Vol. 172, No. 1JOURNAL OF BACTERIOLOGY, Jan. 1990, p. 361-3710021-9193/90/010361-11$02.00/0Copyright C 1990, American Society for Microbiology

Characterization of the C Operon Transcript of Bacteriophage MuSTEVEN F. STODDARDt AND MARTHA M. HOWEt*

Department of Microbiology and Immunology, University of Tennessee-Memphis, Memphis, Tennessee 38163, andDepartment of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin 53706

Received 23 June 1989/Accepted 15 October 1989

Mu transcription occurs in three phases: early, middle, and late. Middle transcription occurs in the regionof the C gene, which encodes the transactivator for late transcription. A middle promoter, P., was previouslylocalized between 0.28 and 1.2 kilobase pairs upstream of C. We used Si nuclease mapping with both unlabeledand radiolabeled capped RNAs from induced lysogens to characterize C transcription and identify itspromoter. The C transcription initiation site was localized to a 4-base-pair region, -740 base pairs upstreamof C within the region containing Pm. Transcription of C was activated between 4 and 8 min after induction ofcts and Cam lysogens and increased throughout the lytic cycle. Significant C transcription did not occur inreplication-defective Aam lysogens. These kinetic and regulatory characteristics identify the C transcript as amiddle RNA species and demonstrate that Pm is the C promoter. DNA sequence analysis of the Pm regionshowed a good -10, but poor -35, site homology to the Escherichia coli RNA polymerase consensus sequence.In addition, the sequence demonstrated that C is the distal gene in a middle operon containing several openreading frames. S1 mapping also showed an upstream transcript with a 3' end in the Pm region at a sequencestrongly resembling a Rho-independent terminator. The regulatory characteristics of this RNA are consistentwith this terminator, t9.2, being the early operon terminator.

Mu is a temperate bacteriophage that infects Escherichiacoli K-12 and several other enteric bacteria (for reviews, seereferences 46 and 48). The temporal coordination of eventsleading to phage growth during the lytic cycle is achievedlargely by control of transcription, which occurs in threephases: early, middle, and late.

Early transcription initiates at the Pe promoter (-1 kilo-base pair [kb] from the left end) (13, 24) immediately afterinduction and is confined to the region between 1 and 9 kbfrom the left end (55; C. F. Marrs and M. M. Howe,Virology, in press). Early RNA synthesis reaches a peak at4 to 8 min, after which repression of Pe by Ner reduces earlytranscription to a low level for the rest of the cycle (49, 53,55; Marrs and Howe, in press). Besides Ner, the early regionencodes the DNA transposition and replication functions Aand B, plus a number of nonessential or growth-enhancingfunctions located distal to B (13, 32). On the basis of polarityof insertion elements (11, 55; C. J. Thompson, C. F. Marrs,and M. M. Howe, manuscript in preparation) and the appar-ent lack of additional early promoters (44), the early RNA isthought to consist of a single polycistronic transcript. Earlytranscription occurs in the absence of de novo proteinsynthesis, Mu DNA replication, or Mu C protein (53, 55;Marrs and Howe, in press).Middle transcription begins after the early peak but before

the onset of the late phase and continues until cell lysis; it ischaracterized by its replication dependence, requirement forde novo protein synthesis, and independence from C, thetransactivator of late transcription (4, 28, 44; Marrs andHowe, in press). RNA classified as middle hybridizes to theC region (Marrs and Howe, in press). It is probable thatmiddle transcription includes all of C and terminates just

* Corresponding author.t Present address: Department of Microbiology, University of

Illinois at Urbana-Champaign, Urbana, IL 61801.t Present address: Department of Microbiology and Immunology,

University of Tennessee-Memphis, 858 Madison Ave., Memphis,TN 38163.

downstream (17, 27); however, the size of the middle regionupstream of C and the identity of the C promoter are notknown. Hybridization of capped radiolabeled RNA frominduced Mu lysogens to Mu DNA fragments on Southernblots localized a middle promoter, Pm, to a BglI fragment(fragment 46) 0.28 to 1.2 kb upstream of C (44). It wassuggested that Pm is the C promoter.

Late transcription initiates at four promoters located in theright two-thirds of the genome (4, 28, 44). Transcription inthis region, which encodes the virion morphogenesis and celllysis functions, is observed from -15 min after inductionuntil cell lysis (21, 44, 53; Marrs and Howe, in press). Latetranscription is dependent on C, de novo protein synthesis,and Mu DNA replication (4, 13, 28; Marrs and Howe, inpress). The replication requirement might result indirectlyfrom the defect in middle transcription.The Mu genome is transcribed almost exclusively in the

rightward direction (1, 53), and production of phage particlesrequires the host RNA polymerase (RNAP) throughout thelytic cycle (47). The early promoter P, is regulated primarilythrough repression by the Mu c (repressor) and Ner proteins;however, stimulation by E. coli integration host factor alsooccurs (12-14, 19, 23). The DNA sequence of P, closelyresembles that of the E. coli RNAP-u70 promoter consensussequence (36, 38). Although the late promoters share homol-ogy with the E. coli -10 consensus, all four possess adifferent conserved sequence in their -35 regions. Thesesequences and the demonstration that purified C bindsspecifically to DNA in that region suggest that C is anactivator protein (4, 28). Pmom is subject to additionalpositive control by Dam methylation (22) and negativecontrol by the host OxyR function (3).Middle transcription, by controlling C expression and thus

coordinating the early replication and late morphogenesisstages, may be a key factor in the programming of Mu lyticgrowth. We have used S1 mapping to define the middlepromoter and to characterize the C operon transcript and itsregulation.

361

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

362 STODDARD AND HOWE

MATERIALS AND METHODS

Bacterial strains and plasmids. Bacterial strains are deriv-atives of E. coli K-12. MH414 is F- thyA Xr-mal (16); its xrphenotype is caused by the mal mutation. The following Mulysogens contain prophages inserted at the malT locus (con-ferring a xr phenotype) of the nonsuppressing strain W3110thyA (1) and were derived as previously described (16; Marrsand Howe, in press): MH429 (Mu cts62), MH3868 (Mu cts62Cam2005), and MH3870 (Mu cts62 Cam4005); MH435A F-thyA malT (Mu cts62 AamlO93) is similar except that themalT mutation was spontaneous and the Mu prophageinsertion site is unknown; MH3565 F- thyA mal_kr::(Mucts62 Cam1966) contains an uncharacterized mal mutationand a recently recognized auxotrophy. MH7260 is strainMH130 F+ araD A(ara-leu::[-Mu cts6l G- A{S-attR}])130(20), lysogenized with A imm434 (this work). MH10006 andMH10007 are transformants of MH4985 (gal lac rpsL; 31)containing plasmids pWM6 and pBR322, respectively (thiswork). Plasmid pWM6 (27) is a derivative of pBR322 (45), inwhich the Mu EcoRI-to-PvuI fragment (5.1 to 10.7 kb) hasreplaced the Tet region of pBR322 from the EcoRI to Sallsite, destroying the Mu PvuI site and recreating the vectorSall site at the 10.7-kb Mu-pBR322 junction.Media, chemicals, solutions, and enzymes. Bacteria were

routinely cultured by using LB broth and agar (20) supple-mented as necessary with 50 jig of thymine per ml, or

ampicillin at 50 (in agar) or 100 (in broth) ,ug/ml. Cultures forRNA isolations were grown in supplemented minimal me-dium (44). Titers of Mu cts62 lysates were determined onstrain MH4985 on TCMG plates (41). Except for growthmedia, solutions were made with Milli-Q purified water(Millipore Corp.) and treated with 0.1% diethylpyrocarbon-ate, as described previously (44). Cobaltous chloride(CoCl2 6H20) was from Matheson Coleman and Bell.Formamide (ACS grade) was deionized (26) and stored at-20°C. Redistilled phenol (International BiotechnologiesInc.) was equilibrated with 10 mM Tris hydrochloride, pH8.0, before use. "Ultrapure" urea was from ICN Biomedi-cals Inc. Other chemicals and antibiotics were from SigmaChemical Co. Dialysis tubing (Spectrapor [12,000 to 14,000molecular weight cutoff]; Spectrum Medical Industries) andcarrier tRNA (Sigma type XXI) were prepared as previouslydescribed (26 and 44, respectively). Radiolabeled nucleo-tides (Dupont, NEN Research Products) were supplied asfollows: [a-32P]dATP, [k-32P]dGTP, [a-32P]GTP, and [a-32P]CTP, 800 Ci/mmol; [.y-32P]ATP and [a-32P]cordycepin,3,000 Ci/mmol. TBE (pH 8.0) contained 50 mM Tris base, 50mM boric acid, and 1 mM EDTA. Enzyme suppliers were asfollows: restriction endonuclease SinI, Promega Biotec;other restriction endonucleases and DNA polymerase IKlenow fragment, New England BioLabs, Inc.; T4 polynu-cleotide kinase, Pharmacia, Inc.; calf thymus terminal trans-ferase, S1 nuclease, and calf intestine alkaline phosphatase,Boehringer Mannheim Biochemicals; vaccinia virus guanyl-yltransferase (capping enzyme), Bethesda Research Labora-tories, Inc.DNA isolation, manipulation, and end labeling. Plasmids

pWM6 and pBR322 were isolated from strains MH10006 andMH10007 and purified as previously described (44). Restric-tion endonuclease digestions were done by using the recom-mended conditions of the supplier and were terminated byheat inactivation.To make end-labeled DNA probes, plasmid pWM6 was

digested with an appropriate restriction endonuclease (suchas BstXI for the BstXI probe), phenol extracted and ethanol

precipitated, and then 32P end labeled. For the 5'-HaeIII and5'-SinI probes, the 1.9-kb HaeIII and 2.7-kb SinI fragmentsof pWM6 were isolated by preparative electrophoresis inagarose gels (26) and concentrated on Nensorb columns(Dupont, NEN) before labeling. End labeling was carried outin reactions with DNA polymerase I Klenow fragment,alkaline phosphatase, polynucleotide kinase, or terminaltransferase by using procedures essentially as described byManiatis et al. (26) in the following order: to 5' end label atBglII, SinI, and XhoII sites-phosphatase and then kinaseplus 1 ,uM [y-32PIATP (100 ,Ci); to 5' end label at HaeIII,BstXI, and BstNI sites-Klenow, phosphatase, and thenkinase as above; to 3' end label at BglII and AccI sites-Klenow plus 2 ,uM each of [a-32P]dATP and [ax-32P]dGTP (80to 160 pCi); to 3' end label at the NsiI site-terminaltransferase plus 1 FM [ct-32P]cordycepin (350 ,uCi). Theend-labeled DNA was ethanol precipitated to remove unin-corporated label (26) and then digested with a second endo-nuclease to create asymmetrically labeled probe fragments.The size and unlabeled restriction site endpoint of eachprobe was as follows (probe identity, size, position ofunlabeled end; Fig. 1): 5'-BstXI, 7.55 kb, vector PvuII (theMu portion ends at the 5.1-kb Mu EcoRI site); 5'-SinI, 1.13kb, Mu TaqI at -364; 5'-HaeIII, 0.59 kb, Mu BglI at -248;5'-BglII, 7.6 kb, vector PvuII (the Mu portion ends at the5.1-kb Mu EcoRI site); 3'-AccI, 0.28 kb, Mu NsiI at 282;3'-NsiI, 2.9 kb, vector PvuII (the Mu portion ends at position1757); 3'-BglII, 1.9 kb, vector PvuII (the Mu portion ends atposition 1757). The labeled probe fragments were isolated byelectroelution from neutral agarose or polyacrylamide gelslices (26), concentrated by using Elutip (Schleicher &Schuell, Inc.) or Nensorb columns, and stored in 1 mMEDTA at -20°C.To make unlabeled probes for SI mapping of capped

RNA, plasmid pWM6 was digested with HaeIII (probe 1; 1.9kb), SinI (probe 2; 2.7 kb), or BglI (probes 3 and 4; 0.97 and3 kb, respectively), and each fragment was isolated bypreparative electrophoresis (26); plasmid pBR322 was linear-ized with EcoRI, phenol extracted, and ethanol precipitated.For labeled DNA size markers, plasmid pWM6 was digestedwith HaeIII, BstNI, or XhoII in separate reactions, and thefragments were end labeled as described above, phenolextracted, ethanol precipitated, and stored in 1 mM EDTA at-200C.Preparation of capped RNA and RNA size markers. Cul-

tures of MH429 grown in supplemented minimal mediumlysed at 45 to 50 min and gave titers of -2 x 109 phage perml. RNA was purified in CsCl gradients and capped withvaccinia virus guanylyltransferase and [k-32P]GTP, as pre-viously described (44). Labeled RNA size markers weresynthesized by using Riboprobe and Gemini in vitro tran-scription systems with materials and protocols supplied byPromega Biotec. Briefly, plasmids pSP64 and pGEM4 wereendonuclease digested such that transcription by SP6 or T7RNAP in the presence of [ox-32P]CTP would produce labeledrunoff RNAs of known length. The transcription templatesfor marker species were as follows: with SP6 polymerase,pSP64 digested with BstNI or HgaI produced 146- and519-base markers, respectively, and pGEM4 digested withHindIII, PvuII, or HgaI produced 61-, 108-, and 395-basemarkers, respectively. With T7 polymerase, pGEM4 di-gested with DdeI or FokI produced 248- and 689-basemarkers, respectively.

Si mapping procedure. Si mapping was performed byusing the hybridization conditions of Berk and Sharp (2) asfollows: probe DNA (6 to 26 fmol, 1.8 x 104 to 8 x 104 cpm),

J. BACTERIOL.

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Mu C OPERON CHARACTERIZATION 363

238 - 241 C Operon Transcript

I

Upstream Transcript_ _ 1..| 262

1 127 473 477961/ 977 1 396

RIRr1119 -1137

C Operon Terminator1420Bgl I

- 248

Acc Hse III Sin Bst XI1 346 753 1263

FIG. 1. Features of the C operon. The map and C operon features, which are drawn approximately to scale, were derived from the DNAsequence: left end to position -1 (36), 1 to 964 (43; GenBank accession no. Y00419), 965 to 1477 (17, 27; GenBank accession nos. M13657and X03992, respectively). Sequence coordinates are those of Stoddard and Howe (43); base 1 is the internal cytidine in the AccI recognitionsite (GT/CTAC). Restriction sites are indicated by vertical lines below. ORFs are depicted by boxes; coordinates designate the first base ofthe initiation codon and last base of the final sense codon. The ORFs upstream of C, which were named for the number of amino acids theyencode, are each preceded by potential ribosome-binding sites, with ORF120 possessing the strongest Shine-Dalgarno sequence homology(10). Stem-loop structures represent regions that resemble Rho-independent terminators (50) and that were shown to coincide with 3' endsofRNAs (17, 27; this study); coordinates refer to the 3'-most base of the downstream repeat. Arrowheads designated LIR and RIR representleft and right copies of a 19-base sequence repeated in inverted orientation. Wavy arrows represent S1-mapped transcripts. The upstreamtranscript 3' end is at base 211 + 2. A dashed vertical line indicates the 5' end of the C operon RNA initiated at the middle promoter Pm. TheBgII fragment 46 was previously shown to contain a middle-phase transcription initiation signal (44). The sequences of Priess et al. (36) andStoddard and Howe (43) overlap from positions 1 to 964. The reported sequences differ at the following positions (Priess et al. position/basereported, Stoddard and Howe position/base reported): 9301/T, 317/A; 9610/G, 626/C; 9642/C, 658/T; 9738 to 9750/F CCC TGA GAT GTC, 754to 766/T CCI .AG CAT GTC. As a consequence of the two differences within the last grouping of bases, Priess et al. (36) reported an ORF95terminating at TGA (position 759) instead of ORF120. The fact that the ORF120 region is translated into a 13.5-kilodalton peptide (thepredicted size for ORF120) that can be appropriately truncated by an amber codon insertion downstream of position 759 (K. Mathee, personalcommunication) argues against the existence of ORF95 and for ORF120.

test RNA (3 to 50 ,ug), and 10 ,g of carrier tRNA werecombined and ethanol precipitated in a microcentrifuge tube.The pellet was suspended in 28 ,ul of formamide, mixed with7 RI of Si salts [5 mM EDTA, 2 M NaCl, 0.2 M piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), pH 6.4], incubatedat 70°C for 10 min, and transferred to 45°C (for 5'-HaeIII and3'-BglI1 probes and all unlabeled DNA probes for mappingcapped RNA), 49°C (for 3'-AccI and 3'-NsiI probes), or 53°C(for 5'-BgII, 5'-BstXI, and 5'-SinI probes). After 3 to 4 h,350 RI of cold S1 buffer (5% glycerol, 0.25 M NaCl, 1 mMZnSO4, 30 mM sodium acetate, pH 4.8) containing 250 U ofS1 nuclease was quickly added, and the tube was transferredto 37°C. The minus S1 (-S1) control samples received onlyS1 buffer. After 60 min, the reaction products were precip-itated by adding 1 ml of cold absolute ethanol and thenincubating the mixture in dry ice-ethanol for 30 min. Theprecipitated samples were washed three times with cold 80%ethanol, dried, suspended in gel-loading buffer (formamide, 3mM EDTA, 0.1% bromophenol blue, 0.1% xylene cyanol),denatured by incubation at 100°C for 2 min, and electro-phoresed in denaturing 5% polyacrylamide-7 M urea gels(26) in TBE. For autoradiography, the gels were fixed toWhatman 3MM filter paper and then exposed to X-Omat ARfilm (Eastman Kodak Co.) for 12 h to 12 days at -70°C byusing DuPont Cronex Lightning-Plus intensifying screens.The nonlysogen RNA -S1 control identified species re-

sulting from probe degradation before protection by MuRNA; only 5 to 10% of this sample was applied to the gel.The nonlysogen RNA +S1 control revealed species thatsurvived because of self-annealing or underdigestion. Eachprobe was in excess relative to the amount of specifichybridizing Mu RNA. The relative intensity of differentbands in an autoradiograph was estimated by comparison toa standard autoradiograph that contained signals resulting

from electrophoresis of twofold serial dilutions of probe.This method allowed estimation of ratios between signalsthat were visible but outside the linear range of scanningdensitometry. It gave generally reproducible results in sep-arate but equivalent experiments.

RESULTS

The previous mapping of Pm to fragment 46 (Fig. 1)suggested that the C promoter could be located between 0.28and 1.2 kb upstream of C. Preliminary S1 mapping (data notshown) suggested that the C transcript 5' end was slightlyupstream of a HaeIII site at position 346 (all positiondesignations refer to the numbering system of Fig. 1). TheDNA sequence between C and the AccI site at position 1 wastherefore determined to assist in further characterization ofthe middle operon (43). Its principal features, includingpotential open reading frames and repeated sequences, arediagramed in Fig. 1.

Localization of the C transcript 5' end. To S1 map the Ctranscript from within C and localize its 5' end to withinseveral nucleotides, the BstXI, SinI, and HaeIII sites atpositions 1263, 753, and 346, respectively, were chosen as5'-end-labeling sites for DNA probes (Fig. 1). Each had anunlabeled end at or upstream (left) of the BglI site at position-248. With RNA isolated 40 min after induction ofMu cts62and Mu cts62 Cam1966 lysogens (MH429 and MH3565,respectively), the major protected species had sizes of-1,000 bases for the BstXI probe, -510 bases for SinI, and-104 bases for HaeIII (Fig. 2A), corresponding to a Ctranscript 5' end near position 240 (Fig. 1). With the HaeIIIprobe, a very minor species (less than 1% of the majorspecies) of -460 bases was also detected (* in Fig. 2A),corresponding to a 5' end near position -115.

VOL. 172, 1990

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

364 STODDARD AND HOWE

At Bst XiProbe

+ t

zz X ou

ProbE(

Hae I

Probe

=: 'It' X n (aZZ Xa ()u Z Z X 0 u

4

FIG. 2. Localization of the C mRNA 5' end by Si mapping using 5'-end-labeled DNA probes. Autoradiographs show products of Sireactions after electrophoresis in polyacrylamide-urea gels. Each probe was asymmetrically labeled at the indicated restriction site (top), so

as to reveal only rightward transcripts. (A) Lanes are labeled as follows: Mkr, marker DNA fragments with sizes in bases indicated on theleft; NL, products of probe plus nonlysogen (MH414) RNA with (+S1) or without (-Si) Si nuclease; cts and Cam, Si products of the probeplus RNAs isolated at 40 min after induction of MH429 (cts62) and MH3565 (cts62 Cami966), respectively. The C operon RNA-protectedspecies are indicated by arrows at the right. The asterisk indicates a minor Mu RNA-protected species of -460 bases. The amounts of RNAand probe used were constant for all reactions with a given probe as follows: BstXI, 18 ,ug of RNA, 6 fmol of probe (3.3 104 cpm); SinI,6 p.g ofRNA, 13 fmol of probe (5.6 x 106 cpm); HaeIII, 3 Fg of RNA, 13 fmol of probe (8 x 104 cpm). (B) Alignment of the 5' end of C operonRNA with the DNA sequence. Four left lanes: DNA sequence generated from the HaeIII probe by using the Maxam and Gilbert technique(30); base cleavage specificities are indicated at the top. Right lane: Si products of the HaeIII probe and Cam1966 RNA isolated 40 min afterinduction of MH3565. Tick marks align the sequence ladder with the Si-protected bands, which correspond to a C operon RNA 5' end atpositions 238 to 241 (5'-ATAA) of Fig. 1. The alignment includes a 1.5-base correction for the increased migration of chemically cleaved DNAcompared to Si-cleaved DNA (42).

The comigration of HaeIII probe fragments protected bycts and Cam lysogen RNAs indicated that these RNAspecies have the same 5' end (Fig. 2A). Its position was

localized at the DNA sequence level by electrophoresis ofthe Cam RNA-protected species next to a sequence laddergenerated from the full-length probe (Fig. 2B). A smallcluster of protected fragments aligned with the sequence atpositions 238 to 241, corresponding to an RNA 5' end withinthe bases 5'-ATAA on the nontemplate strand. Clusters ofneighboring bands are commonly observed in Si mapping;they neither support nor rule out the possibility that there aremultiple RNA 5' ends within positions 238 to 241.As previously observed with other Mu amber mutants

(Marrs and Howe, in press), there was no evidence oftranscriptional polarity caused by the Cam1966 mutation(located at position 980 upstream of the BstXI site; 27); theratio of Cam to cts RNA-protected species was essentiallythe same for all three probes. Although the Cam1966 RNAshowed somewhat less protection than cts62 RNA with all

three probes, this difference varied between experiments(but not between probes) and could not be reproduced using40 min Cam2005 and Cam4005 RNAs (data not shown). TheCam1966 lysogen grew somewhat slower than the cts andother Cam lysogens in supplemented minimal medium, sug-gesting that the reduction in Caml966 RNA may result fromthe auxotrophy rather than from the Cam1966 defect.

Si mapping of capped RNAs. To demonstrate that the CRNA 5' end at position -240 results from transcriptioninitiation instead of processing or degradation, we Simapped RNAs that were specifically labeled at their 5'-initiated ends by capping (29), by using unlabeled Mu DNAfragments with right endpoints in the transcribed region(herein called probes). With the SinI and BglI probes 2 and3, respectively (Fig. 3B), the major protected RNA specieswere -520 and -485 bases long, respectively (Fig. 3A),resulting from a rightward transcript initiating near position240 (Fig. 3B). With the HaeIII probe 1, the major species bwas -106 bases long, corresponding to an initiation site

J. BACTERIOL.

HaePro b.

- baj- 2";:;E

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Mu C OPERON CHARACTERIZATION 365

ARNA: N L cts cts

DNA: 1 P 1 E P 2 P 3 P 4

rrI

C -

b-a -

P..

i:

Ii

I4.14'

I

*.7.

.F.

.1II

- 689- 519- 395

- 248

- 146

- 108

pM C operon RNA

P? P? Proposed transcript*

129 72 42

I I I t I FRAGMFNT 721I IIBgl I Sin Hase III gl I

1.9 kb H o

2.7 kb

0.98 kb F

Acc Hae III

I -

4 1

I I W W

13

3.0 kb I -I 4

FIG. 3. Localization of C transcript initiation site by Si mapping of capped RNA. (A) An autoradiograph showing Si reaction productsafter electrophoresis in a polyacrylamide-urea gel. RNAs isolated 40 min after induction of the Mu cts62 lysogen MH429 were labeled at their5'-initiated ends by capping and then Si mapped with unlabeled Mu DNA probes (numbered 1 through 4 [Fig. 3B]) or linearized pBR322 DNA(P) as a negative control. Reactions contained: NL, capped nonlysogen RNA from strain MH414 (25 pug, 0.14 x 106 cpm) plus probe 1 (0.7pmol); lanes 1 to 4 and P (pBR322 DNA control), 25 ,ug of capped cts RNA (1.7 x 106 cpm) plus 0.7, 0.8, 1.2, 1.2, and 2.4 pmol of DNA forprobes 1 to 4 and P, respectively. Mu-specific RNA species protected by probe 1 are labeled a through d (left). Mkr, in vitro-synthesizedRNAs (sizes in bases indicated on the right). (B) Diagrammatic representation of capped RNA Si mapping results. The unlabeled DNA probes1 to 4 are shown below the map of the fragment 46 region; the left-end restriction site and size (kb) of each unlabeled probe fragment areindicated at the left. Note that the map to the left of fragment 46 is partially deleted and not drawn to scale. Asterisks represent the capped5' initiated ends of RNAs that survived Si treatment (wavy arrows). Solid horizontal bars upstream of t9.2 represent overlapping 72- and129-amino acid ORFs in the same reading frame (36); each is preceded by a potential ribosome-binding site. As proposed (see Discussion),the -310-base minor capped RNA species d (panel A) might initiate at one of two promoterlike sequences (P?), transcribe ORF72, andterminate at t9s2-

within the same group of bases defined previously (Fig. 2B).Thus, the C RNA 5' end at bases 238 to 241 results fromtranscription initiation, and the region immediately upstreamof this site should constitute the C promoter.

Three relatively minor Mu RNA species, a, c, and d, werealso observed with the HaeIII probe (Fig. 3A). Species a is1 to 2 bases shorter than b and may reflect infrequentinitiation at an adjacent downstream base still within the

--I IBglI1 Sin

I "V II

i I

I

VOL. 172, 1990

I

L'-ii.m

:i

II

iliiI C-1

I

f%

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

J. BACTERIOL.366 STODDARD AND HOWE

:eiit N ~ NA*A<.-_M._. .R_,__NA_,_

r4 r

6 12 20 40 e

Cam RNA

en 1, :4 8 12 40

I4.

FIG. 4. C operon transcription kinetics for induced Mu cts and Cam prophages. Autoradiographs show Si reaction products afterelectrophoresis in polyacrylamide-urea gels. Reactions contained 26 fmol (1.4 x 105 cpm) of 5'-end-labeled HaeIII probe plus 6 ,ug of RNAisolated at various times (indicated above each lane) after induction of cts (MH429) or Cam (MH3565) lysogens. For the cts + CM lane, theRNA was isolated 12 min after induction of a cts lysogen (MH429) that was treated with 100 ,ug of chloramphenicol per ml 5 min beforeinduction. The remaining notations are as described in the legend to Fig. 2.

238-to-241 region; minor starts at neighboring residues havebeen observed in vitro for some E. coli promoters (5, 25).The alternative explanation, Si overdigestion due to tran-sient separation of the RNA:DNA duplex at the downstreamHaeIII end, seems less likely because of the high G+Ccontent in that region. Si digestion at the RNA 5' end wouldbe undetectable because of loss of label. Minor species c,which is -12 bases longer than b, is unlikely to have resultedfrom a separate initiation event because a 5' end for c wasnot detected with the more sensitive HaeIII labeled-DNAprobe (Fig. 2). Species c might theoretically result from themajor species by formation of short RNA-RNA hybrids thatcould extend the Si protection for 10 to 12 bases past theHaeIII site. Sequences potentially capable of such pairingare present in distal regions of the C transcript and in otherconcurrently synthesized Mu RNAs. Species d (-310 bases)was about 10% as abundant as the C RNA and was observedwith probes 1, 2, and 3, but not 4 (Fig. 3A). Because d didnot vary in size, it must initiate and end between thefragment 46 left end and the HaeIII site (Fig. 3B). Thepresence of d within this 594-base region is consistent withthe previous localization to fragment 46 of minor initiationsignals postulated to be distinct from those caused by Pm(44).

Regulation of C operon transcription. Although previousstudies suggested that C is a middle gene (27; Marrs andHowe, in press), it was necessary to show that the Ctranscript has the regulatory characteristics previously ob-served for Pm (44). We therefore examined C operon regu-lation by S1 mapping with RNA isolated at various timesafter induction of cts, Cam, and Aam lysogens. With cts andCam RNAs and a probe 5' end labeled at the HaeIII site,significant transcription was first observed at 8 min afterinduction and increased steadily until 40 min (Fig. 4). Inextreme overexposures, a faint signal was also presentbefore and at 4 min after induction, but since a light signalwas present with both nonlysogen RNA controls, it wasunclear whether these signals were meaningful. The sametemporal pattern was obtained with 5'-end-labeled SinI andBglII probes (data not shown). From multiple experiments,the increase between 4 and 8 min was estimated to be-30-fold (data not shown).A minor rightward RNA species with a 5' end -460 base

pairs (bp) upstream of the HaeIII site was also detected at 0,4, 8, 12, 20, and 40 min with both cts and Cam RNAs (Fig.4, * species; also present at 40 min in Fig. 2A). This signalincreased -sixfold between 20 and 40 min but was still nomore than --1% as abundant as the C transcript at 40 min. Its

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Mu C OPERON CHARACTERIZATION 367

c; cts ( S6

'g _ CO ZJ0e)o z L

a

0

X

0

- 928

>-

192

1 a 1-124FIG. 5. Degree of replication dependence of C operon transcrip-

tion. Autoradiograph ofS1 reaction products after electrophoresis ina polyacrylamide-urea gel. Reactions contained 10 fmol (1.8 x 104cpm) of 5'-end-labeled BglII DNA plus variable amounts of Mulysogen RNA (indicated in,ug above each lane) supplemented withnonlysogen RNA (strain MH414) such that the total was always 50jig. Lysogen RNA was isolated 40 min after induction of cts(MH429) or Aam (MH435A) lysogens. The remaining notations are

as described in the legend to Fig. 2.

characteristics are most consistent with it being unregulated;the signal did not appear to be activated immediately afterinduction (unlike early RNA), and its synthesis was notprevented by chloramphenicol (unlike middle and lateRNA).With 40-min RNA from a replication-defective Aam lyso-

gen (MH435A), only a low level of C operon transcriptioncould be detected, and then only with long exposures andelevated amounts of RNA (Fig. 5; data not shown). Inhibi-tion of protein synthesis, and therefore replication, withchloramphenicol also inhibited C operon transcription (Fig.4). Thus, the intermediate initiation time, C independence,and replication dependence establish the C operon transcriptas a middle-class RNA species and demonstrate that Pm isthe C promoter.The estimated 30-fold increase in C operon transcription

that occurred between 4 and 8 min for the replicatingprophages cannot be explained merely by a commensurateincrease in Mu copy number. In supplemented minimalmedium, Mu replication should begin at -7 min and result inno more than two to four copies by 8 min (51, 52, 54); hence,C transcription appears to have been activated. To estimatethe degree of activation associated with phage replication,we compared the amounts of probe protected by RNA from

induced cts and replication-defective Aam prophages. Atleast 1,000 times more 40-min Aam RNA than 40-min ctsRNA was needed to protect an equivalent amount of BglIIprobe (Fig. 5). The Mu copy number in an induced ctslysogen in this medium at 40 min should be -40 (33, 51, 52:our burst size was -10, and DNA copy number assays werenot performed). Hence, replication resulted in -25-foldactivation of C operon transcription on a per-copy basis. Aprevious estimate of the replication dependence of transcrip-tion initiation within the Pm region was lower, indicatingthree- to sixfold activation (on the basis of hybridization ofcapped RNA to fragment 46 (44). In the presvious study (44),weak initiation signals not attributable to Pm activity sug-gested that fragment 46 contains additional promoterswhich, by raising the baseline signal from replication-defec-tive prophages, may have caused the earlier estimate to beaberrantly low.Operon regulation can also result from internal transcrip-

tion termination, specific endonucleolytic processing, ordifferential resistance to 3' exoribonuclease attack due to theformation of secondary structures (7, 35). One clue to theinvolvement of such mechanisms might be the existence ofan abundant internal 3' end. We searched for 3' ends in theC operon by using a probe 3' end labeled at the NsiI site(position 282) and unlabeled at the right endpoint (position1757), downstream of the previously described C geneterminator (17, 27). With 40-min RNA from cts and Camlysogens, we detected numerous internal 3' ends distributedthroughout the operon; however, none clearly suggestedregulatory activity (data not shown). The 3' end of thelargest protected species was subsequently mapped to thedistal half of the C terminator inverted repeat (position 1420)by using a probe 3' end labeled at the BgIII site (data notshown). Neither this nor the previous mapping experiments(17, 27) fix the exact 3' end of the C transcript at the DNAsequence level; however, all are consistent with terminationat this stem-loop structure.

Localization of an upstream RNA 3' end in the Pm region.The Pm region DNA sequence contains an inverted repeatthat strongly resembles a Rho-independent terminator (50).The possibility that this might be the early operon terminatorand that termination would occur within the promoter se-quence prompted us to search for evidence of 3' RNA endsat this position. We used a probe 3' end labeled at the AccIsite and unlabeled at the NsiI site (positions 1 and 282,respectively). With RNA from a cts lysogen, an Sl-protectedspecies of -211 ± 2 bases was obtained (Fig. 6), correspond-ing to an RNA end immediately following the terminatorstem within seven consecutive thymidine residues. This 3'end was present at 4 min and showed a slight increase at 8min, followed by a larger increase (-sixfold) between 8 and40 min. It also appeared to be present in the uninducedlysogen, but probe degradation may have contributed to thissignal. Unlike middle transcription, synthesis of the up-stream RNA did not require protein synthesis or phage DNAreplication (Fig. 6), although the amount of 3' ends did notincrease from 8 to 40 min for the Aam RNA as it had for thects RNA. Since the amount and extent of early transcriptionis normal under the conditions used here to prevent proteinsynthesis and Mu DNA replication (Marrs and Howe, inpress), the temporal and regulatory characteristics of theupstream RNA are consistent with its being an early tran-script. It might originate from the early promoter, P,;however, this has not been demonstrated. Since there ap-peared to be a low level of the upstream RNA made in theuninduced lysogen and since there is probably a weak

VOL. 172, 1990

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

368 STODDARD AND HOWE

.tS i - .: 1 r.

FIG. 6. Localization of an upstream RNA 3' end at t9.2. Autora-diograph of Si reaction products after electrophoresis in a poly-acrylamide-urea gel. Reactions contained 16 fmol (2.9 x 104 cpm) of3'-end-labeled AccI DNA probe plus 8 gg ofRNA isolated at 0, 4, 8,12 (CM only), and 40 min after induction of cts (MH429) or Aam(MH435A) lysogens. An arrow indicates the species protected bythe upstream RNA. The remaining notations are as described in thelegend to Fig. 2.

rightward promoter upstream of t9.2 (see Discussion), it islikely that another transcript contributes to the 3' endsobserved. Because the origin and number of transcripts thatterminate at this site are unknown, we have named thisterminator t9.2 after its position in the Mu DNA sequence(36). A minor probe-sized band (Fig. 6) was also present, butit is unclear if this resulted from readthrough or from probesurvival due to reannealing. Other methods will be requiredto evaluate the efficiency of this terminator.

DISCUSSION

The results obtained in this study localized the middlepromoter Pm to -740 bp upstream of C, within positions 238to 241 of the DNA sequence (Fig. 1), and showed by theregulatory characteristics of the C transcript that this pro-moter is responsible for middle-phase C operon transcrip-tion. Examination of the DNA sequence of the transcribedregion revealed that C occupies the distal position in thismiddle operon.

Function and mechanism of regulation of the C operon.DNA sequence analysis of the C operon (43) showed severalopen reading frames (ORFs) upstream of C, each possessinga potential ribosome-binding site (10). Thus far, C is the onlyC operon protein with a known function. Synthesis of a13.5-kilodalton peptide from ORF120 has been observed in

vivo (K. Mathee, personal communication; see Fig. 1 leg-end), but translation of the other upstream ORFs has not yetbeen demonstrated. The role of the 19-base inverted repeatsLIR (left inverted repeat) and RIR (right inverted repeat)(Fig. 1) is also unknown. They do not lie within intergenicregions, nor are they situated so as to block ribosomebinding by formation of RNA secondary structure (10);however, regulation of translation elongation remains anopen possibility. The data neither support nor exclude thepossibility of RNA processing or inhibition of RNA elonga-tion at these sites. A stable stem-loop involving LIR and RIRis possible in theory (lAG0 = -40.9 kcal/mol [40]), andalternative DNA structures formed by local melting andreannealing in these regions should involve little loss of basepairing. Thus, they could potentially serve as points ofregulation in different conformations. To date, there is noevidence of inversion mediated at these repeats; however,the potential inverted region is small, and inversion mayhave escaped detection. They do not resemble the terminalrepeats of the Mu G segment or Cin, Hin, or Pin site-specificDNA inversion systems (18, 34), nor the TnpR-specificresolution sequences of yb or TnSOJ (15, 39).C operon transcription, by controlling C expression and

thereby late transcription, is potentially a coordinating eventbetween the DNA replication and phage assembly stages ofMu development; thus, it should also be controlled. It islikely that C operon transcription is regulated at initiation,since constitutive leader RNAs were not detected in thisstudy or promoter localization studies (44). The approxi-mately 30-fold increase in C operon RNA from 4 to 8 mincoincident with an expected two- to fourfold increase in Mucopy number, and the estimated 25-fold increase (per Mucopy) in C operon RNA levels at 40 min due to replication(Fig. 5), argues that Pm is subject to activation.

Activation by simple relief from phage repression (notnecessarily due to the c gene repressor) seems unlikelybecause Pm is not significantly active when fused to galK orlacZ DNA in promoter assay plasmids (data not shown; K.Mathee, personal communication). The presence of a good-10 but poor -35 site suggests that a promoter-specificDNA-binding accessory factor may be required; this struc-ture is often found in E. coli promoters that use RNAP-uf70but need additional DNA-binding factors for full activity(37). The alternative possibility that Pm might require a newsigma factor or modified RNAP is less attractive; suchpromoters tend to lack conservation in the RNAP-`70 -10region (38). If a Mu-encoded factor were sufficient to acti-vate Pm, replication would presumably be required only toraise its concentration to an effective level (an indirectreplication requirement). As observed in RNA capping andhybridization experiments (data not shown), the failure of aninduced replication-defective AS-attR prophage (A130;MH7260) to respond to such factors from a replicatingmini-Mu (X imm434::mini-Mu A346 [6]) containing the left-most 5.1 kb of Mu DNA, suggests that simple production oftrans-acting factors from this region cannot explain thereplication dependence. It does not exclude potential in-volvement of cis-acting factors or trans-acting factors en-coded in other parts of Mu, for example, the remainder ofthe early region.Another possibility is that DNA replication activates Pm

directly, perhaps by altering DNA structural features such assuperhelical density or alternative secondary structures orby causing promoter strand separation. Creation of hemi-methylated or unmethylated DNA is unlikely to be respon-sible because Dam and Dcm sites are not found within 300 bp

I -i

a a - -u*-

.w~~~~~~.,.0 - * %.S..I

J. BACTERIOL.

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Mu C OPERON CHARACTERIZATION 369

200Upstream RNA t9.2

AAAAA--AAAA

240 260C Operon RNA

* **_

CAGTACCAGCCCTCAC Tf1iCTGTAAACAGTAAA GCCGGTTAATCCGGGCTTTTTACG C 0TAGAAACTCGGG0 TARRR-R-RR-aR 7 '--- - 7-

RRtR-RRR3tR-RRR- TTGACA TATAAT-35 -10

280 300 320 340 360

ORF 72 F ORF 42 Heelli... I_C G T G T~~~~~~~GTACGGTCTAGGTTGACTTGCC=CGTGCC CcV ~ ~ ~~~7lv- ~ ~ v-

FIG. 7. DNA sequence and features in the C operon promoter region. A single strand of sequence is presented, beginning at base 161 (Fig.1) and ending with base 360. Transcripts are designated by wavy arrows with the C operon transcript 5' end indicated by asterisks. The -35and -10 consensus sequences for E. coli RNAP-cr70-dependent promoters (38) are shown below the Pm region at positions showing partialhomology. A likely -10 site for the middle promoter is boxed. Arrows underline regions of dyad symmetry, with each arrow pointing towardits complement; the thickest arrows represent the t9.2 terminator sequence. Right-angle arrows above the sequence indicate the startingcodons of ORF72 and ORF42; dots indicate Shine-Dalgamo sequence matches for each (10). Regions marked A or R indicate strand-specificsequences that match the consensus for Mu A (9) or repressor (23) protein-binding sites, respectively; a hyphen indicates a mismatch. Proteinbinding to these sites has not yet been demonstrated. The repressor sites exist on the complementary strand rather than the strand shown.

of Pm. The above structural requirements might be served byany moving replication fork. Alternatively, if the replicationcomplex served to recruit Pm-activating factors, then Mu-specific replication might be required. Since two to four Mucopies could have accumulated before Pm activation, our

data do not distinguish between indirect versus direct acti-vation by replication.

Several potential DNA-binding sites for the Mu A (9) andrepressor (23) proteins are present in the Pm region sequence(Fig. 7). Although Mu A or repressor is unlikely to regulatePm alone (see above), either protein might modulate theeffect of other regulatory factors. In addition, a potentialintegration host factor-binding site (8) exists -100 basesupstream of Pm. Because potential binding sites for theseproteins occur throughout the C operon (43; data not shown)and neither binding studies nor mutational analyses havebeen done, their significance is unclear.The presence of t92 within Pm is an interesting feature of

this promoter. Current models (50) predict that RNA poly-merase should occupy the same region during termination att92 as during transcription initiation at Pm. Although the dataindicate that these events occur concurrently, there were no

obvious signs that they influence each other. Both antago-nistic and protagonistic relationships could be imagined,such as occlusion of Pm activity by the termination complexor facilitated initiation at Pm by RNAP terminating at t9.2.Since termination at t92 was observed under conditions thatprevent Pm activity (Aam and chloramphenicol results [Fig.6; 44]), it is clear that termination at t9.2 alone does notactivate Pm

Possible identity of transcripts that terminate at t9.2. Be-cause of its early-phase regulatory characteristics, one tran-script that terminates at t9.2 may originate at Pe. Based on

RNA R-looping studies (J. Engler, personal communication)and hybridization of pulse-labeled RNA to Southern blots(S. H. Shore, Ph.D. thesis, University of Wisconsin-Mad-ison, 1986), the length of the early transcript has beenestimated at 7 to 8 kb; hence, the location of t92 iS consistentwith expectations for the early terminator. Assuming an

RNA elongation rate of 40 bases per s (50), the first tran-scripts from Pe could reach t9.2 by 4 min and increase innumber by 8 min, as observed. Characterization of the

upstream RNAs will be required before t92 can be assignedto a particular transcript species.At least one additional upstream RNA is apparently syn-

thesized. The rightward RNA that caused the -460-baseHaeIII-probe protected species (asterisk in Fig. 4) was

observed in uninduced lysogens and showed temporal char-acteristics that were more like a constitutive than an earlyRNA. Several observations suggest that its 5' end near

position -115 (within fragment 46) may result from tran-scription initiation. First, promoter localization experimentssuggested that fragment 46 contains a weak promoter withapparently constitutive characteristics (44). Second, theminor capped RNA species d (Fig. 3A) results from tran-scription initiation in fragment 46, between its left end andthe HaeIII site (positions -248 to 346). Assuming that d is arightward transcript (leftward is less likely [see below]), itwould terminate at t9.2 and initiate -310 bases upstream,near position -100.The following hypothesis might account for these obser-

vations: a minor proposed transcript (Fig. 3B) could initiate310 to 330 bp upstream of t92, independently of phagereplication or protein synthesis, and cause the weak pro-moter signals that were observed in the previous study (44).Termination of this same transcript at t92 would explain thecapped RNA species d (-310 bases; Fig. 3A), and a smallamount of readthrough reaching the HaeIII site (135 bpdownstream of t92) would explain the minor -460-basespecies observed with the labeled HaeIII probe. Earlytranscription from P,, could account for most, if not all, of theincrease in 3' ends observed between 4 and 8 min afterinduction (Fig. 6). At late times, repression of Pe by Ner andthe increase in Mu copy number may raise the relativecontribution of the proposed transcript, in agreement withthe observation that the 3'-end signal at t92 and the HaeIIIreadthrough signal both increased -sixfold between 8 and 40min with cts RNA. It might also explain why increasedreadthrough of the longer early-region transcripts was notevident at 40 min, when the 3'-end signal at t92 was strongest(a full-length species of -600 bases would be expected).Several potential promoter sequences for the proposed tran-script, as well as a 72-amino acid ORF (not the C operonORF72) with a potential ribosome-binding site (Fig. 3B), are

180

VOL. 172, 1990

220

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

370 STODDARD AND HOWE J. BACTERIOL.

present upstream of t92. Because the constitutively ex-pressed lig gene is located in this general region (32), it maybe a candidate for the upstream ORF. The possibility thatminor species d could originate from the complementarystrand (leftward transcription) cannot be ruled out; however,it would contain only two small ORFs which both lackribosome-binding sites.

ACKNOWLEDGMENTS

This work was supported by the College of Medicine, Universityof Tennessee, Memphis; by the College of Agricultural and LifeSciences, University of Wisconsin-Madison; by Public Health Ser-vice grants AI12731 and AI24774 and National Science Foundationgrant PCM81-09769 to M.M.H.; and by a University of TennesseeVan Vleet Professorship and a University of Wisconsin VilasProfessorship.We thank W. Margolin and L. Chiang for helpful discussions and

Z. Burton for providing information regarding Si mapping.

LITERATURE CITED1. Bade, E. G. 1972. Asymmetric transcription of bacteriophage

Mu-1. J. Virol. 10:1205-1207.2. Berk, A. J., and P. A. Sharp. 1978. Spliced early mRNAs of

simian virus 40. Proc. Natl. Acad. Sci. USA 75:1274-1278.3. Bolker, M., and R. Kahmann. 1989. The Escherichia coli

regulatory protein OxyR discriminates between methylated andunmethylated states of the phage Mu mom promoter. EMBO J.8:2403-2410.

4. Bolker, M., F. G. Wulczyn, and R. Kahmann. 1989. Role ofbacteriophage Mu C protein in activation of the mom genepromoter. J. Bacteriol. 171:2019-2027.

5. Brosius, J., R. L. Cate, and A. P. Perlmutter. 1982. Preciselocation of two promoters for the P-lactamase gene of pBR322.J. Biol. Chem. 257:9205-9210.

6. Burlingame, R. P., M. G. Obukowicz, D. L. Lynn, and M. M.Howe. 1986. Isolation of point mutations in bacteriophage Muattachment regions cloned in a A::mini-Mu phage. Proc. Natl.Acad. Sci. USA 83:6012-6016.

7. Burton, Z. F., C. A. Gross, K. K. Watanabe, and R. R. Burgess.1983. The operon that encodes the sigma subunit of RNApolymerase also encodes ribosomal protein S21 and DNAprimase in E. coli K-12. Cell 32:335-349.

8. Craig, N. L., and H. Nash. 1984. E. coli integration host factorbinds to specific sites in DNA. Cell 39:707-716.

9. Craigie, R., M. Mizuuchi, and K. Mizuuchi. 1984. Site-specificrecognition of the bacteriophage Mu ends by the Mu A protein.Cell 39:387-394.

10. Gold, L. 1988. Posttranscriptional regulatory mechanisms inEscherichia coli. Annu. Rev. Biochem. 57:199-233.

11. Goosen, T., M. Giphart-Gassler, and P. van de Putte. 1982.Bacteriophage Mu DNA replication is stimulated by non-essen-tial early functions. Mol. Gen. Genet. 186:135-139.

12. Goosen, N., and P. van de Putte. 1986. Role of Ner protein inbacteriophage Mu transposition. J. Bacteriol. 167:503-507.

13. Goosen, N., and P. van de Putte. 1987. Regulation of transcrip-tion, p. 41-52. In N. Symonds, A. Toussaint, P. van de Putte,and M. M. Howe (ed.), Phage Mu. Cold Spring Harbor Labo-ratory, Cold Spring Harbor, N.Y.

14. Goosen, N., M. van Heuvel, G. F. Moolenaar, and P. van dePutte. 1984. Regulation of Mu transposition II: the Escherichiacoli HimD protein positively controls two repressor promotersand the early promoter of bacteriophage Mu. Gene 32:419-426.

15. Grindley, N. D. F., M. R. Lauth, R. G. Wells, R. J. Wityk, J. J.Salvo, and R. R. Reed. 1982. Transposon-mediated site-specificrecombination: identification of three binding sites for resolvaseat the res sites of -yb and Tn3. Cell 30:19-27.

16. Grundy, F. J., and M. M. Howe. 1984. Involvement of theinvertible G segment in bacteriophage Mu tail fiber biosynthe-sis. Virology 134:296-317.

17. Heisig, P., and R. Kahmann. 1986. The sequence and mom-transactivation function of the C gene of bacteriophage Mu.

Gene 43:59-67.18. Hiestand-Nauer, R., and S. lida. 1983. Sequence of the site-

specific recombinase gene cin and of its substrates serving in theinversion of the C segment of bacteriophage P1. EMBO J.2:1733-1740.

19. Higgins, N. P., D. A. Collier, M. W. Kilpatrick, and H. M.Krause. 1989. Supercoiling and integration host factor changethe DNA conformation and alter the flow of convergent tran-scription in phage Mu. J. Biol. Chem. 264:3035-3042.

20. Howe, M. M. 1973. Prophage deletion mapping of bacteriophageMu-1. Virology 54:93-101.

21. Howe, M. M. 1987. Late genes, particle morphogenesis, andDNA packaging, p. 63-74. In N. Symonds, A. Toussaint, P. vande Putte, and M. M. Howe (ed.), Phage Mu. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

22. Kahmann, R., and S. Hattman. 1987. Regulation and expressionof the mom gene, p. 93-109. In N. Symonds, A. Toussaint, P.van de Putte, and M. M. Howe (ed.), Phage Mu. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.

23. Krause, H. M., and N. P. Higgins. 1986. Positive and negativeregulation of the Mu operator by Mu repressor and Escherichiacoli integration host factor. J. Biol. Chem. 261:3744-3752.

24. Krause, H. M., M. R. Rothwell, and N. P. Higgins. 1983. Theearly promoter of bacteriophage Mu: definition of the site oftranscript initiation. Nucleic Acids Res. 11:5483-5495.

25. Maizels, N. M. 1973. The nucleotide sequence of the lactosemessenger ribonucleic acid transcribed from the UV5 promotermutant of Escherichia coli. Proc. Natl. Acad. Sci. USA 70:3585-3589.

26. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

27. Margolin, W., and M. M. Howe. 1986. Localization and DNAsequence analysis of the C gene of bacteriophage Mu, thepositive regulator of Mu late transcription. Nucleic Acids Res.14:4881-4897.

28. Margolin, W., G. Rao, and M. M. Howe. 1989. BacteriophageMu late promoters: four late transcripts initiate near a con-served sequence. J. Bacteriol. 171:2003-2018.

29. Martin, S. A., and B. Moss. 1975. Modification of RNA bymRNA guanylyltransferase and mRNA(guanine-7-)methyltrans-ferase from vaccinia virions. J. Biol. Chem. 250:9330-9335.

30. Maxam, A. M., and W. Gilbert. 1977. A new method forsequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564.

31. O'Day, K., D. Schultz, W. Ericsen, L. Rawluk, and M. M. Howe.1979. Correction and refinement of the genetic map of bacterio-phage Mu. Virology 93:320-328.

32. Paolozzi, L., and N. Symonds. 1987. The SE region, p. 53-62. InN. Symonds, A. Toussaint, P. van de Putte, and M. M. Howe(ed.), Phage Mu. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

33. Pato, M. L., and C. Reich. 1982. Instability of transposaseactivity: evidence from bacteriophage Mu DNA replication.Cell 29:219-225.

34. Plasterk, R. H. A., A. Brinkman, and P. van de Putte. 1983.DNA inversions in the chromosome of Escherichia coli and inbacteriophage Mu: relationship to other site-specific recombi-nation systems. Proc. Natl. Acad. Sci. USA 80:5355-5358.

35. Plunkett, G., Ill, and H. Echols. 1989. Retroregulation of thebacteriophage lambda int gene: limited secondary degradationof the RNase III-processed transcript. J. Bacteriol. 171:588-592.

36. Priess, H., B. Briuer, C. Schmidt, and D. Kamp. 1987. Sequenceof the left end of Mu, p. 277-296. In N. Symonds, A. Toussaint,P. van de Putte, and M. M. Howe (ed.), Phage Mu. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.

37. Raibaud, 0., and M. Schwartz. 1984. Positive control of tran-scription initiation in bacteria. Annu. Rev. Genet. 18:173-206.

38. Reznikoff, W. S., D. A. Siegele, D. W. Cowing, and C. A. Gross.1985. The regulation of transcription initiation in bacteria.Annu. Rev. Genet. 19:355-387.

39. Rogowsky, P., and R. Schmitt. 1984. Resolution of a hybridcointegrate between transposons TnSOI and Tnl721 defines the

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

VOL. 172, 1990 Mu C OPERON CHARACTERIZATION 371

recombination site. Mol. Gen. Genet. 193:162-166.40. Saenger, W. 1984. Principles of nucleic acid structure, p.

150-151. Springer-Verlag, New York, N.Y.41. Schumm, J. W., D. D. Moore, F. R. Blattner, and M. M. Howe.

1980. Correlation of the genetic and physical maps in the centralregion of the bacteriophage Mu genome. Virology 105:185-195.

42. Sollner-Webb, B., and R. H. Reeder. 1979. The nucleotidesequence of the initiation and termination sites for ribosomalRNA transcription in X. laevis. Cell 18:485-499.

43. Stoddard, S. F., and M. M. Howe. 1987. DNA sequence withinthe Mu C operon. Nucleic Acids Res. 15:7198.

44. Stoddard, S. F., and M. M. Howe. 1989. Localization andregulation of bacteriophage Mu promoters. J. Bacteriol. 171:3440-3448.

45. Sutcliffe, J. G. 1979. Complete nucleotide sequence of theEscherichia coli plasmid pBR322. Cold Spring Harbor Symp.Quant. Biol. 43:77-90.

46. Symonds, N., A. Toussaint, P. van de Putte, and M. M. Howe.1987. Phage Mu. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

47. Toussaint, A., and J. P. Lecocq. 1974. Sensitivity of bacterio-phage Mu-1 development to rifampicin and streptolydigin. Mol.Gen. Genet. 129:185-188.

48. Toussaint, A., and A. R6sibois. 1983. Phage Mu: transposition as

a life-style, p. 105-158. In J. A. Shapiro (ed.), Mobile geneticelements. Academic Press, Inc., New York.

49. van Leerdam, E., C. Karreman, and P. van de Putte. 1982. Ner,a cro-like function of bacteriophage Mu. Virology 123:19-28.

50. von Hippel, P. H., D. G. Bear, W. D. Morgan, and J. A.McSwiggen. 1984. Protein-nucleic acid interactions in transcrip-tion: a molecular analysis. Annu. Rev. Biochem. 153:389-446.

51. Waggoner, B. T., and M. L. Pato. 1978. Early events in thereplication of Mu prophage DNA. J. Virol. 27:587-594.

52. Waggoner, B. T., M. L. Pato, and A. L. Taylor. 1977. Charac-terization of covalently closed circular DNA molecules isolatedafter bacteriophage Mu induction, p. 263-274. In A. I. Bukhari,S. Adhya, and J. Shapiro (ed.), DNA insertion elements,plasmids, and episomes. Cold Spring Harbor Laboratory, ColdSpring Harbor, N.Y.

53. WUifelman, C., M. Gassler, W. F. Stevens, and P. van de Putte.1974. On the control of transcription of bacteriophage Mu. Mol.Gen. Genet. 131:85-96.

54. WUffelman, C., and B. Lotterman. 1977. Kinetics of Mu DNAsynthesis. Mol. Gen. Genet. 151:169-174.

55. WjiJfelman, C., and P. van de Putte. 1974. Transcription ofbacteriophage Mu, an analysis of the transcription pattern in theearly phase of phage development. Mol. Gen. Genet. 135:327-337.

on April 24, 2021 by guest

http://jb.asm.org/

Dow

nloaded from