Simulation-based model checking approach to cell fate specification
during C. elegans vulval development by HFPNe
Chen LI Masao NagasakiKazuko Ueno Satoru Miyano
Overview of the work
The topic of this presentation
Establish a quantitative methodology to model and analyze in silico models
incorporating model checking approach.
overview
Biological consideration (Rule1)
Biological consideration (Rule II)
Qualitative Model Checking
Application: Vulval Precursor Cell (VPC) Fate Determination Model
Quantitative Model
Our work: HFPNe Model Checking HFPNe: Hybrid Functional Petri Net with extension
Overview of the work (Background)
• Discrete model• Computational Tree Logic (CTL), Linear Temporal Logic (LTL)
Biological consideration (Rule I)
+Model Checking
1.
2.
3.
Vulval induction in C. elegans
What is model checking?
Specification(Desired system properties)
Model checkerModel(System requirements)
AnswerYes: if model satisfies specification
No: if model does not satisfies specification
Counterexample
A high speed technique for automatic verification of systems. Formal validation method applied to ensure consistency and
correctness Model checking:
⇒ Essential idea: conducts an exhaustive exploration of all possible behaviors.
Method : model checking
Biological background of VPC fate determination
Induced signal
Lateral signal
Vulva
The fates of 1◦, 2 ◦ and 3 ◦ are the production of the coordination regulated by three signaling pathways.
Fate deterination mechanism
VulvaHypodermis Hypodermis
* Sternberg PW: Vulval development. WormBook 2005, 25:1-28.* Sternberg PW, Horvitz HR: The combined action of two intercellular signaling pathways specifies three cell fates during vulval induction in C. elegans. Cell 1989,58(4):679-693.
Hybrid Functional Petri Net with extension (HFPNe)Continuous
Discrete
• Nagasaki, M., Doi, A., Matsuno, H., and Miyano, S., A versatile Petri net based architecture for modeling and simulation of complex biological processees, Genome Informatics, 15(1):180–197, 2004.
• https://cionline.hgc.jp
speed
Entities Processes Connectors
delay
Continuous entity
Discrete entity
Continuous process
Discrete process
Process connector
Association connector
Inhibitation connector
Generic entity
Various types
Generic process
Various operations
Generic
DNA sequenceTCAGGAAGTGCGCCA
transcriptionSubstance
Transcription stateAUGAAAGCAAUUUUCGUACG
mRNA
Modeling method
HFPNe model of VPC fate determination mechanism
Number of Entities: 427
Number of Processes: 554
Number of Connectors: 780
HFPNe model on Cell Illustrator Online 4.0
Signaling crosstalks underlying VPC fate determination
https://cionline.hgc.jp
Modeling method
Simulating HFPNe model with model checking method on Cell IllustratorTwo rules of determining VPCs for 48 genotypes
Temporal interval (Rule I) and temporal order (Rule II) Combination of AC and four genes
Simulation targets for evaluation Fate patterns from In silico and in vivo experiments
Simulation
Anchor Cell formed, ablated
lin-12 wt, ko, gf
lin-15, vul, lst wt, ko
Two rules of determining VPC fates
[Rule I]: Fate can sustain the behaviors at a certain over-threshold state within a given length of time.
[Rule II]: Fate will be priorly adopted according to the temporal sequence of first time epoch inducing over-threshold state.
⇒ 2○ fate
⇒ 1○ fate
Too shortEarlier
First over-threshold state
Two rules of determining VPC fates
[ ]
3○ 3○ 2○ 1○ 2○ 3○
Cell fate pattern
Rule I or II
Simulation targets for evaluation
In silico data- model checking
[3 3 2 2 2 3][3 1 1 1 1 3]
…[1 1 1 1 1 1][3 1 1 1 1 1]
In vivo dataIn vivo data*[3 3 2 1 2 3][2 1 2 1 2 2]
…[2 2 2 2 2 2]
? → 1 ◦, 2 ◦, 3 ◦
Hybrid lineages*[3 3 3 ? 3 3]
[3 3 3 1 3 3][3 3 3 2 3 3][3 3 3 3 3 3]
Cell fate patterns
*Sternberg, P.W. and Horvitz, H.R., The combined action of two intercellular signaling pathways specifies three cell fates during vulval induction in C. elegans, Cell, 58(4):679–693,1989.
• Investigate the variations of each fate pattern• Evaluate two rules by comparing simulation targets
Simulation procedures
Purpose: Investigate the variations of each fate pattern Evaluate two rules by comparing simulation targets
Simulation targets for evaluation Noise parameters:
Log-normal distribution: LSMass(arg1, arg2) Emulation of temporal stimulations Function of rand()
HFPNe models: 10,000 simulations for 48 sets of different genetic conditions (in total 480,000 runs).
Simulator: Cell Illustrator “High-Speed Simulation Module” 10,000 simulations conducted on a day on average
48 sets processed within 6 days with eight processors (Intel Xeon ⇒3.0GHz processor with 16GB of memory).
Simulation
Simulation results
Conclusion
Modeling and simulating biological systems using the model checking approach based on HFPNe. Two rules for the quantitative model of the VPC fate specification are
considered from two viewpoints. i.e., temporal interval and temporal order
The simulation targets including in silico and in vivo data are considered. Sp., observation of hybrid lineage data.
480,000 simulations are performed to Examine the consistency and the correctness of the model Evaluate the two rules of VPC fate specification.
Computational experiment and biological evaluation: could not be easily put into practice without the HFPNe modeling method and the functions of Cell Illustrator (“High-Speed Simulation Module”)