Characterizing the Biological Functions of Five Shikimate Dehydrogenase

Homologs in Pseudomonas putida KT2440

by

Kathrine Anne Penney

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Cell and Systems Biology

University of Toronto

Copyright by Kathrine Anne Penney, 2012

ii

Characterizing the Biological Functions of Five Shikimate Dehydrogenase

Homologs in Pseudomonas putida KT2440

Kathrine Anne Penney

Master of Science

Cell and Systems Biology

University of Toronto

2012

Abstract

The shikimate pathway links carbohydrate metabolism to biosynthesis of the aromatic amino

acids in plants, fungi, bacteria and apicomplexan parasites. The pathway has seven enzymatic steps

which convert erythrose-4-phosphate and phosphoenolpyruvate to chorismate, the precursor of

tyrosine, tryptophan and phenylalanine. Due to the absence of the pathway in mammalian species, the

enzymes are attractive targets for herbicides and antimicrobials. Shikimate dehydrogenase (SDH)

catalyses the fourth step, the NADP-dependent reversible reduction of 3-dehydroshikimate to

shikimate. Five SDH homologs AroE, Ael1, YdiB, RifI and SdhL have been identified through kinetic

analysis and phylogenetic studies in the bacterium Pseudomonas putida. SDH homolog gene knockouts

(KO) were used to characterize their functions. The AroE KO and Ael1 KO were successfully constructed

via gene SOEing of the SDH homolog with a gentamycin antibiotic cassette and homologous

recombination via electroporation into WT P. putida KT2440. Preliminary characterization tested KO

growth, auxotroph recovery and fluorescent activity.

iii

Acknowledgments

I would like to acknowledge Dr. Dinesh Christendat for supervising my Masters project and

funding me for the duration of my graduate program as well as the University of Toronto Fellowship. I

would like to thank my fellow lab members Christel Garcia, James Peek, Geoff Fucile, Jimmy Poulin,

Stephanie Prezioso, Stephen Buranyi, and Daniel Johnson for providing an excellent work environment

and support system as well as our undergraduate students Urja Naik, Thomas Shi and Martin Sain.

Additionally, thank you to Dr. David Guttman and Dr. Keiko Yoshioka for being on my

supervisory committee and providing me with guidance during my project. Thank you to the Guttman

and Desveaux lab members, especially Pauline Wang, Pauline Fung and Jessica Yang, who helped with

trouble-shooting and assisted with protocols. Thank you to Dr. Daphne Goring and the Goring Lab

members for our weekly joint lab meetings and feedback on my research, especially previous Goring Lab

members Katrina Haasen, Laura Chapman and Donna Yee for acting as my mentors.

I also would like to acknowledge Dr. Ayush Kumar and Jenny Cortez from the University of

Ontario Institute of Technology in Oshawa for providing the knockout protocol and initial reagents and

allowing me to work with his lab during Summer 2010. Finally, I would like to thank my parents, Brennan

and Janice Penney, and my gran'mre Rose Anne Penney, for their constant encouragement and

support.

iv

Table of Contents

Abstract ............................................................................................................................................. ii

Acknowledgments ............................................................................................................................ iii

List of Tables ................................................................................................................................... viii

List of Figures .................................................................................................................................... ix

List of Appendices ............................................................................................................................. xi

Chapter 1: Introduction ......................................................................................................................1

1.1 The Shikimate Pathway .......................................................................................................................1

Chemical reactions and enzymes ..........................................................................................................4

Herbicide and antimicrobial drug development ...................................................................................7

1.2 Shikimate Dehydrogenase ...................................................................................................................8

i. AroE ............................................................................................................................................ 10

ii. YdiB ............................................................................................................................................. 12

iii. SdhL ............................................................................................................................................ 13

iv. RifI ............................................................................................................................................... 14

v. Ael1 ............................................................................................................................................. 14

vi. DHQ-SDH .................................................................................................................................... 15

1.3 Pseudomonads ........................................................................................................................... 15

Pseudomonas species ......................................................................................................................... 15

Pseudomonas putida KT2440 ............................................................................................................. 17

Industrial and Environmental Applications ........................................................................................ 19

Chapter 2: Thesis Objectives ............................................................................................................. 20

Chapter 3: Materials and Methods ................................................................................................... 22

3.1 Generation of Knockout Mutants ..................................................................................................... 22

i. P. putida Genomic DNA Extraction ............................................................................................. 22

ii. Bacterial Maintenance ............................................................................................................... 22

iii. Permanent Stocks ....................................................................................................................... 23

iv. Plasmids ...................................................................................................................................... 23

v. Acquisition of SDH Genes ........................................................................................................... 25

vi. Primer Design ............................................................................................................................. 25

vii. Template PCR ......................................................................................................................... 29

v

viii. Gentamycin PCR ..................................................................................................................... 29

ix. Gene SOEing PCR ........................................................................................................................ 30

x. Generation of E. coli DH5 competent cells .............................................................................. 31

xi. Cloning into pUC18 ..................................................................................................................... 31

xii. Cloning into pEX18Ap ............................................................................................................. 32

xiii. Cold Fusion Recombination Cloning ....................................................................................... 33

xiv. Diagnostic PCR ........................................................................................................................ 34

xv. Diagnostic Digests ................................................................................................................... 34

xvi. Sequencing PCR ...................................................................................................................... 34

xvii. Generation of P. putida KT2440 electrocompetent cells ....................................................... 35

xviii. Electroporation into P. putida electrocompetent cells .......................................................... 35

xix. Colony PCR .............................................................................................................................. 36

xx. Extraction of KO genomic DNA ............................................................................................... 36

xxi. Verification of KOs PCR .......................................................................................................... 36

xxii. Preliminary verification of P. putida KO`s .............................................................................. 37

xxiii. MLSA typing ............................................................................................................................ 37

3.2 Characterization of AroE and Ael1 Knockouts .................................................................................. 38

i. Growth Curve Assay ................................................................................................................... 38

ii. Auxotroph Recovery ................................................................................................................... 38

iii. Serial Culturing ........................................................................................................................... 39

iv. Fluorescence of WT and Knockouts ........................................................................................... 39

Chapter 4: Results ............................................................................................................................ 40

4.1 Generation of the AroE, Ael1, YdiB, RifI and SdhL mutant constructs ............................................. 40

i. Amplification of SDH 5 and 3 templates and Gm cassette ....................................................... 40

ii. Amplification of SDH mutant fragments by gene SOEing .......................................................... 42

iii. Cloning into pUC18 and pEX18Ap plasmids ............................................................................... 45

iv. Cold fusion recombination cloning............................................................................................. 47

v. Plate selection for putative SDH mutant constructs .................................................................. 48

vi. Diagnostics of putative SDH mutant constructs ......................................................................... 48

vii. Sequencing of putative constructs ......................................................................................... 54

viii. Homologous recombination into P. putida KT2440 ............................................................... 54

ix. Diagnostics for putative knockouts ............................................................................................ 56

vi

4.2 Characterization of the AroE and Ael1 Knockouts ........................................................................... 57

i. Growth assay of WT P. putida, AroE KO and Ael1 KO in rich and minimal media ..................... 57

ii. Recovery of the KOs with intermediates and products of the shikimate pathway .................. 60

iii. Rescue of KO growth by serial culturing .................................................................................... 61

iv. Fluorescence study of the AroE KO and Ael1 KO ....................................................................... 61

Chapter 5: Discussion ....................................................................................................................... 63

5.5 Hypotheses of Function .................................................................................................................... 63

5.2 Reasoning for Experimental Design ................................................................................................. 67

5.3 The SDH Mutant Constructs ............................................................................................................. 69

5.4 The AroE and Ael1 Knockouts .......................................................................................................... 70

5.5 Characterization of the AroE and Ael1 Knockouts ........................................................................... 70

Chapter 6: Future Research .............................................................................................................. 73

6.1 Generation and characterization of YdiB, RifI and SdhL KOs .......................................................... 73

6.2 Generation and characterization of unmarked KOs by Flp recombinase-catalyzed excision ......... 73

6.3 Generation and characterization of double and triple KOs in P. putida KT2440 ............................ 75

6.4 Phenotype MicroArrayTM of AroE and Ael1 KO ................................................................................ 75

6.5 HPLC screening and mass spectrometry for substrate identification .............................................. 77

6.6 In-depth microscopic analysis and differential staining for cell membrane modification ............... 77

6.7 Complementation of SDH homologs between Pseudomonas species ............................................. 77

Chapter 7: References ...................................................................................................................... 79

Appendix I: Sequence Data ............................................................................................................... 86

i. SDH Gene Sequences in P. putida KT2440 ..................................................................................... 86

AroE .................................................................................................................................................... 86

Ael1 ..................................................................................................................................................... 86

YdiB ..................................................................................................................................................... 86

RifI ....................................................................................................................................................... 87

SdhL .................................................................................................................................................... 87

ii. Plasmid Sequences ......................................................................................................................... 88

pPS856-corrected (3786 bp) ............................................................................................................... 88

pUC18T-mini-Tn7T-Gm (4569 bp) ...................................................................................................... 89

pUC18 (2686 bp) ................................................................................................................................. 90

pEX18Ap (5842 bp) ............................................................................................................................. 91

vii

pUCP21 (3898 bp) ............................................................................................................................... 92

pFLP2 (9297 bp) .................................................................................................................................. 93

iii. Gentamycin Cassette Sequence ..................................................................................................... 96

iv. SDH Knockout Sequences ............................................................................................................... 96

AroE Mutant Fragment ....................................................................................................................... 96

Ael1 Mutant Fragment ....................................................................................................................... 97

YdiB Mutant Fragment ....................................................................................................................... 97

RifI Mutant Fragment ......................................................................................................................... 98

SdhL Mutant Fragment ....................................................................................................................... 98

viii

List of Tables

1. Table of Primers

2. Table of SDH Nucleotide Lengths

3. Table of SDH homologs in Pseudomonas

ix

List of Figures

1. The shikimate pathway

2. The aromatic amino acids

3. Forth step reaction catalyzed by SDH

4. Phylogenetic tree of bacterial SDH

5. Known substrates of the SDH homologs

6. Representative structure of SDH

7. SDH substrate binding and catalysis site

8. Pseudomonas metabolism

9. Evidence for the five SDH homologs in P. putida

10. Overview of gene KO construction

11. Plasmid maps used for gene knockouts

12. Amplification of SDH 5 and 3 products

13. Amplification of Gm products

14. Amplification of gene SOEing products

15. Amplification of WT SDH genes

16. Amplification of Cold Fusion products

17. Diagnostic PCRs for AroE mutant construct

18. Diagnostic PCRs for Ael1 mutant construct

19. Diagnostic PCRs for RifI mutant construct

20. Diagnostic digests for AroE mutant construct

21. Diagnostic digests for Ael1 mutant construct

22. Diagnostic digests for RifI mutant construct

x

23. P. putida WT and KO genomic DNA

24. Antibiotic selection of WT and KOs

25. Growth of WT and KOs in rich media and minimal media

26. Growth assay of WT, AroE KO and Ael1 KO in rich media

27. Comparison of fluorescence between WT and KOs

28. Genes surrounding the five SDH homologs in the P. putida KT2440 genome.

29. Overview of FLP-mediated excision for unmarked KOs

30. Overview of the Biolog Phenotype MicroArrayTM

xi

List of Appendices

I. Sequence Data

i. SDH sequences from Pseudomonas putida KT2440

ii. Plasmid sequences

iii. Gm cassette

iv. Knockout sequences

1

Chapter 1: Introduction

1.1 The Shikimate Pathway

The shikimate pathway links carbohydrate metabolism to the biosynthesis of physiologically

important aromatic compounds in plants, bacteria, fungi, and apicomplexan parasites (Figure 1)

(Hermann et al, 1999). The primary role of the shikimate pathway is to produce the chorismate

precursor for the aromatic amino acids tryptophan, tyrosine and phenylalanine (Figure 2).

2

Figure 1: The shikimate pathway. The metabolic pathway consists of seven enzymatic reactions that use

erythrose-4-phosphate from the pentose phosphate pathway and phosphoenol pyruvate from glycolysis

to synthesize chorismate, the precursor for the three aromatic amino acids and other secondary

metabolic pathways. In plants, 3-dehydroquinate dehydratase and shikimate dehydrogenase are

bifunctional enzymes. In fungi, the second, third, fourth, fifth and sixth step is catalyzed by a

pentafunctional enzyme called the arom complex. Source: Kate Penney, modified from Missouri State

Universitys The Shikimate Pathway.

Figure 2: The aromatic amino acids. Tryptophan and phenylalanine are non-polar, tyrosine is polar, and all are

electrically neutral amino acids containing an aromatic ring. Source: Modified from BioTec.

Phosphoenolpyruvate from glycolysis and erythrose-4-phosphate from the pentose phosphate

pathway are converted to chorismate via seven enzymatic reactions. These shikimate pathway enzymes

are monofunctional in bacteria, mono- or bifunctional in plants, and are part of a pentafunctional

enzyme in fungi (the AROM complex) (Herrman et al, 1997). The shikimate pathway enzymes are ideal

targets in the development of herbicide and antimicrobials due to the absence of the pathway in

animals.

The shikimate pathway intermediates are also involved in branch point pathways and the

biosynthesis of a wide range of aromatic metabolites (Haslam, 1993). For example, 3-Deoxy-D-arabino-

heptulosonate-7-phosphate (DAHP) is thought to be a precursor to 3-amino-5-hydroxy benzoic acid

(AHBA), whose derivative is part of the structure of the antibiotic rifamycin, produced by

3

Amycolaptopsis mediterranei (Herrman et al, 1999). The intermediate 3-dehydroquinate (DHQ) can be

converted to 3-dyhdroshikimate (DHS) or to quinate, which is part of the quinate catabolic pathway

(Haslam, 1993). Quinate is an important compound, as it can act as a carbon reservoir for aromatic

biosynthesis in bacteria and plants, while some fungi are capable of using quinate as a sole carbon

source via a pathway that converts DHQ and DHS to protocatechuate, succinate and acetyl CoA

(Herrman et al, 1999).

In plants, chorismate is the precursor to the aromatic amino acids, indoles and quinines, which

are themselves prescursors to a broad range of secondary metabolites such as lignins, pigments,

phenylpropanoids, phytoalexins, UV protectants, hormones, alkaloids, flavonoids and electron carriers.

These metabolites are involved in processes such as plant-microbe interaction signaling and pollen

fertility as well as providing structural integrity to plants (Fucile et al, 2008; Weaver et al, 1997). A dual

pathway theory has been suggested in which amino acid biosynthesis occurs in the plant plastid, while a

cytosolic shikimate pathway leads to the synthesis of aromatic secondary metabolites (Weaver et al,

1997).

Plant shikimate pathway enzymes are strongly affected by stress, which can be induced by light

stimuli, pathogens, wounding and amino acid starvation (Weaver et al, 1997). These enzymes exist as

isoforms whose expression depends on changing environmental conditions. Amino acid starvation and

nitrogen starvation result in a general stress response that increases the production of phenolic

compounds through induction of the shikimate pathway enzymes and phenylpropanoid and flavonoid

metabolism (Weaver et al, 1997; Roberts et al, 2002). Wounding requires secondary metabolites such as

lignin to repair damage to the plant.

4

Chemical reactions and enzymes

The first step of the shikimate pathway is the condensation of phosphoenolpyruvate (PEP) and

erythrose-4-phosphate (E4P) to 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) and inorganic

phosphate, catalyzed by DAHP synthase (EC 2.5.1.54) (Haslam, 1993). Escherichia coli has three DAHP

synthase isoenzymes Tyr-sensitive, Trp-sensitive and Phe-sensitive which can be regulated via

transcriptional control and feedback inhibition by the aromatic amino acids (Herrmann et al, 1999). The

E.coli DAHP synthase is a metallo-protein in which the metal (Cu, Fe or Zn in bacteria and Mn or Co in

plants) has a catalytic and a structural role (Herrman, 1999). While they catalyze the same overall

reaction, the bacteria and plant DAHP synthases share approximately 20% sequence identity (Herrmann

et al, 1999).

The second step of the pathway converts DAHP to 3-dehydroquinate (DHQ) and inorganic

phosphate via 3-dehyroquinate synthase, an enzyme requiring both inorganic phosphate and NAD+ (EC

4.2.3.4) (Haslam, 1993). DHQ synthase isolated from E. coli requires the divalent cations Co and Zn for

activity (Herrman et al, 1999). The substrate for DHQ synthase is the pyran form of DAHP and the

reaction chemistry involves an oxidation, -elimination, reduction and aldol condensation (Herrman et

al, 1999). Unlike DAHP synthases, bacterial and plant DHQ synthase are more closely related (52.5%

identity between E. coli and tomato DHQ synthase) (Herrman et al, 1999).

The third step of the pathway is the dehydration of DHQ to dehydroshikimate, catalyzed by 3-

dehydroquinate dehydratase (EC 4.2.1.10) (Haslam, 1993). DHQ dehydratase exists as type I and type II

enzymes, which differ in their overall structures and reaction chemistry (Herrman et al, 1999). Type I

and type II DHQ dehydratases are considered examples of convergent evolution as they have no

sequence similarity. E. coli DHQ dehydratase is a type I enzyme. DHQ can also be converted to quinate

by the NAD-dependent quinate dehydrogenase enzyme in a reversible reaction, branching into the

5

quinate biosynthetic pathway. Quinate can re-enter the shikimate pathway via the quinate hydrolase

enzyme, converting it to shikimate (Herrman et al, 1999).

The fourth step of the pathway is the NADP-dependent reversible reduction of

dehydroshikimate to shikimate via the enzyme shikimate dehydrogenase (SDH; EC 1.1.1.25) (Figure 3). In

bacteria, SDH is monofunctional, while in plants it is part of a DHQ-dehydratase-SDH fusion protein that

catalyzes steps 3 and 4 of the shikimate pathway (Haslam, 1993). SDH will be examined in greater depth

in section 1.2 of the introduction.

Figure 3: The fourth reaction of the shikimate pathway in bacteria. The reversible reduction of dehydroshikimate (DHS) to shikimate, an NADPH-dependent reaction catalyzed by the shikimate dehydrogenase (SDH) enzyme. Source: Hermann et al, 1999.

The fifth step of the pathway is the phosphorylation of shikimate to synthesize shikimate-3-

phosphate (S3P), a reaction catalyzed by shikimate kinase (SK; EC 2.7.1.71) using ATP (Haslam, 1993).

Two forms of SK exist in E. coli, isoenzymes I and II, which have 30% identity. The affinity of SK

isoenzyme I for shikimate is 100 times less than isoenzyme II, suggesting that it may have a different

physiological role (Haslam, 1993). The expression of the SK isozyme II gene is regulated by trp- and tyr-

repressors and is inhibited by the herbicide 2,4-D (Herrman et al, 1999). Plant SK is localized to the

chloroplast. Some evidence suggests that plant SKs act as regulatory points, directing carbon flow to

specific secondary metabolic pathways (Fucile et al, 2008).

6

The sixth step of the pathway, catalyzed by EPSP synthase (EC 2.5.1.19), involves a condensation

of PEP and S3P to 5-enolpyruvylshikimate-3-phosphate (EPSP) and inorganic phosphate (Haslam, 1993).

In plants, EPSP synthase is localized to the chloroplast. The commercially available herbicide glyphosate

(N-(phosphonomethyl) glycine) competes with PEP and binds to the enzyme-E3P complex to inhibit the

reaction (Hermann et al, 1999).

The seventh and final step of the pathway, catalyzed by chorismate synthase (CS; EC 4.2.3.5), is

the trans-1,4 removal of phosphate from EPSP to synthesize chorismate (Haslam, 1993). Reduced flavin

(FMN) is required for catalysis. The FMN acts as an electron donor to EPSP, and forms an EPSP-

intermediate which is converted to chorismate by the release of inorganic phosphate (Herrman et al,

1999). In bacteria and plants, CS exists as a monofunctional enzyme that utilizes reduced FMN from the

cellular environment. In fungi and protozoans, CS is a bifunctional enzyme that acquires reduced FMN

via NADPH-driven FMN oxidoreductase (Ehammer et al, 2007).

In fungi such as Neurospora crassa, Aspergillis nidulans, Saccharomyces cerevisiae,

Schizosaccharomyces pombe, Pneumocystis carinii and in the apicomplexan parasite Toxiplasma gondii,

steps two through six of the shikimate pathway are catalyzed by a large pentafunctional polypeptide

known as the AROM complex (Haslam, 1993). In apicomplexan parasites, it has been hypothesized that

the shikimate pathway functions in the plastid-like organelles (Roberts et al, 2002).The enzyme protein

domains do not follow the order of the pathway reactions, with DHQ synthase and EPSP synthase at the

amino terminal, and SK, DHQ dehydratase and SDH at the carboxy terminal (Herrman, 1999). DNA

sequence analysis of the AROM complex suggests that the evolution of the pentafunctional polypeptide

is a result of several fusion events of the five separate ancestral genes (Ducati et al, 2007).

7

Herbicide and antimicrobial drug development

Due to the absence of the pathway in mammalian species, the shikimate pathway enzymes are

attractive targets for herbicides and antimicrobial agents (Hermann et al, 1999). The shikimate pathway

enzymes have been characterized by DNA and protein sequence to determine primary structure, and by

X-ray crystallography to determine tertiary and quaternary structure. Biochemical and molecular

studies, such as site-directed mutagenesis, gives a better understanding of the reaction mechanism,

kinetics and regulation of the shikimate pathway enzymes (Herrman et al, 1999). As a result, compounds

such as substrate analogs have been developed that can interact with or inhibit various steps in the

shikimate pathway in vivo or in vitro (Roberts et al, 2002).

Glyphosate is a broad-spectrum, non-selective herbicide that targets aromatic amino acid

biosynthesis (Orcary et al, 2011). Glyphosate inhibits the shikimate pathway enzyme EPSP synthase

acting as an analog of PEP, one of the enzymes substrates. The growth of both gram-negative and gram-

positive bacteria is also inhibited by glyphosate (Roberts et al, 2002). Additionally, high concentrations

of the herbicide can restrict the growth of apicomplexan parasites. Plants treated with glyphosate have

attenuation of growth followed by slow plant death in a few days to weeks (Orcaray et al, 2011). This is

thought to be the result of two possible scenarios. In the first, shikimate accumulates in plant tissue as a

result of decreased feedback inhibition at the EPSP synthase step, resulting in an increased carbon flow

that causes carbon shortages in other essential metabolic pathways. In the second scenario, the lack of

efficient amino acid biosynthesis needed to maintain various cellular functions, such as protein

synthesis, results in plant death (Orcaray et al, 2011).

The evolution of glyphosate-resistant species has provided motivation for identifying novel

inhibitors of the plant shikimate pathway. In addition, there is considerable interest in targeting the

pathway in pathogenic bacteria including Salmonella typhimurium and Mycobacterium tuberculosis, and

8

in apicomplexan parasites such as Plasmodium falciparum, the causative agent of malaria (Coggins et al,

2003; Ducati et al, 2007; McRobert et al, 2005; Kapnick et al, 2008). Para-aminobenzoate (PABA) is a

downstream intermediate of the shikimate pathway involved in folate production, and is essential for

growth in P. falciparum (McConkey, 1999). In E. coli, fluorinated shikimate analogs had previously been

studied for their ability to inhibit PABA synthesis. The fluorinated analogs were used in combination with

anti-malarial drugs pyrimethamine and atovaquone and resulted in lower required dosages, toxicity and

a decrease in drug-resistant strains of P. falciparum (McConkey, 1999; McRobert et al, 2005).

Apicomplexan parasites Toxoplasma gondii (causal agent of toxoplasmosis) and P. falciparum

contain an incomplete shikimate pathway, while some shikimate pathway enzymes have been

discovered in Pneumocystis carinii (causal agent of pneumonia) and Mycobacterium tuberculosis (causal

agent of tuberculosis) (Roberts et al, 1998). The apicomplexan shikimate pathway can be inhibited by

the commercial herbicide glyphosate, which can be reversed by the addition of p-aminobenzoic acid

(PABA), or by fluorinated analogues of shikimate (Roberts et al, 2002).

1.2 Shikimate Dehydrogenase

Shikimate dehydrogenase catalyzes the NADP-dependent reversible reduction of DHQ to

shikimate, the fourth step of the shikimate pathway (Figure 3) (Haslam, 1993). Five functional SDH

homologs AroE, Ael1, YdiB, RifI and SdhL have been identified through kinetic analysis and

phylogenetic studies. The overall structures of each homolog share a high degree of similarity; however

kinetic analysis shows that the SDH homologs favour different biological substrates (Singh et al, 2008). A

phylogenetic study of the SDH superfamily was completed using approximately 250 fully sequenced

bacterial genomes to determine the evolutionary distribution of the SDH enzymes (Figure 4) (Singh et al,

2008). Most of the major bacterial taxonomic groups were represented across the 250 genomes. The

previously characterized AroE (E. coli), YdiB (E. coli), SdhL (H. influenzae) and RifI (A. mediterranei and S.

9

coelicolor) homologs were added to the phylogenetic tree as points of reference (Singh et al, 2008; Ye et

al, 2003; Benach et al, 2003; Yu et al, 2001; Guo and Frost, 2002, 2004; Singh et al, 2005).

10

Figure 4: Bayesian-inferred phylogenetic tree of SDH homologs. From all major taxonomy, 250 fully sequenced

bacterial genomes were used and five subgroups of SDH AroE, Ael1, YdiB2, RifI and SdhL were

classified based on phylogenetic distribution, catalytic motif and functional group. Source: Singh et al,

2008.

Well-resolved clades were observed for each subclass of SDH enzyme. The archetypal AroE

subclass is present in Proteobacteria, Cyanobacteria, Actinobacteria, enteric bacteria and Firmicutes

(Singh et al, 2008). The SdhL subclass is present in -Proteobacteria, Actinomycetes and Deinococcus.

The RifI subclass is mainly found in Actinomycetes and Proteobacteria. The YdiB subclass is present in a

mixed phylum of bacteria that groups with RifI, however the E. coli YdiB homolog is found to cluster

specifically with Gram-positive enteric bacteria within the Firmicutes clade (Singh et al, 2008). The Ael1

subclass is present in a Protobacteria clade within the AroE homologs. Bacteria with SdhL, RifI, YdiB or

Ael1 homologs have at least one other homolog, predicted as AroE due to conserved motifs found in

known AroE homologs (Singh et al, 2008).

i. AroE

AroE is considered the archetypal SDH, the homolog that has retained SDH activity throughout

its evolution and accepts shikimate as its substrate (Figure 5). The AroE encoding gene, aroE, was

cloned, sequenced and expressed in E. coli K12 in 1988. The sequence is 819 nucleotides in length and

encodes a 272 residue polypeptide (Anton et al, 1988). E. coli AroE loss-of-function mutants can be

rescued by the three aromatic amino acids, which suggest that AroE is essential for basic metabolism

(Pittard and Wallace, 1966; Singh et al, 2008).

11

Figure 5: Substrates accepted by the SDH homologs. (a) Shikimate is the substrate for AroE, the homolog responsible for flux through the main trunk of the shikimate pathway. YdiB also accepts shikimate. (b) Quinate is the higher affinity substrate for YdiB, the homolog considered to be a branch point enzyme for quinate biosynthesis. (c) Amino-shikimate is a possible substrate for RifI, a homolog involved in the amino-shikimate biosynthetic pathway. Source: Hermann et al, 1999.

The first crystal structure of AroE from H. influenzae was published in 2003, to a resolution of

2.4 in apo form and a resolution of 1.95 in complex with the cofactor NADPH (Ye et al, 2003). The

AroE crystal structure showed two domains, one catalytic domain and one NAPDH-binding domain,

where the catalytic domain is arranged as a novel fold comprised of an open twisted / structure and

the NADPH-binding domain forms a typical Rossman fold comprised of a single parallel -sheet

surrounded by -helices (Figure 6). AroE has a glycine-rich P-loop containing the conserved GAGGXX

fingerprint motif that hydrogen bonds to NADPH. A deep pocket between the two domains contains

strictly conserved active site residues responsible for substrate binding (Ye et al, 2003). AroE contains

the functional motifs SXS, PFK, NT and NTD for substrate binding and catalysis, and the GAGG and NRT

residues for cofactor binding (Figure 7) (Singh et al, 2008).

Figure 6: Representative structure of SDH. The structure of the AroE enzyme in E. coli, containing a catalytic

domain which binds shikimate and a substrate binding domain for NADPH. Source: Ye et al, 2003.

http://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=An external file that holds a picture, illustration, etc.Object name is jb143017501a.jpg [Object name is jb143017501a.jpg]&p=PMC3&id=164887_jb143017501a.jpg

12

Figure 7: Consensus motif of the five SDH groups (Weblogo). Substrate binding and catalytic residues, G-motif and

cofactor-binding residues show the degree of conservation of AroE, SdhL, YdiB, Ael1 and RifI homologs

across several (n) species. Source: Singh et al, 2008.

ii. YdiB

YdiB, considered a branch point enzyme, has SDH activity and the ability to divert metabolic flux

from the shikimate pathway into the quinate biosynthetic pathway due to substrate affinity for both

shikimate and quinate (Figure 5) (Singh et al, 2008). The quinate catabolic pathway converts quinate to

DHQ via the quinate dehydrogenase enzyme (EC 1.1.1.24) (Lindner et al, 2006). DHQ is converted to DHS

via the enzyme dehydroquinase (EC 4.2.1.10) and DHS is converted to protocatechuate via the enzyme

DHS dehydratase (EC 4.2.1.118). Shikimate can also enter the pathway by converting back into DHS and

is catalyzed by SDH. Protocatechuate is metabolized via the -ketoadipate pathway and is the precursor

to catechol, acetyl-CoA and succinate (Teramoto et al, 2009).

The crystal structure of YdiB in E. coli was published in 2003 to a resolution of 2.3 and

identified NAD+ as the preferred cofactor over NADP. YdiB has 28% sequence identity with AroE from E.

coli, however the three dimensional structures of the proteins are highly conserved (Benach et al, 2003).

13

While a conserved active site lysine and aspartate are catalytic residues in AroE, they are thought to

instead act as substrate-binding residues in E. coli YdiB (Singh et al, 2008). However, a recent study has

shown that the conserved lysine and aspartate act as a catalytic dyad in AroE, Ael1, SdhL and YdiB in P.

putida KT2440 (Peek et al, 2011). The YdiB functional motifs are similar to AroE, with the exception of

the SXS motif substituting a threonine for the second serine (SXT), and an aspartate instead of the

conserved asparagine in the cofactor binding motif, which indicates the enzymes preference for NADH

(Figure 7) (Singh et al, 2008).

iii. SdhL

SdhL (shikimate dehydrogenase-like) was discovered as a novel SDH and its crystal structure

from H. influenzae was published in 2005 along with its biochemical characterization and a mechanistic

analysis (Singh et al, 2005). SdhL is distinct from AroE and YdiB in phylogeny and kinetics; however it

retains a similar three-dimensional structure to other members of the SDH family. Unlike AroE and YdiB,

SdhL is not present in E. coli, appearing only in a small number of species including Pseudomonas,

Salmonella, Corynebacterium, Yersinia and Haemophilus (Singh et al, 2005). From the crystal structure,

NADPH was determined as the cofactor required for activity. A lysine residue (Lys-67) and an aspartate

residue (Asp-103), located at the entrance of the substrate binding pocket and conserved across all

three SDH homologs were identified as a catalytic dyad by site-directed mutagenesis (Singh et al, 2005).

SdhL requires NADPH for enzyme activity and accepts shikimate as a substrate; however the

turnover rate is 1000-fold lower than the E. coli AroE enzyme. Additionally, the enzyme does not display

activity using quinate as a substrate. Its low activity using shikimate or quinate and its phylogenetic

divergence from the other SDH enzymes suggests the SdhL homolog is involved in a novel pathway and

has unrelated biological function (Singh et al, 2005).

14

iv. RifI

RifI was discovered in A. mediterranei as part of the aminoshikimate pathway, a metabolic

pathway that parallels the shikimate pathway but involves amino-derivatized intermediates (Yu et al,

2001). The aminoshikimate pathway forms the early stages in the production of the antibiotic rifamycin

B in A. mediterranei. The rifI gene is found in the rif biosynthetic gene cluster in A. mediterranei, which

also contains homologs of a number of other shikimate pathway enzymes (Guo and Frost, 2004).

The aminoshikimate pathway adds a glutamine to E4P producing aminoDAHP, which is

converted to aminoDHQ, aminoDHS and 3-amino-5-hydroxybenzoic acid (AHBA), the precursor of

ansamycins (Floss et al, 2010). The rifI gene was expressed in E. coli via protein recombination and

showed catalytic activity for shikimate, aminoquinate and aminoshikimate (5-amino-5-deoxyshikimic

acid; Figure 5) (Floss et al, 2010). In A. mediterranei, the presence of RifI repressed production of AHBA

and a regulatory function preventing the accumulation of AHBA was hypothesized since RifI has no

effect on the production of rifamycin B (Yu et al, 2001). The RifI group was further divided into four

additional subgroups (RifI2-5) since the key motifs vary significantly within the RifI phylogenetic clade

(Singh et al, 2008).

v. Ael1

Ael1 (AroE-like) is a functionally distinct SDH subclass that was named due to the high level of

sequence identity it shares with AroE-type enzymes (54% identity with E. coli AroE) (Singh et al, 2008).

The Ael1 crystal structure in Pseudomonas putida was determined to a resolution of 1.7 and a

mechanistic analysis of the enzyme was recently published (Peek et al, 2011). Ael1 has a high level of

structural similarity to AroE, YdiB and SdhL. It exhibits nearly complete conservation of active site

residues including an invariant Lys and Asp which function as a catalytic dyad (Peek et al, 2011).

15

Ael1 has substrate affinity for shikimate but unlike AroE, it also accepts quinate as a substrate

(Peek et al, 2011). Compared to the other SDH groups, Ael1 has the broadest range of substrate

specificity and can use either cofactor to catalyze the oxidation of shikimate; however it preferentially

binds NADPH. The substrate-binding and catalysis motif of (S/T)XS, N(A/C) and NFD differs greatly from

that of AroE (Figure 5) (Singh et al 2008). It is interesting to note that Ael1 has a higher affinity for

shikimate but exhibits a lower turnover rate than AroE; Ael1 is still as efficient but it is evident that

shikimate and quinate are not its biological substrates and therefore Ael1 is likely involved in a novel

pathway (Singh et al, 2008).

vi. DHQ-SDH

In plants, the third and fourth steps of the shikimate pathway are catalyzed by the bifunctional

enzyme dehydroquinate dehydratase-shikimate dehydrogenase (DHQ-SDH) (Singh and Christendat,

2006). Structural analysis of the enzyme revealed two distinct functional domains, a DHQ domain and a

SDH domain, with similar structure to their monofunctional counterparts from bacteria. (Singh and

Christendat, 2006). Various models for metabolite channeling between DHQ and SDH domains were

suggested based on the newly acquired structural and kinetic information for A. thaliana DHQ-SDH. The

lack of a physical tunnel in the A. thaliana DHQ-SDH crystal structure suggested that proximity between

the active sites is likely the main mechanism of metabolite channeling between the two domains of the

enzyme (Singh and Christendat, 2006).

1.3 Pseudomonads

Pseudomonas species

Pseudomonads are Gram-negative bacteria that are found in a wide variety of ecological niches

and living organisms (Rehm, 2008). The pseudomonads are located globally due to a high degree of

genomic diversity and their genetic adaptability. They have significant metabolic diversity and are able

16

to utilize a wide range of carbon-sources such as benzoate, phenylacetate, protocatechuate, toluene

and aromatic amino acids. Organisms fall into the genus Pseudomonas if they are Gram-negative,

aerobic, have motility via polar flagella, and are non-sporulating rods 1.5 to 5 m in length (Cornelis,

2008). Pseudomonads are further classified by their pathogenicity, which can manifest in plants, humans

and animals (Rehm, 2008).

Some pseudomonads have the ability to fluoresce when exposed to low wavelength UV

radiation. The best known fluorescent species of Pseudomonas are P. aeruginosa, P. fluorescens, P.

syringae, P. putida and P. flavescens (Cornelis, 2008). The fluorescent property of these pseudomonads

is due to the production of yellow-green fluorescent pigments known as siderophores. Siderophores are

involved in iron acquisition via iron carriers, chelating of iron, or active transport of iron across

membranes and can be regulated by intracellular iron concentration (Rehm, 2008). The uptake of iron is

a biological challenge for pseudomonads, indicated by the number of iron acquisition systems. (Rehm,

2008). Pyoverdines are the primary siderophores of pseudomonads and are required for numerous

cellular functions such as plant growth promotion, biocontrol of plant pests, animal pathogenicity and

bioremediation (Cornelis, 2008).

The best characterized Pseudomonas species and their strains are P. aeruginosa PAO1, P.

fluorescens Pf-5/PfO-1, P. syringae pv. tomato/syringae/phaseolicoa, and P. putida KT2440 (Rehm,

2008). P. aeruginosa is an opportunistic human pathogen that targets immunocompromised individuals

and has a high resistance to antibiotics (Cornelis, 2008). P. syringae, a plant pathogen, can infect a large

variety of plant species and exists as different pathovars (pv.) based on the plant host. Pathovars of P.

syringae are the causal agents of bacterial speck in tomato, and halo blight and brown spot disease in

bean plants (Rohmer, 2004; Singh, 2006). The P. fluorescens Pf-5 and PfO-1 strains are plant commensal

bacteria that produce secondary metabolites used to suppress plant-pathogen growth (Rehm, 2008). P.

17

putida is a non-pathogenic pseudomonad that is mainly found in soil, water and the plant rhizosphere

and is commonly used for bioremediation of chemically polluted environmental areas (Cornelis, 2008).

Pseudomonas putida KT2440

P. putida can utilize a broad range of organic compounds, such as aromatic compounds or

hydrocarbons, as its sole carbon source and energy source (Nelson et al, 2002). Favoured aromatic

compounds include benzoate, p-hydroxybenzoate, phenylacetate, benzylamine, phenylethylamine,

phenyl-hexanoate, -heptanoate and -otanoate, nicotinate, p-coumarate, ferulate, caffeate, vanillate,

pyruvate, succinate, quinate and the aromatic amino acids phenylalanine and tyrosine (Jiminez et al,

2002; Kurbatov, 2006). P. putida modifies the diverse structures of several aromatic compounds to

common intermediates that are involved in central metabolic pathways (Figure 8) (Nelson et al, 2002).

Figure 8: Pseudomonas putida KT2440 metabolism of aromatic compounds. Four central pathways the

protocatechuate, catechol, phenylacetate, and homogentisate pathways are involved in the catabolism

of aromatic secondary metabolites from the shikimate pathway Source: Nogales et al, 2008.

18

The four central pathways are the protocatechuate, catechol, phenylacetate, and

homogentisate pathways, which are involved in the catabolism of aromatic secondary metabolites from

the shikimate pathway (Jiminez et al, 2002). P. putida also has the ability to metabolize a variety of

biogenic and xenobiotic compounds (Kurbatov et al, 2006).

The best characterized P. putida strain, KT2440, is a plasmid-free derivative of P. putida mt-2, a

toluene-degrading bacterium (Ramos-Diaz et al, 1998). The KT2440 genome is a single, circular

chromosome over 6,000,000 bp long and has a close evolutionary relationship to P. aeruginosa (Nelson

et al, 2002). However, the non-pathogenic P. putida lacks important virulence factors such as exotoxin A

and type III secretion systems. Through phylogenetic analysis, all five functional SDH homologs have

been found in P. putida KT2440, whereas P. syringae and P. fluorescens have three (AroE, YdiB, SdhL)

and P. aeruginosa has two (AroE and YdiB) (Figure 9) (Singh et al, 2008).

Figure 9: The phylogenetic context of P. putida KT2440 SDH homologs. Each taxon contains (in order) the number of SDH homologs present in that species, the arbitrary homolog designator from the phylogenetic distribution, the genus and species, followed by the substrate binding and catalytic residues and the cofactor binding residues. Abbreviated species are Pseudomonas putida, Pseudomonas syringae, Pseudomonas fluorescens, and Pseudomonas aeruginosa. Source: Singh et al, 2008.

19

Industrial and Environmental Applications

Pseudomonads can synthesize secondary metabolites and biopolymers (Rehm, 2008). They are

also able to degrade potentially toxic compounds, such as chlorinated aromatic hydrocarbons, found as

chemical pollutants in the environment (Wackett, 2003). Their metabolic diversity and ability to form

biofilms allow pseudomonads to survive in a variety of environmental conditions. As a result of these

properties, pseudomonads are bioengineered for the clean-up of polluted or chemically altered

environmental sites. The bioremediation process utilizes bacteria, plants or fungi obtained from living

systems to remove environmental contaminants (Cornelis, 2008). Pseudomonads, P. putida in particular,

have been considered for the production of low-molecular-weight compounds, recombinant protein

production and biocontrol agents. As a result of the microbes metabolism, contaminants such as

chlorinated hydrocarbons are fully oxidized to harmless molecules (Rehm, 2008).

20

Chapter 2: Thesis Objectives

The objective of this Masters project was to characterize the biological functions of the five SDH

homologs AroE, Ael1, YdiB, RifI and SdhL in bacteria. The shikimate pathway is actively being studied

to develop a more advanced understanding of the enzymes in the pathways, inhibitors of the pathway,

branch-points that divert metabolites to novel pathways, and whether the shikimate pathway enzymes

are essential for cell growth and basic metabolism.

The Christendat Lab is currently studying the enzymes shikimate dehydrogenase, shikimate

kinase, and dehydroquinate dehydratase-shikimate dehydrogenase in microorganisms such as P. putida,

H. influenzae, T. gondii, and the plant species Arabidopsis (Christendat Lab, unpublished data). All five

SDH homologs have previously been identified in P. putida. This raises the questions of how they

evolved, what biological substrates other than shikimate they may have affinity for, what novel

metabolic pathways they may branch to, and whether inactivating of one homolog via mutation would

be effective due to possible compensation by one or more of the other homologs (Singh et al, 2008).

This thesis sought to answer these questions through two objectives. The first was to make gene

knockouts of AroE, Ael1, YdiB, RifI and SdhL via gene splicing by overlap extension (SOEing) to generate

mutant constructs, followed by homologous recombination into P. putida KT2440 (Figure 10). Once the

KOs were obtained, the second objective was to characterize their growth, ability for auxotrophic

recovery, substrate affinity, metabolite changes, cell morphology and fluorescence with the eventual

goal of identifying the biological function of each SDH homolog.

http://www.ncbi.nlm.nih.gov/pubmed/15735308

21

Figure 10: Overview of the SDH gene KO construction. SDH mutant fragments are generated via gene SOEing and

incorporated into a suicide vector to generate the SDH mutant construct. Homologous recombination into

the WT chromosome via a double-crossover event generates the SDH KO. Source: Kate Penney.

22

Chapter 3: Materials and Methods

3.1 Generation of Knockout Mutants

i. P. putida Genomic DNA Extraction

Genomic DNA was extracted from P. putida using the Puregene Genomic DNA Purification Kit

(Gentra Systems) for DNA purification from 0.5 mL gram-negative bacterial culture. A wild-type (WT) P.

putida KT2440 colony was used to inoculate Luria-Bertani (LB) broth with no antibiotics and incubated

overnight at 30oC with shaking. A 750 L cell suspension from the overnight culture of P. putida was

centrifuged at 4600 rpm for 5 minutes. The pellet was resuspended in 600 L cell lysis solution and

incubated at 80oC for 5 minutes to lyse cells. A volume of 1.2 L of 10 mg/mL RNase A solution was

added to the cell lysate and incubated at 37oC for 1 hour. The sample was cooled to room temperature

and 200 L of protein precipitation solution was added to the cell lysate. The lysate was vortexed at high

speed for 20 seconds then centrifuged at 13,000 x g for 10 minutes. The supernatant was transferred to

a clean microcentrifuge tube and incubated for 5 minutes on ice. The lysate was centrifuged at 13,000 x

g for another 10 minutes. The supernatant was transferred to a clean microcentrifuge tube with 600 L

of 100% isopropanol then centrifuged at 13,000 x g for 10 minutes. The supernatant was discarded and

the tube was inverted to dry, and then washed with 600 L of 70% ethanol. The solution was

centrifuged at 13,000 x g for 1 minute and the ethanol was poured off. The tube was inverted and air

dried for 15 minutes. A volume of 50 L of DNA hydration solution was added to the pellet and

incubated overnight at room temperature. Genomic DNA was stored at -20oC.

ii. Bacterial Maintenance

E. coli DH5 was grown in LB broth consisting of yeast extract, tryptone and NaCl and on LB agar

plates. All E. coli DH5 cultures and plates were incubated at 37oC with or without shaking, respectively.

P. putida KT2440 was grown in/on LB broth, LB agar, King B broth, King B agar, Pseudomonas minimal

23

media (PMM) and PMM agar. The King B broth consisted of protease peptone 3, anhydrous potassium

phosphate (K2HPO4), glycerol and 1M magnesium sulphate (MgSO4) with a final pH of 7. The PMM broth

consisted of potassium phosphate (K2HPO4 and KH2PO4, respectively), ammonium sulphate ([NH4]2SO4),

magnesium sulphate (MgSO4) and succinate as the carbon source. All P. putida cultures and plates were

incubated at 30oC with or without shaking.

iii. Permanent Stocks

Permanent stocks were made by adding 15% glycerol to an overnight culture of bacteria, flash

frozen in liquid nitrogen and stored at -80oC. Permanent stocks of E. coli DH5 containing the pEX18Ap

suicide vector, AroE mutant construct or Ael1 mutant construct were made. Permanent stocks of P.

putida KT2440 WT, P. putida KT2440 AroE KO and P. putida KT2440 Ael1 KO were also made.

iv. Plasmids

The pPS856 and pUC18Tmini-Tn7T-Gm plasmids were used as template for the gentamycin

resistance antibiotic cassette, the pUC18 plasmid was used as an intermediate cloning vector, the

pUCP21 plasmid was used as a control for the electroporation protocol due to its ability to replicate in P.

putida KT2440, the pEX18Ap plasmid was used as a suicide delivery vector of the SDH mutant fragments

due to its inability to replicate in P. putida KT2440, and the pFLP2 plasmid was used for FLP-FRT

mediated excision of the gentamycin resistance antibiotic cassette from the P. putida KT2440 KOs

(Figure 11). All plasmids, sequences and plasmid maps were supplied by Dr. Ayush Kumar at UOIT.

24

Figure 11: Plamids used in the generation of SDH mutants. (a) pUC18-mini-Tn7T-Gm and (b) pPS856 contain a gentamycin resistance cassette flanked by two Flp-recombinase target (FRT) sites for use as an antibiotic selection marker. (c) Intermediate cloning vector pUC18 containing Amp resistance and lacZ gene for blue-white selection. (d) pEX18Ap suicide vector contains a sacB, Bacillus subtilis sucrose-encoding gene used for conditional sucrose counterselection, ampicillin resistance, and a lacZ gene. (e) pUCP21 plasmid self-replicates in P. putida and is a positive control for the electroporation protocol. (f) pFLP2 plasmid used for Flp-mediated excision of the antibiotic cassette to generate unmarked mutants. Source: Choi et al, 2005; Hoang et al, 1998; GenScript.

(a) (b)

(c) (d)

(e) (f)

25

Plasmids were extracted from overnight E. coli DH5 cultures using the GenElute Plasmid

Miniprep Kit (Sigma). The overnight culture was pelleted by centrifugation at 12,000 x g for 1 minute

and resuspended in 200 L of the resuspension solution. The cells were lysed by 200 L of the lysis

solution followed immediately by gentle inversion until it became clear and viscous. The cell debris was

precipitated by adding 350 L of the neutralization/binding solution and gently inverted, following by

centrifugation at 12,000 x g for 10 minutes. A binding column was washed with 500 L of column

preparation solution and centrifuged at 12,000 x g for 1 minute. The cell supernatant was transferred to

the binding column and centrifuged at 12,000 x g for 1 minute. The column was washed with 750 L of

wash solution and centrifuged at 12,000 x g for 1 minute, followed by an additional 2 minute spin after

discarding the flow-through. The binding column was transferred to a 1.5 mL microcentrifuge tube and

50 L or 100 L of molecular reagent water was added, and then centrifuged at 12,000 x g for 1 minute.

All plasmid minipreps were stored at -20oC.

v. Acquisition of SDH Genes

The P. putida KT2440 SDH homologs were previously identified (Singh et al, 2008) and the DNA

sequences were obtained from GenBank through NCBI (http://www.ncbi.nlm.nih.gov/genbank/). The

accession and version numbers for the SDH homologs are: AroE, NP_742244.1; Ael1, NP_745146; YdiB,

NP_744554.1; RifI NP_744752.1; and SdhL, NP_745898.2.

vi. Primer Design

The Pp-AroE-For primer and the Pp-AroE-UPR-Gm primer amplify a 292 bp 5 fragment of the

AroE gene and have melting temperatures of 67oC and 71oC with a CG content of 56% and 50%. The Pp-

AroE-DNF-Gm primer and the Pp-AroE-Rev primer amplify a 279 bp 3 fragment of the AroE gene and

have melting temperatures of 71oC and 69oC with a CG content of 52% and 61%. The Pp-Ael1-For primer

and the Pp-Ael1-UPR-Gm primer amplify a 269 bp 5 fragment of the Ael1 gene and have melting

26

temperatures of 67oC and 71oC with a CG content of 55% and 61%. The Pp-Ael1-DNF-Gm primer and the

Pp-Ael1-Rev primer amplify a 272 bp 3 fragment of the Ael1 gene and have melting temperatures of

71oC and 68oC with a CG content of 52% and 56%. The Pp-YdiB-For primer and the Pp-YdiB-UPR-Gm

primer amplify a 278 bp 5 fragment of the YdiB gene and have melting temperatures of 68oC and 70oC

with a CG content of 56% and 49%. The Pp-YdiB-DNF primer and the Pp-YdiB-Rev primer amplify a 300

bp 5 fragment of the YdiB gene and have melting temperatures of 71oC and 69oC with a CG content of

51% and 61%. The Pp-RifI-For primer and the Pp-RifI-UPR-Gm primer amplify a 338 bp 5 fragment of the

RifI gene and have melting temperatures of 66oC and 71oC with a CG content of 55% and 50%. The Pp-

RifI-DNF-Gm primer and the Pp-RifI-Rev primer amplify a 258 bp 5 fragment of the RifI gene and have

melting temperatures of 71oC and 68oC with a CG content of 56% and 49%. The Pp-SdhL-For primer and

the Pp-SdhL-UPR-Gm primer amplify a 288 bp 5 fragment of the SdhL gene and have melting

temperatures of 66oC and 71oC with a CG content of 55% and 50%. The Pp-SdhL-DNF-Gm primer and the

Pp-SdhL-Rev primer amplify a 314 bp 5 fragment of the SdhL gene and have melting temperatures of

71oC and 68oC with a CG content of 51% and 58% (Table 1). All gene-specific and recombination primers

were ordered from IDT. The M13 universal primers were commercially available from IDT. The 16S rRNA

PCR primers and the gapA and the gyrB MLSA typing PCR and sequencing primers were obtained from

the Guttman Lab (Table 1).

27

Table 1: Primer design for generating SDH knockout mutants. Gene-specific primers amplify the 5 and

3 SDH fragments; with restriction sites in the 5 forward and 3 reverse primers (bold) and a 20

bp overlap with the Gm cassette in the 5 reverse and 3 forward primers (underlined). Gm

primers amplify the Gm cassette. Cold Fusion primers are gene-specific with a 15 bp overlap

with the pEX18Ap suicide vector. M13 primers amplify the MCS from pEX18Ap. MLSA typing

primers amplify the gapA and gyrB housekeeping genes in P. putida.

Primer Name Primer Sequence (5 3)

Gene Specific Primers

Pp-AroE-For CGACCGAATTCATCCATCCTCATGTCGCTGCC

Pp-AroE-UPR-Gm TCAGAGCGCTTTTGAAGCTAATTCGAGCGTGGCATATTCCAGGTCC

Pp-AroE-DNF-Gm AGGAACTTCAAGATCCCCAATTCGTGTATGGCAAGGAGCCGACG

Pp-AroE-Rev CGAACGGGATCCCGACGTACTTTGTGGGAACGG

Pp-Ael1-For CGACCGAATTCACCACGATTCACCAAGTAGCCC

Pp-Ael1-UPR-Gm TCAGAGCGCTTTTGAAGCTAATTCGGTATTCCAGCTGCTGGTTGCTG

Pp-Ael1-DNF-Gm AGGAACTTCAAGATCCCCAATTCGGAGCTGGCCTATGGCAAAGG

Pp-Ael1-Rev CGAACGGGATCCCGAACATGTTGTGGTTGATGCC

Pp-YdiB-For CGACCGAATTCGGATTATGGTGGGCAGGAACAGG

Pp-YdiB-UPR-Gm TCAGAGCGCTTTTGAAGCTAATTCGAGGCATTCGAGCTGTTCAGC

Pp-YdiB-DNF-Gm AGGAACTTCAAGATCCCCAATTCGTCGTCCAGTTGCAACTGGTCG

Pp-YdiB-Rev CGAACGGGATCCCGTTCCGTCACTTGTCGTTCG

Pp-RifI-For CGACCGAATTCCGAAGCTGTTGTGTGTGTGC

Pp-RifI-UPR-Gm TCAGAGCGCTTTTGAAGCTAATTCGAGTGGGCTGGAAGACTTCGAC

Pp-RifI-DNF-Gm AGGAACTTCAAGATCCCCAATTCGCGAGGTTGCAGTTGTTGTGGTTG

Pp-RifI-Rev CGACCGAAGCTTCGATAACCGGATCATGACTGCG

Pp-SdhL-For CGACCGAATTCAGCAAGCGTATGTCGATGCC

Pp-SdhL-UPR-Gm TCAGAGCGCTTTTGAAGCTAATTCGTGTTGTACACCGGGGTAAGGC

Pp-SdhL-DNF-Gm AGGAACTTCAAGATCCCCAATTCGATGCAGGCTTCCTTGTACGGC

Pp-SdhL-Rev CGACCGAAGCTTCAGTGGCTGACTCTGTTACGC

28

Gentamycin Primers

Gm-F CGAATTAGCTTCAAAAGCGCTCTGA

Gm-R CGAATTGGGGATCTTGAAGTTCCT

Cold Fusion Cloning Primers

Pp-AroE-RecF CGACTCTAGAGGATCATCCATCCTCATGTCGCTGCC

Pp-AroE-RecR CGGTACCCGGGGATCCGACGTACTTTGTGGGAACGG

Pp-Ael1-RecF CGACTCTAGAGGATCACCACGATTCACCAAGTAGCCC

Pp-Ael1-RecR CGGTACCCGGGGATCCGAACATGTTGTGGTTGATGCC

Pp-YdiB-RecF CGACTCTAGAGGATCGGATTATGGTGGGCAGGAACAGG

Pp-YdiB-RecR CGGTACCCGGGGATCCGTTCCGTCACTTGTCGTTCG

Pp-RifI-RecF CGACTCTAGAGGATCCGAAGCTGTTGTGTGTGTGC

Pp-RifI-RecR CGGTACCCGGGGATCCGATAACCGGATCATGACTGCG

Pp-SdhL-RecF CGACTCTAGAGGATCAGCAAGCGTATGTCGATGCC

Pp-SdhL-RecR CGGTACCCGGGGATCCAGTGGCTGACTCTGTTACGC

M13 Primers

M13-For GTTTTCCCAGTCACGAC

M13-Rev CAGGAAACAGCTATGAC

16S rRNA Primers

16S(Ps-f)

16S(Ps-r)

GGTCTGAGAGGATGATCAGT

TTAGCTCCACCTCGCGGC

MLSA PCR Primers

gapA+264

gapA-931

gyrB+133

gyrB-1124

CCGGCSGARCTGCCSTGG

ASSCCCAYTCGTTGTCRTACCA

CTGCACCAYATGGTSTTCGAGG

CGNGCDGCRTCGAKCATCTTGC

29

MLSA Sequencing Primers

gapA+312

gapA-874

gyrB+271

gyrB-1022

TCGARTGCACSGGBCTSTTCACC

GTGTGRTTGGCRTCGAARATCGA

TCBGCRGCVGARGTSATCATGAC

TTGTCYTTGGTCTGSGAGCTGAA

vii. Template PCR

The 5 and 3 fragments of the SDH genes were PCR amplified from P. putida genomic DNA

(gDNA) using gene-specific primers. The template PCR was optimized using various concentrations of

gDNA, an annealing temperature gradient from 50oC-65oC and lab-purified Pfu/Taq polymerase, or high-

fidelity commercial Pfu/Taq polymerase (Fermentas). A 50 L PCR reaction was prepared containing 40

ng gDNA, 1X Pfu buffer with Mg2+ (lab-made), 200 M dNTPs (BioBasic), 10 M forward primer, 10 M

reverse primer, 1 unit Pfu/Taq polymerase and sterile, distilled water. Cycle conditions were 95oC for 5

minutes, followed by 35 cycles of 95oC for 30 seconds, 55oC for 30 seconds, 72oC for 1 minute (30

seconds for Taq) and a final extension at 72oC for 10 minutes. The PCR products were run on a 0.8%

agarose gel containing ethidium bromide and the 5 and 3 fragments were extracted using the GenElute

Gel Extraction Kit (Sigma) or the QIAquick Gel Extraction Kit (Qiagen).

viii. Gentamycin PCR

The gentamycin (Gm) resistance cassette was PCR amplified from the pUC18T-mini-TN7T-Gm

vector using the Gm-F and Gm-R primers. A 50 L PCR reaction was prepared containing 6 ng of the

vector, 1X Pfu buffer with Mg2+ (lab-made), 200 M dNTPs (BioBasic), 10 M forward primer, 10 M

reverse primer, 1 unit Pfu/Taq polymerase and sterile, distilled water. Cycle conditions were 95oC for 5

minutes, followed by 35 cycles of 95oC for 30 seconds, 55oC for 30 seconds, 72oC for 2 minutes (1 minute

for Taq) and a final extension at 72oC for 10 minutes. The Gm product was run on a 0.8% agarose gel

30

containing ethidium bromide and extracted using the GenElute Gel Extraction Kit (Sigma) or the

QIAquick Gel Extraction Kit (Qiagen).

ix. Gene SOEing PCR

The SDH mutant fragments were amplified by gene SOEing using the 5 and 3 SDH fragments of

the gene and the Gm resistance cassette as template. SOEing was originally done with lab-purified Pfu

polymerase and was optimized through trials using different concentrations of templates, different

molar ratios of templates, with and without DMSO, an annealing temperature gradient from 50oC-65oC,

3-5 cycles pre-addition of primers, 25-35 cycles post-addition of primers, different annealing and

extension times, diluted polymerase, addition of extra Pfu post-addition of primers, two-template PCR

and three-template PCR. The SOEing was completed using high-fidelity commercial Taq in a 50 L PCR

reaction containing 40 ng of each template, 1X Taq buffer (Fermentas), 0.25 L Mg2+ (BioBasic), 200 M

dNTPs (BioBasic), 1 unit Taq polymerase (Fermentas) and sterile, distilled water. Cycle conditions were

95oC for 5 minutes, followed by 5 cycles of 95oC for 30 seconds, 55oC for 30 seconds and 72oC for 1

minute 45 seconds. The PCR was paused while 10 M forward primer (Pp-[SDH]-For) and 10 M reverse

primer (Pp-[SDH]-Rev) were added to the reaction. The PCR continued with 35 cycles of 95oC for 30

seconds, 55oC for 30 seconds and 72oC for 1 minute 45 seconds with a final extension at 72oC for 10

minutes, used with Taq polymerase. The hot-start DNA polymerase Phire was used for a more precise

result. A 25 L PCR reaction was prepared containing 40 ng of all templates, 5X Phire buffer with Mg2+

(Finnzymes), 200 M dNTPs (BioBasic), 1 unit Phire polymerase (Finnzymes) and sterile, distilled water.

Cycle conditions were 98oC for 30 seconds, followed by 5 cycles of 98oC for 5 seconds, 55oC for 10

seconds and 72oC for 45 seconds. The PCR was paused while 10 M forward primer (Pp-[SDH]-For) and

10 M reverse primer (Pp-[SDH]-Rev) were added to the reaction. The PCR continued with 35 cycles of

98oC for 5 seconds, 55oC for 10 seconds and 72oC for 45 seconds with a final extension at 72oC for 5

31

minutes. The SDH mutant fragments were run on 0.8% agarose gels containing ethidium bromide and

extracted using the GenElute Gel Extraction Kit (Sigma).

x. Generation of E. coli DH5 competent cells

An E. coli DH5 colony was used to inoculate a preculture in 5 mL LB with 100 mg/mL ampicillin and

incubated overnight at 37oC with shaking. A 10-fold dilution of preculture to LB with 100 mg/mL

ampicillin was made and incubated at 37oC with shaking until the OD600nm reached 0.6. The culture was

divided into two aliquots of 50 mL each and centrifuged at 4000 rpm for 10 minutes at 4oC, resuspended

in 25 mL of an ice-cold solution of 0.1 M CaCl2, incubated on ice for 30 minutes then centrifuged at 4000

rpm for 10 minutes at 4oC. The pellet was resuspended in 5 mL of an ice-cold solution of 0.1 M CaCl2

with 10% glycerol, divided into 100 L aliquots and flash frozen in liquid nitrogen. All competent cells

were stored at -80oC.

xi. Cloning into pUC18

The pUC18 plasmid was used as an intermediate cloning vector for the SDH mutant fragments.

The blunt-end Phire polymerase PCR products were ligated into the pUC18 plasmid that had been

digested with SmaI restriction enzyme (NEB) in a 20 L reaction containing 1X NEBuffer4 (NEB), 50 ng

pUC18, 2 L SmaI and sterile, distilled water. The reaction was incubated overnight at room

temperature. The SDH mutant fragments were ligated in the vector in a 10 L reaction containing a 2:1

molar ratio of insert:vector, 10X ligation buffer (Fermentas), T4 ligase (Fermentas) and sterile, distilled

water. The ligation was incubated overnight at room temperature. After the competent cells were

thawed on ice for 10 minutes, the ligation was added to the cells and incubated on ice for 25 minutes.

The cells were heat-shocked at 42oC for 1 minute, incubated on ice for 5 minutes, and then 1 mL of LB

without antibiotics was added to the cells and incubated at 37oC for 1 hour. The culture was centrifuged

at 13,000 x g for 1 minute, the supernatant discarded and the pellet resuspended in 50-100 L LB. The

32

resuspended cells were plated on LB agar with 100 g/mL ampicillin, 40 mg/mL X-Gal and 0.1 mM IPTG,

and incubated overnight at 37oC.

xii. Cloning into pEX18Ap

All SDH fragments: The pEX18Ap plasmid was digested with FastDigest SmaI restriction enzyme

(Fermentas) in a 20 L reaction containing 1X FastDigest Buffer (Fermentas), 40 ng mutant fragment, 1

L SmaI and sterile, distilled water. The reaction was incubated at 37oC for 30 minutes and inactivated at

65oC for 5 minutes. AroE and Ael1 mutant fragment: Mutant fragments were digested with EcoRI and

BamHI (NEB) in a 10 L reaction containing 1X Buffer Tango (NEB), 50 ng mutant fragment, 1 L EcoRI, 2

L BamHI and sterile, distilled water; pEX18Ap was digested with EcoRI and BamHI in a 20 L reaction

containing 1X Buffer Tango, 50 ng mutant fragment, 1 L EcoRI, 2 L BamHI and sterile, distilled water.

Both digests were incubated overnight at 37oC with a 20 minute inactivation at 65oC. YdiB mutant

fragment: Mutant fragment was digested with FastDigest BamHI (Fermentas) in a 30 L reaction

containing 1X FastDigest buffer (Fermentas), 50 ng mutant fragment, 1 L FD BamHI and sterile, distilled

water; pEX18Ap was digested first with FastDigest SmaI (Fermentas) in a 20 L reaction containing 1X

FastDigest buffer, 1 g pEX18Ap, 1 L FD SmaI and sterile, distilled water and incubated for 30 minutes

at 37oC, then 1 L FD BamHI was added and incubated for an additional 30 minutes at 37oC with a 20

minute inactivation at 65oC. RifI and SdhL mutant fragment: Mutant fragments were digested with

FastDigest HindIII (Fermentas) in a 30 L reaction containing 1X FastDigest buffer (Fermentas), 50 ng

mutant fragment, 1 L FD HindIII and sterile, distilled water; pEX18Ap was digested with FastDigest SmaI

and FastDigest HindIII in a 20 L reaction containing 1X FastDigest buffer, 1 g pEX18Ap, 1 L FD SmaI, 1

L FD HindIII and sterile, distilled water, and incubated for 30 minutes at 37oC with a 20 minute

inactivation at 65oC.

33

All digests were cleaned up using the PureLink PCR Purification Kit (Invitrogen) protocol. A 10 L

ligation was prepared for each mutant fragment containing 1X ligation buffer (Fermentas), a 3:1 insert

to vector molar ratio, 1 unit T4 ligase (Fermentas) and water. The ligations were incubated overnight at

room temperature and transformed into E. coli DH5 competent cells. The digests were cleaned using

the PureLink PCR Purification Kit (Invitrogen) and the PCR purified samples were stored at -20oC. The

ligations were transformed into E. coli DH5 competent cells.

xiii. Cold Fusion Recombination Cloning

The SDH mutant fragments were amplified during the SOEing PCR with cold fusion cloning

primers to produce recombinant (Rec) SDH mutant fragments (Table 1). A 25 L PCR reaction was

prepared containing 40 ng of all templates, 5X Phire buffer with Mg2+ (Finnzymes), 200 M dNTPs

(BioBasic), 1 unit Phire polymerase (Finnzymes) and sterile, distilled water. Cycle conditions were 98oC

for 30 seconds, followed by 5 cycles of 98oC for 5 seconds, 55oC for 10 seconds and 72oC for 45 seconds.

The PCR was paused while 10 M forward primer (Pp-[SDH]-RecF) and 10 M reverse primer (Pp-[SDH]-

RecR) were added to the reaction. The PCR continued with 35 cycles of 98oC for 5 seconds, 55oC for 10

seconds and 72oC for 45 seconds with a final extension at 72oC for 5 minutes. The SDH mutant

fragments were run on 0.8% agarose gels containing ethidium bromide and extracted using the

GenElute Gel Extraction Kit (Sigma). The pEX18Ap plasmid was digested with FastDigest BamHI

(Fermentas) in a 20 L reaction containing 1X FastDigest buffer (Fermentas), 1 g pEX18Ap, 1 L FD

BamHI and water. The digest was cleaned up using the PureLink PCR Purification Kit (Invitrogen). The

Rec-SDH mutant fragments were ligated with the BamHI-digested pEX18Ap using the Cold Fusion

Cloning Kit (Systems Biosciences). A 10 L cold fusion reaction was set up with a 2:1 molar ratio of

insert:linearized vector, 5X master mix and sterile, distilled water followed by incubation for 5 minutes

at room temperature and then 10 minutes on ice. The reaction was transformed into E. coli DH5

competent cells.

34

xiv. Diagnostic PCR

The diagnostic PCR amplified the SDH mutant fragment from the plasmid using gene-specific

primers, the multiple cloning site containing the SDH mutant fragment using M13 primers, and the Gm

cassette using Gm primers.LB cultures of white, GmR E. coli DH5 colonies were plasmid miniprepped

using the GenElute Plasmid Miniprep Kit (Sigma). The putative pEX18Ap SDH mutant constructs were

subjected to a 25 L diagnostic PCR containing 20 ng of the plasmid, 1X Pfu buffer with Mg2+ (lab-made),

200 M dNTPs (BioBasic), 10 M forward primer, 10 M reverse primer (gene specific, M13 and Gm

primers), 1 unit Pfu polymerase (lab-purified) and sterile, distilled water. Cycle conditions were 95oC for

5 minutes, followed by 35 cycles of 95oC for 30 seconds, 55oC for 30 seconds, 72oC for 3 minutes 30

seconds and a final extension at 72oC for 10 minutes. The PCR products were run on a 0.8% agarose gel

containing ethidium bromide.

xv. Diagnostic Digests

Diagnostic digests were used to cut out the SDH mutant fragment from the plasmid using EcoRI

and BamHI/HindIII and the Gm cassette using XbaI. LB cultures of white E. coli DH5 colonies were

plasmid miniprepped using the GenElute Plasmid Miniprep Kit (Sigma). The plasmids were digested in a

20 L reaction containing 1X FastDigest buffer (Fermentas), 1 g plasmid, 1 L FD EcoRI (Fermentas), 1

L FD BamHI (Fermentas) or FD HindIII (Fermentas) and sterile, distilled water; and containing 1X

FastDigest buffer (Fermentas), 1 g plasmid, 1 L FD XbaI (Fermentas) and sterile, distilled water. All

diagnostic digests were run on 0.8% agarose gels containing ethidium bromide.

xvi. Sequencing PCR

The SDH mutant constructs were used as template for sequencing. The plasmid template was

heated at 85oC for 5 minutes prior to setting up the reaction. A 10 L PCR was prepared containing 500

ng plasmid, 5X sequencing buffer (Applied Biosystems), 10 M forward OR reverse primer, 0.5 L BigDye

35

mix (Applied Biosystems) and sterile, distilled water. The gene-specific forward and reverse primers (Pp-

[SDH]-For and Pp-[SDH]-Rev) or the vector-specific M13 primers were used. The PCRs were submitted to

the CAGEF lab for sequencing.

xvii. Generation of P. putida KT2440 electrocompetent cells

The Kumar protocol was initially used for generation of P. putida KT2440 electrocompetent cells,

where 6 mL of an overnight culture of WT P. putida KT2440 grown in LB broth with no antibiotic was

divided equally into 4 microcentrifuge tubes and centrifuged at 4000 rpm for 10 minutes at room

temperature. The cell pellets were washed twice with 1 mL of room temperature 300 mM sucrose and

resuspended in a combined total of 100 L of 1 mM sucrose. The P. putida KT2440 electrocompetent

cells used to create the knockouts were made following a protocol from the Guttman/Desveaux labs. A

WT P. putida KT2440 colony was used to inoculate a preculture in 5 mL LB with no antibiotics at 30oC

overnight with shaking. The overnight culture was used to inoculate another 5 mL LB with no antibiotic

and incubated at 30oC with shaking until the OD600 was 0.6-0.8. The culture was incubated on ice for 10

minutes and centrifuged at 5000 rpm for 10 minutes. The pellet was resuspended in ice-cold 0.5 M

sucrose in the same volume as the original culture. The cells were centrifuged at 5000 rpm for 10

minutes then resuspended in 0.5 M ice-cold sucrose twice more. The cells were flash frozen in liquid

nitrogen in 200 L aliquots and stored at -80oC.

xviii. Electroporation into P. putida electrocompetent cells

The Guttman/Desveaux protocol was also used for electroporation. The pEX18Ap SDH mutant

constructs were added to 200 L WT P. putida KT2440 electrocompetent cells and transferred to a 2 mm

gap width electroporation cuvette. A BioRad Gene Pulser II pulsed the electrocompetent cells (25 F,

400 ohm and 2.5 kV) followed by the immediate addition of 1 mL LB broth. The cells were incubated for

1 hour, plated on LB agar with 30 g/mL Gm and incubated overnight at 30oC. Cells were patched onto

36

LB with 30 g/mL Gm and LB with 200 g/mL Cb to determine double-crossover from single-crossover

events. Merodiploids were resolved by plating on LB with 30 g/mL Gm and 5% sucrose. The colonies

that were resistant to Gm and sucrose, and sensitive to Cb (GmR, CbS and SucR) were considered putative

KO mutants. The Kumar protocol differed from the Guttman/Desveaux protocol by using 100 L of

electrocompetent cells.

xix. Colony PCR

The putative KO mutant colonies were used as template in a colony PCR to amplify the SDH

mutant fragments and the Gm cassette. A 50 L PCR reaction was set up containing the colony, 1X Pfu

buffer with Mg2+ (lab-made), 200 M dNTPs (BioBasic), 1 unit Pfu polymerase (lab-purified) and sterile,

distilled water. Cycle conditions were 95oC for 5 minutes, followed by 35 cycles of 95oC for 30 seconds,

55oC for 30 seconds and 72oC for 3 minutes 30 seconds, with a final extension at 72oC for 10 minutes.

The colony PCR products were run on 0.8% agarose gels containing ethidium bromide. The colony PCR

was optimized by incubating the colonies in sterile, distilled water at 80oC for 5 minutes before setting

up the reaction.

xx. Extraction of KO genomic DNA

The P. putida KT2440 AroE KO and P. putida KT2440 Ael1 KO permanent stocks were used to

inoculate LB broth with no antibiotics and incubated overnight at 30oC with shaking. Genomic DNA was

extracted from the P. putida KT2440 KOs using the Puregene Genomic DNA Purification Kit (Gentra

Systems) for DNA purification from 0.5 mL gram-negative bacterial culture.

xxi. Verification of KOs PCR

The AroE KO and Ael1 KO were confirmed by amplification of the KO gDNA with the forward

AroE or Ael1 primers and the Gm reverse primer, with WT gDNA as a control. A 50 L PCR was set up

containing 250 ng of WT, AroE KO or Ael1 KO gDNA, 1X Pfu buffer with Mg2+ (lab-made), 200 M dNTPs

37

(BioBasic), 10 M forward primer (Pp-[SDH]-For), 10 M reverse primer (Gm-R for KOs and Pp-[SDH]-

Rev for WT), 1 unit Pfu polymerase (lab-purified) and sterile, distilled water. Cycle conditions were 95oC

for 2 minutes, followed by 35 cycles of 95oC for 30 seconds, 55oC for 30 seconds, 72oC for 3 minutes and

a final extension at 72oC for 3 minutes. The PCR products were run on a 0.8% agarose gel containing

ethidium bromide.

xxii. Preliminary verification of P. putida KO`s

Presence of RifI gene: A 50 L PCR was set up containing 60 ng of WT, AroE KO or Ael1 KO P.

putida gDNA, 1X Pfu buffer with Mg2+ (lab-made), 200 M dNTPs (BioBasic), 10 M forward primer (Pp-

RifI-For), 10 M reverse primer (Pp-RifI-Rev), 1 unit Pfu polymerase (lab-purified) and sterile, distilled

water. Cycle conditions were 94oC for 2 minutes, followed by 3 cycles of 95oC for 2 minutes, 55oC for 30

seconds, 72oC for 2 minutes, followed by 32 cycles of 95oC for 30 seconds, 55oC for 30 seconds, 72oC for

2 minutes, and a final extension at 72oC for 3 minutes. The PCR products were run on a 0.8% agarose gel

containing ethidium bromide. 16S rRNA: A 25 L PCR was set up containing 50 ng of WT, AroE KO or

Ael1 KO gDNA, 10X Taq buffer (Fermentas), 25 mM Mg2+ (BioBasic), 200 M dNTPs (BioBasic), 10 M

forward primer (16S(Ps-f)), 10 M reverse primer (16S(Ps-r)), 1 unit Taq polymerase (Fermentas) and

sterile, distilled water. Cycle conditions were 94oC for 4 minutes, followed by 35 cycles of 94oC for 30

seconds, 55oC for 30 seconds, 72oC for 2 minutes, and a final extension at 72oC for 5 minutes. The PCR

products were suspended in 10 L of 10 mM Mg. Temperature dependence: The AroE and Ael1 KOs

were streaked on identical LB plates with 30 g/mL Gm and incubated overnight at 30oC and 37oC.

xxiii. MLSA typing

A 25 L PCR was set up containing 20 ng of WT, AroE KO or Ael1 KO gDNA, 10X Taq buffer

(Fermentas), 25 mM Mg2+ (BioBasic), 200 M dNTPs (BioBasic), 100% DMSO, 10 M forward primer

(gapA+264 or gyrB+133), 10 M reverse primer (gapA-931 or gyrB-1124), 1 unit Taq polymerase

38

(Fermentas) and sterile, distilled water. Cycle conditions were 94oC for 2 minutes, followed by 35 cycles

of 94oC for 30 seconds, 58oC for 30 seconds, 72oC for 1 minute, and a final extension at 72oC for 5

minutes with a 10oC soak. The PCR products were run on a 0.8% agarose gel containing ethidium

bromide. The MLSA sequencing PCR was set up containing 20 ng of WT, AroE KO or Ael1 KO gDNA, 10X

Taq buffer (Fermentas), 25 mM Mg2+ (BioBasic), 200 M dNTPs (BioBasic), 100% DMSO, 10 M forward

primer (gapA+312 or gyrB+271), 10 M reverse primer (gapA-974 or gyrB-1022), 1 unit Taq

polymerase (Fermentas) and sterile, distilled water. Cycle conditions were 94oC for 2 minutes, followed

by 35 cycles of 94oC for 30 seconds, 58oC for 30 seconds, 72oC for 1 minute, and a final extension at 72oC

for 5 minutes with a 10oC soak. The PCR was submitted to the CAGEF lab for sequencing.

3.2 Characterization of AroE and Ael1 Knockouts

i. Growth Curve Assay

LB broth with no antibiotics was inoculated with WT P. putida, AroE KO and Ael1 KO and

incubated overnight at 30oC with shaking. The overnight cultures were used to inoculate 250 mL of LB

with no antibiotics and grown for 2 hours until reaching an OD600 of approximately 0.6. The 250 mL

cultures were incubated at 30oC with shaking for 13-15 hours, 1 mL aliquots were removed every half

hour and the OD600 was measured and recorded on a spectrophotometer. The data was input and the

growth curves were graphed using Microsoft Office Excel. A growth assay of WT P. putida in PMM was

also completed.

ii. Auxotroph Recovery

The AroE and Ael1 KOs were grown in PMM broth overnight at 30oC with shaking. The PMM

was preliminarily supplemented with 2.5 M shikimic acid, 3.7 M quinic acid, 2.2 M chorismate, 2.6 M

benzoic acid, 2.6 M gallic acid, 5.0 M citric acid or 3.0 M FeSO4 and grown overnight at 30oC with

shaking.

39

iii. Serial Culturing

The AroE and Ael1 knockouts were grown overnight at 30oC with shaking in 20 mL LB broth with

no antibiotics. The 20 mL overnight culture was used to inoculate 180 mL of PMM and grown at 30oC

with shaking until the culture reached an