J. Mol. Bid. (1987) 198, 281-293 Characterization of the Binding Sites of cl Repressor of Bacteriophage Pl”f Evidence for Multiple Asymmetric Sites James L. Eliason and Nat Sternberg Central Research and Development Department E. 1. du Pant de Nemours and Company, Inc. Experimental Station Wilmington. DE 19898, cT’.i\‘.d. (Received 27 Mny 1987) The repressor of bacteriophage Pl, encoded by the cl gene, is responsible for maintaining a Pl prophage in the lysogenic state. In this paper we present: (1) the sequence of the rightmost 943 base-pairs of the Pl genetic map that includes the $-terminal 224 base- pairs of the cl gene plus its upstream region; (2) the construction of a plasmid that directs the production of approximately 5 y6 of the cell’s protein as Pl repressor; (3) a delet,ion analysis that establishes the startpoint of Pl repressor translation; (4) filter binding experiments that demonstrate that Pl repressor binds to several regions upstream from the cl gene; (5) DNase I footprint experiments that’ directly identify two of the Pl repressor binding sites. Sequences very similar to the ident’ified binding sites occur in at least 11 sites in Pl, in most cases near functions known, or likely. to be controlled by repressor. From these sites we have derived the consensus binding site sequence ATTGCTCTAATAAATTT. We suggest that, unlike other phage operators. the PI repressor binding sites lack rotational symmetry. 1. Introduction Bacteriophage Pl is a temperate phage of Escherichia coli. In t,he prophage state Pl exists as a circular plasmitl with a copy number equal to that of the bacterial chromosome (Ikeda 8r Tomizawa. 1969). The prophage is maintained by a replication and partition system that’ ensures that less than one in lo4 cell djvisions result in the loss of the prophage (Rosrrer, 1972; Austin et al., 1981). The expression of phage vegetative functions is repressed by t,he a&ion of a multicomponent immunity system (for reviews, see St,ernberg & Hoess, 1983; Yarmolinsky & Sternberg, 1987). The repressor of phage lytic functions (henceforth called Pl repressor) is encoded by the cl gene (Scott. 1970). The nnt gene codes for an anti-repressor that interferes with PI repressor action (Wandersman & Yarmolinsky, 1977), and the c4 gene codes for a repressor of anf (Scott. et al., 1978). Pl phage with mutations that inactivat#e either cl or c4 do not produce lysogens. Virulent mutants of Pl called Plz!irR grow in the presence of Pl repressor because their ant genes are not repressed by the c4 gene product. Mutations that inactivate the ant gene allow c-t- phage and virR phage, but not’ cl - phage. t Contribution no. 4306. to form lpsogens (Wandersman & Yarmolinsky, 1977; Scott et il.. 1978). The Pl genetic map is conventionallv drawn as a cxircle divided into 100 map unit,s (i’armolinsky, 19X7; Yarmolinsky & Sternberg. 1987). The O/l00 point is the 1oxP site, at which site-specific recombination occurs (Sternberg 8; Hamilton, 19X1). This recombination unlinks markers flanking lord’, and results in a linear genetic map with the left end at. 0 map units and the right end at 100. Genetic experiments have localized the cl gene t.o the right, end of the Pl genetic map (Scott, 1968). Cloning experiments have established that it is encoded in the region common to 1’1 EcoRI fragment 7 and BumHI fragment, 2 (0.64 to 2.7 kbf from the loxf’ site: (see Fig. 1) (Sternberg, 1979; Raumstark et al., 1987; N. Sternberg, unpublished results). Pl repressor has a molecular weight of 33.000 (Heilman et al., 1980) and binds specifically to A fragment of Pl DNA that is contained between map positions 99.5 and 100 (Baumstark & Scott, 1980; Baumstark et al., 1987). Repressor also directly represses the PI bun gene (map position 76) (Austin et al.. 1978), the Pl wf gene (map position 2: L&‘indle & Hayes, 1986). and a Pl $ Abhrwiations used: kb. IO3 base,-pairs: hp. basr- pair(s).
Transcript
J. Mol. Bid. (1987) 198, 281-293
Characterization of the Binding Sites of cl Repressor of Bacteriophage Pl”f
Evidence for Multiple Asymmetric Sites
James L. Eliason and Nat Sternberg
Central Research and Development Department E. 1. du Pant de Nemours and Company, Inc.
Experimental Station Wilmington. DE 19898, cT’.i\‘.d.
(Received 27 Mny 1987)
The repressor of bacteriophage Pl, encoded by the cl gene, is responsible for maintaining a Pl prophage in the lysogenic state. In this paper we present: (1) the sequence of the rightmost 943 base-pairs of the Pl genetic map that includes the $-terminal 224 base- pairs of the cl gene plus its upstream region; (2) the construction of a plasmid that directs the production of approximately 5 y6 of the cell’s protein as Pl repressor; (3) a delet,ion analysis that establishes the startpoint of Pl repressor translation; (4) filter binding experiments that demonstrate that Pl repressor binds to several regions upstream from the cl gene; (5) DNase I footprint experiments that’ directly identify two of the Pl repressor binding sites. Sequences very similar to the ident’ified binding sites occur in at least 11 sites in Pl, in most cases near functions known, or likely. to be controlled by repressor. From these sites we have derived the consensus binding site sequence ATTGCTCTAATAAATTT. We suggest that, unlike other phage operators. the PI repressor binding sites lack rotational symmetry.
1. Introduction
Bacteriophage Pl is a temperate phage of Escherichia coli. In t,he prophage state Pl exists as a circular plasmitl with a copy number equal to that of the bacterial chromosome (Ikeda 8r Tomizawa. 1969). The prophage is maintained by a replication and partition system that’ ensures that less than one in lo4 cell djvisions result in the loss of the prophage (Rosrrer, 1972; Austin et al., 1981). The expression of phage vegetative functions is repressed by t,he a&ion of a multicomponent immunity system (for reviews, see St,ernberg & Hoess, 1983; Yarmolinsky & Sternberg, 1987). The repressor of phage lytic functions (henceforth called Pl repressor) is encoded by the cl gene (Scott. 1970). The nnt gene codes for an anti-repressor that interferes with PI repressor action (Wandersman & Yarmolinsky, 1977), and the c4 gene codes for a repressor of anf (Scott. et al., 1978). Pl phage with mutations that inactivat#e either cl or c4 do not produce lysogens. Virulent mutants of Pl called Plz!irR grow in the presence of Pl repressor because their ant genes are not repressed by the c4 gene product. Mutations that inactivate the ant gene allow c-t- phage and virR phage, but not’ cl - phage.
t Contribution no. 4306.
to form lpsogens (Wandersman & Yarmolinsky, 1977; Scott et il.. 1978).
The Pl genetic map is conventionallv drawn as a cxircle divided into 100 map unit,s (i’armolinsky, 19X7; Yarmolinsky & Sternberg. 1987). The O/l00 point is the 1oxP site, at which site-specific recombination occurs (Sternberg 8; Hamilton, 19X1). This recombination unlinks markers flanking lord’, and results in a linear genetic map with the left end at. 0 map units and the right end at 100. Genetic experiments have localized the cl gene t.o the right, end of the Pl genetic map (Scott, 1968). Cloning experiments have established that it is encoded in the region common to 1’1 EcoRI fragment 7 and BumHI fragment, 2 (0.64 to 2.7 kbf from the loxf’ site: (see Fig. 1) (Sternberg, 1979; Raumstark et al., 1987; N. Sternberg, unpublished results). Pl repressor has a molecular weight of 33.000 (Heilman et al., 1980) and binds specifically to A fragment of Pl DNA that is contained between map positions 99.5 and 100 (Baumstark & Scott, 1980; Baumstark et al., 1987). Repressor also directly represses the PI bun gene (map position 76) (Austin et al.. 1978), the Pl wf gene (map position 2: L&‘indle & Hayes, 1986). and a Pl
$ Abhrwiations used: kb. IO3 base,-pairs: hp. basr- pair(s).
6 Rellgate
Figure 1. kwtial twtric~tiwi rna~) of’ hhR1 f’ragmwt 7 it1111 r.onstruc*tioti of rrJ~ressor ovrrJnwJ”“i,lt(t~~ing Jtlastnids. The toJt right section of the Figure shows it portion of t hr 1’1 map surrounding the /().).I’ site. and sholvs t.hr ~1 gene. thr2 /+oRJ. HomHT and Stt/c~J sites. and the ttames of’the /GoIi J ant1 RnwHJ fragmrttts. The ttutttlwrs underneath t htl sites are the 1’1 maJ) Jwsitions (Tarmolinsky & Sternberg. 19Si). To cwnstruvt pSS2762. F:cwRJ fragment 7 of Pl DXA was cleaved with BnnlHT and ~S’amI. and the 2.4 kh fragment containing ~1 was isolated. pRBK6 was c~lravrtl with I’vctJJ and BantHl. mixed aith the ~1 f’ragttrc~ttt and ligated. To construct the p,IJ,JC:52C) series of ltlasmids. pKS2itil was linearized with Rrrtt~HT. digested u it It H~l3l as drsc*rihetl in Materials attd Methods. and c.ut with HIMI: kinawd Brrw HI linkrrs \vyrt’ ligated to thr rnds. ~~swss linkers wrt~ removed hy tligrstion with Hr/wHT. and the l)Ki\ was rrligatrd. The ltrewnce of the hat/t H J tinkw. tht, ahsrnw of t)he \l~0~~/1nrnHT fragment antl an estinratc of the t~strnt of the tlclrtion \vrrc tlt~trrtnittt~d lty cliprstion with Nrtrn H I and /Q/l I J~~ILF,520 plasmids Al. AS. A6. A9. AIO. A11, AIX Al-t tttl(i Al 6 had the r~sprctctf structurw and were analyzctl frirt htlr. ~~~II,E:i”Odl:~l3 \\-a s c~onstruc~trtl ftY~tl1 l).J I~IST,POAI 3 as cltw*rilwtl in the test.
promoter located at map posit)ion 53 (Yarmolinsk~ 8r R&rnberg, 1987; Sternberg ~1 ~1.. 1986) that has a rolr in Iytic DSA replic2t~ion (G. (‘ohen 8 S. Sternberg, unpublished results: E. Hansen. personal cwmmunication). Thus, unlike t.he repwssors of t)hr li~.mbda family of phages ((‘arnphll B Hotstein. l%G), Pl repressor acts at. many widely separat,ed sites on t’hr phage genomv.
The IINA binding sites for most prokaryotic~ regulatory prot,eins. including all \~rll-characterized phage repressors. are 14 t)o 11 bp long and have substantial %fold rotational symmetry (I’abo 8: Saw&r. 1984). In t’his paper we identify xcvrral binding sites for I’1 repressor by J)Na,se J fooi.print c,xperimrnts and nitrocellulose filter binding. These twults suggest that the binding sites for 1’1 rrprtwor differ from other phage operatjors not oni> in their phwement in the genomr. but also in that they lavk significant rotational symmc%ry.
2. Materials and Methods
(a) 8fmirt.s
The bacterial strains (and their genotypes) used in this study were: KS2739 (F-sf? his
I, broth. J, agar plates anti I,(‘.4 Jtlatrn (I, agar plus 2 trxv-(‘a(‘l,) wwe used as drsc*ribt~d hy Stern twrg 6 Hamilton (I 981 ). Restriction rnxymrs. KltvtoM t’ragtnt~ttt of J)S;\ lwlytnrrasr I. Jthagr T4 J)ol?nuc~lrotitIr kinaw. and ‘1’4 11X.4 ligase were obtainrd front lit%hestla Research Laboratories or New England Biolabs anti wert’ used according to the rec~orrtmertcJatiotts of the supJ)lirr. Esonwlraw Bn/3l was obtained from IMhrsda Rjcwawh Laboratories. &xl31 digestions wrc carried out fix 5 to PO s it1 20 rn>f-Tris. HCI (JtH 8+). I:! trtbl-&$‘I,. II mw(‘a(‘l,. 60 mwKa(‘l. 1 tnl\l-EJ)T,~ with I unit of enzyme;4 pg of plasrnid 1)X-A. I’ndrr these c,onditions thcb enzyme digests aJ)J)roxirnat,rly 300 bp;min. Thr rrac~tiott was tjrrrttinattvi by extraction with phenol. I)Sase I was obtained from J~oehrinprr-Matirilieirn. Protein tttc~lrc~ular \veight markers were J~urchasrd front J3io-Rad. HowHJ linkers ((‘(K~ATUX) were purchased from (‘ollahorativv Research. and J)hosJ)horylatrd as describtd hy hlattiatis rl al. (I 981).
3’.J,ahrling was Jwrformrd tvith the Kleno\v t’ragtttt~ttt of’ I)XA polytnerasr I and an [a”2P]dSTJ’ as drsc~ribetl I)> Maniatis rt ol., (1982). 5’ I,a,brling was Jwrformetl with T4 polynuclrotidr kinasr and ( 32PI,-2TP (Mania,tis rf rtl.. 1982).
Sequencing hy the chain termination tnrthod (Sangw vl (II.. 19X) was carried out on templates derived by clotting I’1 sryutwcrs into XJ13 vectors mpl0 and rnpl I (Messing. 1983). Sequencing by the chernival degradation mrthotl was performed as described by Maxam B (:ilbrrt (1977). Samples obtained hy both m&hods wcrc analyztxd b> rlectrophoresis on X0, (w/v) acrylamidr/urra gels (Sangrt 8: (‘oulson. 1978) followed by autoradiography using a DuPont Owwi intensifj?ng screen.
X82739 cnontaining plastnid JtNiSd762 or onr of thr pJLE520 series of plasmids was grown in J, broth at, 30°C’ to an OD,,, of’05 and the culture was divided in half. Ow half was incubated at 42 ‘(” and the ot,hrr \VRS left at 3OY”. After 4 h. 0.2 ml of each culture was wntrifugrd. and the cell Jwllet was resuspended and ana,lyzeti on 15”,, (n/v) acrylamide/SDS gels accwdinp to Larmrnli (1970).
(f) t’rrparation of’ cd (i.rtracf.5
Strain KS2739 vontaininp a plasmid was grown in 2.50 ml of hroth cont,aitting 2.5 pg ampicillin/ml to an OT),,,
PI Repressor Binding Sitm ‘83
of 0.5, shifted to 42°C by immersion in hot water. and incubated at) 42Y’ for 3.5 h. The cells were pelleted. resuspended in 2 ml of lysis buffer (100 mM-Tris. HCI (pH 8.0). 200 rnM-KC]. 0.1 mw-dithiothreit)ol, 1 mM- FDTA. 5”/, (v/v) glycerol). sonicated in the presence of 1 0.5 mg phenylmethylsulfonyl fluoride/ml, and centrifuged at 13.000 revs/min in a Sorvall SS-34 rotor for 45 min. The supematant was saved.
(g) I’1 reprraaor assays
In the immunity assay, IO8 cells of strain 532738 containing either plasmid pRK6. plasmid pNS2762. or one of the pJLE520 plasmids, were plated on LCA plates. Then 10 ~1 of several dilutions of PlCmGrRant6 and PlCmzYrB lysates were spotted onto the plates. which were then incubated overnight at 37°C. The efficiency of plating of PlCmrQrHnntB was approximately 10e3 on strains producing avtivr PI repressor (posit&r strains) and 0.X to I.1 on strains that did not produce active rrpr~sor (negative strains). PlCmairB plated with unit efficiency on all strains. Plating efficiencies were nor- malized to the plating on zu’S2738 containing pRK6. I’nder these conditions the t’, promoter on the plasmid is substantially. but not completely, repressed.
Tn the hnn expression assay the colony-forming abilit) of strain NS479 (APl: ban) containing plasmid pRK6, plasmid pNS2762 or one of the pJLE520 plasmids was measured at both 30 and 42°C. Strains that did not produce actjive rq’ressor had the same efficiency of plating at both temperatures. since expression of the ha?, gene c~omplements the temperative-sensitive mutation in the dntrB gene (1)‘Ari it nl.. 1975). In contrast. strains containing plasmids t)hat direct the expression of’ act,ivr rtapressor do not express hull (Austin rt aZ.. 1978) and form c*olonirs with an rffic*ienc~y of plating of less t,han 10e5 at 42°C’ caornpared to MY’.
The method used was a modification of thr method of Riggs of al. (1970). pNK2353 plasmid DIVA was digested with one or more rrstrication enzymes and mixed with a (stall extract in 250 ptl of 40 mhf-Tris. H(‘l (pH 8.0). 80 rtlM-K(‘1. 0.X mrv-bZI)TA. 4 m.n-M&l,. 04 mm dithiothreitol. 200 (I-, v) glvc*erol. When necessary. the extract was diluted in Iyiis buffer. The mixture was incubated at 0 ‘(’ for 20 min. and passed through nitrocrllulosr filters (Schlrichrr and Schuell grade RA85 presoaked in wash bufliir ( 10 mnl-Tris H(‘I (pH 7.4), 50 mM-KU, 1 mnl-EDTA)). The filter was washed with 500 ~1 of wash buffrl,. and thf> bound 1)X,\ was eluted b) vortexing the filter in thcs presence of 200 111 of 10 mw-Tris. HCI (pH i4), 20 In&r-NaU. 0.20,, SDS. The I)PiA was then precipitated with ethanol and electro- phorrsed on a So,, acrylamide gel in 1 x TKE (Maniatis et nl.. 1982) and visualixecl \vith rthidium bromide staining,
Singly end-labeled Dh’A was incubated with ill rxt’ract (dilutions \vpre made in Iysis buffer) at 4°C for 40 min in 250 p1 of 10 rnM-Tris HCI (pH 7.0). 2.5 mM-Mg(‘l,. 0.1 rnM-EDTA. 1 m,n-CaCl,. 50 mM-Kc’]. 0.1 mg bovine serum albumin/ml, 2.5 pg carrier DNA/ml. DBase I was addetl to a final concentration of 40 q/ml and after I2 min the reart,ion was terminated by the addition of 60 ~1 of 8 M-ammonium acetate. 0.3 mg carrier TINA/ml and 0.7.; ml of ethanol. The samples wert’
electrophoresrd 011 a DSA stqut~nciny grl and autoradiographrd.
3. Results
(a) 7’hr wqwnce of PI EVA front IoxP to cl
l\‘e determined the DNA sequrn~ of the rightmost 943 bp of PI, from the 1oxP site at map posit,ion O/l00 to the BgZII site at map position 99. Thf> sequencing strategy is shown in Figure p(a) a,nd the sequence itself in Figure 2(b). ‘l’ht> bases are numbered starting at the center of the 1orP sit’e and proceeding toward the c 1 gene (Fig. 1). An open reading frame of greater than 74 atnino acids beginning with an ATG and possessing a Shinr-- Dalparno (1974) sequence starts 2 19 bp upstream from the RglTT sit’e and continues toward that site past the end of the sequenced region. 1Ve assign t,his open reading frame to t’he cl gene (see below),
Figure I describes the construction of thfx pJIX520 series of plasmids and their precursor, pE’s2762. To generate pSS2762. the BwzHT-SmaT fragment of PI I>?;A containing t,he ~1 gene was cloned between the RamHI and I’vrrTT sites of’ the IP, promoter vector pRK6. The pJLE520 series was generated from ph’S2762 by a multistep procvdure. First. varying amounts of PI sequenct were’ removed by digestion with Ba/31 starting from the RamHI site upstream from the ~1 gene and procaeeding toward cl. Cleavage with IipaT removed the fragment of I, 1ISA sequence iaontIaining thtx 3’ etltl of the S gene, and the D?iA was religated in the presence of HanlHI linkers. The plasmids of t’he pJLE520 series have the 5’ one-third of the ,LV gene fused to various points wit,hin the putative PI ~1 genv or to points upstream from that gene. with a11 8 bl) &XV/HI linker at the junction of PI and i sequences. The deletion endpoints were’ det#er- mined by Maxam-Gilbert sequencing and are shown in Figure 2(b). pJLE52OAl3H was WIT- strut-ted from pJLE520Al3 by digesting the latt,er plasmid with RamHI, filling in t,he 5’ stic:kJ- ends with Klenow fragment and the four dXTPs as described by RIaniatis et al., (19X2). and religating. AR predicted, pJLE520Al3K has a (‘1~1 site in place of thr, HamHI site.
Thr properties of pE’s2762 and the ten pJLE520 plasmids are summarized in Table 1. The produv- tion of PI repressor protein was det,ermined by gel rlectrophorf& its described in Materials and Mrthodx. E. coli strain NS2i39 cont,ains a defective IL prophage bearing a cIts857 gene, and when this strain contains pXi2762 or one of the pJLE520 plasmids. a shift in temperature from 30 to 42°C’ causes a large increase in transcript#ion init’iated at the plasmid PL promoter. Aft.er a shift to 42Yl. a protein with the molecular weight of Pl repressor (33.000) was induced in cultures containing pJLE.520 plasrnids A6, A9 and Al6 (pJLE520-cl + plasmids). Induction of a protein larger than 33.000
Met lie Asn Tyr Val Tyr Gly Glu Gin Leu ACCAGGAGTTCGTCAGCTTCA~GATCTCTTTCTAAAAAAAGCTGTTGCA
Al3 Tyr Gin Glu Phe Val Ser Phe Arg Asp Leu Phe Leu Lys Lys Ala Val Ala CGCGCCCWACGTTGATGCCGCCAGCGACGGTCGTCCTGTTCGCCCGGT
Al Arg Ala Gin His Val Asp Ala Ala Ser Asp Gly Arg Pro Val Arg Pro Val
TGTCGTTCTGCCGTTCAAAGAAACGGACAGCATTCAGGCTGAAATTGATA Val Val Leu Pro Phe Lys Glu Thr Asp Ser Ile Gln Asp Glu Ile Asp
AATGGACATTAATGGCGCGGGAACTGGAGCAGTACCCAGATCT
Lys Trp Thr Leu Met Ala Arg Glu Leu Glu Gln Tyr Pro Asp
(bl
50
100
150
200
250
300 350 400 450
500 550 600 650
700
750
800
650
900
Figure 2. (a) Squencing stratqy. All rrpions wew srqwnwd at least tlviw. and. excq)t, for 20 bl) adjawnt to tht) /‘U/II site. thv srqurnw of both strands was determined. Thick lines drwotjc~ regions seyuenc~ed 1)~ the mrthod of San#rr r,t (I(. (l!K7) and thin linrs drnotr repions srquenwd 1)~ the method of lllaxarn & C:ilbrrt (1977). (I)) Thr wqurnc~v of’ thv 3 portion of the cl gene and its upst~ream region. Thrx numbering starts at the center of the lo.rl’ site. I)rwe& lrfi\varcI on thr ~rnt~tic map (rightward in the Figure) toward ~1. and ends at the /Q/IT site in cl. The srquenw of Itasw 1 to .iO has lwrn published (Stjerntwtg. et ccl.. 19X6), and t’hr sequence of positions 1.5 to 63X a~rrrs with the sryucnc~t’ detrrminrtl by Bilunlstark rl nl. (1987). Known and I)ut,ative repwssnr binding sites (SW the text, and Table 2) aw boxed. I’romotvr sc~~uenws arc underlined. The Inwmoter and binding site marked with ast,rrisks are c~onvrrit,ionall~ written showing thr strand wrn+~mrntar~ to thr one shown in thp Figure. Thr 1, brackets denott> thr endpoints of the deletions in tlw l~.lT,E%?O srrirs of plasmids (Fig. I). l).JLE:.52OAIiL and I~JI~lC52OAl6 rash contain 2 tandem WamHT linkrrs at t,hch tlvletion junction.
Properties of plasmids containing all or part of the cl gene. t The deletion endpoints in the pJLE520 plasmids were determined by Maxam-Giltwrt seyuencing.
111 this c&mm +I is the start of the ATG of the cl grnr (base-pair 720 in Fig. 2(h)) and nrgativp numbers are upstream.
1 See Pig. 4. 0 See Fig. 3 11 A plus denotes that the plasmid conferred immunity to infection by PlcirBantti in the immunit!,
ashay and repressed hc~n expression in the ban expression assay (see Matrrials and Methods). .4 minus mww that the plasmid did not confer immunity or repass horn.
was observed wit,h pJLE520 plasmids AlO, A12, A13H and Al4 (pJLE520-elf plasmids). No induced protein was seen in cells containing pJLE520 plasmids Al, A3 or A13 (pJLE520-cl- plasmids) or pNS2762. The results for plasmids pNS2762. pJLE520A3, pJLE52OA 12 and pJLE520A9 are shown in Figure 3. ln the cases where a protein was induced, it constit,uted approximately 5(y0 of the cellular protein. All thfl pJLE520-cl+ plasmids retain the initiat,or ATG and ribosome binding site located between positions 709 and 722 (Fig. 2(b)). All the pJLE52Wcl- plasmids lack t)he A\TG. Some of the pJLE520-elf plasmids retain the XTG and some do not, hut’ all of them have the cl gene fused in frame to the 5’ end of the ,Iilr gene (see Table 1 and Fig. 4). Sane of the pJLE520-cl’ plasmids and none of the pJLE520-cl- plasmids has the cl gene in frame> with E.LV. The mobilities of the larger proteins on aorylamide/SDS gels (Fig. 3) are consist,rnt with the proposal that they are fusion proteins with the N-terminal end of S and the (I-terminal end of PI repressor.
The product,ion of the 33,000 I& protein by pJLE520 plasmids correlates with PI repressor activit,y in two in-~~ivo assays, an immunity assay and a ban expression assay (see Materials and Methods and Table I). NS2738 containing any of the pJLE520-~1 ’ plasmids was positive for repressor activity in both assays, and NS2738 containing any of the pJI,F:520-rl- plasmids was negative in both assays. NS2738 cont’aining a pJLE520-elf plasmid was positive for repressor activity if the plasmid had all (pJLE520AlO and pJLE52OA.14) or all but, six (pJLE520Al2) of the codons of t<he ~1 gene, but negative if the plasmid was missing the first, 1X codons of the cl gene (pJLE52OA1313). We conclude that the open
reading frame that we have assigned t,o bta cl codes for PI repressor.
Plasmid pXW762 contains a c~ornplete cl gene and conferred immunity and repressed hnn in the Pl repressor assays in viao, but did not direct the overproduction of Pl repressor as measured by our protein gels. We do not know the reason for this apparent anomaly. but its should be not,ed that! there is an abundant E. coli protein of the same molecular weight as Pl repressor and its presence in t’he gels would obscure a moderate level of Pl reprfhssor.
(c) Localization of PI repressor binding Q%tf3 in plasmid piNR23d’I
Haumstark & Scott (1980) showed that PI repressor specifically binds to a 593 bp HamHI- PvuTI fragment that lies between the ~1 gene and lox/‘. We wished to determine if there are multiple binding sites in this region and to localize t,hem more precisely. To do this, crude extracts were made from strain NS2739 containing either pJLE520A9, pJLE520A3 or pRK6 and used in a series of nitrocellulose filter binding experiments on restriction digests of pNS2353 DNA as described in Materials and Methods. With the (arude ext’racts made from NS2739 containing either pRK6 or pJLE520A3 we could not detect retent,ion of any DNA fragments to t#he filter. Tn contrast, the extract made from NS2739 containing pJLE52OA9 bound one or more fragment,s of pNS2353 DXA to the filter (see Fig. 5(a)). A summary of the data from several such experiments is given in Figure 5(b). The TagI and AZuI-RamHI fragments that bind PI repressor (hatched bars in Fig. 5(b))
31
21
14
define at least two binding regions: one near the lo.rP site and one near t,he HamHI sit)e.
To determine precisely where the binding sites nrar lo.rf’ are located. we performed I>P\‘asr I “footprint” experiments. Figure 6 shows two of these. A crude extract from XS2739 oont’aining pJLE52089. but not an extract from XK2739 containing pRK6 (not shown), protects two regions of approximately 25 bp each centered on positions 70 and 152 (Fig. 6(a): see also Fig. d(b)). In accordance with nomenclature suggest’ed (Yarmolinsky &, Sternberg, 1987) these sites hare been named Op99e and Op99d, respect,ively. DNX fragment’s containing either Op99e alone (Fig. 6(b)) or Op99d alone (dat’a not shown) show protection of t,he same regions. Half protection of Op99e requires approximatelv twice as much extract as half prot’ection 0; Op99d (Fig. 6(b)). suggesting that Op99d has a higher affinity for Pl repressor. Thv presence or absence of Op99d on the fragments does not afIf:ct the amount of extract, required t)o observe half protection of Op99e (Fig. 6(b)) and cite wr.sn (dat,a not shown), suggesting that 1’1 repressor binds to t,hese two sit,es non-c:o-operatively.
CGGATCGATCCGI GATCTCTTTCTA LA - c-1 i-i - c___1 ii ,..-_A ASPI9 Leu20 Pile2, Le”22
CGGATCCG AGGAGGATCAATGATA ..’ LA u L J- -J - - ti ‘Td
t- L,nker + i -~---__ A14 ~- +
CGGATCCGCGGATCCG/ ACGGCGAA.. u u u L-i LJ 4” $,A L$ 1 1 c---- L,nkers ~- .~-* 1.. A,2 .- .~- i
Figure 4. r!lignmrnt of thr S and (‘1 robing f’ratnes. ‘Thr left portiott of the top lint, shobvs thr !+ ftasw of’ thta 1,1’ gene just upstream from the HpaI site. ,Just below it is the translational reading frame of the N protein. Also sho\vn are thr 1)K.A sequtw~w fi~srtl to S itr several of’ the f),Jl~EX!O plasmitis with the reading frame of thr cl gerw indicatecf. S and cl are in the samt’ rracfing f’ramr in f)lasmidx pJLE520A13K. pJLE5%OA11 anti f~.JT~f+X2OAl~. hut not in f~.JLE52OAl3.
PI Elepressor Binding AWes 287
Op99e and Op99d are very similar and pNS2353 contains homologous sequences at three additional sites called Op99a, Op99c and OpGalK (Figs 2 and 5(b)). -4 simple model derived from the filter binding dat’a shown in Figure 5(b) predicts that all fire of these sequences are Pl repressor binding skes, and that a DNA fragment is retained on the filter only if it contains two or more of these Op sit’es. No fragment with only one site was retained on the filter. This model allows us to explain the apparently anomalous filter binding results in which all of the sequences in Figure 5(b) occur both on fragments that bind PI repressor and on fragments that do not. This model also requires that there be at least five binding sites to explain the data. The details of the argument are as follows. The leftmost Tug1 fragment in Figure 5(b) binds Pl repressor, yet neither the leftmost AZuI-BamHI fragment nor t’he leftmost B&S1 fragment bind despite the fact that t)hrse latter two fragments combined contain all the sequrncles in the leftmost Tap1 fragment. Therefore, there are at least two components required for the binding of the leftmost TaqI fragment, and one is missing from each of the other fragments. The leftmost IfphI fragment also has h&h of t)htkse csomponents. one of which must lie in
the ga,lK gene derived from E. coli, in the 30 bp between the HphI and B&NT sites. The other must, lie just to the right of the BamHI site in the 69 bp between the BnmHI and 7’ngI sites. The former region contains OpGalK and thr latter region contains Op99a. To account for thr binding of the AEuI-RamHI fragment that is locatrtl just to the right of the BamHI site. a third operat,or site must lie in t’he 165 bp region between t,hr Ksnl and Alul sites that are present just to the right, of the RamHI site. This region contains Op99c. The binding of the rightmost Hinfl-SnaHT fragment shown in Figure 5(b) is account,ed for by the prc~setl~ of Op99d and Op99e on this fragment: when this fragment is cleaved between Op99d and Op99e with P$MI, neither subfragment is bound to the filter (Fig. 5(a)). Filter binding experiments in which pNS2353 was digested with several other combina- tions of restriction enzymes (data not shown) give results consistent’ wit,h this model.
Table 2 shows the sequences of the five 1’1 repressor binding sit’es in pSS2353 dcwrihetl above. A sixth possible binding site. Oy99b. overlaps Op99a. The significance of Op99h is not clear. Table 2 also shows the sequences of sevtaral other putative sites in the Pl genomr. and the consensus
Table 2 Pl repressor hindin,g sitps
Known and putative repressor binding sites. Each site is named for its location in map units m the I’1 genome (Yarmoiinsky & Sternberg, 1987). A letter is appended when more than 1 site OCCUTS within I map unit. Each site is shown along with the 3 bases on either side of it. The consensuh seq~nce and the palindrome that most c-loseli resembles it (see Discussion) alp at the top. Bases that do not match the consensus sequencer are circled. Op99a. Op99b. Op99c, Op99d. Op99e and OpGalK arc described in the text. ($72 and 0~86 are from secluenves provided by H. Schuster (personal c,omtnuni~ation). 0~51 is from a sequence provided by H. Baumstark (personal communication). Op2a aml Op%b were found hy a computer search of a sequence provided by LVindle (1986). 0$1:3 is located in EcoRI fragnlent 14 (X. Sternberg, unpublished results).
The bottom section is a tabulation of the frequency with which the 4 bases appear at each of the poGtions within the PI operator sites. The consensus hah+pair is underlined. The bases in Op(:alK are omitted from this tabulation.
b I 2 4 5
Op GolK Op99a, b op99c Op99d Op99e
B0m IOXP
GolK + I + +
Rsa I Em
BstNI
HphI
Ah/I- BomHI
HinfI- SnuBI - Pfl MI
I I 1 I I
Hmf I- SnoBI
(b)
Figure 5. Xitrocellulose filter binding of’ fragments of pZW235.1. (a) Lanes 1 to 3. piW2353 digested with NirrfI and SncrBT. Lane 1. untreated digest. Lane 2. the digested pNS2353 DKA was subjected to nit~rocellulosr filter binding as tlrscribed in Materials and Methods with 4 ~1 of a IO-fold dilution of extract from cells containing pJLIC52OA.9. Lane 3. as lane 2 except 6 /tl of a IO-fold diluted pJLE52OA.1 extract, was used. The sizes of the 1>3A fragments in bp (and the tjinding sites they csontain) are: 1008. 997. 883(0pGalK), 615, 517, 404(fp99c), 396. 315(0p99d and Op99e), 105(0p99a,). 105 and 75. Only the 315 bp fragment. containing Op!J9d and Op99e is retained on the filter. and only by t.he extract from pJLE520A9containing cells. Lanes 4 to 6, as lanes I t,o 3 except that the pNS2353 DNA was digested with f’$MI
PI Repressor Binding Sitps
Op99e
Op99d
I 2 3 4 5 6 123456 7 8 9 IO II I2
Up99d
Op99e
(a)
Figure 6. I)Sase 1 protection of sites O+99ti and Op99e. (a) Thr Hinff-NnnBl fragment containing Op99d and Op99r was 3’.labrllrd at the HinfI end (position 194 in Fig. 2(b)). L anrs 1 through 4 are Maxam-Gilbert sequencing reactions. I,anr 1. (:: lane 2. A + G; lane 3. V + T: lane 4. (‘. The brackets at the left den0t.F: the location of Op99d and Oo99e. lm~~s 5 and 6 rontain DKasr I protection reactions (see Materials and Methods). Lane 5. no protein: lane 6. 1 PI of a IO-fold dilution of the crude extract from ES2739 containing pJLE520A9. (b) Lanes 1 to 6: the 268 bp DdeI-H&f1 fragment containing Op99d and Op99e was 5’-labelled at the D&I site and subjected to DNase I protection reactions. Lane I, no protein: lane 2, 1 ~1 of 200-fold diluted pJLE520A9 extract: lane 3. 2 ~1 of 200.fold diluted extra&; lane 4. 4 ~1 of’ a 200.fold diluted extract: lane 5, I ~1 of a 20.fold diluted extract; lane 6. 2 ~1 of a 20-fold diluted extract. Lanes 7 ttr I”: as lanes I to 6 except that the 190 bp 11deTCPflMI fragment containing only Op99e was used.
in additiotr t,o Hinfl and SnnRJ. The fragments (and sites) are: 1008. 907. 883(OpGalK), 615. 517. 404(0~99~~). 237(Op99e), 105(0p99a) 105. 78(0p99d), 75 and 70. None of the fragments is retained on the filter by either extract. (b) The fragments of pNS2353 DNA retained on nitrocellulose filters by repressor. The Figure shows approximately 20% of pICS2353. and is drawn to scale. The hatched bars represent fragments that are retained on the filter by an extract, made from cells containing pJLE520A9, a,nd the open bars represent fragments that are not retained. Tn each case several fragments from elsewhere in the plasmid were produced and none was retained on the filter. Extracts made from cells caclntaining pRK6 or pJJ,E520A3 did not bind any fragments to a filter. The enzymes used to generate the fragments are at the left. The arrows at the top represent t,he repressor binding sites Op99a to Op99e and OpCalK with the direction of the arrows indicnt inp the orientation of the sites (see t,he text and Table 2).
srquertcc~ derived from t hr. various sitcls. ‘I’hC consensus sequence is very A + T-rich and has no significant symmetry.
4. Discussion
We have determined the sequence of the rightmost 943 bp of phage PI. This region includes an open reading frame that begins with an ATG and continues out of the sequenced region. We have assigned this partial reading frame to be the start of the Pl repressor gene, cl. for t,he following four reasons. First, it is located in t’he correct posit’ion, on HnmHI fragment 2. Second, plasmids in which this open reading frame is placed under the caontrol of the AT’, promoter overproduce a protein of the molecular weight of Pl repressor that shows repressor activity in zGo. and sequence-sprc+ic 1)X.A binding acttvitv in vitro. Third. t,his prot,ein and Pl repressor acti”vity are absent if the ATG of the cl reading frame is deleted. All other AT(& and (:TGs wit’hin the sequenced portion of RantHT fragment 2 start open reading frames t,hat are much too small to encode PI repressor or occur greater than 190 bp downstream from t)hr AT(: whose deletion abolishes repressor synthesis. Fourth, fusions of different portions of this open reading frame to t,he 5’ one-third of AS gene encode proteins with different phenot’ypes. Fusions t.o S that contain the entire rl gene or that’ contain all but the first six codons of cl encode proteins that have PI repressor activity. In contrast. a fusion tnissing the first I8 codons of ~1 is inactive evtbn t,hough it produces the same amount’ of prot’cin as do t,he other fusions. These rest&s imply that the first six amino acids of repressor are not required for binding. that an important srqnrncv lies bcltweett residues (i and 19. and that a substantial nutnher of atnino acids cart he fused to t htl N- terminal rnd of T’l repressor wit.hout seriously impairing its funcation.
IVc have localized two of the PI repressor hinding sites (Op99d and Op99e) to the region hetwecn the cl gene and the 1oxP site by DNase 1 footprint experiments. Fragments of plasmid pNS2363 containing these sites are specificall> hound by, Pl repressor to nitrocellulose filters. Other fragments of pNS2353 retained on filiers c*ontain sequencaes very similar to Op99d and Op99e. Two such sites. Op99a and Op99c. also lie between /OX/’ and cl. and another site. OpGalK. is in thcl 17. coli gczlh’ gene.
IMa from &her laboratories support our identification of Op99a, Op99c, Op99d and Op99e as PI repressor binding sites and there is now evidence for at least 11 Op sites in Pl. M. Velleman, K. Dreiseikelmann & H. Schuster (Persona1 communi- (bation) have also performed DBase 1 footprint experiments. and have observed protection of sit,es 0~53, 0~72. Opt%, Op99a and Op99c by purified Pl repressor. 0~53 was also identified b;v us in a sequence of IGoR,T-14. Haumstark d rcl. (1987) have
also proltos~4 that seyucttcvs nrar Op!l!fa. /~p!)!tcl and Op99e are recognized by repressor on th(i tJiLSiS
of filt,er binding experiments and competition i’ot, hinding between plasmids containing thvsr I’1 srcluencPs. and a palindromic oligonn~lrot~it~t, I hat caont’airts hasrs 5 and 7 t)hrouph 1 i of the ~ot~s~tts~~s hinding site sequence we have proposed (Tit hIc& 2). Reducing the homology between the oligottrtc*lc+ tidr and the (Aottsensus binding sittb i)y :I bp abolished i he abilit)y of t hc oligortuc+~rtt iclt, to compete with plasmid DNA for hittditrg 1’1 repressor. Op51 was found in a sequcknce I)rovideti by B. Baumstark (personal communication). who also noted its similarity to the &her Or) sites and showed that a fragment of 1’1 1)N.A containing it is rrt ained by r’i repressor on nit~roc~ellillosf~ filters. OpPa and 0~2.21~ were found by us in a srclrtcrtcv of’ the PI r~f gene provided by \2’indle (19%).
The srquettc*es of the 11 putativcb rtLl)rt’ssor’ binding sites in PI plus the sit’e in the qczlli grnv arc’ shown in Table 2. Wts art’ not c~rrt~ain of tltt, vzac*t size of thth site. IYe have pivrn thv size iis 17 t)l). since this is thr number of c~otisc~c~ittivt~ t)asck-[‘airs itr \\,hich at least six of t,hc 11 sites in PI match. Thv central I3 hp of the I7 bp vonsettsus srqurtic~c~ ilr’t’ highly (*ottserved, with four c~ornpletely c~ottservetl positions and four others that vary only in the weak]\- (*onserved Sites ~)pg%l ;tIld o/J!%‘. Sequcnc~s outside t.hr 17 bp (*onsertsus quert(‘e do rtot appear to he c~~trsrt~v~d (Tablr 2). Thth site> iti t htb ynlh’ gene tloc~ not match thr (~oriscnstts sc~qttcn(~t~ very well. and wt’ assume that its r~sistr~nc~~ is :I c*oincidenc~c*. The tJcagrrt> of horrtolog~~ ICI t hr consensus sequence need not c*orrr~latr with I)indittg affinity. hut Op99ti tnat~cahcs t hc, cortst~nsu~ t)c,ttcat than Op99e and appears to havcl an approxitrratr~l\ two-fold higher aflinit,v for PI repressor.
The, most interesting aspect of t Ircl (aottsettstts scquentY~ dvrivrd from thr r’l rf~pressor hitidittp sites is that it shows no rotational sytnmctr>.. llost other prokaryotic reprrssors caharactcrizcid to clat,cb recaopnize binding siteh that have substantial Z-fold rotational sytnmcltry (T>aho &V Salttar. 1984). ‘I’hchsc repressors form dimers (or tcbtrarnrrs) uit.h Z-fold axes of sytnmet t-J- that caoittcidc with the sytntnet r) axes of their respective binding sites. Onto tnonomer of the dimrbr makes spcc~itic c&ttac*ts to ottcx-haif of the binding sitca and thr, other tnonottter tnakes sitnilar caontacts to the other half of thti sit,<>. I~or these proteins onI), a fc>w spvcifica caorttjacts (*art provide a large atnount of specificity. sirtc*cb tba(ah conta,rt oc(‘urs t wic*fs itr tlw I~oittrfi c~ttri~~l~~~. 1’1
repressor apparently does ttot tts(’ this c~fiic+rtl strategy for rec.ogniziny its binding sittah Its ctiomplex \vith 1)NA would have to cotttairr about twice as many different, kinds of contact, to xchievf t’hr same specificity. There arr other esamples of prokaryotict sequence-specific DXA binding prot’eins that recognize asymmetric sites. Among these at’v
1’1 Rep.4 prot,ein (Chattora,j pt al.. 19%). Alttt~ protein (Ross C?L Landy, 1983). the li:. wli I)naA (Fuller et nl., 1984) and integration host factor (C’raig Cyr Nash. 1984) proteins. all known I1S.A
Pl Repressor Binding Sitrx
polymerases, and some restriction enzymes (Kessler 8.z Hiiltke. 1986).
Since we have not, yet determined which bases are important for binding we cannot rule out absolutel) a role for symmetry in the binding of PI repressor to IlKA, but our results argue against such an idea. In particular, symmetry could play a role in the interaction of PI repressor with DPI;A: (1) if there is symmetry in t,hc binding sites that we have not detected; or (2) if Pl repressor recognizes symmetric elements that are widely separated on the DNA.
The inverted repeat that most’ closely matches the consensus I’1 repressor binding site is the 17 bp sequence AATTT(1TCTGAGAA,4TT, which can be caonstructed from the consensus sequence by changing three base-pairs and moving the center of the sit,e one base-pair t’o the left, adding an A to the 5 end and deleting the 3’-terminal T (see Table 2). While in principle this sequence could contain a,li t’he information necessary to be a binding site. we do not believe that, it is significant for two reasons. First. the palindrome matches the repressor binding sites much less than t’he consensus sequence. The base-pairs t>hat arc changed (positions 4, 9 and I I) to construct the palindrome are among the most conserved in the site. Of all the Pl repressor binding sites. only the dubious sites OpGalK and Op99h match the palindrome at even one of t.he positions where it differs from the consensus. M’e think it) unlikely that such highly conserved positions are not important for binding. Second. the likelihood of finding this close a match to a palindrome bF pure ehancae in t,his situation is quite high. At an,v point in a random sequence with the A + T c&omposition of t’h(a (donsensus secluence. t)hr probability of being able to construct a 16 or I7 bp inverted repeat by changing three base-pairs or fewer is >50”/,, if one allows for moving the center of the site one has+f)air in rit her direction (c~alculation not shown).
(‘o-operative binding to widely separated sit,es has been observed for ot hrr repressors (Hochschild & I’t)ashne, 198fia: Martin et al.. 1986; I)andaneIl it nl.. 1987) and two separated sites eacbh lacking sym met r) (YH1ld c~onstitute a rotationally symmetn(* sitr if they were in inverted orientation and hound co-operatively. This may occur in t hr (WW of 1’1 repressor, but we presently favor the vie\\- that it does not. Pi repressor binds non-co- operativeI>- to the sites Op99d and Op99e in footprint experiments. The apparent co-operativit?- of binding I>SA fragments to nitrocellulose filters by Pl repressor i* ohserved with Op99a and Op99c. which are in the same orientat.ion, as well as with Op99d and Op99e. which are in the opposite orientation (Fig. 5(b)). \I’c consider t h(s footprint experiments more reliablls for det,ermining the co- operativity of I)inding (Senear d nl.. 1986). The ohserved c&o-operativity iit the filter binding experi- ments may rc+lrc~t~ requirements for the binding of t.he I)r\‘Am-protJein caomples to the filter rather tha,n the binding of the prot,ein to the 1)X.4. Baumstark fd r/l. (1987) rlicl observe binding of plasmids
containing only Op99a (and Op99b) to nit roeellulose filters, but they used whole plasmid DIVA and there are two candidates for a Pl repressor binding site in their vect,or sequences (base-pairs -t170 to 1186 and 4182 to 4198 in the standard pHft322 map (Sutcliffe. 1978: Peden. 1983)) that have more homolog,v to the consensus sequence than does Op(:alK.
Two structural motifs have been proposed to be involved in recognition of specific I)NL4 s&es by proteins. The first is the “helix-turn-helix” motif (Pabo 8r Sauer. 1984) found in many prokargot,ic repressors. In the cases of I(%). E, repressor. 431 repressor. CAP protein and lac repressor. the second of the two helices. the “recognition helix”. of each of these proteins has been proposed to nmke sequence-specifics contacts in the major groove of their respective binding sit#es (Anderson rt nl.. 19% I ; Hochscahild 8-z Ptashne, 19866; Paho & I,ewis, 19X2; Anderson pf 01.. 1985: McKay & Steite. 1981; Ebright. 1986). The second motif is the “metal binding finger” proposed to be used tj>- TFTTIA (Miller rf nl.. 19X5).
\Ve have not complet)ed the sequen(~ of t,he cl gene, hut our sequence shows a possihlr helix-turil- helix binding motif, and no “metal binding finger”. The sequence (:ln-S-X-9-.4la-?i-S-S-(:I~-?i-S-S- X-.I-Val-S-I”;-Leu. which forms the st,ructural framcw,ork of the helix-turn-helix motif of I. repressor (Pabo & Sailer. 19X3: I’abo & Lewis. 1982). occurs in Pi repressor at amino acids 30 to 47. Several feat.nres of this Pl repressor sequrnc~e cast doubt on its suitability to serve 1 tie same funct,ion in PI repressor as it does in i repressor. For example. if this region of PI repressor did form a bihelical unit just like that of i repressor. the charged aspartate residue at positiotl 37 would have to be buried in the core of the prot,eiti. and the “recognition helix” would contain two proline residues.
\\‘hile \vc do not yet have tlirecst evitlenc~e t,hat reprrssoi binding to the Op sites iLfFt’t’t S grnr
expression. most of the PI repressor binding sit cs overland promoters. suggesting that PI ref)ressor eati prrwnt transcript ion initiation by htericall~ exelnding RX.4 polymerasc. Several of’ these promoters could transcribe PI filnc*tions known to be ntidl>r direcat c*ontrol of 1’1 repressor. It1 all eases where a PI repressor binding site o\ erlaps a promoter. the relative orientation of t’he binding site and the promoter is the same. The significance of this is not clear. There are three promot,er-like sequrnws hetwern lorl’ and ~1 (Fig. L’(b)). One is hetn-rerr positions 33 and 62 and reads t.oward lox/‘, one is betwern positions 139 and I65 and reads awaY from bo.rl’ and toward t,he small open reading frames upst,ream from ~1 (see the legend to Fig. 2(b)) and one is between positions 624 and 647 and rra.ds toward cl, Op99a and Oy99e overlap the - 3.5 regions of’ the presumpt)ivtl promoters at positions 624 to 647 and 33 to 62. respect,ively. Op!)!Id overlaps the - 10 region of the presumptive promoter at positions I39 to I65 (Fig. z’(b)). Site
0~53 overlaps the promoter in I/:coRI fragment I4 important for t’he regulation of lytic replicat,ion. The sequence of a promoter upstream from the bnrl gene has been determined (H. Schuster. personal communication) and it overlaps the “perfect“ T’l repressor binding site 0~72. Two possible promoters lie upstream from the ref gene (Windle. 1986) and 1’1 repressor binding site Op2a overlaps both ot them. There is evidence that’ PI repressor regulates it,s own synthesis (Sternberg & Hoess, 1983: N. St8ernberg, unpublished results). It is possible that Pl repressor binding to Op99a and/or Op99h (which overlaps Ojp99a) mediates t’his aut’oregulw- tion (Yarmolinsky & Sternberg. 1987). A role in 1’1 gene regulation for Op99d and the promoter it overlaps is suggested by the properties of the virl I mutation (also called WC) (Scott et al.. 1977). This mutation is locakd about 70 bp from lox1 on t,he side opposite from cl (Yarmolinsky & Sternberg. 1987: N. Sternberg, unpublished results) and it creates a promot,er whose transcript would extend t,hrough 1oxP and toward the small open reading frames orf-2, ~$3. o+# and oyf--5 that lie het8ween t.he ~1 gene and t.he promotor that overlaps Op99d (see the legend t,o Fig. 2). When Pl~irl 1 infects a I’1 lysogen it’ induces the resident prophage (West c1: Scott, 1977). and overproduc~es a protein of molecular weight 3500 (Heilmann et al., 1980) that could correspond t,o the product of either orf-2.
o:f’,? or 0+5. Tt is t,empting to speculate that t’he expression of one or more of t)hesc small prot,eins may be incompat,ible with the lysogenie state. and is normally repressed by 1’1 repressor binding t)o Op99d. The virulent phenotjype of PI virl 1 ~~mld be due to the c*onstitjutive expression of one of these proteins. This hypot’hesix is supported b!- t.he ohservation that a recessive amber mutation ealletl ~oi suppresses the virulent phenotype of PI Grl 1 and may be one of these small prot’eins, since it maps between cl ant1 Zoxl’ (Scott. 1980).
\Vr thank K. Baumstark, H. Schuskr and E. Hansen for communicating unpublished results: 1). Ohlendorf and (‘. Pabo for discussions about protein structures: and It. hlenzel and I’. Webrr for comments on the manuscript.
References
Abremski. K. & Hoess. R. (1983). Gent, 25. 49-58. Anderson. ,J.. Ptashnr. M. 8r Harrison. S. (‘. (1985).
LVut we (London), 3 16. 59W.W 1. Anderson, IV. F.. Ohlendorf. 1). H.. Takeda, Y. &
Matthews. B. IV. (1981). N&uw (London), 290, 7~54~~ 758.
Austin. S., Sternberg. X. & Yarmolinsky. M. (197X). J. Mol. Hiol. 120. 297-309.
