masl; Table 3-1) were negative for CCLV in RT-PCR and serological test and upon
TEM, contained only NCLV (Guerra, 2004; Guerra et al., 2005). In Panama, NCLV tends to be
found in specific niches having characteristic agroclimatic conditions including high altitude and
low temperatures. However, the CCLV is found in vast locations ranging from the sea level up to
1500 masl. In Brazil, NCLV is also found in few locations with distinct climatic conditions
82
(Kitajima et al., 2003a; Bastianel et al., 2006a) as is seen in Panama. However in Guatemala,
CCLV was present in costal areas as well as the high plateau (Palmieri et al., 2005).
The RT-PCR procedure using three CCLV-specific primer pairs amplified the expected
product from leprosis symptomatic leaf, fruit and bark samples collected from Potrerillos, but not
from the samples from visually healthy trees or samples from Boquete (Figure 3-1). The RT-
PCR primer pairs for CCLV showed high specificity, amplifying the expected products from
CCLV-infected citrus tissue only. As all three ORFs are highly conserved and specific (RNA 1
ORF 1; Chapter 2) or they are highly expressed in leprosis-infected plants (RNA 1 ORF 2 and
RNA 2 ORF 4; Chapter 2), these detection assays targeting those ORFs should be sensitive and
accurate.
The primer pair Kpr-658-659 amplified a 425 bp product of RNA 1 ORF 2 from RNA
extracts collected from Panama, Brazil, Venezuela, and Guatemala, but not from healthy extracts
or extracts from symptomatic trees at Boquete (Figure 3-2). The function of this RNA 1ORF 2
remains to be determined, as the sequence has no relation with sequences available in the
GenBank (Chapter 2). RT-PCR assays using this primer pair amplified products of the expected
size from all countries sampled (Figure 3-2). This suggests that CCLV is associated with the
spreading form of citrus leprosis in these countries, whereas NCLV has been only reported in
few locations (Dominguez et al., 2001; Guerra-Moreno, 2004; Kitajima et al., 2003b).
A distinct 29 kDa protein band was observed in Western blot assays using polyclonal
antibodies raised against CCLV p29 (Figure 3-3), but no protein bands were detected from
healthy or from samples from Boquete which contain only NCLV by TEM analysis (Dominguez
et al., 2001; Guerra-Moreno, 2004; Guerra-Moreno et al., 2005). A second protein band
(approximately 25-26 kDa in size) also was present (Figure 3-3). This protein could be the result
83
of post-translation proteolytic processes or degradation of protein in the extracts. Protein
degradation could occur because the proteins were extracted in Panama, shipped to Florida and
were stored several months at -20 ºC. Antibodies developed in rabbit had the highest titer when
compared with those developed in chicken (Figures 3-3, panels A and B).
The immuno imprint assays using polyclonal antibodies raised against CCLV p29 allowed
the detection of CCLV in infected citrus leaf and fruit samples collected from Potrerillos, but not
in samples from Boquete or healthy controls (Figures 3-4 and 3-5). The polyclonal antibodies
reacted most strongly with infected citrus fruit samples as seen by the deep purple color on the
membrane (Figures 3-4 and 3-5, panels D-F). The leaf samples were lighter purple color
compared with fruit tissue; however they were highly distinguishable from the healthy controls
which showed no color reaction (Figures 3-4 and 3-5, panels H and I). As seen with Western
blot, the rabbit antibodies had the higher titers as compared with the chicken antibodies.
Citrus samples infected with CCLV collected from Potrerillos, Panama gave positive
results in DASI-ELISA tests over a three year period from 2005-2007 (Figures 3-6, 3-7 and 3-8).
The presence of the virus was detected in infected leaf, bark and fruit tissue. Healthy plants did
not react with CCLV polyclonal antibodies. The presence of the virus in Brevipalpus mites also
was detected by the DASI-ELISA assays. The 2006-2007 years OD405nm values were up to 10
times higher compared to healthy plants (Figure 3-7), confirming the specificity of these
antibodies and their value for detection of CCLV. In other virus-pathosystems antibodies
developed against non-structural proteins such as inclusion bodies proteins such as RNA 1 ORF
2, are expected to be more effective at detecting the presence of the virus than from the
antibodies reacting with the coat protein (Rubinson et al., 1997). These non-structural or
inclusion body proteins may be present in greater quantities or may be more immunogenic than
84
capsid proteins (Brakke, 1990; Hampton et al., 1990; Rubinson et al., 1997). These antibodies
have proven to be excellent tools for quick and accurate serological detection of CCLV in field
samples.
It has been reported that CCLV has limited or no systemic movement within citrus tissue
as compared with other citrus viruses (Colariccio et al., 2000; Kitajima et al., 2003a; Kitajima et
al., 2000; Rodrigues et al., 2003; Rossetti, 1980; Rossetti, 1996). Using the DASI-ELISA assay
for CCLV, citrus leaf tissue excised 2-4 mm from the chlorotic lesion (non-symptomatic area),
reduced OD405nm values by 50% as compared with samples from the chlorotic areas, but the
OD405nm values were still far above the threshold value and would considered as positive (Figure
3-7). Nevertheless, when tissue excised 4-6 mm from the lesion was tested in DASI-ELISA, low
OD405nm values were obtained, and were the cut off values for declaration of being positive for
CCLV (Figure 3-7, panels A-D). These observations are important, especially for personnel in
diagnostic clinics and quarantine facilities, as samples collected could produce a false negative if
the wrong type of tissue (non-symptomatic) is selected for processing. The low titer of the CCLV
protein found in non-symptomatic tissue near the lesion (4-6 mm), along with the findings from
Chapter 2 where molecular studies showed the presence of RNA molecules only in the
symptomatic tissue and TEM analyses which detected no virions in the surrounding symptomatic
areas (Guerra-Moreno, 2004; Kitajima et al., 1972; Kitajima et al., 1974) supports the hypothesis
that CCLV has non- or limited systemic movement in citrus.
The molecular (RT-PCR) and serological (DASI-ELISA, immuno imprint and Western
blot) detection systems reported in this study were designed based on the properties of the highly
expressed ORFs of CCLV. While serological methods are less sensitive than RT-PCR methods
(Livieratos et al., 1999; Monis & Bestwick, 1997; Rubinson et al., 1997), the serological
85
methods are more appropriate for large scale surveys. The DASI-ELISA assay should be useful
for large scale uses and for epidemiological studies to confirm the presence of CCLV. Immuno
imprint, Western blot and RT-PCR assays could be used as back-up methods to re-confirm the
results obtained by DASI-ELISA. The implementation of the molecular and serological detection
procedures detailed here could be useful in epidemiology and certification programs in countries
where the disease is present; and would be invaluable for quarantine programs at port of entry in
countries such as USA, where the disease is absent.
86
Table 3-1. Detailed description of the citrus samples collected from Chiriquí and Veraguas, Panama during July 2005 and used in DASI-ELISA assays.a
Common name
Tissue type
Locationb
Geographical Position
Elevation (masl)c
ELISA Results
Comments
Sweet Orange
Leaf - 1 Potr 8º 36.755’ N 82 º 26.215’ W
422.87 + CCLV-infected
Sweet Orange
Leaf - 2 Potr 8º 36.711’ N 82 º 26.228’ W
418.60 + CCLV-infected
Sweet Orange
Leaf - 3 Potr 8º 36.747’ N 82 º 26.238’ W
420.43 + CCLV-infected
Mandarin Leaf Potr 8º 36.724’ N 82 º 26.223’ W
419.26 + CCLV-infected
Sweet Orange
Fruit Potr 8º 36.717’ N 82 º 26.233’ W
419.82 + CCLV-infected
Sweet Orange
Bark Potr 8º 36.746’ N 82 º 26.224’ W
421.65 + CCLV-infected
Mandarin Bark Potr 8º 36.724’ N 82 º 26.223’ W
418.90 + CCLV-infected
Sweet Orange
Leaf Sant 8º 5.474’ N 80 º 59.082’ W
106.70 - Healthy control
Lemon Leaf Boq 8º 47.686’ N 82 º 26.479’ W
1205.79 - NCLV-infected
Mandarin Leaf Sant 8º 5.471’ N 80 º 59.094’ W
105.79 - Healthy control
Grapefruit Leaf Boq 8º 47.697’ N 82 º 26.490’ W
1208.54 - Healthy control
Wash. Navel
Leaf Boq 8º 47.697’ N 82 º 26.494’ W
1210.68 - NCLV-infected
Lemon Bark Boq 8º 47.686’ N 82 º 26.479’ W
1219.51 - NCLV-infected
aBoquete and Potrerillos are in Chiriquí province, and Santiago are in Veraguas Province b Potr = Potrerillos; Sant= Santiago; Boq= Boquete. cmasl = meters above sea level.
87
Table 3-2. Primers used for RT-PCR analysis of Cytoplasmic citrus leprosis virus (CCLV). Primer RNA Primer Sequence Kpr658 RNA 1 5'_7804AAGGTCTGCGTGATATTAGCAAGCCTA7830_3' Kpr659 RNA 1 5'_8228TATGGGTCGCTTCGGGAAGCCCATAC8203_3' Kpr668 RNA 1 5'_7714AACATATGTCGGAT:CGATGAGTATCGTAACTTTCACTTTGAC7739_3' Kpr669 RNA 1 5'_8477AGGAGGACGACTCCGACTCAGCGCAGAAGCTTGCGGCCGCA8502_3' Kpr685 RNA 1 5'_2477CAATTAGAGCATAGCCATTATAG2500_3' Kpr686 RNA 1 5'_3166GTTAGCGTATTCAAGGATTCTGGA3143_3' Kpr670 RNA 2 5'_4130AGGCGCGCAGCTAACGTTAGGCAAAG4155_3' Kpr671 RNA 2 5'_4386ACCAGAGCACCACAGATCCTGAAGAAG4360_3'
Primers Kpr-658, 659, 668, 669, 685 and 686 were designed based on sequences from RNA 1; while primers Kpr-670 and 671 correspond to sequences from RNA 2.
88
Figure 3-1. RT-PCR amplification of CCLV RNA 1 ORFs 1 and 2; and RNA 2 ORF 4. Citrus
samples were collected from Potrerillos and Boquete, Chiriquí State, and Santiago, Veraguas State, Panama. Leprosis-affected leaf (lane 1), bark (lane 2) and fruit (lane 3) were used as target samples. Healthy leaf tissue (lanes 4 and 5) was used as a negative control. Water controls were also used for RT and PCR (lanes 6 and 7, respectively). A) Primer pair Kpr-685-686 was used to amplify a 690 bp fragment from the RNA1 ORF 1. B) RT-PCR detection of a 425 bp fragment from the RNA 1 ORF 2 using primers Kpr-658-659. C) Detection of a 257 bp RT-PCR product from RNA 2 ORF 4 using CCLV-specific Kpr-670-671 primers. D) RT-PCR amplification of a 350 bp amplicon from citrus 18 S rRNAs using Kpr-616-617 primers. The arrows indicate the position of the expected amplified RT-PCR products. The DNA marker sizes are indicated between the panels by double headed arrows. Each lane was loaded with 10 µl of RT-PCR products. Lanes M were loaded with 100 bp DNA ladder (Invitrogen).
1 2 3 4 5 6 7 M
257 bp350 bp
600 bp
425 bp600 bp
A B
C D
M 1 2 3 4 5 6 7
1 2 3 4 5 6 7 M M 1 2 3 4 5 6 7
1500 bp
1500 bp
690 bp
89
Figure 3-2. RT-PCR detection of CCLV in samples collected from different countries. A).
Agarose gel electrophoresis of RT-PCR products (10 µl each). Leprosis affected sample extracts from Potrerillos, Panama (lanes 1 and 2); Boquete, Panama (lanes 3 and 4); Brazil (lanes 5 and 6), Guatemala (lanes 7 and 8); and Venezuela (lanes 9 and 10) were tested. Healthy tissue from Florida (lanes 11 and 12) and Potrerillos, Panama (lane 13) were used as negative controls. A PCR product from a control DNA plasmid (AGpl-1-C09) containing a CCLV insert (lane 14) was used as a positive control. B). Detection of a 350 bp product of 18 S rRNA gene by RT-PCR. Test samples in lanes 1 to 13 were from the same sources as in panel A, lanes 1-13. Lanes M were loaded with 100 bp DNA ladder (Invitrogen).
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14
300
1500
600
2072
300
600 M 1 2 3 4 5 6 7 8 9 10 11 12 13
A
B
90
Figure 3-3.Western blot detection of CCLV p29 using polyclonal antibodies. Leprosis-affected
citrus leaf (lanes 1-3) and fruit (lanes 4-6) tissue were used for total protein extraction followed by Western blot detection. Healthy leaf tissue from Boquete, Chiriquí State (lane 7) and Panama City, Panama (lane 8) were used as negative controls. A) Immuno-detection of CCLV p29 using polyclonal antibody developed in rabbits (R_p29-27). B) Western immunoblot detection of CCLV p29 using polyclonal antibody raised in chicken (C_p29-28). The top band (panel A and B, lanes 1-6) represent the CCLV p29. The lower bands may represent the CCLV p29 after post-translation processes or protein degradation. Protein degradation, probably due to long term shipment and storage, is observed in all lanes (mainly in lane +). Rabbit and chicken raised antibodies were used in 1:10,000 dilutions. Fifteen µl of total protein extraction were loaded in each well, except for lane +, where 1 μl of the CCLV p29 bacterial expressed protein (concentration of 1 μg ml-1) was loaded as positive control.
1 2 3 4 5 6 7 8 +
1 2 3 4 5 6 7 8 +
A
B
35 kDa31 kDa
35 kDa31 kDa
91
Figure 3-4. Immuno Imprint detection of CCLV p29 in citrus samples collected from Potrerillos
and Boquete, Panama using polyclonal antibodies developed in rabbits (R_p29-27). A-C) Immuno-chemical detection of CCLV p29 in leprosis-affected citrus leaves collected from Potrerillos. D-F) Immuno-chemical detection of CCLV p29 in leprosis-affected citrus fruit collected from Potrerillos. G) Immuno-detection of CCLV p29 bacterial expressed protein that was used as a positive control (2 μl of 1 μg ml-1 concentration). H-I) Healthy citrus leaves collected from Boquete were used as negative controls. The R_p29-27 antibody was used at 1:10,000 dilution.
92
Figure 3-5. Immuno imprint detection of CCLV p29 in citrus samples collected from Potrerillos and Boquete, Panama using polyclonal antibodies raised in chicken (C_p29-28). A-C) Immuno imprint detection of CCLV p29 in leprosis-affected citrus leaves collected from Potrerillos. D-F) Immuno imprint detection of CCLV p29 in leprosis-affected citrus fruits collected from Potrerillos. G) Immuno-detection of CCLV p29 bacterial expressed protein that was used as a positive control (2 μl of 1 μg ml-1 concentration). H-I) healthy citrus leaves collected from Boquete were used as negative controls. The polyclonal antibody (R_p29-28) was developed in chicken and used in 1:10,000 dilution.
93
Figure 3-6. DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs
collected from Boquete and Potrerillos, Panama during July 2005. CCLV specific antibodies raised in rabbits (R_p29-27 and R_p29-29) and chicken (C_p29-28 and C_p29-30) were utilized. A) DASI-ELISA detection using R_p29-27 and C_p29-28 as primary and secondary antibodies, respectively. B) DASI-ELISA detection of CCLV using R_p29-27 and C_p29-30 as primary and secondary antibodies, respectively. C) DASI-ELISA detection of CCLV using R_p29-29 and c_p29-28 as primary and secondary antibodies, respectively. D) DASI-ELISA detection of CCLV using R_p29-29 and C_p29-30 as primary and secondary antibodies, respectively. The dashed lines represent threshold values (3 X healthy control values). Bacterial expressed protein was used as positive control (last column in each graph). Both primary and secondary antibodies were used at 1:5,000 dilutions. Each measurement value is the average of the readings from five replications.
0
0.05
0.1
0.15
0.2
0.25
0.3
Abs
orba
nce
at 4
05 n
m
-0.2
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Abs
orba
nce
at 4
05 n
m
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Abs
orba
nce
at 4
05 n
m
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Abs
orba
nce
at 4
05 n
m
A B
C D
0.058
0.45
0.39
0.36
Sweet orange leaf 1. Potrerillos.Sweet orange leaf 2. Potrerillos.Sweet orange leaf 3. Potrerillos.Mandarin leaf. Potrerillos.S f
Sweet orange fruit. Potrerillos.Sweet orange bark. Potrerillos.Mandarin bark. Potrerillos.Sweet orange leaf. Boquete.Lemon leaf. Boquete.
Whashintong Navel leaf. Boquete.Grapefruit fruit. Boquete. Lemon bark. Boquete.Bact. Expr. Protein (Positive Control)
Washington Navel leaf . Boquete.Sweet orange leaf 1. Potrerillos.Sweet orange leaf 2. Potrerillos.Sweet orange leaf 3. Potrerillos.Mandarin leaf. Potrerillos.S f
Sweet orange fruit. Potrerillos.Sweet orange bark. Potrerillos.Mandarin bark. Potrerillos.Sweet orange leaf. Boquete.Lemon leaf. Boquete.
Whashintong Navel leaf. Boquete.Grapefruit fruit. Boquete. Lemon bark. Boquete.Bact. Expr. Protein (Positive Control)
Washington Navel leaf . Boquete.
94
Figure 3-7. DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potrerillos, Panama during December 2006. CCLV specific antibodies raised in rabbits (R_p29-27 and R_p29-29) and chicken (C_p29-28 and C_p29-30) were used. A) DASI-ELISA detection using R_p29-27 and C_p29-28 as primary and secondary antibodies, respectively. B) DASI-ELISA detection of CCLV using R_p29-27 and C_p29-30 as primary and secondary antibodies, respectively. C) DASI-ELISA detection of CCLV using R_p29-29 and c_p29-28 as primary and secondary antibodies, respectively. D) DASI-ELISA detection of CCLV using R_p29-29 and C_p29-30 as primary and secondary antibodies, respectively. The dashed lines represent threshold values (3 X healthy control values). Bacterial expressed protein was used as positive control (last column in each graph). Both primary and secondary antibodies were used at 1:10,000 dilutions. Each measurement value is the average of readings from three replications.
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Abs
orba
nce
at 4
05 n
m
-0.1
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
Abs
orba
nce
at 4
05 n
m
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
Abs
orba
nce
at 4
05 n
m
-0.1
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
Abs
orba
nce
at 4
05 n
m
A B
C D
0.127
0.036
0.103
0.021
Sweet orange leaf 1. Potrerillos.Sweet orange leaf 2. Potrerillos.Sweet orange fruit. Potrerillos.Sweet orange fruit. Potrerillos.2 - 4 mm from leaf lesion. Potrerillos.
4 - 6 mm from leaf lesion. Potrerillos.Brevipalpus spp. Potrerillos.Brevipalpus spp. Boquete.Mandarin leaf. Potrerillos.
Whashintong Navel leaf 1. Boquete.Whashintong Navel leaf 2. Boquete.Healthy leaf 1. PanamaHealthy leaf 2. PanamaBact. Expr. Protein (Positive control)
Washington Navel leaf 1. Boquete.Washington Navel leaf 2. Boquete.
95
Figure 3-8. DASI-ELISA detection of CCLV in samples from citrus leaves, fruits and twigs collected from Boquete and Potrerillos, Panama during June 2007. CCLV specific antibodies raised in rabbits (R_p29-27 and R_p29-29) and chicken (C_p29-28 and C_p29-30) were used. A) DASI-ELISA detection using R_p29-27 and C_p29-28 as primary and secondary antibodies, respectively. B) DASI-ELISA detection of CCLV using R_p29-27 and C_p29-30 as primary and secondary antibodies, respectively. C) DASI-ELISA detection of CCLV using R_p29-29 and c_p29-28 as primary and secondary antibodies, respectively. D) DASI-ELISA detection of CCLV using R_p29-29 and C_p29-30 as primary and secondary antibodies, respectively. The dashed lines represent threshold values (3 X healthy control values). Bacterial expressed protein was used as positive control (last column in each graph). Both primary and secondary antibodies were used at 1:10,000 dilutions. . Each measurement value is the average of readings from three replications.
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
Abs
orba
nce
at 4
05 n
m
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
Abs
orba
nce
at 4
05 n
m
-0.5
0
0.5
1
1.5
2
2.5
Abs
orba
nce
at 4
05 n
m
-0.2
0
0.2
0.4
0.6
0.8
1
1.2
Abs
orba
nce
at 4
05 n
mA B
C D
0.04
0.20
0.390.024
Sweet orange leaf 1. Potrerillos.2 - 4 mm from leaf lesion. Potrerillos.4 - 6 mm from leaf lesion. Potrerillos.Sweet orange leaf 2. Potrerillos.Sweet orange leaf 3. Potrerillos.S t l f 4 P t ill
Sweet orange leaf 4. Potrerillos.Sweet orange leaf 5. Potrerillos.Lemon leaf. Boquete.Mandarin leaf. Boquete.
Whashintong Navel leaf. Boquete.Grapefruit leaf. Boquete. Healthy leaf 1. Panama. Healthy leaf 2. Panama Bact. Expr. Protein (Positive Control)
Washington Navel leaf . Boquete.Sweet orange Fruit 1. Potrerillos.Sweet orange Fruit 2. Potrerillos.
Sweet orange leaf 1. Potrerillos.2 - 4 mm from leaf lesion. Potrerillos.4 - 6 mm from leaf lesion. Potrerillos.Sweet orange leaf 2. Potrerillos.Sweet orange leaf 3. Potrerillos.S t l f 4 P t ill
Sweet orange leaf 4. Potrerillos.Sweet orange leaf 5. Potrerillos.Lemon leaf. Boquete.Mandarin leaf. Boquete.
Whashintong Navel leaf. Boquete.Grapefruit leaf. Boquete. Healthy leaf 1. Panama. Healthy leaf 2. Panama Bact. Expr. Protein (Positive Control)
Washington Navel leaf . Boquete.Sweet orange Fruit 1. Potrerillos.Sweet orange Fruit 2. Potrerillos.
96
CHAPTER 4 GENERAL CONCLUSIONS
In this study, the molecular characterization of the genome of the Cytoplasmic citrus
leprosis virus (CCLV) from Panama is reported. This include the sequence of the Panamanian
isolate of CCLV which is compared with the two isolates reported from Brazil, as additionally
the subgenomic (sg) and defective interfering (DI) RNAs associated with CCLV-infected citrus
tissue are characterized. Additionally, RT-PCR and serological diagnostic methods for detection
of CCLV were developed based on highly expressed ORFs.
At the beginning of this research, little was known about the molecular properties of
CCLV. Although the disease was first reported in South America in the 1920’s, the suspected
causal virus particles were not observed by transmission electron microscopy (TEM) until the
early 1970’s. The virus was tentatively placed under the Rhabdoviridae family (monopartite
negative-sense viruses) based on the particle morphology similarities. The low titer of the virus,
its limited or non-systemic behavior in infected tissue, as well the difficulty in purifying the virus
has hampered the characterization of this pathogen.
The majority of the molecular characterization data has been collected in the last seven
years. Northern hybridizations and sequence analyses have proven that at least two different
viruses are associated with citrus leprosis (Guerra-Moreno et al., 2005): the CCLV, which is an
bipartite positive-stranded RNA virus and is widely spread in South and Central America, and
the nuclear citrus leprosis virus (NCLV) which has been reported in only a few locations.
Hybridization patterns with probes targeting both RNAs 1 and 2 and sequence analysis indicate
that the CCLV is a positive-sense, bipartite RNA virus with four 3’ co-terminal sg- and several
DI-RNAs are present in infected tissue. The virus shows distant relationship with other positive-
97
sense RNA viruses in the tobamo, furo, tobra, bromo and cucumoviruses groups, but no
relationship with rhabdoviruses.
CCLV is distinctly different from these positive-sense plant RNA viruses with respect to
the genomic organization, gene expression and the presence of novel viral proteins including the
Ovarian Tumor (OTU) gene-like cysteine protease. This is the first report of a plant virus with
protein domains similar to OTU. Two of the six CCLV putative proteins show relationships with
proteins of other plant viruses; and the remaining four putative proteins have novel sequences
with no similarities with other viral sequences from the GenBank. This information provides
evidence that CCLV possibly belongs to a new plant virus genus. Therefore it is proposed that
CCLV be placed into a new genus called, Cycilevirus, becoming its type member.
In addition to the genomic RNAs, CCLV possesses an array of sg- and DI-RNAs which
are present in infected citrus tissues. Many plant viruses produce sg and DI-RNAs, however
CCLV is unique as its sg and DI-RNAs have a 5’ m7GpppN-cap and 3’ poly(A) tail structure at
theirs termini. With these termini, CCLV g-, sg- and DI-RNAs resemble the mRNAs of their
hosts. These terminal structures may facilitate the translation of CCLV proteins inside the citrus
cell environment and possibly inside mite cells as occur with other plant viruses (Dreher &
Miller, 2006; Ivanov et al., 1997). The presence of DI-RNAs has been demonstrated in multiple
hosts infected with RNA viruses, however this is the first report of the presence of naturally
occurring DI-RNAs in citrus plants infected with CCLV. Analysis of the sequences up- and
downstream of the DI-RNA junction sites revealed that the borders are flanked by short direct
and inverted repeats. These DI-RNAs were chimeric recombinant molecules apparently
generated by aberrant RNA synthesis by the replicase driven-template switching mechanism
(Ayllon et al., 1999; Wu & White, 1998). The influence of these DI-RNAs on CCLV symptom
98
expression is unknown, but the presence of these DI-RNAs in high concentration (Figures 2-3
and 2-4) in infected leaf tissue suggests that they may possibly interfere with the symptoms
caused by CCLV, as occurs with Turnip crinkle virus (TCV; Li et al., 1989) and broad bean
mottle bromovirus (BBMV; Pogany et al., 1995). Also the presence of these DI-RNAs in high
concentration in citrus tissue infected with CCLV may interfere with the replication of the g-
RNAs and cause a reduction on the g-RNA accumulation (Figures 2-3 and 2-4) as occurs with
other virus-pathosystem (White & Nagy, 2004).
As previously mentioned, the detection of CCLV in the past was based on symptoms and
the visualization of virions in infected tissue using TEM. This study reports the development of
molecular and serological approaches for CCLV detection. Both RT-PCR primer pair and
polyclonal antibodies against CCLV were designed based on the properties of the highly
expressed ORFs of CCLV. Molecular approaches directed toward the sequences from both
RNAs 1 and 2 proved to be highly specific in detecting CCLV in samples from South and
Central America. These primer pairs contain unique sequences not shared by other plant viruses,
making them ideal tools for detection when using RT-PCR. The serological assays were specific
in detecting CCLV proteins in citrus samples showing leprosis symptoms and from mites
collected from CCLV-infected citrus trees. The polyclonal antibodies reacted strongly with
CCLV proteins collected from infected tissues using Western blots and immuno imprint assays.
Also in DASI-ELISA at least 5-fold differences in the optical measurement values between
infected and healthy plants was obtained. Therefore these antibodies are excellent tools for quick
and accurate serological detection of CCLV and may be useful for large epidemiological field
surveys.
99
Although substantial progress was made regarding the molecular features of CCLV in
recent years, there is a need for additional studies to better understand the pathogen-vector-host
interactions of this patho-system. Two of the six CCLV putative proteins have been assigned a
function based on sequences similarities with other plant viruses; however the functions of the
remaining four proteins remain unresolved. Development of infectious clones or mutants of
CCLV, along with other in vivo experiments, will be required to obtain detailed information
regarding the function of the CCLV proteins. Furthermore, little is known about the nature of
mite transmission and the interaction between mites and CCLV and/or plant proteins.
100
LIST OF REFERENCES
Adkins, S. & Kao, C. C. (1998). Subgenomic RNA promoters dictate the mode of recognition by bromoviral RNA-dependent RNA polymerases. Virology 252, 1-8.
Ahlquist, P. & Kaesberg, P. (1979). Determination of the length distribution of poly(A) at the 3' terminus of the virion RNAs of EMC virus, poliovirus, rhinovirus, RAV-61 and CPMV and of mouse globin mRNA. Nucleic Acids Res 7, 1195-1204.
Ahola, T. & Ahlquist, P. (1999). Putative RNA capping activities encoded by brome mosaic virus: methylation and covalent binding of guanylate by replicase protein 1a. J Virol 73, 10061-10069.
Ahola, T., den Boon, J. A. & Ahlquist, P. (2000). Helicase and capping enzyme active site mutations in brome mosaic virus protein 1a cause defects in template recruitment, negative-strand RNA synthesis, and viral RNA capping. J Virol 74, 8803-8811.
Ahola, T., Laakkonen, P., Vihinen, H. & Kaariainen, L. (1997). Critical residues of Semliki Forest virus RNA capping enzyme involved in methyltransferase and guanylyltransferase-like activities. J Virol 71, 392-397.
Albiach-Marti, M. R., Mawassi, M., Gowda, S., Satyanarayana, T., Hilf, M. E., Shanker, S., Almira, E. C., Vives, M. C., Lopez, C., Guerri, J., Flores, R., Moreno, P., Garnsey, S. M. & Dawson, W. O. (2000). Sequences of Citrus tristeza virus separated in time and space are essentially identical. J Virol 74, 6856-6865.
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389-3402.
Araya-Gonzalez, J. 2000. Informe sobre la prospección de la leprosis de los cítricos en la zona fronteriza sur (Costa Rica-Panamá). Ministerio de Agricultura y Ganaderia. 5pp
Ayllon, M. A., Lopez, C., Navas-Castillo, J., Mawassi, M., Dawson, W. O., Guerri, J., Flores, R. & Moreno, P. (1999). New defective RNAs from citrus tristeza virus: evidence for a replicase-driven template switching mechanism in their generation. J Gen Virol 80 ( Pt 3), 817-821.
Bassanezi, R. B., Bergamin Filho, A., Amorim, L., Gimenes-Fernandes, N., Gottwald, T. R., & Bové, J. M. (2003). Spatial and temporal analyses of citrus sudden death as a tool to generate hypotheses concerning its etiology. Phytopathology 93:502-512.
Bassanezi, R. B. & Laranjeira, F. F. (2007). Spatial patterns of leprosis and its mite vector in commercial citrus groves in Brazil. Plant Pathology 56, 97-106.
Bastianel, M., de Oliveira, A. C., Cristofani, M., Filho, O. G., Freitas-Astúa, J., Rodrigues, V., Astúa-Monge, G. & Machado, M. A. (2006a). Inheritance and Heritability of Resistance to Citrus Leprosis. Phytopathology 96, 1092-1096.
101
Bastianel, M., Freitas-Astúa, J., Kitajima, E. W. & Machado, M. A. (2006b). The citrus leprosis pathosystem. Summa Phytopathologica 32, 211-220.
Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones, S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E. L., Studholme, D. J., Yeats, C. & Eddy, S. R. (2004). The Pfam protein families database. Nucleic Acids Res 32, D138-141.
Bitancourt, A. A. (1937). Leprose e a próxima colheita. OBiológico 3, 37-40.
Brakke, M. K. (1990). Preparation of antigen: Viruses. In Serological Methods for detection and identification of viral and bacterial plant pathogens: A laboratory manual, pp. 15-26. Edited by R. Hampton, E. Ball & S. De Boer. St. Paul, Minnesota, USA: APS Press.
Brigneti, G., Voinnet, O., Li, W. X., Ji, L. H., Ding, S. W. & Baulcombe, D. C. (1998). Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. The EMBO journal 17, 6739-6746.
Brown, A.E. 2005. Mode of Action of Landscape Insecticides and Miticides Pesticide Information Leaflet No. 42. Department of Entomology. Maryland Cooperative Extension. University of Maryland. http://www.entmclasses.umd.edu/peap/leaflets/pil42.pdf. Accessed on November 2nd, 2007
Buck, K. W. (1996). Comparison of the replication of positive-stranded RNA viruses of plants and animals. Adv Virus Res 47, 159-251.
Bugl, H., Fauman, E. B., Staker, B. L., Zheng, F., Kushner, S. R., Saper, M. A., Bardwell, J. C. & Jakob, U. (2000). RNA methylation under heat shock control. Mol Cell 6, 349-360.
Bustamante, P. I. & Hull, R. 1998. Plant virus gene expression strategies. Electron. J. Biotechnol. 1, 13-24. ISSN 0717-3458. Available at http://www.scielo.cl/scielo.php?script=sci_arttext&pid=S0717-34581998000200003&lng=es&nrm=iso. Accessed on November 4th 2007
Campos, F. J. & Omoto, C. (2002). Resistance to hexythiazox in Brevipalpus phoenicis (Acari: Tenuipalpidae) from Brazilian citrus. Experimental & applied acarology 26, 243-251.
Campos, F. J. & Omoto, C. (2006). Stability of Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae) resistance to hexythiazox in citrus groves. Neotrop Entomol 35, 840-848.
Canto, T., Prior, D. A., Hellwald, K. H., Oparka, K. J. & Palukaitis, P. (1997). Characterization of cucumber mosaic virus. IV. Movement protein and coat protein are both essential for cell-to-cell movement of cucumber mosaic virus. Virology 237, 237-248.
Chagas, C. M., Kitajima, E. W. & Rodrigues, J. C. (2003). Coffee ringspot virus vectored by Brevipalpus phoenicis (Acari: Tenuipalpidae) in coffee. Experimental & applied acarology 30, 203-213.
102
Chagas, C. M. & Rossetti, V. (1980). Transmission Of Citrus Leprosis By Insertion Of Infected Leaf Tissue On Green Stems. Fitopatologia Brasileira 5, 211-214.
Chagas, C. M. & Rossetti, V. (1984). Transmission of leprosis by grafting. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists, pp. 215-217. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside CA, USA.
Chagas, C. M., Rossetti, V. & Chiavegato, L. G. (1984). Effectiveness of the life cycle stages of Brevipalpus phoenicis Geijskes in leprosis transmission. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists, pp. 211-214. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside, CA, USA.
Chang, C. J., M. Garnier, L. Zreik, V. Rossetti, & J. M. Bové. 1993. Culture and serological detection of the xylem-limited bacterium causing citrus variegated chlorosis and its identification as a strain of Xylella fastidiosa. Curr. Microbiol. 27:137-142.
Chen, T. Y., French, J. V., Liu, T. X. & Da Graça, J. V. (2006). Predation of Galendromus helveolus (Acari: Phytoseiidae) on Brevipalpus californicus (Acari: Tenuipalpidae). Biocontrol Science and Technology 16, 753-759.
Chiavegato, L. G., Pereira, G. M. d. & Pavarini, R. (1997). Avaliação das diferentes fases de desenvolvimento de Brevipalpus phoenicis (Geijskes, 1939) (Acari: tenuipalpidae) na transmissão da leprose em plantas cítricas. Cientifica 25, 307-315.
Chiavegato, L. G. & Salibe, A. A. (1984). Transmissibility of leprosis symptoms by Brevipalpus phoenicis into young citrus plants under laboratory conditions. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists, pp. 218-221. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside, CA, USA: IOCV-UCR.
Childers, C. C. (1994). Feeding injury to “Robinson” tangerine leaves by Brevipalpus mites (Acarina: Tenuipalpidae) in Florida and evaluation of chemical control on citrus. Florida Entomologist 77, 265-271.
Childers, C. C., French, J. V. & Rodrigues, J. C. (2003a). Brevipalpus californicus, B. obovatus, B. phoenicis, and B. lewisi (Acari: Tenuipalpidae): a review of their biology, feeding injury and economic importance. Experimental & applied acarology 30, 5-28.
Childers, C. C., Kitajima, E. W., Welbourn, W. C., Rivera, C. & Ochoa, R. (2001a). Brevipalpus mites on citrus and their status as vectors of citrus leprosis. Manejo Integrado de Plagas 60, 66-70.
Childers, C. C. & Rodrigues, J. C. (2005). Potential pest mite species collected on ornamental plants from Central America at port of entry to the United States. Florida Entomologist 88, 408-414.
Childers, C. C., Rodrigues, J. C., Derrick, K. S., Achor, D. S., French, J. V., Welbourn, W. C., Ochoa, R. & Kitajima, E. W. (2003b). Citrus leprosis and its status in Florida and Texas: past and present. Experimental & applied acarology 30, 181-202.
103
Childers, C. C., Rodrigues, J. C., Kitajima, E. W., Derrick, K. S., Rivera, C. & Welbourn, W. C. (2001b). A control strategy for breaking the virus-vector cycle of Brevipalpus spp. and the Rhabdovirus disease, citrus leprosis. Manejo Integrado de Plagas 60, 76-79.
Childers, C. C., Rodrigues, J. C. & Welbourn, W. C. (2003c). Host plants of Brevipalpus californicus, B. obovatus, and B. phoenicis (Acari: Tenuipalpidae) and their potential involvement in the spread of viral diseases vectored by these mites. Experimental & applied acarology 30, 29-105.
Clark, M. F. & Adams, A. N. (1977). Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. The Journal of general virology 34, 475-483.
Colariccio, A., Lovisolo, O., Boccardo, G., Chagas, C. M., d'Alquilo, M. & Rossetti, V. (2000). Preliminary purification and double stranded RNA analysis of Citrus leprosis virus. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists, pp. 159-163. Edited by J. V. da Graça, R. F. Lee & R. K. Yokomi. Campinas, São Paulo, Brazil: IOCV-UCR.
Colariccio, A., Lovisolo, O., Chagas, C. M. & Galleti, S. R. (1995). Mechanical transmission and ultrastructural aspects of citrus leprosis disease. Fitopatologia brasileira 20, 208.
Contraloría General de la República de Panamá. Dirección de Estadística y censo. 2003. Sexto Censo Nacional Agropecuario. Avaliable at http://www.contraloria.gob.pa/dec/ (Accessed on 08/27/2007)
De Andrade-Maia, O. M. & Leite De Oliveira, C. A. (2005). Transmissibilidade do virus da leprose de cercas-vivas, quebra-ventos e plantas daninhas para laranjeiras atraves de Brevipalpus phoenicis (Geijskes). Bragantia 64, 417-422
Denmark, H. A. (1984). Brevipalpus mites found on Florida citrus (Acarina: Tenuipalpidae). Florida, Dept Agric & Consumer Services, Division of Plant Industry Entomol Circ 69.
Ding, S. W., Li, H., Lu, R., Li, F. & Li, W. X. (2004). RNA silencing: a conserved antiviral immunity of plants and animals. Virus research 102, 109-115.
Damayanti, T. A., Nagano, H., Mise, K., Furusawa, I. & Okuno, T. (1999). Brome mosaic virus defective RNAs generated during infection of barley plants. J Gen Virol 80 ( Pt 9), 2511-2518.
Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness for survival. Annu Rev Microbiol 51, 151-178.
Dominguez, F. A., Bernal, J. A., Childers, C. C. & Kitajima, E. W. (2001). First report of citrus leprosis virus in Panama. Plant Dis 85, 228.
Dreher, T. W. (1999). Functions of the 3'-untranslated segions of positive strand RNA viral genomes. Annu Rev Phytopathol 37, 151-174.
104
Dreher, T. W. & Miller, W. A. (2006). Translational control in positive strand RNA plant viruses. Virology 344, 185-197.
Duggal, R., Lahser, F. C. & Hall, T. C. (1994). cis-Acting sequences in the replication of plant viruses with plus-sense RNA genomes. . Annu Rev Phytopathol 32, 287-309.
Erny, C., Schoumacher, F., Jung, C., Gagey, M. J., Godefroy-Colburn, T., Stussi-Garaud, C. & Berna, A. (1992). An N-proximal sequence of the alfalfa mosaic virus movement protein is necessary for association with cell walls in transgenic plants. The Journal of general virology 73 ( Pt 8), 2115-2119.
Fauquet, C. M., Mayo, M. A., Maniloff, J., Desselberger, U. & Ball, L. A., (eds) (2005). Virus Taxonomy: VIIIth Report of the International Committee on Taxonomy of Viruses. San Diego, CA: Elsevier Academic Press.
Fawcett, H. S. (1911). Scaly bark or nail-head rust of citrus. Bull. 106. In Fla Agric Exp Sta, p. 41. Gainesville, FL, USA.
Fawcett, H. S. & Lee, H. A. (1926). Citrus diseases and their control. . New York, USA: McGraw-Hill.
Fazeli, C. F. & Rezaian, M. A. (2000). Nucleotide sequence and organization of ten open reading frames in the genome of grapevine leafroll-associated virus 1 and identification of three subgenomic RNAs. J Gen Virol 81, 605-615.
Finn, R. D., Marshall, M. & Bateman, A. (2005). iPfam: visualization of protein-protein interactions in PDB at domain and amino acid resolutions. Bioinformatics 21, 410-412.
Florida Agricultural Statistics Service. 2003. Citrus 2002-03 summary: Production, price, and value production by counties and per tree. Online version at http://www.nass.usda.gov/Statistics_by_State/Florida/index.asp (Last accessed, August 29th, 2007) 8pp.
Florida Department of Agricultures and Consumer Services (FDACS); and the United States Department of Agriculture. 2003. Florida Agricultural Fast Facts: 2003 Directory. Online version at http://www.florida-agriculture.com/pubs/agfacts.htm (Last accessed, March 29, 2004) 170pp.
Florida Department of Citrus. 2003. Florida citrus economic indicators. Economic and market research department. Lakeland, FL, USA 168pp.
Food and Agricultural Organization of the United Nations (FAO). 2006. Economic and Social Department. The Statistics Division. Major food and agricultural commodities and producers. http://www.fao.org/es/ess/top/country.html?lang=en&country=166&year=2005. Last accessed on October 31st, 2007.
French, J. V. & Rakha, M. A. (1994b). False spider mite: damage and control on Texas citrus. Subtropical Plant Sci 46, 16-19.
105
Frezzi, M. J. (1940). “Lepra explosiva” of orange. Studies in the pathology laboratory of Bella Vista (Corrientes). Frutas y Hortalizas 5, 1-15.
Frolov, I., Hardy, R. & Rice, C. M. (2001). Cis-acting RNA elements at the 5' end of Sindbis virus genome RNA regulate minus- and plus-strand RNA synthesis. Rna 7, 1638-1651.
Gomez de Cedron, M., Ehsani, N., Mikkola, M. L., Garcia, J. A. & Kaariainen, L. (1999). RNA helicase activity of Semliki Forest virus replicase protein NSP2. FEBS Lett 448, 19-22.
Gómez, E. C., Vargas, M. R., Rivadameira, C., Locali, E. C., Freitas-Astua, J., Astua-Monge, G., Rodrigues, J. C. V., Mesa-Cobo, N. C. & Kitajima, E. W. (2005). First report of Citrus leprosis virus on citrus in Santa Cruz, Bolivia. Plant Dis 89, 686.
González, R. H. (1975). Revision of the Brevipalpus phoenicis “complex” with descriptions of new species from Chile and Thailand (Acarina: Tenuilpalpidae). Acarologia 17, 81-91.
Gorchakov, R., Hardy, R., Rice, C. M. & Frolov, I. (2004). Selection of functional 5' cis-acting elements promoting efficient sindbis virus genome replication. J Virol 78, 61-75.
Gottwald, T.R.; Hughes; G.; Graham, J.H.; Sun, X. & Riley, T. (2001). The citrus canker epidemic in Florida: The scientific basis of regulatory eradication policy for an invasive species. Phytopathology 91, 30-34
Graham, J. H.; Gottwald, T. R.; J. Cubero, J.; & Achor, D. S. (2004). Xanthomonas axonopodis pv. citri: factors affecting successful eradication of citrus canker. Molecular Plant Pathology 5, 1-15.
Gravena, S., Benvenga, S. R., Souza amorim, L. C., da Silva, J. L. & Araujo junior, N. (2005). Manejo prático da resistência do ácaro-da-leprose dos citros. Laranja 25, 11-24.
Graves, M. V. & Roossinck, M. J. (1995). Characterization of defective RNAs derived from RNA 3 of the Fny strain of cucumber mosaic cucumovirus. J Virol 69, 4746-4751.
Guerra-Moreno, A.-S., Manjunath, K.-L., Brlansky, R.-H., Howd, D., Fernandez, O. & Lee, R.-F. (2003). Characterization of citrus leprosis virus from Panama. Phytopathology 93, S30.
Guerra-Moreno, A. S. (2004). Partial molecular characterization and development of a rapid diagnostic method for Citrus leprosis virus (CILV) from Panama. In Plant Pathology, p. 80. Gainesville, FL, USA: University of Florida.
Guerra-Moreno, A. S., Manjunath, K. L., Brlansky, R. H., Howd, D. & Lee, R. F. (2004). Ultrastructural and molecular characterization of Citrus leprosis virus indicates possible association of two distinct viruses. Phytopathology 94, S37.
106
Guerra-Moreno, A. S., Manjunath, K. L., Brlansky, R. H. & Lee, R. F. (2005a). Citrus leprosis symptoms can be associated with the presence of two different viruses: cytoplasmic and nuclear, the former having a multipartite RNA genome. In Proceedings of the 16th Conference of the International Organization of Citrus Virologists, pp. 230-239. Edited by M. E. Hilf, N. duran-Villa & M. A. Rocha-Peña. Monterrey, Mexico: IOCV-UCR.
Guerra-Moreno, A. S., Manjunath, K. L., Lee, R. F. & Brlansky, R. H. (2005b). Citrus leprosis disease is associated with a bipartite positive-sense RNA virus. In XLV Annual Meeting of the American Phytopathological Society, Caribbean Division. San Jose, Costa Rica.
Guirado, N., Nogueira, N. L., Ambrosano, E. J. & Francozo, M. (2001). Efeito de extratos vegetais na atividade vetora de Brevipalpus phoenicis. Summa Phytopathologica 27, 343-347.
Halbert, S. E.; Genc, H., Cevik, B.; Brown, L. G.; Rosales, I. M.; Manjunath, K. L.; Pomerinke, M.; Davison, D. A.; Lee, R. F. & Niblett, C. L. (2004). Distribution and characterization of Citrus tristeza virus in south Florida following stablishment of Toxoptera citricida. Plant Dis 88, 935-941.
Halbert, S. E. & Manjunath, K. L. (2004). Asian citrus pysllids (Sternorrhycha:Psyllidae) and greening disease of citrus: a literature review and assessment of risk in Florida. Fla Entomol 87 330-353.
Hamilton, W. D., Boccara, M., Robinson, D. J. & Baulcombe, D. C. (1987). The complete nucleotide sequence of tobacco rattle virus RNA-1. J Gen Virol 68 ( Pt 10), 2563-2575.
Hampton, R., Ball, E. & De Boer, S. (1990). Serological Methods for detection and identification of viral and bacterial plant pathogens: A laboratory manual. St. Paul, Minnesota, USA: APS Press.
Haramoto, F. H. (1969). Biology and control of Brevipalpus phoenicis (Geijskes) (Acarina: Tenuilpalpidae). Hawaii Agric Exp Sta Tech Bull 68.
Hardy, R. W. & Rice, C. M. (2005). Requirements at the 3' end of the sindbis virus genome for efficient synthesis of minus-strand RNA. J Virol 79, 4630-4639.
Helguera, M., Bravo-Almonacid, F., Kobayashi, K., Rabinowicz, P. D., Conci, V. & Mentaberry, A. (1997). Immunological detection of a GarV-type virus in Argentine garlic cultivars. Plant Dis 81, 1005-1010.
Hernandez, C., Carette, J. E., Brown, D. J. & Bol, J. F. (1996). Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and nonstructural genes in RNA 2. J Virol 70, 4933-4940.
107
Hilf, M. E., Karasev, A. V., Pappu, H. R., Gumpf, D. J., Niblett, C. L. & Garnsey, S. M. (1995). Characterization of citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208, 576-582.
Holland, J. & Domingo, E. (1998). Origin and evolution of viruses. Virus Genes 16, 13-21.
Holland, J., Spindler, K., Horodyski, F., Grabau, E., Nichol, S. & VandePol, S. (1982). Rapid evolution of RNA genomes. Science (New York, NY 215, 1577-1585.
Ivanov, P. A., Karpova, O. V., Skulachev, M. V., Tomashevskaya, O. L., Rodionova, N. P., Dorokhov Yu, L. & Atabekov, J. G. (1997). A tobamovirus genome that contains an internal ribosome entry site functional in vitro. Virology 232, 32-43.
Jacobson, A. & Peltz, S. W. (1996). Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu Rev Biochem 65, 693-739.
Kaariainen, L. & Ahola, T. (2002). Functions of alphavirus nonstructural proteins in RNA replication. Prog Nucleic Acid Res Mol Biol 71, 187-222.
Karasev, A. V. (2000). Genetic Diversity And Evolution Of Closteroviruses. Annu Rev Phytopathol 38, 293-324.
Karasev, A. V., Nikolaeva, O. V., Mushegian, A. R., Lee, R. F. & Dawson, W. O. (1996). Organization of the 3'-terminal half of beet yellow stunt virus genome and implications for the evolution of closteroviruses. Virology 221, 199-207.
Kitajima, E. W., Chagas, C. M. & Rodrigues, J. C. (2003a). Brevipalpus-transmitted plant virus and virus-like diseases: cytopathology and some recent cases. Experimental & applied acarology 30, 135-160.
Kitajima, E. W., Muller, G. W., Costa, A. S. & Yuki, W. (1972). Short, rod-like particles associated with Citrus leprosis. Virology 50, 254-258.
Kitajima, E. W., Rezende, J. A. & Rodrigues, J. C. (2003b). Passion fruit green spot virus vectored by Brevipalpus phoenicis (Acari: Tenuipalpidae) on passion fruit in Brazil. Experimental & Applied Acarology 30, 225-231.
Kitajima, E. W., Rodrigues, J. C. V., de Moraes, G. J. & Childers, C. C. (2000). Brevipalpus mite-borne viruses. Virus Review & Research 5, 44-45.
Kitajima, E. W., Rosillo, M., Portillo, M.M., Muller, G.W. & Costa, A.S. (1974). Microscopia electronica de tejidos foliares de laranjeira infetadas pela lepra explosiva da Argentina. Fitopatologia (Peru) 9, 55-56.
Knorr, L. C. (1968). Studies on the etiology of leprosis in citrus. In Proceedings of the 4th Conference of the International Organization of Citrus Virologists, pp. 332-340. Edited by J. F. L. Childs. Gainesville, FL, USA.: University of Florida Pres.
108
Knorr, L. C. (1973). Citrus diseases and disorders: an alphabetized compendium with particular reference to Florida. Gainesville, Fl, USA: University of Florida Press.
Knorr, L. C., Denmark, H.A., & Burnett HC. (1968). Occurrence of Brevipalpus mites, leprosis and false leprosis on citrus in Florida. Florida Entomologist 51, 11-17.
Knorr, L. C. & Price, W. C. (1958). Leprosis. In Florida guide to citrus diseases, and nutritional disorders in color, pp. 112-113. Edited by R. M. Pratt. Florida, USA: Agricultural Experiment Station.
Kondo, H., Maeda, T., Shirako, Y. & Tamada, T. (2006). Orchid fleck virus is a rhabdovirus with an unusual bipartite genome. J Gen Virol 87, 2413-2421.
Kondo, H., Maeda, T. & Tamada, T. (2003). Orchid fleck virus: Brevipalpus californicus mite transmission, biological properties and genome structure. Experimental & applied acarology 30, 215-223.
Kondo, H., Maeda, T., Tamada, T., & Shirako, Y. (1998). The genome structure of Orchid fleck virus shows it to be a unique bipartite genome virus that resembles rhabdoviruses. In Abstr 7th Int Congr Plant Pathology, p. 1.11.81. Edinburgh, Scotland.
Koonin, E. V. (1993). Computer-assisted identification of a putative methyltransferase domain in NS5 protein of flaviviruses and lambda 2 protein of reovirus. J Gen Virol 74 ( Pt 4), 733-740.
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Crit Rev Biochem Mol Biol 28, 375-430.
Kreuze, J. F., Savenkov, E. I. & Valkonen, J. P. (2002). Complete genome sequence and analyses of the subgenomic RNAs of sweet potato chlorotic stunt virus reveal several new features for the genus Crinivirus. J Virol 76, 9260-9270.
Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. Journal of molecular biology 305, 567-580.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.
Leon M., G. A., Realpe, C. E. & Garzon, P. A. (2006). Occurrence of Citrus leprosis virus in Llanos Orientales, Colombia. Plant Dis 90, 682.
Li, F. & Ding, S. W. (2006). Virus counterdefense: diverse strategies for evading the RNA-silencing immunity. Annual review of microbiology 60, 503-531.
109
Li, W., Hartung, J. S. & Levy, L. (2006). Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. Journal of microbiological methods 66, 104-115.
Li, X. H., Heaton, L. A., Morris, T. J. & Simon, A. E. (1989). Turnip crinkle virus defective interfering RNAs intensify viral symptoms and are generated de novo. Proc Natl Acad Sci U S A 86, 9173-9177.
Livieratos, I. C., Avgelis, A. D. & Coutts, R. H. A. (1999). Molecular characterization of the Cucurbit yellow stunting disorder virus coat protein gene. Phytopathology 89, 1030-1035.
Locali-Fabris, E. C., Freitas-Astua, J., Souza, A. A., Takita, M. A., Astua-Monge, G., Antonioli-Luizon, R., Rodrigues, V., Targon, M. L. & Machado, M. A. (2006). Complete nucleotide sequence, genomic organization and phylogenetic analysis of Citrus leprosis virus cytoplasmic type. J Gen Virol 87, 2721-2729.
Locali, E. C., Freitas-Astua, J., Alves de Souza, A., Takita, M. A., Astua-Monge, G., Antonioli, R., Kitajima, E. W. & Machado, M. A. (2003). Development of a Molecular Tool for the Diagnosis of Leprosis, a Major Threat to Citrus Production in the Americas. Plant Dis 87, 1317-1321.
Lovisolo, O. (2001). Citrus leprosis virus: Properties, diagnosis, agro-ecology and phytosanitary importance. Bulletin OEPP 31, 79-89.
Lovisolo, O., Colariccio, A., Chagas, C. M., Rossetti, V., Kitajima, E. W. & Harakava, R. (1996). Partial purification of Citrus leprosis virus. In Proceedings of the 9th Conference of the International Organization of Citrus Virologists, pp. 179-183. Edited by S. M. Garnsey, L. W. Timmer & J. A. Dodds. Riverside, CA, USA: IOCV-UCR.
Lovisolo, O., Colariccio, A. & Masenga, V. (2000). New experimental host and further information on Citrus leprosis virus. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists, pp. 164-173. Edited by J. V. da Graça, R. F. Lee & R. K. Yokomi. Campinas, São Paulo, Brazil: IOCV-UCR.
Lu, R., Folimonov, A., Shintaku, M., Li, W. X., Falk, B. W., Dawson, W. O. & Ding, S. W. (2004). Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome. Proceedings of the National Academy of Sciences of the United States of America 101, 15742-15747.
Lutcke, H. A., Chow, K. C., Mickel, F. S., Moss, K. A., Kern, H. F. & Scheele, G. A. (1987). Selection of AUG initiation codons differs in plants and animals. Embo J 6, 43-48.
Makarova, K. S., Aravind, L., Galperin, M. Y., Grishin, N. V., Tatusov, R. L., Wolf, Y. I. & Koonin, E. V. (1999). Comparative genomics of the Archaea (Euryarchaeota): evolution of conserved protein families, the stable core, and the variable shell. Genome Res 9, 608-628.
110
Makarova, K. S., Aravind, L. & Koonin, E. V. (2000). A novel superfamily of predicted cysteine proteases from eukaryotes, viruses and Chlamydia pneumoniae. Trends Biochem Sci 25, 50-52.
Mathews, D. H., Sabina, J., Zuker, M. & Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288, 911-940.
Matzura, O. & Wennborg, A. (1996). RNAdraw: an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft Windows. Comput Appl Biosci 12, 247-249.
Mawassi, M.; Mietkiewska,E.; Hilf, Mark.; Ashoulin, L.; Karasev, A. V.; gafny,R.; Lee, R. F.; Garnsey, S. M.; Dawson, W. & Bar-Joseph, M. (1995). Multiple species of defective RNAs in plants infected with Citrus tristeza virus. Virology 214, 264-268
Melzer, M. J., Karasev, A. V., Sether, D. M. & Hu, J. S. (2001). Nucleotide sequence, genome organization and phylogenetic analysis of pineapple mealybug wilt-associated virus-2. J Gen Virol 82, 1-7.
Merits, A., Kettunen, R., Makinen, K., Lampio, A., Auvinen, P., Kaariainen, L. & Ahola, T. (1999). Virus-specific capping of tobacco mosaic virus RNA: methylation of GTP prior to formation of covalent complex p126-m7GMP. FEBS Lett 455, 45-48.
Meza Guerrero, C. (2003). Informe: Resultados del muestreo regional de leprosis de los cítricos. , p. 43. Costa Rica: Organismo Internacional Regional de Sanidad Agropecuaria (OIRSA).
Miller, W. A. & Koev, G. (2000). Synthesis of subgenomic RNAs by positive-strand RNA viruses. Virology 273, 1-8.
Ministerio de Desarrollo Agropecuario (MIDA). 2000. Acciones de diagnóstico, vigilancia, campaña e investigación orientados a la erradicación de la “Leprosis de los Cítricos” en la República de Panamá. MIDA. Panama. 16pp
Moller, S., Croning, M. D. & Apweiler, R. (2001). Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics (Oxford, England) 17, 646-653.
Monis, J. & Bestwick, R. K. (1997). Serological detection of grapevine associated closteroviruses in infected grapevine cultivars. Plant Dis 81, 802-808.
Morris, T. J. & Dodds, J. A. (1979). Isolation and analysis of double strand RNA from virus infected plant and fungal tissue. Phytopathology 69, 854-858.
Musumeci, M. R. & Rossetti, V. (1963). Transmissao dos sintomas de leprose dos citros pelo acaro Brevipalpus phoenicis. Ciencia e Cultura 15, 228.
111
Nagy, P. D. & Simon, A. E. (1997). New insights into the mechanisms of RNA recombination. Virology 235, 1-9.
Nicholas, K. B. & Nicholas, H. B. (1997). GeneDoc: A tool for editing and annotating multiple sequence alignments.: Distributed by the author http://www.psc.edu/biomed/genedoc.
Nogueira, N. d., Rodrigues, J. C. V., Cabral, C. P. & Prates, H. S. (1996). Influence of citrus leprosis on the mineral composition of Citrus sinensis leaves. Sci Agric 53, 2-3.
Nogueira, N. L., Rodrigues, J. C. V. & Rossi, M. L. (2003). Particulas semelhantes a rhabdovirus em tres especies ornamentais apresentando lesoes locais e presenca do acaro Brevipalpus. Summa Phytopathologica 29 278-282.
Ochoa, R., Aguilar, H. & Vargas, C. (1994). Phytophagous mites of Central America: an illustrated guide. Turrialba, Costa Rica: CATIE.
Omoto, C. (1998). Acaricide resistance management of leprosis mite (Brevipalpus phoenicis) in Brazilian citrus. Pesticide Science 52, 189-198.
Omoto, C., Alves, E. B., Konno, R. H. & Campos, F. J. (2003 ). Management of Brevipalpus phoenicis (Acari: Tenuipalpidae) resistance to acaracides in Brazilian citrus. In International Society of Citriculture IX Congress, p. 771.
Palmieri, M., Donis, I., Salazar, A. L., Blanco, S., Porres, M., Brlansky, R. H., Guerra-Moreno, A. S., Manjunath, K. L. & Lee, R. F. (2005). Leprosis in Guatemala. In Proceedings of the 16th Conference of the International Organization of Citrus Virologists, p. 510. Edited by M. E. Hilf, N. Duran-Villa & M. A. Rocha-Peña. Monterrey, Mexico: IOCV-UCR.
Pascon, R. C., Kitajima, J. P., Breton, M. C., Assumpcao, L., Greggio, C., Zanca, A. S., Okura, V. K., Alegria, M. C., Camargo, M. E., Silva, G. G., Cardozo, J. C., Vallim, M. A., Franco, S. F., Silva, V. H., Jordao, H., Jr., Oliveira, F., Giachetto, P. F., Ferrari, F., Aguilar-Vildoso, C. I., Franchiscini, F. J., Silva, J. M., Arruda, P., Ferro, J. A., Reinach, F. & da Silva, A. C. (2006). The complete nucleotide sequence and genomic organization of Citrus Leprosis associated Virus, Cytoplasmatic type (CiLV-C). Virus Genes 32, 289-298.
Perrault, J. (1981). Origin and replication of defective interfering particles. Curr Top Microbiol Immunol 93, 151-207.
Pogany, J., Romero, J., Huang, Q., Sgro, J. Y., Shang, H. & Bujarski, J. J. (1995). De novo generation of defective interfering-like RNAs in broad bean mottle bromovirus. Virology 212, 574-586.
112
Rangel, E., Manjunath, K. L., Guerra-Moreno, A. S., Brlansky, R. H. & Lee, R. F. (2005). Bacterial Expression and Purification of a protein from Citrus leprosis virus. In Proceedings of the 16th Conference of the International Organization of Citrus Virologists, pp. 510-511. Edited by M. E. Hilf, N. Duran-Villa & M. A. Rocha-Peña. Monterrey, Mexico: IOCV-UCR.
Reis, P. R., Sousa, E. O., Teodoro, A. V. I. & Pedro-Neto, M. (2003). Effect of prey density on the functional and numerical responses of two species of predaceous mites (Acari: Phytoseiidae). Neotropical Entomology 32, 461-467.
Rhoads, A. S. & DeBusk, E. F. (1931). Diseases of citrus in Florida. University of Florida Agricultural Experiment Station Bulletin 229, 84-91, 208-211.
Rodrigues, J. C., Kitajima, E. W., Childers, C. C. & Chagas, C. M. (2003). Citrus leprosis virus vectored by Brevipalpus phoenicis (Acari: Tenuipalpidae) on citrus in Brazil. Experimental & applied acarology 30, 161-179.
Rodrigues, J. C. V. ( 2000). Relações patogeno-vector-planta no sitema leprose dos citrus. In Centro de Energia Nuclear na Agricultura p. 168. Piracicaba, Brasil da Universidade de São Paulo. Brazil.
Rodrigues, J. C. V., Locali, E. C., Freitas-Astua, J. & Kitajima, E. W. (2005). Transmissibility of Citrus leprosis virus by Brevipalpus phoenicis to Solanum violaefolium Plant Disease 89, 911.
Rodrigues, J. C. V. & Machado, M. A. (2000). Virus-Brevipalpus-plant relationships of the citrus leprosis pathosystem. In Proceedings of the International Society of Citriculture,, pp. 768-770. Orlando, FL, USA.
Rodrigues, J. C. V., Machado, M. A., Kitajima, E. W. & Muller, G. W. (2000). Transmission of citrus leprosis virus by Brevipalpus phoenicis (Acari: Tenuipalpidae). In Proceedings of the 14th Conference of the International Organization of Citrus Virologists, pp. 174-178. Edited by J. V. da Graça, R. F. Lee & R. K. Yokomi. Campinas, São Paulo, Brazil: IOCV-UCR.
Rodrigues, J. C. V., Nogueira, N. L., Freitas, D. S. & Prates, H. S. (1997). Virus-like particles associated with Brevipalpus phoenicis Geijskes (Acari: Tenuipalpidae), vector of citrus leprosis virus. An Soc Entomol Brazil 26, 391-395.
Rodrigues, J. C. V., Zuniga-Reyes, J. A., Achor, D. S., Childers, C. C. & Kitajima, E. W. (2007). Occurrence and distribution of Citrus leprosis virus in Honduras. Plant Pathology 56, 344.
Rodriguez, O. & Romano-Gallo, J. (1968). The influence of viruses on the mineral composition of citrus leaves. In Proceedings of the 4th Conference of the International Organization of Citrus Virologists, pp. 307-341. Edited by J. F. L. Childs. Gainesville, FL, USA: University of Florida Press.
113
Rosner, A., Lee, R.F. & Bar-Joseph, M. (1986) Differential hybridization with cloned cDNA sequences for detecting a specific isolate of Citrus tristeza virus. Phytopathology 76: 820-824
Rossetti, V. (1980). Diferenciação entre o cancro cítrico e outras moléstias. Citrus 1, 23-26.
Rossetti, V. (1996). Transmission of Citrus leprosis virus (CiLV)-a review. In Procedings of the 13th Conference of the International Organization of Citrus Virologists, pp. 331-335. Edited by J. V. Da Graça, P. Moreno & R. K. Yokomi. Riverside, CA, USA: IOCV-UCR.
Rossetti, V. (2001). Manual ilustrado do doenças dos citros. Piracicaba, Brazil: Fealq/Fundecitrus.
Rossi-Zalaf, L. S. & Alves, S. B. (2006). Susceptibility of Brevipalpus phoenicis to entomopathogenic fungi. Experimental & applied acarology 40, 37-47.
Roux, L., Simon, A. E. & Holland, J. J. (1991). Effects of defective interfering viruses on virus replication and pathogenesis in vitro and in vivo. Adv Virus Res 40, 181-211.
Rozanov, M. N., Koonin, E. V. & Gorbalenya, A. E. (1992). Conservation of the putative methyltransferase domain: a hallmark of the 'Sindbis-like' supergroup of positive-strand RNA viruses. J Gen Virol 73 ( Pt 8), 2129-2134.
Rubinson, E., Galiakparov, N., Radian, S., Sela, I., Tanne, E. & Gafny, R. (1997). Serological Detection of Grapevine Virus A Using Antiserum to a Nonstructural Protein, the Putative Movement Protein. Phytopathology 87, 1041-1045.
Rubio, L., Yeh, H. H., Tian, T. & Falk, B. W. (2000). A heterogeneous population of defective RNAs is associated with lettuce infectious yellows virus. Virology 271, 205-212.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular cloning: A laboratory manual. Second edition. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press.
Sánchez-Anguiano, H. (2005). Detection of Citrus leprosis virus in the State of Chiapas, Mexico: http://www.pestalert.org/notifications.cfm?region=Mexico#16. (Last accessed, August 25, 2007).
Sasaya, T., Ishikawa, K. & Koganezawa, H. (2001). Nucleotide sequence of the coat protein gene of Lettuce big-vein virus. J Gen Virol 82, 1509-1515.
Sasaya, T., Ishikawa, K. & Koganezawa, H. (2002). The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses. Virology 297, 289-297.
Sasaya, T., Kusaba, S., Ishikawa, K. & Koganezawa, H. (2004). Nucleotide sequence of RNA2 of Lettuce big-vein virus and evidence for a possible transcription termination/initiation strategy similar to that of rhabdoviruses. J Gen Virol 85, 2709-2717.
114
Savenkov, E. I., Solovyev, A. G. & Morozov, S. (1998). Genome sequences of poa semilatent and lychnis ringspot hordeiviruses. Arch Virol 143, 1379-1393.
Schagger, H., Aquila, H. & Von Jagow, G. (1988). Coomassie blue-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for direct visualization of polypeptides during electrophoresis. Analytical biochemistry 173, 201-205.
Shirako, Y., Suzuki, N. & French, R. C. (2000). Similarity and divergence among viruses in the genus Furovirus. Virology 270, 201-207.
Skulachev, M. V., Ivanov, P. A., Karpova, O. V., Korpela, T., Rodionova, N. P., Dorokhov, Y. L. & Atabekov, J. G. (1999). Internal initiation of translation directed by the 5'-untranslated region of the tobamovirus subgenomic RNA I(2). Virology 263, 139-154.
Steinhauer, W. R., Walsh, R. C. & Kalfayan, L. J. (1989). Sequence and structure of the Drosophila melanogaster ovarian tumor gene and generation of an antibody specific for the ovarian tumor protein. Mol Cell Biol 9, 5726-5732.
Teodoro, A. V. & Reis, P. R. (2006). Reproductive performance of the mite Brevipalpus phoenicis (Geijskes, 1939) on citrus and coffee, using life table parameters. Braz J Biol 66, 899-905.
Teodoro, A. V. I. & Reis, P. R. (2004). Reproductive performance of the mite Brevipalpus phoenicis (Geijskes, 1939) on citrus and coffee, using life table parameters. Brazilian Journal of Biology 66, 34-43.
Thivierge, K., Nicaise, V., Dufresne, P. J., Cotton, S., Laliberte, J. F., Le Gall, O. & Fortin, M. G. (2005). Plant virus RNAs. Coordinated recruitment of conserved host functions by (+) ssRNA viruses during early infection events. Plant Physiol 138, 1822-1827.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876-4882.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680.
Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences of the United States of America 76, 4350-4354.
United Nations Conference on Trade and Development (UNCTAD). 2005. Market information in the commodities area: Citrus Fruits. http://r0.unctad.org/infocomm/anglais/orange/market.htm. Last accessed on October 25th, 2007.
115
United States Department of Agriculture. 2003. Citrus fruits 2003 Summary: September 2003. National Agricultural Statistics Service. NASS, USDA 7pp.
United States Department of Agriculture (USDA). Foreign Agricultural Service Horticultural & Tropical Products Division. 2004. The U.S. and World Situation: Citrus. http://www.fas.usda.gov/htp/horticulture/citrus/2004%20Citrus.pdf. Last accessed on November 1st, 2007.
van Regenmortel, M. H. V., Fauquet, C..M.,. Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo M.A., McGeoch, D.J., Pringle, C.R., & Wickner, R.B. (2000). Virus Taxonomy: The Classification and Nomenclature of Viruses. The Seventh Report of the International Committee on Taxonomy of Viruses. San Diego, CA, USA: Academic Press.
van Rossum, C. M., Brederode, F. T., Neeleman, L. & Bol, J. F. (1997). Functional equivalence of common and unique sequences in the 3' untranslated regions of alfalfa mosaic virus RNAs 1, 2, and 3. J Virol 71, 3811-3816.
Ward, C. W. (1993). Progress towards a higher taxonomy of viruses. Res Virol 144, 419-453.
White, K. A., Bancroft, J. B. & Mackie, G. A. (1991). Defective RNAs of clover yellow mosaic virus encode nonstructural/coat protein fusion products. Virology 183, 479-486.
White, K. A. & Nagy, P. D. (2004). Advances in the Molecular Biology of Tombusviruses: Gene Expression, Genome Replication, and Recombination . Progress in Nucleic Acid Research and Molecular Biology 78, 187-226
Whiteside, J. O. (2000). Citrus trees and their fruit. In Compendium of Citrus Diseases, Second edn, p. 92. Edited by L. W. Timmer, S. M. Garnsey & G. J.H. St. Paul, MN.: APS Press
Wu, B. & White, K. A. (1998). Formation and amplification of a novel tombusvirus defective RNA which lacks the 5' nontranslated region of the viral genome. J Virol 72, 9897-9905.
Yang, G., Mawassi, M., Gofman, R., Gafny, R. & Bar-Joseph, M. (1997). Involvement of a subgenomic mRNA in the generation of a variable population of defective citrus tristeza virus molecules. J Virol 71, 9800-9802.
116
BIOGRAPHICAL SKETCH
Abby S. Guerra-Moreno was born and raised in Santiago City, Veraguas State, Republic of
Panama. The agriculture-related topics were his favorite classes in primary and junior high
school. He received his high school diploma, with the highest honors, from the Instituto Nacional
de Agricultura (INA) located in Divisa, Panama. He obtained his BS degree at the Universidad
de Panama in 2000, where he was the first of his class. He majored in agronomy engineering
with specialization in plant protection. After graduation, he was working at the Instituto de
Investigaciones Agropecuarias de Panama (IDIAP) where he was offered an opportunity to study
a non-degree seeking Master’s Program in Ecological Agriculture at the Centro Agronómico
Tropical de Investigación y Enseñanza (CATIE) in Costa Rica. Mr. Abby S. Guerra-Moreno
joined the Plant Pathology Department (PLP) at the University of Florida (UF) for pursuing
graduate studies in Spring 2002 and he obtained his M.Sc. degree in May 2004. Immediately,
after graduation, Mr. Guerra-Moreno was accepted into the PLP UF Ph.D. program, to work on
the molecular characterization and the development of molecular and serological diagnostic
methods for Cytoplasmic citrus leprosis virus (CCLV).
