Characterization of IntA, a Bidirectional Site-Specific RecombinaseRequired for Conjugative Transfer of the Symbiotic Plasmid ofRhizobium etli CFN42
Rogelio Hernández-Tamayo,a Christian Sohlenkamp,b José Luis Puente,c Susana Brom,a David Romeroa
Programas de Ingenería Genómica,a Ecología Genómica,b Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, México;Departamento de Microbiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos, Méxicoc
Site-specific recombination occurs at short specific sequences, mediated by the cognate recombinases. IntA is a recombinasefrom Rhizobium etli CFN42 and belongs to the tyrosine recombinase family. It allows cointegration of plasmid p42a and thesymbiotic plasmid via site-specific recombination between attachment regions (attA and attD) located in each replicon. Cointe-gration is needed for conjugative transfer of the symbiotic plasmid. To characterize this system, two plasmids harboring the cor-responding attachment sites and intA were constructed. Introduction of these plasmids into R. etli revealed IntA-dependent re-combination events occurring at high frequency. Interestingly, IntA promotes not only integration, but also excision events,albeit at a lower frequency. Thus, R. etli IntA appears to be a bidirectional recombinase. IntA was purified and used to set upelectrophoretic mobility shift assays with linear fragments containing attA and attD. IntA-dependent retarded complexes wereobserved only with fragments containing either attA or attD. Specific retarded complexes, as well as normal in vivo recombina-tion abilities, were seen even in derivatives harboring only a minimal attachment region (comprising the 5-bp central regionflanked by 9- to 11-bp inverted repeats). DNase I-footprinting assays with IntA revealed specific protection of these zones. Muta-tions that disrupt the integrity of the 9- to 11-bp inverted repeats abolish both specific binding and recombination ability, whilemutations in the 5-bp central region severely reduce both binding and recombination. These results show that IntA is a bidirec-tional recombinase that binds to att regions without requiring neighboring sequences as enhancers of recombination.
Site-specific recombinases are a set of DNA-breaking and -re-joining enzymes that play a pivotal role in bacterial genome
plasticity. All of them perform recombination between DNA seg-ments, independently of RecA, by recognizing and binding toshort (�50-bp) DNA sequences. Based on amino acid sequencealignments, the presence of characteristic amino acids in the activesite, and catalytic mechanisms, site-specific recombinases havebeen grouped into two families: the tyrosine family and the serinefamily. These two families are unrelated to each other, with differ-ent protein structures and reaction mechanisms (1). Most site-specific recombinases require additional host factors for efficientcatalysis.
The tyrosine recombinase family is the one most represented inbacterial genomes. A recent survey identified over 1,300 gene se-quences belonging to the family (2). Tyrosine recombinases cata-lyze recombination between substrates that share limited se-quence identity. The sequence identity usually extends over theshort strand exchange region and flanking recombinase-bindingsites (inverted repeats). DNA homology within the 6- to 8-bpregion between the strand cleavage sites, called the overlap, spacer,or crossover region, is critical for the recombination reaction inmost (3, 4), but not all (5), cases studied.
Members of the tyrosine recombinase family catalyze a varietyof sequence-specific DNA rearrangements in biological systems,including the integration and excision of phage genomes, such asthe phage � integrase (6), the yeast Flp recombinase (7), the phageP1 Cre recombinase (8, 9), and the Escherichia coli XerC/XerDrecombinases (10, 11), into and out of their bacterial hosts. Al-though the tyrosine recombinase family is the best understoodamong the recombinases, both structurally and biochemically, itis still difficult to predict the function (i.e., integration versus ex-
cision) based solely on the primary sequence. Moreover, it is astructurally diverse family, where over 56 subfamilies (containingat least four elements each) have been identified (2). Additionally,although tyrosine recombinases have been found in almost everysequenced bacterium, functional characterization has been con-centrated mostly in the Enterobacteriaceae.
For instance, in alphaproteobacteria, a very diverse and ecolog-ically important bacterial class, only two representatives of thetyrosine family and another from the serine family have beencharacterized. Among these, phage 16-3 is a temperate phage ofSinorhizobium meliloti 41 that integrates its genome with highefficiency into the host chromosome by site-specific recombina-tion between the attachment regions attB and attP using the ty-rosine recombinase Int (12). In Mesorhizobium loti R7A, integra-tion of the symbiosis island (an integrative conjugative element)into the Phe-tRNA gene is catalyzed by the tyrosine recombinaseIntS (13); interestingly, excision of the symbiosis island requires,besides IntS, the recombination directionality factor RdfS (13).For the serine family, a site-specific recombinase (RinQ) can befound as part of the plasmid multimer resolution system, whose
target site is a locus that participates in the incompatibility withp42d of Rhizobium etli (14).
R. etli CFN42 is a soil alphaproteobacterium able to inducenitrogen-fixing nodules on the roots of bean plants. The straincontains six plasmids (p42a to p42f), whose sizes range from 185to 643 kb. Plasmid p42d is the symbiotic plasmid (pSym), carryingmost of the information required for nodulation and nitrogenfixation; p42a is self-transmissible at high frequency and is indis-pensable for conjugative transfer of the pSym (15, 16, 17). Therequirement for p42a for conjugative transfer of the pSym in anotherwise wild-type strain was striking, given the existence on thepSym of a full traACDG-virB1-virB11 system functional for con-jugation (18, 19). This system, however, is kept transcriptionallysilent, under all conditions tested, by the action of the strong re-pressor RctA (19, 20). Operation of the pSym conjugative systemwas detected only upon inactivation of the repressor RctA or con-stitutive expression of the rctB gene (19, 20).
The requirement for p42a for transfer of the pSym was uncov-ered by sequence analysis and characterization of conjugativeproducts. Sequence analysis revealed a 53-bp region that is 90%identical between the pSym and p42a, including a 5-bp centralregion flanked by 9- to 11-bp inverted repeats, reminiscent ofbacterial and phage attachment sites (21). A gene encoding anintegrase-like protein belonging to the tyrosine recombinase fam-ily (intA) was localized downstream of the attachment site on p42a(21). We have shown previously that cointegration of the pSymand p42a, mediated by site-specific recombination between theattachment-like sites present on the pSym (attD) and p42a (attA),participates in conjugative transfer of p42d (21). The pSym-p42acointegrate is able to perform conjugative transfer. In most cases,resolution occurs at the same site, regenerating the wild-type sym-biotic and p42a plasmids (21).
Although our previous studies clearly demonstrated the role ofIntA in catalyzing cointegration reactions in vivo, several impor-tant questions were left unanswered. Among these, the issue ofdirectionality of IntA for the recombination activity (i.e., cointe-gration versus excision), as well as the determination of the min-imal regions participating in IntA binding and recombination,were still unknown.
In this study, we demonstrate that (i) IntA is able to catalyzeboth cointegration and excision reactions in vivo, although thebalance is strongly skewed toward cointegration; (ii) the minimalregions needed for specific binding and recombination activity ofIntA on the attA and attD regions are comprised of 9- to 11-bpinverted regions plus a 5-bp central region; and (iii) integrity ofthe inverted repeats is absolutely required for IntA binding andrecombination, while the central sector modulates the efficiencyof these activities.
(This research was conducted by R. Hernández-Tamayo inpartial fulfillment of the requirements for a Ph.D. in Ciencias Bio-médicas from the Universidad Nacional Autónoma de México,Cuernavaca, México, 2013.)
MATERIALS AND METHODSBacterial strains, plasmids, and growth conditions. The strains and plas-mids used in this work are shown in Table 1. Rhizobium strains weregrown at 30°C in PY (peptone-yeast extract) medium (23). E. coli strainswere grown at 37°C in LB (lysogeny broth) medium (26). When needed,antibiotics were added at the following concentrations (in microgramsper milliliter): nalidixic acid, 20; spectinomycin, 100; kanamycin, 30;
erythromycin, 100; carbenicillin, 100; and tetracycline, 10 for E. coli or 5for Rhizobium. Media containing sucrose were prepared by adding appro-priate volumes of a filter-sterilized, concentrated sucrose solution (50%[wt/vol]) to autoclaved PY medium.
Molecular and microbiological procedures. DNA manipulationsand molecular techniques were done using established procedures (31).Extraction of DNA from agarose gels was done with a GeneJet extractionkit (Fermentas), and plasmids were isolated with a High Pure PlasmidIsolation kit (Roche). All oligonucleotides used (Table 2) were synthesizedat the Unidad de Síntesis de Oligonucleótidos of the Instituto de Biotec-nología, Universidad Nacional Autónoma de México. DNA fragmentssuitable for cloning were produced by PCR amplifications, using Taqpolymerase High Fidelity (Invitrogen). Amplification consisted of 30 cy-cles of 1 min at 94°C, 1 min at variable temperature (depending on theprimer combination), and 1 to 3 min at 68°C. PCR products were ex-tracted with phenol, precipitated in ethanol, resuspended in Tris-EDTAbuffer, and digested with the appropriate restriction enzyme(s) to gener-ate the required ends of the fragments. PCR products were purified beforecloning by band slicing. Primer combinations employed to generate attAor attD fragments for cloning and electrophoretic mobility shift analysesare shown in Table S1 in the supplemental material. Fragments of 23 bp,containing either wild-type or mutant versions of att sequences, weregenerated by annealing custom-made oligonucleotides (see Table S1) andpurified using a GeneJet extraction kit (Fermentas); double-strandedfragments were digested with the required enzymes and ligated into suit-ably digested pRD02. For ligations, T4 polynucleotide ligase (Fermentas)was used. Plasmid transformation of E. coli was done using CaCl2-com-petent cells. All plasmid constructions were verified by restriction analysisand PCR and, in most cases, by DNA sequencing.
Plasmid transfer from E. coli to Rhizobium was done by biparentalmating, using E. coli S17.1 harboring the appropriate plasmid as a donorand specific R. etli strains as recipients. The strains were grown in liquidmedium to stationary phase, washed twice with PY medium, mixed in adonor/recipient ratio of 1:2 on PY plates, and incubated at 30°C over-night. After incubation, the cells were resuspended in 10 mM MgSO4-0.01% Tween 40, and dilutions were plated on PY medium containingnalidixic acid, kanamycin, and tetracycline. Cointegration frequencieswere evaluated independently at least three times and are expressed as thenumber of transconjugants per recipient cell � standard deviation. Todetermine cointegrate excision frequencies, we used the sacB gene (27) inone of the plasmids employed to generate the cointegrate, thus allowingpositive selection for cointegrate excision. To that end, appropriate R. etlistrains harboring the desired cointegrate were grown overnight in PYmedium, and suitable dilutions of each culture were plated onto PY me-dium containing sucrose at 12.5% (wt/vol). Excision frequencies wereevaluated at least three independent times and are expressed as the num-ber of sucrose-resistant colonies per total number of cells � the standarddeviation.
Plasmid profiles and hybridization. Rhizobium plasmids were visu-alized by the Eckhardt procedure (32). Gels were transferred onto Hy-bond N� membranes (Amersham) using the manufacturer’s protocoland cross-linked using a UV cross-linker unit (Stratagene). Hybridiza-tions were performed overnight using [�-32P]dCTP-labeled probes(Megaprime kit; Amersham) under high-stringency conditions (65°C inrapid-Hyb buffer; Amersham). Hybridization signals were detected with aPhosphorImager (Molecular Dynamics).
Expression and purification of IntA. The short form of IntA (seeResults) was overexpressed in E. coli strain BL21(DE3)(pLysS) (Novagen)as an N-terminal maltose-binding protein (MBP)-tagged protein. For thispurpose, intA was amplified by PCR from R. etli CFN42 DNA using theUpXbaintA (built-in XbaI site) and LwPstintA (built-in PstI site) primers(Table 2), digested with the indicated enzymes, and ligated into suitablydigested pMALc2x (29). The resulting construct, pMAL-c2x::intA, wasverified by sequencing. The E. coli BL21(DE3) strain was transformed withthe pMAL-c2x::intA recombinant plasmid (pRD17) and grown overnight
in LB medium plus carbenicillin at 30°C. The overnight culture was di-luted 1:100 in fresh LB medium carrying carbenicillin and grown at 30°Cto an A600 of 0.6 to 0.7; expression was induced by the addition of 0.1 mMIPTG (isopropyl �-D-thiogalactoside) for 2 h at 30°C. Bacteria were har-vested by centrifugation at 4,100 � g for 10 min at 4°C, and the pelletswere suspended in column buffer (20 ml of 20 mM Tris-HCl, pH 7.4, 200mM NaCl, 1 mM EDTA). Sonication was done using an Ultra Cell(Sanyo) at an output control of 25 W by continuous pulses (interstimulusinterval, 10 s) interrupted by 5-s breaks on ice. Soluble and insolublefractions of the E. coli lysate were separated by centrifugation at 8,200 � gfor 15 min at 4°C. The MBP-IntA fusion protein was purified with anamylose affinity column (New England BioLabs). After loading and wash-ing, MBP-IntA was eluted with a buffer containing 10 mM maltose. Pro-teins were detected by SDS-PAGE after staining with Coomassie blue.
Fractions containing MBP-IntA were concentrated by Amicon (Milli-pore) filtration, pooled, and kept in 30% glycerol at �20°C.
Electrophoretic mobility shift assays (EMSAs). Regions correspond-ing to attA and attD prepared by PCR (see “Molecular and microbiolog-ical procedures” above) were separated on 1.5% agarose gels and purifiedby band slicing. Reaction mixtures for DNA mobility shift assays con-tained 0.10 pmol of DNA and variable amounts of the MBP-IntA proteinin a final volume of 10 l. MBP-IntA was incubated with the desiredfragments for 30 min at room temperature in binding buffer (20 mMTris-HCl [pH 8.5], 10% glycerol, 50 mM KCl, 3 mM MgCl2, 0.5 mg ofbovine serum albumin/ml). To evaluate binding specificity, a 383-bp frag-ment from the R. etli pcaD gene was added to the binding reaction mix-ture. The mixtures were loaded on native 8% polyacrylamide gels pre-pared with TB-EDTA (40 mM Tris base, 40 mM boric acid, 1 mM EDTA)
TABLE 1 Bacterial strains and plasmids
Strain or plasmid Relevant features Reference or source
R. etli strainsCFN42 Wild type 22CE2 CFN42 Rifr derivative 23CE3 CFN42 Strr derivative 23CFN2001 CE2 derivative lacking p42a and p42d 21CFNX107 CFN2001 recA::Spr Smr 21CFNX663 CE3 recA Rifr/p42d::Tn5mob;p42a::intA::Spr Smr 21CFNX750 CFNX107/pRD01 This studyCFNX751 CFN2001/pRD01 This studyCFNX752 CFNX750/pRD02 This studyCFNX753 CFNX663/pRD18 This study
A. tumefaciens strainUIA143 C58 recA derivative lacking pTi 24
E. coli strainsS17.1 thi pro recA hsdR hsdM RP4-2-Tc::Mu-Km::Tn7 25DH5� �� �80dlacZ�M15 �(lacZYA-argF)U169 recA1 endA1 hsdR17(rK
� mK�) supE44 thi-1 gyrA relA1 26
BL21(DE3)/pLysS F� ompT hsdSB(rB� mB
�) gal dcm (DE3) pLysS (Camr) Novagen
PlasmidspK18 mob sacB Suicide vector; Kanr 27pBBRMCS3 Broad-host-range cloning vector; Tcr 28pMalc2X Protein maltose fusion and expression vector 29pRK404 Broad-host-range cloning vector; Tcr 30pRD01 pBBRMCS3::intA-attA This studypRD02 pK18 mob sacB::attD (253 bp) This studypRD03 pK18 mob sacB::attD (198 bp) This studypRD04 pK18 mob sacB::attD (203 bp) This studypRD05 pK18 mob sacB::attD (150 bp) This studypRD06 pK18 mob sacB::attD (85 bp) This studypRD07 pK18 mob sacB::attD (65 bp) This studypRD08 pK18 mob sacB::attD (53 bp) This studypRD09 pK18 mob sacB::attD (23 bp) This studypRD10 pK18 mob sacB::attA (467 bp) This studypRD11 pK18 mob sacB::attA (287 bp) This studypRD12 pK18 mob sacB::attA (237 bp) This studypRD13 pK18 mob sacB::attA (187 bp) This studypRD14 pK18 mob sacB::attA (98 bp) This studypRD15 pK18 mob sacB::attA (89 bp) This studypRD16 pK18 mob sacB::attA (53 bp) This studypRD17 pMalc2x::intA gene This studypRD18 pRD17 fused with pRK404 This studypRD19 pK18 mob sacB::attD (MutPalinA) This studypRD20 pK18 mob sacB::attD (MutPalinB) This studypRD21 pK18 mob sacB::attD (MutPalinC) This studypRD22 pK18 mob sacB::attF (CFN42) This study
and subjected to electrophoresis for 1.5 h at 60 V. DNA was visualized withethidium bromide.
DNA footprinting. To obtain labeled attA and attD fragments forDNase I footprinting, the primers of interest were 5= end labeled with T4polynucleotide kinase in the presence of [ -32P]ATP (3,000 Ci/mmol)and used to amplify attA and attD. An amount of probe equivalent toabout 100,000 cpm was preincubated at room temperature with increas-ing concentrations of MBP-IntA in binding buffer (20 mM Tris-HCl [pH8.5], 10% glycerol, 50 mM KCl, 3 mM MgCl2, 0.5 mg of bovine serumalbumin/ml). After 20 min, 0.003 U of DNase I (Roche, Nutley, NJ) indilution buffer (8 mM Tris-HCl [pH 7.9], 40 mM MgSO4, 4 mM CaCl2, 40mM KCl, 2 mM EDTA [pH 8.0], 24% glycerol) was added to the mixtureand incubated at room temperature for 2 min. Reactions were stopped byaddition of 500 l DNase I stop solution (570 mM ammonium acetate,80% ethanol, 0.5 mg/ml tRNA). Digested DNA samples were isolated byphenol-chloroform extraction and ethanol precipitation. Pellets contain-ing DNA were air dried and then resuspended in formamide-containingloading dye. The samples were heated at 95°C for 3 min and loaded into an8% polyacrylamide gel containing 7 M urea. The gels were vacuum driedand visualized with a PhosphorImager (Molecular Dynamics). Sequenc-ing reactions were included as size markers. Nucleotide sequence deter-mination was performed by the dideoxy chain termination method (33)with a TaqTrack sequencing kit (Promega).
RESULTSIn vivo IntA-dependent cointegration and cointegrate resolu-tion. To evaluate if IntA is able to catalyze both cointegration and
resolution reactions in vivo, a simplified two-plasmid system wasdesigned. The system employed as hosts R. etli strains lacking bothp42a and p42d and, when required, without an active recA gene, aswell. One of the plasmids used (pRD01) contains a broad-host-range origin of replication and an RP4-oriT sequence and harborsa 1.32-kb fragment possessing both the intA gene and the attAsequence. Upon introduction by conjugation of pRD01 into thedesired hosts, the plasmid becomes the only source of both IntAand attA. The second plasmid used (pRD02) comprised a nonho-mologous plasmid carrying an origin of replication that is active inE. coli but inactive in R. etli (i.e., a suicide plasmid in R. etli), anRP4-oriT sequence, and a 0.26-kb fragment harboring attD. Notethat, besides the RP4-oriT sequence, these two plasmids share onlyatt regions. In this system, stable transconjugants containingpRD02 should only be obtained by integration catalyzed by IntA.
Stable transconjugants containing pRD02 were obtained onlyin the presence of pRD01 (Table 3, top two rows); in contrast, notransconjugants were obtained whenever the mobilized plasmidlacked attD (Table 3, bottom two rows). Note that similar fre-quencies were obtained irrespective of the recA status of the hoststrain, indicating that most of the events leading to stabilization ofpRD02 were recA independent. To ascertain if stabilization ofpRD02 requires integration, plasmid profiles of selected transcon-jugant strains were analyzed by the in-gel lysis technique of Eck-
TABLE 2 Oligonucleotides used in this work
Name Sequencea Locationb
UpXbaintA GCTCTAGAATGATAAAAGCCCGCAAAT 1339 p42aLwPstintA TGCACTGCAGTTAAATAAGTCGTGCGGC 2589 p42apcaDup CTTGGATCCGCCGGCCTGCTGCTCGATCTGCTCT 72348 p42epcaDlw GATGGATCCTCGACTTGGCCGCTTGGGTGAGA 72731 p42eUpattA1 CTGGATCCCAAAGGTCGCTCCTGAAT 2252 p42aUpattA2 CTGGATCCTCTGTCGGCTCATTTCGC 2432 p42aUpattA3 CTGGATCCGAGATTTTTATACGTCATTAAC 2492 p42aUpattA4 CTGGATCCAACGGAAGCGACGTCAG 2532 p42aUpattA5 CTGGATCCGATTGATAAAAGCCCGCAAAT 2595 p42aLwattA1 CGAATTCATTTTCCCGAGAATAACATG 2687 p42aLwattA2 CGAATTCACTTCCGATAAGCAGTACTTA 2617 p42a53bpUpA CTGGATCCTCCGATAAGTAC 2595 p42a53bpLwA CGAATTCTGATTTGCGGGCT 2647 p42aUpattD1 CTGGATCCTTGCGATTGAGAGTCCGGTCA 5655 p42dUpattD2 CTGGATCCATTTCCGGGGCGAATCCGCC 5705 p42dUpattD3 CTGGATCCTCGCTTCCGATAAGCATTACT 5765 p42dLwattD1 CGAATTCCGGCGTTTGCATCTCGTTA 5875 p42dLwattD2 CGAATTCGAAGCCAATATGGCAGTACATTC 5823 p42dLwattD3 CGAATTCCGATTGCTATAACGACGAAAA 5765 p42d53bpUpD CTGGATCCTCCGATAAGTAA 5743 p42d53bpLwD CGAATTCTGATTTGCGGGCG 5796 p42dUp23bp CGGATCCTCCGATAAGCATTACTTATCGGACTTAAGT 5743 p42dLw23bp GCCTAGGAGGCTATTCGTAATGAATAGCCTGAATTCA 5765 p42dUpMutA CGAATTCGATAGTAAGCATTACTTATCGGAGGATCCG 5743 p42dLwMutA GCTTAAGCTATCATTCGTAATGAATAGCCTCCTAGGC 5765 p42dUpMutB CGAATTCTCCGATAAGTGACCCTTATCGGAGGATCCG 5743 p42dLwMutB GCTTAAGATTCTATTCACTGGGAATAGCCTCCTAGGC 5765 p42dUpMutC CGAATTCTCCGATAAGCATTACTTAGAATGGGATCCG 5743 p42dLwMutC GCTTAAGAGGCTATTCGTAATGAATCTTACCCTAGGC 5765 p42dUpattF CGAATTCTCCGATAAGCAGCCCTTATCGGAGGATCCG 101656 p42fLwattF GCTTAAGAGGCTATTCGTCGGGAATAGCCTCCTAGGC 101678 p42fa All oligonucleotides are shown in the 5=-to-3= direction. Nonencoded bases introduced as clamps are shown in italics. Restriction sites are underlined; the first twooligonucleotides carry XbaI and PstI, respectively, while the rest carry either EcoRI (GAATTC) or BamHI (GGATCC) sites. Novel bases changed by mutation are in boldface italics.b The location is indicated by the first 5= nucleotide and the replicon where the sequence is located. Accession numbers are p42a (NC_007762), p42d (NC_004041), p42e(NC_007765), and p42f (NC_007766) of R. etli.
hardt (32). Figure 1A shows that all transconjugants bearingpRD02 present a novel plasmid band, whose size is compatiblewith integration of pRD02 into pRD01. To verify that this novelplasmid band is due to cointegration, plasmid profiles were sub-jected to Southern blot hybridization, using as a probe eitherpK18mob (Fig. 1B) or the intA gene (Fig. 1C). As expected, thenovel plasmid band harbors both sequences, confirming cointe-gration between pRD01 and pRD02. Further proof of cointegra-tion in these strains was obtained through PCR. For everytransconjugant strain analyzed, no amplified products were ob-served when PCRs were set up with primers flanking the att re-gions in pRD01 or pRD02; in contrast, amplified products wereobtained upon combination of the forward primer flanking oneatt insert with the reverse primer of the other att insert (data noshown). These results indicate that cointegrates were formed byIntA-mediated recombination between attD and attA.
Cointegrates obtained in this section also offer a convenientway to evaluate if IntA can catalyze excision. Since pRD02 alsocontains a Bacillus subtilis sacB gene (a sucrose-dependent, condi-
TABLE 3 Frequencies of in vivo IntA-dependent cointegration andexcision in R. etli
Strain Relevant genotype
Frequency (10�5) of:
Cointegrationa Excisionb
CFNX750::pRD02 recA mutant intA�
attA� attD�
2.34 � 1.43 0.28 � 0.14
CFNX751::pRD02 recA� intA� attA�
attD�
7.6 � 1.52 ND
CFNX750::pK18mob sacB
recA mutant intA�
attA�
�0.002 NA
CFNX751::pK18mob sacB
recA� intA� attA� �0.002 NA
a Cointegration frequencies are expressed as the number of transconjugants perrecipient cell � standard deviation for at least three independent determinations.b Excision frequencies were evaluated at least three independent times and areexpressed as the number of sucrose-resistant colonies per total cells � standarddeviation. ND, not done; NA, not applicable.
FIG 1 Analyses of in vivo cointegration and excision events. (A and D) Plasmid profiles of selected strains stained with ethidium bromide. (B, C, E, and F)Southern blots of the corresponding plasmid profiles revealed by autoradiography using 32P-labeled intA (B and E) or pK18mob sacB (C and F) as a probe. (A toC) Cointegration events. Lane 1, CFN42; lane 2, CFNX107; lane 3, CFNX750; lanes 4 to 8, putative cointegrates pRD01::pRD02. (D to F) Excision events. Lane1, CFN42; lane 2, CFNX107; lane 3, CFNX750; lane 4, CFNX752; lanes 5 to 9, putative excisants.
tionally lethal marker in Gram-negative cells), excision of pRD02from these cointegrates can be evaluated by sucrose selection. Pu-tative excisants were obtained at a 10-fold-lower frequency thantransconjugants (Table 3). Analysis of the plasmid profile in theseexcisants revealed the loss of the cointegrate plasmid band, with aplasmid band corresponding in size to pRD01 (Fig. 1D), whichalso hybridizes with an intA probe (Fig. 1E), appearing instead.Complete loss of pRD02 from the excisants was corroborated bythe absence of hybridization with the pRD02 plasmid backbone(Fig. 1F). These results indicate that R. etli IntA is a “bidirectional”recombinase, able to promote not only integration, but also exci-sion events, albeit at a lower frequency.
IntA binds specifically to the attA and attD sites. The R. etliIntA open reading frame (ORF) (accession no. AF538364) has twopotential UUG start codons, localized 11 codons apart. Since it isunknown which of the two start codons is employed in vivo, ap-propriate oligonucleotides were used to amplify both the long andthe short forms of IntA. Given the insolubility of the native pro-tein, both forms were fused to MBP and purified as described inMaterials and Methods. No difference was found between the twoforms for in vivo recombination activity and DNA binding (datanot shown); therefore, we report here only the data obtained withthe short form of IntA.
The functionality of the MBP-IntA fusion protein was ascer-tained by in vivo assays. To this end, we employed R. etliCFNX663, which contains the symbiotic plasmid (p42d) markedwith Tn5 and also carries inactivating mutations in both recA andintA. Inactivation of these two functions renders a strain unable todonate its pSym by conjugation due to the inability to form thep42a-pSym cointegrates necessary for transfer. This strain shouldrecover conjugative ability upon complementation with an activeintA.
To evaluate if the MBP-IntA hybrid can complement conjuga-tive capacity, a plasmid harboring the hybrid (pRD17) was fusedwith pRK404, giving rise to pRD18, which is able to replicate in R.etli (see Materials and Methods), and introduced into strainCFNX663. As expected, strain CFNX663 was unable to transferthe pSym to Agrobacterium tumefaciens strain UIA143, but all theCFNX633 derivatives complemented with the MBP-intA hybridregained conjugative pSym transfer at a frequency indistinguish-able from the one afforded by the wild-type intA (see Fig. S1 in thesupplemental material). These results indicate that fusion of IntAto MBP does not affect its in vivo recombination ability.
The MBP-tagged IntA derivatives were purified to homogene-ity by amylose affinity chromatography (see Materials and Meth-ods) (see Fig. S1B in the supplemental material) and used to set upEMSAs. Linear DNA fragments carrying the regions attA (467 bp)and attD (253 bp) were mixed with a nonspecific DNA fragmentof R. etli (pcaD; 383 bp). Increased amounts of MBP-IntA, up to a7-fold molar excess with respect to DNA, were added to thesemixtures. As shown in Fig. 2, well-defined complexes were de-tected even at the smallest amount of IntA used. As expected forspecific binding of IntA to att-containing fragments, increasedamounts of IntA led to a gradual recruitment of attA and attDfragments into retarded complexes. No retardation of the pcaDfragment was observed, even at the largest amount of IntA em-ployed. These results clearly indicate specific binding of MBP-IntA to attA and attD.
The palindromic regions in attA and attD are required forspecific binding of IntA. To determine the minimal regions
needed for specific binding of IntA, shortened derivatives of theattA and attD regions were produced by PCR (Fig. 3A). All short-ened fragments of the attA and attD regions were subjected to IntAEMSA analyses.
Clear IntA-DNA complexes were detected for all the shortenedderivatives harboring the corresponding palindromic region, forboth attA (Fig. 3B) and attD (Fig. 3C). The IntA-protected com-plexes for the palindrome-bearing, shortened derivatives wereproduced with the same stoichiometry as the full-length frag-ments. Interestingly, fragments lacking the corresponding palin-drome (attA, 98 bp, and attD, 65 bp) (Fig. 3B and C, respectively)failed to produce IntA-protected complexes. These results indi-cate that the palindromic sequence in each att region is indispens-able for IntA binding.
To verify if the palindromic regions are sufficient for binding, asynthetic 23-bp palindrome was produced by annealing of cus-tom-made oligonucleotides (see Materials and Methods). Asshown in Fig. 3D, IntA-dependent complexes were readily de-tected with this synthetic palindrome, even at the smallest IntAamount employed, indicating that the palindromic region is suf-ficient to achieve specific binding of IntA.
IntA binds mainly to the palindromic sector in att regions.To ascertain more precisely the sequence bound by IntA, DNA-footprinting assays with IntA in the presence of DNase I (Fig. 4)were carried out for both att regions. Consistent with the resultspresented thus far, a 34-bp sequence motif in attD was protectedfrom DNase attack in the presence of IntA, even at the lowestprotein concentration tested (Fig. 4, left). This 34-bp sector fullyencompasses the palindromic sequence. In a similar way, a 33-bpsequence in attA, spanning the corresponding palindrome, wasalso protected by IntA (Fig. 4, right). Protection of both palin-dromic sequences by IntA is fully consistent with the results de-scribed above.
In vivo recombination abilities of shortened derivatives ofattA and attD. To evaluate if shortening of both att regions affectsin vivo recombination abilities, every reduced fragment (Fig. 3A)was cloned separately into a mobilizable suicide plasmid, thusgenerating families of plasmids (pRD03 to pRD08, attD; pRD11 topRD16, attA). Introduction of these plasmids into an R. etli strainharboring pRD01 (intA and attA) allows easy evaluation of in vivocointegration ability.
As shown in Table 4, no significant reduction in cointegration
FIG 2 IntA interacts specifically with attA and attD. EMSAs were set up withequal molar proportions of specific (attA and attD) and nonspecific (pcaD)DNA fragments, mixed in the absence (lane 1) or presence (lanes 2 to 8) ofMBP-tagged IntA, analyzed on an 8% polyacrylamide gel, and stained withethidium bromide. Lane 1, no IntA; lanes 2 to 8, increasing amounts of IntA(molar ratios [DNA/protein] were 1:0.5, 1:0.75, 1:1, 1:1.25, 1:1.5, 1:2, and 1:3,for lanes 2 to 8, respectively).
ability was found for shortened derivatives of attD, with the ex-ception of pRD07, which was unable to generate cointegrates; thisplasmid contains a 65-bp fragment that is the only one lacking thepalindromic sequence and hence is unable to bind IntA in vitro.Similar results were found for variants of the attA region (Table 4).Every variant of attA that contains the palindromic sequencecointegrates readily; the variant that lacks the palindromic sectorwas unable to cointegrate. As expected from these data, a plasmidthat carries a synthetic 23-bp palindromic sector (pRD09) pro-motes intA-dependent cointegration at frequencies comparable tothose found with larger fragments.
Cointegrates generated with these plasmids also allowed us toexplore the excision ability of IntA, using the methodology de-scribed above. As shown in Table 4, fragments that retain in vivocointegration ability were also as efficient as the original fragmentsin promoting in vivo excision. The positive correlation between invitro IntA binding and in vivo recombination ability, as well as thefinding that the palindromic sequence suffices for binding of IntAand recombination ability, support the proposal that the palin-dromic sequence is the minimal region needed for the action ofIntA.
Mutations in the palindromic sequence abolish specificbinding and recombination ability. The conserved 23-bp palin-dromic sequence is comprised of two 9-bp inverted repeats sepa-rated by a 5-bp sequence. To evaluate the roles of the invertedrepeats and central region in the binding of IntA and recombina-tion ability, we constructed mutant versions of the palindromicsequence in which five contiguous changes were made in the left(MutPalinA) or right (MutPalinC) inverted repeat, thus disrupt-
ing their complementarity; a 5-bp change was also constructed inthe central region (MutPalinB).
Analyses of IntA binding to these mutant fragments by EMSArevealed that mutations that disrupt the integrity of the 9-bp in-verted repeats abolish both specific binding (Fig. 5) and recombi-nation ability (Table 4, plasmids pRD19 and pRD21). In contrast,a mutation that disrupts the 5-bp central region reduces bothbinding (Fig. 5) and recombination (as much as 100-fold; com-pare plasmids pRD09 and pRD20 in Table 4). Sequence analysis ofthe R. etli CFN42 genome revealed the presence of a palindromicsector on plasmid p42f highly similar to attA and attD. The in-verted repeats in this motif are identical to those in both attA andattD, but the central region differs from the one in attA in only 2out of 5 bases (Fig. 5). To evaluate if the palindromic sequence onp42f is active in IntA-mediated recombination, this sequence wassubjected to IntA binding experiments (Fig. 5) and in vivo recom-bination (Table 4, pRD22). IntA recognizes the palindromic se-quence in p42f, albeit with reduced affinity compared to the pal-indromic sequence in attA and attD. In vivo recombinationmediated by IntA also occurred with the attF palindrome, but at a100-fold-lower efficiency than for the attA and attD motifs. Theseresults demonstrate that integrity of the inverted repeats is abso-lutely required for IntA binding and recombination, while thecentral sector modulates the efficiency of these activities.
DISCUSSION
In this work, we characterize the function of the R. etli IntA site-specific recombinase through a combination of in vivo and in vitroassays. The results described here clearly show that IntA is able to
FIG 3 The palindromic sequences in attA and attD are required for specific binding of IntA. (A) Shortened derivatives of attA and attD regions, which wereanalyzed by EMSA; derivatives marked with a plus showed IntA-dependent retarded complexes, while those labeled with a minus lacked any detectable complex.The boxed regions in the topmost diagrams correspond to the 53-bp homology between attA and attD; the arrows indicate the palindromic sector present in eachof these regions. The vertical dashed lines show the retention of specific sequence characteristics in each derivative. (B and C) EMSA analyses of shortenedderivatives of the attA and attD regions, respectively. Lanes marked with a minus lack MBP-tagged IntA, while lanes with a plus contain increasing amounts ofMBP-tagged IntA (DNA/IntA molar ratios ranged from 1:1 to 1:6). (D) EMSA analysis of a synthetic 23-bp palindromic sequence with increasing amounts ofMBP-tagged IntA.
catalyze both cointegration and excision events in vivo in a man-ner dependent on the presence of a characteristic 23-bp sequence(the att sector) harboring the two arms of a palindrome plus adivergent central region. Thus, R. etli IntA appears to be a bidirec-tional recombinase. Evaluations presented here regarding the fre-quency of integration (2 � 10�5) and excision (2 � 10�6) eventsdiffer only 10-fold. However, it should be kept in mind that theevaluation of integration frequency is in fact the sum of two inde-pendent processes: conjugative transfer and integration of the testplasmid. Frequency of conjugative transfer was determined sepa-rately at 1 � 10�3; thus, frequencies of integration shown in thispaper should be on the order of 1 � 10�2. Evaluations of theexcision frequency are also a composite of excision itself and lossof the excised segment; however, the frequency of loss of the ex-
cised segment should be negligible, due to the lack of a replicationorigin. Thus, although it is true that IntA can catalyze both inte-gration and excision, the balance between these activities isskewed toward integration by a factor of 4 orders of magnitude.
It should be stressed that experiments such as the one shown inFig. 2 were designed to evaluate not only IntA binding, but alsoIntA-mediated recombination in vitro. IntA binding was readilydemonstrated, but in vitro IntA recombination was not observed,despite designing segments containing the corresponding att in anasymmetric position. This inability persisted despite variations inthe protein concentration used, the reaction pH, the reaction tem-perature, and the presence of different ions (Na� and Mg2�) atvariant concentrations (data not shown). Although it is formallypossible that the suitable combination of parameters needed for in
FIG 4 DNase I protection of the attA and attD regions by IntA. Increasing amounts of MBP-tagged IntA were mixed with 32P-end-labeled DNA fragmentscorresponding to attD (253-bp) (left) or attA (287 bp) (right) and treated with DNase I. DNA/IntA molar ratios ranged from 1:1 to 1:6; controls containing thespecified fragment plus IntA alone or the fragment plus DNase I alone are also shown. Samples were subjected to electrophoresis on an 8% polyacrylamidesequencing gel and detected on a PhosphorImager. The brackets encompass the protected region for each fragment; nucleotides depicted in boldface correspondto the palindromic sequence. The lanes labeled G, A, T, and C correspond to sequencing reactions with the same fragments run in parallel.
vitro recombination has not yet been found, it is also possible thatIntA requires for this activity another protein that interacts with it.Experiments are under way to evaluate this possibility, looking forpossible interacting proteins in pulldown experiments.
The conclusion that binding and recombination catalyzed byIntA requires only a 23-bp sequence motif (the att site) is based on
in vivo and in vitro experiments that show that binding and recom-bination occur only with segments containing the att region andnot in their absence. The fact that an artificial segment containingonly the att site acts as efficiently as a larger segment further sup-ports this conclusion. Moreover, this observation reveals that R.etli IntA, unlike other tyrosine recombinases (34), does not re-quire other neighboring sequences acting as enhancers for itsfunction. Consistent with this, DNase I-footprinting assays withIntA revealed protection of the att sites (Fig. 4); however, IntA alsoprotects an additional 9-bp (attD) or 8-bp (attA) sequence. Thefact that the sequences in the two additional pieces are dissimilarmilitates against a role of these extended sectors as determinantsfor specific binding. These extended protection sectors could bedue to the well-known inability of DNase I to cut in close proxim-ity to a bound protein, due to steric hindrance.
Besides its bidirectional action in vivo, another interestingcharacteristic of the R. etli IntA recombinase is that strict identityin the att sectors is not needed for recombination. Although theinverted repeats are identical between attA and attD, the centralregion differs in 1 nucleotide. Despite this difference, recombina-tion frequencies in vivo were the same for attA-attD and attA-attAcombinations (Table 4). Lack of strict identity in the central re-gion is a characteristic shared with a recently described group oftyrosine recombinases (5).
Mutagenesis of the att region allowed us to explore the role ofdefined sequences in IntA binding and recombination. Mutationsthat disrupt the integrity of the 9-bp inverted repeats abolish bothspecific binding and recombination abilities, while mutations thatchange the 5-bp central region severely reduce both binding andrecombination. Interestingly, reduced binding and recombina-tion were also found with a natural variant of att (attF) differingfrom the sequence of attA only in the last 2 nucleotides in thecentral region (CC instead of TA). Systematic mutagenesis of theresidues of the central region, either singly or in combination, isneeded before assigning a role to residues in the central sector in
TABLE 4 Frequencies in R. etli of in vivo cointegration and excisionwith variant att regions
pRD19 intA� attA� MutPalinA �0.002 NApRD20 intA� attA� MutPalinB 0.071 � 0.0063 0.43 � 0.046pRD21 intA� attA� MutPalinC �0.002 NApRD22 intA� attA� attF� 0.077 � 0.0072 0.54 � 0.35a Cointegration frequencies are expressed as the number of transconjugants perrecipient cell � standard deviation for at least three independent determinations.b Excision frequencies were evaluated at least three independent times and areexpressed as the number of sucrose-resistant colonies per total number of cells �standard deviation. ND, not done; NA, not applicable.
FIG 5 Mutations in the palindromic sequence abolish IntA binding ability. (A) EMSA analyses with increasing amounts of MBP-tagged IntA (DNA/IntA molarratios ranged from 1:1 to 1:6) of a wild-type palindrome (palindromic sequence, 23 bp) and mutants in the left (MutPalinA) or right (MutPalinC) arm of thepalindromic sequence or in the central region (MutPalinB and attF p42f). (B) Alignment of different palindromic sequence variants; nucleotides that differ fromattA are shown in boldface. (C) Quantification of retarded complex formation for the wild-type palindrome (�) and mutants in the central region (MutPalinB,Œ, and attF p42f, �). Quantifications are based on three independent determinations � standard deviations.
resolution of the Holliday junction, as described for other tyrosinerecombinases (4).
The characterization of the IntA recombinase presented hereconfirms our proposal that IntA participates in the high-fre-quency formation of cointegrates p42a-p42d (21). The fact thatIntA presents weak excision activity in vivo would have as a con-sequence, over time, the accumulation of p42a-p42d cointegrates;this tendency, however, is opposed by resolution of these cointe-grates through homologous recombination between repeated se-quences shared between the plasmids (21). Our data also suggestthe possibility of recombination between p42a and p42f; cointe-grates between the two plasmids were recently detected in vivo (S.Brom, unpublished results). Besides its importance for under-standing events of genome evolution in Rhizobium, the IntA sys-tem should be a novel tool to introduce new segments into thegenome in defined locations, thus advancing genome engineeringin this group of organisms. Experiments are under way to achievethis objective.
ACKNOWLEDGMENTS
We gratefully acknowledge Abraham Medrano López for valuable helpwith the DNase I-footprinting experiments, Laura Cervantes for skillfultechnical assistance, and Paul Gaytán and Eugenio López (Unidad deSíntesis de Oligonucleótidos, Instituto de Biotecnología, UNAM) for helpwith oligonucleotide synthesis.
Work at the J.L.P. laboratory was supported by grant 154287 from theConsejo Nacional de Ciencia y Tecnología (México). R.H.-T. was sup-ported during the Ph.D. program (Programa de Doctorado en CienciasBiomédicas, Universidad Nacional Autónoma de México) by a scholar-ship from the Consejo Nacional de Ciencia y Tecnología (México).
REFERENCES1. Wang Y, Yau Y, Perkins-Balding D, Thomson JG. 2011. Recombinase
technology: applications and possibilities. Plant Cell Rep. 30:267–285.2. Van Houdt R, Leplae R, Lima-Mendez G, Mergeay M, Toussaint A.
2012. Towards a more accurate annotation of tyrosine-based site-specificrecombinases in bacterial genomes. Mob. DNA 3:6. doi:10.1186/1759-8753-3-6.
3. Hoess RH, Wierzbicki A, Abremski K. 1986. The role of the loxP spacerregion in PI site-specific recombination. Nucleic Acids Res. 14:2287–2300.
4. Lee G, Saito I. 1998. Role of nucleotide sequences of loxP spacer region inCre-mediated recombination. Gene 216:55– 65.
5. Rajeev L, Malanowska K, Gardner JF. 2009. Challenging a paradigm: therole of DNA homology in tyrosine recombinase reactions. Microbiol.Mol. Biol. Rev. 73:300 –309.
6. Hsu PL, Ross W, Landy A. 1980. The � phage att site: functional limitsand interaction with Int protein. Nature 285:85–91.
7. Kopke K, Hoff B, Kück U. 2010. Application of the Saccharomyces cerevi-siae FLP/FRT recombination system in filamentous fungi for marker re-cycling and construction of knockout strains devoid of heterologousgenes. Appl. Environ. Microbiol. 76:4664 – 4674.
8. Abremski K, Wierzbicki A, Frommer B, Hoess RH. 1986. BacteriophageP1 Cre-loxP site-specific recombination. Site-specific DNA topoisomer-ase activity of the Cre recombination protein. J. Biol. Chem. 261:391–396.
9. Karimova M, Abi-Ghanem J, Berger N, Surendranath V, Pisabarro MT,Buchholz F. 2013. Vika/vox, a novel efficient and specific Cre/loxP-likesite-specific recombination system. Nucleic Acids Res. 41:e37. doi:10.1093/nar/gks1037.
10. Blakely GW, Sherratt DJ. 1994. Interactions of the site-specific recombi-nases XerC and XerD with the recombination site dif. Nucleic Acids Res.22:5613–5620.
11. Sherratt DJ, Soballe B, Barre FX, Filipe S, Lau I, Massey T, Yates J.2004. Recombination and chromosome segregation. Philos. Trans. R. Soc.Lond. B Biol. Sci. 359:61– 69.
12. Semsey S, Blaha B, Köles K, Orosz L, Papp PP. 2002. Site-specificintegrative elements of Rhizobiophage 16-3 can integrate into prolinetRNA (CGG) genes in different bacterial genera. J. Bacteriol. 184:177–182.
13. Ramsay JP, Sullivan JT, Stuart GS, Lamont IL, Ronson CW. 2006.Excision and transfer of the Mesorhizobium loti R7A symbiosis island re-quires an integrase IntS, a novel recombination directionality factor RdfS,and a putative relaxase RlxS. Mol. Microbiol. 62:723–734.
14. Quintero V, Cevallos MA, Dávila G. 2002. A site-specific recombinase(RinQ) is required to exert incompatibility towards the symbiotic plasmidof Rhizobium etli. Mol. Microbiol. 46:1023–1032.
15. Brom S, García-de los Santos A, Cervantes L, Palacios R, Romero D.2000. In Rhizobium etli symbiotic plasmid transfer, nodulation competi-tivity and cellular growth require interaction among different replicons.Plasmid 44:34 – 43.
16. Brom S, Girard L, García-de los Santos A, Sanjuán-Pinilla JM, OlivaresJ, Sanjuán J. 2002. Conservation of plasmid-encoded traits among bean-nodulating Rhizobium species. Appl. Environ. Microbiol. 68:2555–2561.
17. Tun-Garrido C, Bustos P, González V, Brom S. 2003. Conjugativetransfer of p42a from Rhizobium etli CFN42, which is required for mobi-lization of the symbiotic plasmid, is regulated by quorum sensing. J. Bac-teriol. 185:1681–1692.
18. Pérez-Mendoza D, Domínguez-Ferreras A, Muñoz S, Soto MJ, OlivaresJ, Brom S, Girard L, Herrera-Cervera JA, Sanjuán J. 2004. Identificationof functional mob regions in Rhizobium etli: evidence for self-transmissibility of the symbiotic plasmid pRetCFN42d. J. Bacteriol. 186:5753–5761.
19. Pérez-Mendoza D, Sepúlveda E, Pando V, Muñoz S, Nogales J, OlivaresJ, Soto MJ, Herrera-Cervera JA, Romero D, Brom S, Sanjuán J. 2005.Identification of the rctA gene, which is required for repression of conju-gative transfer of rhizobial symbiotic megaplasmids. J. Bacteriol. 187:7341–7350.
20. Sepúlveda E, Pérez-Mendoza D, Ramírez-Romero MA, Soto MJ, López-Lara IM, Geiger O, Sanjuán J, Brom S, Romero D. 2008. Transcriptionalinterference and repression modulate the conjugative ability of the sym-biotic plasmid of Rhizobium etli. J. Bacteriol. 190:4189 – 4197.
21. Brom S, Girard L, Tun-Garrido C, García-de los Santos A, Bustos P,González V, Romero D. 2004. Transfer of the symbiotic plasmid ofRhizobium etli CFN42 requires cointegration with p42a, which may bemediated by site-specific recombination. J. Bacteriol. 186:7538 –7548.
22. Quinto C, de la Vega H, Flores M, Fernández L, Ballado T, Soberón G,Palacios R. 1982. Reiteration of nitrogen fixation gene sequences in Rhi-zobium phaseoli. Nature 299:724 –728.
24. Farrand SK, O’Morchoe SP, McCutchan J. 1989. Construction of anAgrobacterium tumefaciens C58 recA mutant. J. Bacteriol. 171:5314 –5321.
25. Simon R, Priefer U, Pühler A. 1983. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gramnegative bacteria. Biotechnology 1:784 –791.
26. Hanahan D. 1983. Studies on transformation of Escherichia coli withplasmids. J. Mol. Biol. 166:557–580.
27. Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A.1994. Small mobilizable multi-purpose cloning vectors derived from theEscherichia coli plasmids pK18 and pK19: selection of defined deletions inthe chromosome of Corynebacterium glutamicum. Gene 145:69 –73.
28. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, II,Peterson KM. 1995. Four new derivatives of the broad-host-range cloningvector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene166:175–176.
29. New England Biolabs. 2003. pMAL protein fusion and purification sys-tem instruction manual. New England Biolabs, Beverly, MA.
30. Scott HN, Laible PD, Hanson DK. 2003. Sequences of versatile broad-host-range vectors of RK2 family. Plasmid 50:74 –79.
31. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a labora-tory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Har-bor, NY.
32. Eckhardt T. 1978. A rapid method for the identification of plasmid des-oxyribonucleic acid in bacteria. Plasmid 1:584 –588.
33. Sanger FS, Nicklen S, Coulson AR. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74:5463–5467.
34. Lin J, Chen H, Dröge P, Yan J. 2012. Physical organization of DNA bymultiple non-specific DNA-binding modes of Integration Host Factor(IHF). PLoS One 7:e49885. doi:10.1371/journal.pone.0049885.
