Abstract Two-component systems are one of the mostprevalent mechanisms by which bacteria sense, respondand adapt to changes in their environment. The activationof a sensor histidine kinase leads to autophosphorylationof a conserved histidine residue followed by transfer ofthe phosphoryl group to a cognate response regulator inan aspartate residue. The search for antibiotics thatinhibit molecular targets has led to study prokaryotic two-component systems. In this study, we characterized in vitroand in vivo the BaeSR two-component system fromSalmonella Typhimurium and evaluated its role in mdtAregulation in response to ciproXoxacin treatment. We dem-onstrated in vitro that residue histidine 250 is essential forBaeS autophosphorylation and aspartic acid 61 for BaeRtransphosphorylation. By real-time PCR, we showed thatmdtA activation in the presence of ciproXoxacin depends onboth members of this system and that histidine 250 of BaeSand aspartic acid 61 of BaeR are needed for this. Moreover,the mdtA expression is directly regulated by binding of BaeRat the promoter region, and this interaction is enhancedwhen the protein is phosphorylated. In agreement, a BaeRmutant unable to phosphorylate at aspartic acid 61 presentsa lower aYnity with the mdtA promoter.
Keywords Two-component system · BaeSR · CiproXoxacin
Introduction
In prokaryotes, two-component systems (TCSs) transduceand interpret speciWc signals such as pH, temperature, osmo-larity, light, nutrients, ions and toxins to regulate a widerange of processes including motility, virulence, metabolism,developmental switches, antibiotic resistance and stressresponses (Batchelor and Goulian 2003; Cai and Inouye2002; Stock et al. 2000). Most of bacterial TCS sensors aremembrane-associated histidine kinases (HK) (Cock andWhitworth 2007; Grebe and Stock 1999; Laub and Goulian2007) that undergo autophosphorylation at a conserved histi-dine (His) residue in response to environmental signal(s).Subsequently, the His-bound phosphoryl group is transferredto an aspartic acid (Asp) residue located at the cognateresponse regulator (RR). Once activated, the RR binds to tar-get promoter regions and therefore controls gene expressionin response to external signals (Batchelor and Goulian 2006;Koretke et al. 2000). In E. coli, the baeSR genes were Wrstdescribed as putative members of a TCS (Nagasawa et al.1993) involved in drug resistance by regulating the expres-sion of genes that codify for drug transporters (Baranova andNikaido 2002; Nagakubo et al. 2002) and participating inresponse to envelope stress (Leblanc et al. 2011). The baeSRgenes are part of the yegMNOBbaeSR operon. It is likely thatboth YegN (MdtB) and YegO (MdtC) produce a com-plex(es) with the membrane fusion protein family memberYegM (MdtA) and pump out novobiocin and deoxycholate(Baranova and Nikaido 2002), indole (Hirakawa et al. 2005)and condensed tannins (Zoetendal et al. 2008). The responseregulator BaeR modulates the expression of mdtABC and
Communicated by Jan-Roelof van der Meer.
P. Guerrero and B. Collao were contributed equally to this work.
P. Guerrero · B. Collao · E. H. Morales · I. L. Calderón · F. Ipinza · S. Parra · C. P. Saavedra · F. Gil (&)Laboratorio de Microbiología Molecular, Departamento de Ciencias Biológicas, Facultad de Ciencias Biológicas, Universidad Andres Bello, República 217, Santiago, Chilee-mail: [email protected]
123
454 Arch Microbiol (2012) 194:453–460
acrD, which encode multidrug exporter systems (Hirakawaet al. 2005). BaeR overexpression in a �acrB E. coli strainconfers resistance against �-lactams, novobiocin, sodiumdodecyl sulfate and bile salts (Baranova and Nikaido 2002).However, the physiological role of the BaeSR TCS remainsunknown. In this context, Nishino et al. (2005) hypothesizedthat the BaeSR system controls the expression of a widerange of genes. Moreover, in Salmonella enterica serovarTyphimurium (S. Typhimurium), this system was reportedto increase multidrug (Nishino et al. 2007) and metal resis-tance (Yamamoto et al. 2008) through the induction of drugeZux systems, and Hu et al. (2005) described that aS. Typhimurium baeR knockout mutant showed a more-than-fourfold reduction in ceftriaxone resistance, suggesting thatbaeR plays a role in the resistance to this antibiotic. Theemergence and spread of antimicrobial-resistant Salmonellaenterica, particularly those that are resistant to severalantimicrobial agents, are a major public health concern.Multidrug resistance in salmonellae can be conferred byacquisition of multiple speciWc antibiotic resistance genescarried on plasmids and integrons or from mutations inchromosomal genes that reduce accumulation of multipleantibiotics (Ricci and Piddock 2009). In this study, we char-acterized in vitro and in vivo the BaeSR two-component sys-tem from S. Typhimurium and evaluated its role in mdtAregulation in response to ciproXoxacin treatment. We demon-strated in vitro that His 250 residue is essential for BaeS
autophosphorylation and Asp 61 residue for BaeR transphos-phorylation. Moreover, we show that both members of thissystem are required for mdtA activation under ciproXoxacintreatment and conWrmed that His 250 from BaeS and Asp 61from BaeR are required, even though BaeR binds speciWcallyto the mdtA promoter with more aYnity when the protein isphosphorylated.
Methods
Bacterial strains and culture conditions
The strains used were derivatives of S. Typhimurium 14028s.Cells were grown at 37°C, with shaking at 200 rpm in Luria–Bertani (LB) broth containing 10 g of bacto-tryptone, 10 g ofbacto-yeast extract and 5 g of NaCl per liter. The antibioticampicillin (100 �g ml¡1) was used for the selection of plas-mid-containing cells, arabinose 1 mM for pBAD-TOPO andIPTG 1 mM for pET101 TOPO induction.
Gene disruption
Gene disruption was performed according to the methoddescribed by Datsenko and Wanner (2000), and the resis-tance genes were eliminated by using the helper plasmidpCP20 encoding the FLP recombinase (Table 1).
Table 1 Bacterial strains used in this study
Strain Relevant characteristic(s) or genotype Source
S. Typhimurium
14028s Wild-type strain G. Mora
�baeS baeS::FRT This work
�baeS/pBAD-baeS �baeS strain complemented with pBAD vector carrying the S. Typhimurium baeS gene This work
�baeS/pBAD-baeS H250A �baeS strain complemented with pBAD vector carrying the S. Typhimurium baeS gene mutated at position 250
This work
�baeR baeR::FRT This work
�baeR/pBAD-baeR �baeR strain complemented with pBAD vector carrying the S. Typhimurium baeR gene This work
�baeR/pBAD-baeR D61A �baeR strain complemented with pBAD vector carrying the S. Typhimurium baeR gene mutated at position 61
BL21 pET-TOPObaeS BL21(DE3) transformed with the pET-TOPObaeS vector carrying the S. Typhimurium baeS gene
This work
BL21 pET-TOPObaeS H250A BL21(DE3) transformed with the pET-TOPObaeS vector carrying the S. Typhimurium baeS gene mutated at position 250
This work
BL21 pET-TOPObaeR BL21(DE3) transformed with the pET-TOPObaeS vector carrying the S. Typhimurium baeR gene
This work
BL21 pET-TOPObaeR D61A BL21(DE3) transformed with the pET-TOPObaeS vector carrying the S. Typhimurium baeR gene mutated at position 61
This work
123
Arch Microbiol (2012) 194:453–460 455
Cloning and overexpression of baeS and baeR
The S. Typhimurium baeS and baeR genes were ampliWedby PCR, cloned into pBAD-TOPO TA® and transformedinto E. coli TOP10 following the manufacturer’s instruc-tions (Invitrogen). Primer sequences were ATGAAAGTCTGGCGGCCCGG (pBAD-baeSFw); TACTTCTCTCTGTAAATCGC (pBAD-baeSRv); ATGACTGAATTACCCATTGA (pBAD-baeRFw) and TACCAGGCGACACGCATCCG (pBAD-baeRRv). The recombinant plasmids pBAD-baeS or pBAD-baeR were used for complementation andsite-directed mutagenesis experiments. For overexpression andprotein puriWcation, the S. Typhimurium baeS and baeRgenes were ampliWed by PCR, cloned into pET101-TOPOand transformed into E. coli BL21(DE3) following themanufacturer’s instructions (Invitrogen). Primer sequenceswere CACCATGAAAGTCTGGCGGCCCGG (pET-baeSFw); TACTTCTCTCTGTAAATCGC (pET-baeSRv);CACCATGACTGAATTACCCATTGA (pET-baeRFw)and TACCAGGCGACACGCATCCG (pET-baeRRv).
Site-directed mutagenesis
BaeS H250A and BaeR D61A mutations were generatedwith the QuickChange-Site-Directed Mutagenesis kit (Strata-gene, USA) using primers BaeSH250AFw (ATGGCGGATATTTCCGCCGAACTGCGCACGCCG), BaeSH250ARv(CGGCGTGCGCAGTTCCGGGGAAATATCCGCCAT),BaeRD61AFw (GATCTGATCCTGCTGGCCCTGATGCTGCCGGGT) and BaeRD61ARv (ACCCGGCAGCATCAGGGCCAGCAGGATCAGATC) according to the manu-facturer’s instructions using pBAD-baeS, pET-baeS, pBAD-baeR and pET-baeR as parental plasmids, respectively.Mutations were conWrmed by sequencing (Macrogen).
Protein puriWcation
Frozen E. coli BL21 (DE3) carrying pET-baeS or pET-baeR were suspended in 3 ml of lysis buVer containing100 mM phenylmethylsulfonyl Xuoride. After addition of80 �l of lysozyme (10 mg ml¡1), the cell suspension wasstored on ice for 30 min and lysed by sonication. After cen-trifugation at 15,000 rpm for 20 min at 4°C, the supernatantwas mixed with 2 ml of nickel–sepharose suspension (GEHealthcare) and loaded onto a column. After washing with10 ml of lysis buVer, the His-tagged BaeS, BaeS H250A,BaeR or BaeR D61A proteins were then eluted with 2 mleach of lysis buVer containing 0.05, 0.1 or 0.5 M imidazole.The recovery and purity of proteins in each eluate waschecked by SDS-PAGE. The puriWed protein fractions werepooled and dialyzed against storage buVer (50 mM Tris–HCl, pH 7.6, 4°C, 200 mM KCl, 10 mM MgCl2, 0.1 mMEDTA, 1 mM dithiothreitol and 50% glycerol). The protein
concentration was determined by the Coomassie Plus Pro-tein Assay Reagent (Thermo ScientiWc), and the purity waschecked by SDS-PAGE.
BaeS autophosphorylation
The autophosphorylation reaction was performed accordingto Yamamoto et al. (2005). PuriWed BaeS was diluted to1 �M in kinase buVer (50 mM Tris–HCl, pH 8.0, 37°C,50 mM KCl, and 10 mM MgCl2), and the phosphorylationreaction was initiated by adding 1 �Ci of [�-32P] ATP at aWnal concentration of 2.5 �M. The reaction was carried outat 37°C for various times and terminated by adding anequal volume of sample buVer (120 mM Tris–HCl, pH 6.8,4°C, 20% glycerol, 4% SDS, 10% �-mercaptoethanol and0.1% bromphenol blue). After SDS-PAGE, the gel waswashed with 45% methanol, 10% acetic acid, dried andexposed onto an image plate.
Transphosphorylation of BaeR by BaeS
The transphosphorylation reaction was performed accordingto Yamamoto et al. (2005). Phosphorylated BaeS (1 �M) wasmixed on ice with a mixture of BaeR (1 �M) and an excessof cold ATP (0.5 mM) and then incubated at 37°C for vari-ous times. The reaction was terminated by adding an equalvolume of sample buVer. The samples were analyzed bySDS-PAGE. The gel was washed with 45% methanol, 10%acetate, dried and exposed onto an image plate.
RNA isolation and mdtA mRNA detection
An overnight bacterial culture (wild-type and TCS mutantstrains) was diluted 100-fold with fresh LB medium andgrown at 37°C with shaking up to an OD600 t 0.5. The cul-ture was split into two 10 ml aliquots, and one of them wasincubated with 13 ng ml¡1 ciproXoxacin (Applichem).Cells were grown at 37°C, and 4 ml aliquots were with-drawn 20 min after ciproXoxacin exposure. Total RNA wasextracted using the GenElute Total RNA puriWcation kit(Sigma) following the manufacturer’s instructions. TotalRNA was treated with 2 U of DNase I to remove traceamounts of DNA. cDNA synthesis was carried out at 37°Cfor 1 h in 25 ml of a mixture that contained 2.5 pmol of thespeciWc primers, 10 �l of template RNA (5 �g), 0.2 mMdNTPs, 1 �l of nuclease-free water and 4 �l of 5£ buVer[250 mM Tris–HCl pH 8.3, 375 mM KCl, 15 mM MgCl2,10 mM DTT, 40 U of RNasin and 200 U of MMLV reversetranscriptase (Invitrogen)]. Relative quantiWcation of mdtAtranscript levels was performed by real-time RT-PCR(qRT-PCR) using the Brilliant II SYBR Green QPCR MasterReagent kit and the Mx3000P detection system (Stratagene).16S rRNA levels were used for normalization. The qRT-PCR
123
456 Arch Microbiol (2012) 194:453–460
mixture (20 �l) contained 1 �l of cDNA template, 120 nM ofeach primers [TTCTGGTTCTGGCATAGCCG (mdtARTFw)and TAACGGTATTCGCGGCGGTC (mdtARTRv) for themdtA gene; GTAGAATTCCAGGTGTAGCG (16SFw)and TTATCACTGGCAGTCTCCTT (16SRv) for the 16SrRNA gene (16S)] and 10 �l of ROX (1:200). The qRT-PCRwas performed under the following conditions: 10 min at95°C followed by 40 cycles of 30 s at 95°C, 45 s at 53°C and30 s at 72°C, followed by a melting cycle from 53 to 95°C tocheck for ampliWcation speciWcity. A previous standard quan-tiWcation curve with serial dilutions of RT-PCR products wasconstructed for each gene to calculate the ampliWcationeYciency. These values were used to obtain the ratio betweenthe gene of interest and the expression of the 16S rRNA geneas described by PfaZ (2001). All experiments were performedin three biological and technical replicates. The graphics wereperformed using the Graphpad Prism 5 software.
Gel electrophoretic mobility shift assay (EMSA)
Non-radioactive EMSA was performed according to the proto-col described by De la Cruz et al. (2007). The probes wereobtained by PCR using speciWc primers (mdtApromFw: GATGATTTCGGCTCCGTCAC and mdtApromRv: CGGTCGGGCTTTCGCTACGG) for promoter region ampliWcation(600 bp upstream to ATG). Each promoter and negativecontrol DNA (199 bp from mdtA-codifying region, ampliWedusing the mdtARTFw and mdtARTRv primers) (»2 ng ml¡1)was mixed with increasing concentrations of puriWed BaeR,BaeR-P (phosphorylated BaeR), BaeR D61A or BaeRD61A-P (phosphorylated BaeR D61A) in the presence ofbinding buVer (10 mM Tris–Cl [pH 7.5], 50 mM KCl, 5 mMMgCl2, 1 mM dithiothreitol, 2.5% glycerol, 0.05% NP-40).For the preparation of BaeR-P and BaeR D61A-P used inDNA binding studies, a standard phosphorylation reaction wasused in which the proteins (60 �g ml¡1, Wnal concentration)were incubated for 1 h at 30°C in a buVer containing 100 mMTris–Cl (pH 7), 10 mM MgCl2, 125 mM KCl and 50 mMdisodium carbamyl phosphate (Sigma) (Lynch and Lin, 1996).The mixture was incubated for 30 min at room temperatureand loaded on a native 6% polyacrylamide gel in 1£Tris–borate–EDTA buVer at 150 mV for 1.5 h. The DNAbands were visualized by ethidium bromide staining.
Results
PuriWcation of TCS components
For in vitro analysis of HK–RR interaction, 6£ His-taggedBaeR and BaeS from S. Typhimurium were puriWed. Thesensor HK is generally composed of two domains, theamino-terminal membrane-associated domain for monitoring
an external signal(s) and the carboxyl-terminal cytoplasmicdomain with catalytic function of His phosphorylation. WepuriWed the cytoplasmic BaeS domain, which retains theautophosphorylation and transphosphorylation activity tothe cognate RR BaeR in the absence of the eVector-bindingdomain as described to this system in E. coli (Yamamotoet al. 2005). The coding sequences for the carboxyl-termi-nal domain for BaeS with the 6£ His tag sequence at thecarboxyl terminus were PCR-ampliWed and inserted intopET101 to generate the respective recombinant plasmid.
BaeS and BaeS H250A autophosphorylation
PuriWed BaeS and BaeS H250A from S. Typhimurium weresubjected to autophosphorylation in the presence of radio-active ATP. As shown in Fig. 1, puriWed BaeS was able toautophosphorylate, reaching the highest level of phosphor-ylation after 15 min. After this point, the phosphorylationlevel did not increase. In parallel, BaeS H250A was incu-bated in the same conditions as the native protein; however,autophosphorylation was not observed (data not shown) atany times, indicating that His 250 residue is required forBaeS autophosphorylation in vitro.
BaeR transphosphorylation by BaeS
To evaluate whether BaeS was able to transphosphorylateBaeR, a Wxed amount of BaeS was incubated with [�-32P]ATP, allowed to autophosphorylate until saturation (seeFig. 1) and then mixed with an equal molar amount ofBaeR and an excess amount of unlabeled ATP (100-foldmolar excess over the radiolabeled ATP). BaeR phosphory-lation level was estimated by detecting both the increase inBaeR-associated 32P radioactivity and the decrease inBaeS-associated radioactivity (Fig. 2a). The maximumlevel of transphosphorylation was observed within 15 min.As a control, BaeR protein was incubated in the presence of[�-32P] ATP for 30 min, and no phosphorylation wasobserved, conWrming that the presence on BaeS–P is funda-mental for transphosphorylation to BaeR. For the case of
Fig. 1 In vitro BaeS autophosphorylation. One micromolar ofpuriWed BaeS was incubated in kinase buVer containing 1 �Ci of[�-32P]ATP at a Wnal concentration of 2.5 �M at 37°C for the indicatedtimes (30 s–30 min). The autophosphorylation reaction was termi-nated by adding an equal volume of 2£ sample buVer. The reactionmixture was directly subjected to SDS-PAGE. After electrophoresis,the gel was washed, dried and exposed onto an image plate
123
Arch Microbiol (2012) 194:453–460 457
BaeS–BaeR D61A, transphosphorylation was not observedas indicated by the absence of BaeR radioactivity, indicat-ing that Asp 61 residue is critical in phosphate transfer(Fig. 2b).
Detection of mdtA mRNA after ciproXoxacin treatment
BaeS and BaeR are members of a TCS and are suggested tobe part of an operon being the last two genes of a cluster of6 genes, whose expression is positively regulated by BaeRin multidrug and metals treatment (Nishino et al. 2007). Forthis reason, mdtA, the Wrst gene of the operon, was used as apositive control to characterize BaeSR functionality. ThemdtA mRNA was detected in a wild-type, �baeR and�baeS strain. As shown in Fig. 3a, mdtA mRNA levelswere dramatically decreased in both �baeR and �baeS withrespect to the wild-type strain and restored in the comple-mented strain. When ciproXoxacin was added, mdtA tran-script levels were increased about tenfold in a WT strain(Fig. 3b); however, in the �baeS and �baeR strains treatedwith ciproXoxacin, mdtA levels showed no increase andremained lowered. When the �baeS and �baeR strainswere complemented in trans with pBAD-baeS and pBAD-baeR, respectively, mdtA transcript levels were establishedin the presence of ciproXoxacin (Fig. 3b); however, aftercomplementating the �baeS strain with a pBAD-baeSH250A, mdtA levels were not restored. Similar results wereobserved in a �baeR strain complemented with pBAD-baeR D61A (Fig. 3b). These results indicate that His 250residue from BaeS and Asp 61 residue from BaeR areessential for the function of this two-component system andthe activation of the target gene mdtA in S. Typhimurium.
BaeR–P binds to the mdtA promoter region
Electrophoretic mobility shift assays were performed withphosphorylated BaeR-6£ His and a 600 bp DNA fragmentof the upstream region of mdtA as described in methods. Asa negative control, a 199 bp fragment including an mdtA-codifying region was used. With 0.3 �M BaeR-P (phos-phorylated BaeR), we observed the formation of a discretecomplex between BaeR-6£ His and the mdtA promoter thatremained stable during electrophoresis (Fig. 4b). In thepresence of increasing concentrations of BaeR-6£ His,more probes became associated with the protein. In addi-tion, no interaction was observed with a 199 bp DNA frag-ment of the S. Typhimurium mdtA-codifying region. Whenwe used non-phosphorylated BaeR, the band shift patternwas diVerent and bound at higher protein concentrations,suggesting that phosphorylation is critical for BaeR aYnityto the promoter region (Fig. 4a). The BaeR D61A proteinshowed lower aYnity for the mdtA promoter at the sameconcentrations used for the native BaeR protein (Fig. 4c),and even after phosphorylating BaeR D61A, the aYnitywas lower than that observed for BaeR-P, indicating thatphosphorylation of residue Asp 61 is important for BaeRbinding to DNA (Fig. 4d).
Discussion
The growing number of clinical isolates showing multipleantibiotic resistance due to the indiscriminate use of theseincreases on a daily basis, therefore, having a clear under-standing of the physiology and bacterial response to antibiotic
Fig. 2 In vitro transphosphoryl-ation of BaeR by BaeS. Phos-phorylated BaeS was prepared by incubation with [�-32P]ATP at 37°C for 15 min. Transphos-phorylation in vitro was per-formed by mixing equimolar amounts of phosphorylated BaeS and puriWed BaeR in the presence of an excess amount of unlabeled ATP (0.5 mM) for the indicated times (30 s–15 min) at 37°C. The reaction mixture was directly subjected to SDS-PAGE. The amounts of phos-phorylated BaeS and BaeR were measured as in Fig. 1. a Transphosphorylation from BaeS–P to BaeR. b Transphosphorylation from BaeS–P to BaeR D61A
123
458 Arch Microbiol (2012) 194:453–460
would develop more eVective therapies. In the search ofnew targets for antibiotic action, the characterization ofTCSs is attractive for several reasons. First of all, they arewidespread in bacteria and, so far, absent in mammals(Stock et al. 2000). Therefore, general HK or RR inhibitorscould potentially be used as targets for broad-spectrumantibiotics. Alternatively, by targeting speciWc HKs or RRs,selective inhibition may be achieved. Perhaps, the mostattractive reason for targeting TCSs is that they are used bypathogenic bacteria to control the expression of virulencefactors required for infectivity (Stock et al. 2000). Interest-ingly, some bacteria have developed TCSs that regulateresistance to certain chemotherapeutics. These include thevancomycin resistance systems in Enterococcus faecalis
(VanR/VanS) (Evers and Courvalin 1996) and Streptococ-cus pneumoniae (VncS/VncR) (Novak et al. 1999), as wellas the system associated with tetracycline resistance in Bac-teroides fragilis (RprX/RprY) (Rasmussen and Kovacs1993). Genome sequencing projects have demonstrated thattwo-component signal transduction systems represent thesingle largest paralogous family of signaling proteins in thebacterial kingdom (Laub and Goulian 2007). A great diver-sity of regulatory mechanisms has been overlaid on the cen-tral phosphotransfer/phosphorelay pathways, allowingoptimization of signal transmission for the speciWc needs ofeach system (Pratt and Silhavy 1995). In this study, weshow novel evidence that demonstrated the functionality ofthe BaeSR TCS from S. Typhimurium determining its auto-and transphosphorylation in vitro and the mdtA expressionunder ciproXoxacin treatment. Typically in TCSs, a speciWcsignal is sensed by the HK, which undergoes autophospho-rylation at a speciWc histidine residue, in this case His 250from BaeS in S. Typhimurium. This phosphoryl group isthen transferred to an aspartate residue of the cognateresponse regulator (Hoch 2000), which for the case of BaeRis Asp 61, resulting in its activation. The BaeSR system hasbeen related to resistance to diverse antibiotics like novobi-ocin in E. coli, in which a baeR cloned in multicopy plas-mid signiWcantly increased the resistance of the �acrAB(described as acridine eZux system) host strain to this anti-biotic (Baranova and Nikaido 2002) and a S. Typhimuriumstrain in which a transposon mutant in the regulator genebaeR of this two-component system showed a more-than-fourfold reduction in the resistance to ceftriaxone (Hu et al.2005). This evidence suggests that overproduction of BaeRdecreased drastically the drug accumulation, presumablyvia increased active eZux, or the absence of the regulator isinvolved in a loss of resistance. Our results show that mdtAexpression (member of a multidrug eZux system) inS. Typhimurium is upregulated in response to subinhibitoryconcentrations of ciproXoxacin. This is a chemotherapeuticbactericidal antibiotic of the Xuoroquinolone drug class andkills bacteria by stopping DNA synthesis (Nelson et al.2007) and is widely used to treat a number of infections,including those caused by Enterobacteriaceae. Moreover,Baek et al. (2009) conducted a study of both the transcrip-tome and the proteome of E. coli strains treated with methylmethanesulfonate (compound that causes DNA damage),which showed an increase in the expression of several tran-scriptional factors, as well as an increase in the expressionof baeR. This suggests a possible role for this TCS in theregulation of gene expression against damage, such asthe one caused to DNA by ROS-generating compounds,as a consequence of bactericidal antibiotics like ciproXoxa-cin (Kohanski et al. 2007). In this sense, we foundsequences resembling the BaeR box (Nishino et al. 2005) inthe upstream region of the mdt-bae operon from
Fig. 3 mdtA expression in a S. Typhimurium wild type, �baeS and�baeR. Exponentially growing cells were exposed to ciproXoxacin(13 ng ml¡1) for 20 min. Controls received no treatment. a mdtA tran-scripts were detected by qRT-PCR in wild-type, baeS, baeR mutantstrains and complemented strains. b mdtA transcripts were detected byqRT-PCR in wild-type control and ciproXoxacin treatment for wild-type, baeS and baeR strains, and complementation of mutant strainswith plasmids carrying wild-type (�baeS/pBAD-baeS and �baeR/pBAD-baeR) or mutagenic (�baeS/pBAD-baeS H250A and �baeR/pBAD-baeR D61A) genes
123
Arch Microbiol (2012) 194:453–460 459
S. Typhimurium, and consistent with this, we show bymeans an electrophoretic mobility shift assay that the BaeRprotein binds to this region and had more aYnity when theprotein was phosphorylated. However, we also observedmore aYnity when the D61A mutant was phosphorylatedwith carbamyl phosphate. This could be explained due tounspeciWc phosphorylation by carbamyl phosphate at otherresidues of the protein as reported for ArcA by Jeon et al.(2001). This unspeciWc phosphorylation could produce con-formational changes in the protein that increase its aYnityfor the promoter, although this has not been determined sofar. Taken together, our results and the previous evidencesuggest that the BaeS/BaeR TCS might generate a positivefeedback loop by regulating the mdt-bae operon in the pres-ence of ciproXoxacin, probably overexpressing the mem-bers of the operon that function like a multidrug transporteror activating genes that participate in bacteria detoxiWcationand DNA damage repair. Further investigation in the regu-lation of TCSs in several natural environments, such asthose found inside hosts, or under certain drugs treatmentsis needed in order to understand the biological signiWcanceof their regulatory networks. Such investigation may pro-vide further insights into the role of this and other systemsin the physiology of the cell.
Acknowledgments This work was supported by grants from FOND-ECYT #11100142 and DI-UNAB 08-10/R to FG.
References
Baek JH, Han MJ, Lee SY, Yoo JS (2009) Transcriptome and proteomeanalyses of adaptive responses to methyl methanesulfonate in Esch-erichia coli K-12 and ada mutant strains. BMC Microbiol 9:186
Baranova N, Nikaido H (2002) The baeSR two-component regulatorysystem activates transcription of the yegMNOB (mdtABCD) trans-porter gene cluster in Escherichia coli and increases its resistanceto novobiocin and deoxycholate. J Bacteriol 184:4168–4176
Batchelor E, Goulian M (2003) Robustness and the cycle of phosphor-ylation and dephosphorylation in a two-component regulatorysystem. Proc Natl Acad Sci USA 100:691–696
Batchelor E, Goulian M (2006) Imaging OmpR localization in Esche-richia coli. Mol Microbiol 59:1767–1778
Cai SJ, Inouye M (2002) EnvZ–OmpR interaction and osmoregulationin Escherichia coli. J Biol Chem 277:24155–24161
Cock PJ, Whitworth DE (2007) Evolution of prokaryotic two-compo-nent system signaling pathways: gene fusions and Wssions. MolBiol Evol 24:2355–2357
Datsenko KA, Wanner BL (2000) One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. ProcNatl Acad Sci USA 97:6640–6645
De la Cruz MA, Fernández-Mora M, Guadarrama C, Flores-ValdezMA, Bustamante VH, Vázquez A, Calva E (2007) LeuO antago-nizes H-NS and StpA-dependent repression in Salmonella enteri-ca ompS1. Mol Microbiol 66:727–743
Evers S, Courvalin P (1996) Regulation of VanB-type vancomycinresistance gene expression by the VanS(B)–VanR (B) two-com-ponent regulatory system in Enterococcus faecalis V583.J Bacteriol 178:1302–1309
Grebe TW, Stock JB (1999) The histidine protein kinase superfamily.Adv Microb Physiol 41:139–227
Fig. 4 Electrophoretic mobility shift assay for the BaeR binding to the mdtA promoter region. A total of 0.15 pmol of DNA frag-ments including the mdtA pro-moter region (600 bp) and negative control (199 bp from mdtA-codifying region) were incubated with or without vari-ous concentrations of BaeR (a), BaeR-P (b) (phosphorylated BaeR), BaeR D61A (c) and BaeR D61A-P (d) (phosphorylated BaeR D61A). Samples were electro-phoresed on a 6% non-denatur-ing PAGE and stained with ethidium bromide
123
460 Arch Microbiol (2012) 194:453–460
Hirakawa H, Inazumi Y, Masaki T, Hirata T, Yamaguchi A (2005)Indole induces the expression of multidrug exporter genes inEscherichia coli. Mol Microbiol 55:1113–1126
Hoch JA (2000) Two-component and phosphorelay signal transduc-tion. Curr Opin Microbiol 3:165–170
Hu WS, Li PC, Cheng CY (2005) Correlation between ceftriaxoneresistance of Salmonella enterica serovar Typhimurium andexpression of outer membrane proteins OmpW and Ail/OmpX-like protein, which are regulated by BaeR of a two-componentsystem. Antimicrob Agents Chemother 49:3955–3958
Jeon Y, Lee YS, Han JS, Kim JB, Hwang DS (2001) Multimerizationof phosphorylated and non-phosphorylated ArcA is necessary forthe response regulator function of the Arc two-component signaltransduction system. J Biol Chem 276:40873–40879
Kohanski MA, Dwyer DJ, Hayete B, Lawrence CA, Collins JJ (2007)A common mechanism of cellular death induced by bactericidalantibiotics. Cell 130:797–810
Koretke KK, Lupas AN, Warren PV, Rosenberg M, Brown JR (2000)Evolution of two-component signal transduction. Mol Biol Evol17:1956–1970
Laub MT, Goulian M (2007) SpeciWcity in two-component signaltransduction pathways. Annu Rev Genet 41:121–145
Leblanc SK, Oates CW, Raivio TL (2011) Characterization of theinduction and cellular role of the BaeSR two-component envelopestress response of Escherichia coli. J Bacteriol 193:3367–3375
Lynch AS, Lin EC (1996) Transcriptional control mediated by theArcA two-component response regulator protein of Escherichiacoli: characterization of DNA binding at target promoters.J Bacteriol 178:6238–6249
Nagakubo S, Nishino K, Hirata T, Yamaguchi A (2002) The putativeresponse regulator BaeR stimulates multidrug resistance of Esch-erichia coli via a novel multidrug exporter system, MdtABC.J Bacteriol 184:4161–4167
Nagasawa S, Ishige K, Mizuno T (1993) Novel members of the two-component signal transduction genes in Escherichia coli.J Biochem 114:350–357
Nelson JM, Chiller TM, Powers JH, Angulo FJ (2007) Fluoroquinolone-resistant Campylobacter species and the withdrawal of Xuoro-
quinolones from use in poultry: a public health success story. ClinInfect Dis 44:977–980
Nishino K, Honda T, Yamaguchi A (2005) Genome-wide analyses ofEscherichia coli gene expression responsive to the BaeSR two-component regulatory system. J Bacteriol 187:1763–1772
Nishino K, Nikaido E, Yamaguchi A (2007) Regulation of multidrugeZux systems involved in multidrug and metal resistance ofSalmonella enterica serovar Typhimurium. J Bacteriol 189:9066–9075
Novak R, Henriques B, Charpentier E, Normark S, Tuomanen E(1999) Emergence of vancomycin tolerance in Streptococcuspneumoniae. Nature 399:590–593
PfaZ MW (2001) A new mathematical model for relative quantiWca-tion in real-time RT-PCR. Nucleic Acids Res 29:45
Pratt LA, Silhavy TJ (1995) IdentiWcation of base pairs important forOmpR-DNA interaction. Mol Microbiol 17:565–573
Rasmussen BA, Kovacs E (1993) Cloning and identiWcation of a two-component signal-transducing regulatory system from Bacteroi-des fragilis. Mol Microbiol 7:765–776
Ricci V, Piddock LJ (2009) CiproXoxacin selects for multidrug resis-tance in Salmonella enterica serovar Typhimurium mediated byat least two diVerent pathways. J Antimicrob Chemother 63:909–916
Yamamoto K, Hirao K, Oshima T, Aiba H, Utsumi R, Ishihama A(2005) Functional characterization in vitro of all two-componentsignal transduction systems from Escherichia coli. J Biol Chem280:1448–1456
Yamamoto K, Ogasawara H, Ishihama A (2008) Involvement of mul-tiple transcription factors for metal-induced spy gene expressionin Escherichia coli. J Biotechnol 133:196–200
Zoetendal EG, Smith AH, Sundset MA, Mackie RI (2008) The BaeSRtwo-component regulatory system mediates resistance to con-densed tannins in Escherichia coli. Appl Environ Microbiol74:535–539
