Ammonia generation by tryptophan synthase drives akey genetic difference between genital and ocularChlamydia trachomatis isolatesShardulendra P. Sherchanda and Ashok Aiyara,1

aDepartment of Microbiology, Immunology, and Parasitology, Louisiana State University Health Sciences Center New Orleans, New Orleans, LA 70112

Edited by Ralph R. Isberg, Tufts University School of Medicine, Boston, MA, and approved April 19, 2019 (received for review December 19, 2018)

A striking difference between genital and ocular clinical isolates ofChlamydia trachomatis is that only the former express a functionaltryptophan synthase and therefore can synthesize tryptophan byindole salvage. Ocular isolates uniformly cannot use indole due toinactivating mutations within tryptophan synthase, indicating aselection against maintaining this enzyme in the ocular environ-ment. Here, we demonstrate that this selection occurs in twosteps. First, specific indole derivatives, produced by the human gutmicrobiome and present in serum, rapidly induce expression of C. tra-chomatis tryptophan synthase, even under conditions of tryptophansufficiency. We demonstrate that these indole derivatives function byacting as de-repressors of C. trachomatis TrpR. Second, trp operon de-repression is profoundly deleteriouswhen infected cells are in an indole-deficient environment, because in the absence of indole, tryptophansynthase deaminates serine to pyruvate and ammonia. We have usedbiochemical and genetic approaches to demonstrate that expressionof wild-type tryptophan synthase is required for the bactericidalproduction of ammonia. Pertinently, although these indole deriva-tives de-repress the trpRBA operon of C. trachomatis strains withtrpA or trpBmutations, no ammonia is produced, and no deleteriouseffects are observed. Our studies demonstrate that tryptophan syn-thase can catalyze the ammonia-generating β-elimination reactionwithin any live bacterium. Our results also likely explain previousobservations demonstrating that the same indole derivatives inhibitthe growth of other pathogenic bacterial species, and why highserum levels of these indole derivatives are favorable for the prog-nosis of diseased conditions associated with bacterial dysbiosis.

Chlamydia trachomatis | genital and ocular serovars | tryptophan synthaseβ-elimination | serine deamination | trp operon de-repression

The bacterium Chlamydia trachomatis is an obligate intracel-lular pathogen that causes urogenital and ocular infections of

humans. Distinct serovars of C. trachomatis, classified based ontheir outer membrane proteins, are associated with infections atthese sites. Ocular infections are associated with serovars A–C,while urogenital infections are associated with serovars D–K.Genetic and sequence studies indicate that the genomes ofoculotropic and genitotropic strains are >99% identical with twostriking differences (1). Urogenital strains encode an intact cy-totoxin with a GTPase-inactivating domain (CT166) (2) and, inaddition, encode a functional tryptophan synthase that providesthem the capacity to synthesize tryptophan via indole salvage (3,4). The observation that urogenital C. trachomatis isolates ex-press a functional tryptophan synthase extends to genital serovarB isolates, indicating a strong selective pressure to maintain thecapacity to salvage indole in the urogenital environment (3, 5).C. trachomatis is a tryptophan auxotroph and cannot synthesizetryptophan de novo. The capacity of urogenital isolates to syn-thesize tryptophan via indole salvage is proposed to reveal anintricate interplay between C. trachomatis, the IFN-γ–inducedhost enzyme indoleamine 2,3-dioxygenase (IDO1), and themicrobiome at the site of infection (3, 4, 6, 7). When induced,IDO1 degrades tryptophan to kynurenine, thereby starvingChlamydia (8–10). The antibacterial effect of IFN-γ is hampered if

the microbiome at the site of infection produces indole, permittingchlamydial tryptophan synthase to generate tryptophan and thuscircumvent host-imposed tryptophan starvation (3, 4, 6, 7). Thecomposition of the cervicovaginal microbiome indicates the pres-ence of indole-producing genera during dysbiotic conditions, pro-viding a strong reason for genital isolates to maintain an activetryptophan synthase (6, 7). In contrast, factors that drive the loss oftryptophan synthase in the majority of oculotropic strains are un-clear and the focus of this report (5).Tryptophan synthase has two α-subunits, encoded by trpA, and

two β-subunits, encoded by trpB (11, 12). Comprehensive studiesby Caldwell et al. (3), evaluating the tryptophan synthase statusof a large number of clinical genital and ocular isolates, revealedthat no clinical ocular isolates encoded an active tryptophansynthase. With rare exception, this failure arose from pointmutations in either trpA or trpB (3). In most bacteria, tryptophansynthase catalyzes two reactions termed α and β. In the α reac-tion, which is catalyzed solely by TrpA (11, 12), indole-3-glycerolphosphate undergoes a retro-aldol cleavage to release indole andglyceraldehyde-3-phosphate (G3P) (13). Indole is channeled toTrpB by TrpA (11, 14), to undergo a β-replacement reaction withserine to generate tryptophan (11, 13). In addition to β-replacement,in vitro studies using tryptophan synthase from Escherichia colidemonstrated that, in the absence of indole, TrpB deaminates

Significance

Chlamydia trachomatis is a human bacterial pathogen thatcauses distinct pathologies upon infecting ocular and urogen-ital compartments. Previous studies have shown that all uro-genital strains can express tryptophan synthase, an enzymethey use to synthesize tryptophan by salvaging indole pro-duced by other bacterial species in the infection microenvi-ronment. In stark contrast, all ocular strains of Chlamydiatrachomatis lack tryptophan synthase, typically because ofinactivating point mutations. Here, we suggest why ocularstrains lose tryptophan synthase activity; activation of thisenzyme in an indole-deficient environment, like the eye, re-sults in the deleterious production of ammonia. By identifyingthe mechanism that underlies this effect, our findings providestrategies to target infections by Chlamydia and other bacteria.

Author contributions: S.P.S. and A.A. designed research, performed research, contributednew reagents/analytic tools, analyzed data, and wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Published under the PNAS license.

Data deposition: Predicted structures for TrpR and tryptophan synthase from C. tracho-matis D/UW-3/CX have been deposited in the Zenodo data repository, https://doi.org/10.5281/zenodo.2662318.

See Commentary on page 12136.1To whom correspondence should be addressed. Email: aaiyar@lsuhsc.edu.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1821652116/-/DCSupplemental.

Published online May 16, 2019.

12468–12477 | PNAS | June 18, 2019 | vol. 116 | no. 25 www.pnas.org/cgi/doi/10.1073/pnas.1821652116

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

serine via β-elimination to generate ammonia and pyruvate (SIAppendix, Fig. S1) (15–17). The ammonia product of this alternativereaction can be directly antibacterial if it saponifies bacterial lipids(18–20). Alternatively, as first shown for Helicobacter pylori, am-monia kills infected human cells that express the NMDA receptor(21). Given the negative implications of the ammonia-generatingβ-elimination reaction, it is unsurprising that it is biochemicallycurtailed in two ways. First, β-elimination proceeds at a slower ratethan the tryptophan-generating β-replacement reaction (22, 23).Thus, it is not favored if indole is present. Second, β-elimination issuppressed by allosteric interactions within tryptophan synthase.Biochemical studies using Salmonella typhimurium tryptophan syn-thase indicate that the G3P product of the α reaction remainsbound to TrpA forcing an interaction between loop 6 of TrpA withhelix 6 of TrpB (23–27). This allosteric change further decreases therate of β-elimination. Confirming this, mutations placed in S.typhimurium tryptophan synthase that disrupt the TrpA/TrpB allo-steric interaction permit β-elimination to proceed (23–27). Relevantto C. trachomatis tryptophan synthase, studies indicate that theTrpA/TrpB allosteric interaction is not favored for two reasons: (i)TrpA cannot catalyze the α reaction (4); ergo, it is never bound toG3P; and (ii) loop 6 of chlamydial TrpA has mutations (4), whichwhen placed in S. typhimurium tryptophan synthase eliminate al-losteric control (25).These observations led us to posit that ammonia generation by

β-elimination may be a negative selection against C. trachomatistryptophan synthase in an indole-free environment; in thisregard, studies reveal the conjunctival microbiome to be domi-nated by non–indole-producing genera, such as Streptococcus,Corynebacterium, Pseudomonas, and Serratia (28–32). Akin tomany other Gram-negative bacteria, expression of the chla-mydial trpBA genes are tightly regulated by the tryptophan re-pressor (TrpR) (33–35). When associated with its corepressor,tryptophan, TrpR prevents transcription by tightly binding the trpoperator. Transcription of the trp operon is induced when C.trachomatis-infected cells are subjected to tryptophan depletion,for instance, by exposure to IFN-γ (3, 36). We did not detectincreased levels of ammonia in media supernatants under theseconditions, possibly because they disfavor translation of TrpB,which has multiple tryptophan residues. Therefore, we soughtalternative conditions that permit tryptophan synthase expres-sion without depleting tryptophan.Molecular studies conducted with Escherichia coli TrpR in-

dicate that some indole derivatives de-repress the trp operon bydisplacing tryptophan from TrpR, while simultaneously pre-venting it from binding the trp operator (37–39). Recent studieshave demonstrated that some of these indole derivatives arenaturally produced by the human gut microbiome and reachconcentrations ranging from 1 to 7 μM in blood (40–43). Curi-ously, these same derivatives act, via an unknown mechanism, asantibacterials against Legionella pneumophila (44–46) and My-cobacterium tuberculosis (47, 48), and possess antiinflammatoryproperties (40, 49–51). High levels of these indole derivatives inperipheral circulation correlate with protection against inflam-matory bowel disease, Crohn’s disease, and type 2 diabetes (49,52–55); one of them was in clinical trials as an antiinflammatorythat reduces Alzheimer’s disease progression (56, 57).Our results indicate that these indole derivatives effectively kill

urogenital C. trachomatis in vitro. They rapidly induce trpBA ex-pression, concomitant with a rise in ammonia levels when indole isnot provided. Furthermore, while these derivatives are deleteriousto a wild-type genital isolate of C. trachomatis, they have no effecton an ocular isolate or an engineered genital isolate that both lacktryptophan synthase (58). We interpret our results to indicate thattrp operon de-repression in the absence of indole underlies thegenetic selection against tryptophan synthase in oculotropic C.trachomatis strains. While it remains unclear whether the indolederivatives described by us drive trpBA de-repression in vivo, our

results clearly indicate that expression of trpBA in the absence ofindole is severely deleterious to C. trachomatis.Our studies reveal that the ammonia-generating β-elimination

reaction can occur when tryptophan synthase is expressed withina live bacterium. Finally, the widely reported antiinflammatoryproperties associated with these indole derivatives may resultfrom the bacterial burden-reducing consequence of inducingtryptophan synthase activity in an indole-poor environment.

ResultsIndole-3-Propionic Acid and Indole-β-Acrylic Acid Are Predicted to De-repress the C. trachomatis trpRBA Operon. The C. trachomatistrpRBA operon is expressed in conditions where tryptophan islimiting (33, 34), presumably because the TrpR apo-repressor is nolonger associated with its corepressor, tryptophan (33, 34). Al-though C. trachomatis TrpR has diverged from its E. coli homolog(SI Appendix, Fig. S2A), we sought to test whether it could be de-repressed by the same indole derivatives as E. coli TrpR. For E.coli TrpR, indole-3-propionic acid (IPA) and indole-β-acrylic acid(IAA) bind the apo-repressor more tightly than tryptophan butblock TrpR from binding trp operator (37, 39). Lawson and Sigler(38) demonstrated that, although IPA and tryptophan bind thesame pocket, IPA’s carboxylic acid group repels trpR from thephosphodiester backbone of the trp operator. Marmorstein et al.(37, 39) revealed that IAA de-represses the trp operon similarly.To evaluate whether this mechanism of corepressor and de-repressor association were applicable to chlamydial TrpR, wemodeled the structure of chlamydial TrpR with SWISS-MODEL(59), based on the structure of E. coli TrpR (60). Our model (SIAppendix, Fig. S2B) indicates the predicted structure of chlamydialTrpR closely resembles E. coli TrpR. The corepressor bindingpocket (SI Appendix, Fig. S3) is highly conserved. For C. tracho-matis TrpR, the indole ring of tryptophan is sandwiched betweenthe aliphatic chains of arginines 44 and 74 from one TrpRmonomer, and the carboxylic acid group projects toward leucine31, serine 34, and leucine 33 from the other TrpR monomer.Given this structural conservation, we tested the effect of IAA andIPA on C. trachomatis viability and trpRBA expression.

IPA and IAA Are Deleterious to Genital C. trachomatis and De-represstrpRBA Expression. HeLa cells, cultured in complete media, wereinfected with the wild-type C. trachomatis genital strain D/UW-3/CX at a multiplicity of infection (m.o.i.) of 1 and immediately ex-posed to increasing concentrations of IAA or IPA. Extracts of in-fected cells were evaluated for inclusion-forming unit (IFU)recovery as described in Materials and Methods (Fig. 1A). IAA andIPA reduced IFU recovery in a concentration-dependent manner.For both compounds, IFU recovery was reduced by ∼2.5 logs at600 μM. A reduction by ≥1 log was observed at 100 μM IAA and200 μM IPA. As observed previously (44–46), concentrations ofIAA and IPA >3 mM were cytotoxic. We evaluated trpRBA de-repression by quantifying trpB expression relative to 16S rRNA at24 h postinfection (h.p.i.) 100 μM IAA or 200 μM of IPA increasedtrpB expression by >1 log relative to control media (Fig. 1B).Therefore, as seen for E. coli (61, 62), IAA and IPA de-repress theC. trachomatis trpRBA operon even during tryptophan sufficiency.The decrease in IFU could result from either reduced replicationwithin infected cells or fewer infected cells. To distinguish thesepossibilities, primary inclusions were stained at 36 h.p.i. (Fig. 1C).IAA and IPA reduced inclusion size (SI Appendix, Table S1)without changing the fraction of infected cells.

Indole-3-Lactic Acid Has No Effect on Genital C. trachomatis and DoesNot De-repress the trpRBA Operon. In women, the primary site forgenital C. trachomatis infections is the endocervix (63), a micro-environment that often contains Lactobacillus spp. (64), some ofwhich can produce indole-3-lactic acid (ILA) (40). ILA resemblesIPA in structure, with the sole difference being that a hydrogen in

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12469

MICRO

BIOLO

GY

SEECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

IPA is substituted by a hydroxyl group in ILA. This differenceblocks ILA from de-repressing the trp operon (37, 39) but does notprevent ILA from activating host receptors like the aryl hydro-carbon receptor (AhR) (40, 50, 51, 53), which is also activated byIPA and IAA (40, 50, 51, 53). We tested ILA’s effect on C. tra-chomatis because it can be in the natural infection microenvi-ronment, and distinguish effects manifested via host cell changesvs. directly on C. trachomatis. ILA did not affect IFU recovery(Fig. 2A) and did not induce the expression of trpBA (Fig. 2B) oralter inclusion formation (Fig. 2C and SI Appendix, Table S1).These data corroborate the interpretation that IPA and IAAnegatively impact C. trachomatis through de-repression of trypto-phan synthase, rather than by affecting host cell physiology.

IPA and IAA Induce Ammonia Production by Genital C. trachomatis-Infected Cells. Because β-elimination on serine catalyzed bytryptophan synthase creates ammonia (SI Appendix, Fig. S1) (15–17), we tested whether C. trachomatis-infected cells exposed toIPA and IAA produced ammonia. Ammonia is membrane per-meant (65, 66) and equilibrates in an aqueous environment toammonium hydroxide. Therefore, cell supernatants were testedfor their ammonia and ammonium levels (Fig. 3). Under control

conditions, supernatant levels of ammonia/ammonium were in-distinguishable between infected and uninfected cells. Both IPAand IAA dramatically raised supernatant ammonia/ammoniumlevels only for infected cells, such that they ranged between 40 and60 μM at 24 h.p.i. In contrast, ILA, which does not de-repress thetrpRBA operon, did not induce ammonia production. These resultsdirectly prove that serine β-elimination by tryptophan synthase oc-curs within live bacteria when indole is absent. Furthermore, thoseindole derivatives that induce ammonia production are deleteriousto C. trachomatis. We directly tested whether ammonia was dele-terious to C. trachomatis by adding it (as NH4OH) to cell culturemedia immediately after infection. As shown (SI Appendix, Fig.S4A), ammonia interfered with IFU recovery in a concentration-dependent manner. Ammonia also affected chlamydial inclusiondevelopment (SI Appendix, Fig. S4B).

Indole Blocks the Deleterious Effect of IPA and IAA on C. trachomatis.In vitro studies indicate that the indole-consuming β-replacementreaction is favored over the ammonia-generating β-eliminationreaction on serine (22, 23). Indeed, a central tenet to our hy-pothesis is that β-elimination only occurs when indole is absent.We tested whether indole blocks the deleterious effect of IPA and

Fig. 1. IAA and IPA de-repress the C. trachomatis trpRBA operon with deleterious effects. (A) IAA and IPA reduce C. trachomatis D/UW-3/CX IFUs recovered ina dose-dependent manner. HeLa cells were infected with D/UW-3/CX as described (Materials and Methods), following which indicated amounts of IAA or IPAwere added. IFU recovery was evaluated at 42 h.p.i. Structures of IAA and IPA are shown as Insets within graphs. (B) IAA and IPA de-repress the C. trachomatisD/UW-3/CX trpRBA operon. RNA extracted at 24 h.p.i. from cells infected with D/UW-3/CX under control conditions or after IAA (100 μM) or IPA (200 μM)exposure. TrpRBA expression was evaluated by RT-qPCR for trpB. (C) IAA and IPA reduce the size of primary inclusions formed by D/UW-3/CX in HeLa cells.Inclusions were stained in cells fixed at 36 h.p.i. as described (Materials and Methods). Chlamydial inclusions are green, while DNA counterstained withHoechst 33342 is blue. (Scale bar: 20 μm.) *P < 0.05, using the Wilcoxon rank sum test, and **P < 0.01, using the same test.

12470 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

IAA (Fig. 4). Provision of 50 μM indole concurrently with IPA andIAA completely restored inclusion size (Fig. 4A) and IFU re-covery (Fig. 4B). Indole also reduced supernatant ammonia levelsto control levels (Fig. 4C). Importantly, indole did not preventIPA and IAA from de-repressing trpRBA (Fig. 4D), indicating thatindole blocks the deleterious effect of IPA and IAA by shiftingcatalysis from β-elimination to β-replacement.

IPA and IAA Do Not Affect a C. trachomatis Serovar A Strain thatLacks Intact TrpA, or an Engineered C. trachomatis Serovar D PointMutant that Lacks TrpB. Tryptophan synthase is inactivated inoculotropic C. trachomatis strains predominantly by mutations intrpA or trpB, with trpA mutations being more frequent (3).Studies by the groups of McClarty and Caldwell, demonstratethat while C. trachomatis TrpA lacks catalytic activity, it is es-sential for TrpB to catalyze β-replacement (4). Consistent withthis, although tryptophan depletion induces TrpB production inoculotropic C. trachomatis trpA mutants (3, 4), they are notindole-rescuable (3, 4). We evaluated the effect of IPA and IAAon an oculotropic C. trachomatis trpA mutant (A2497), or an

engineered point mutant that inactivates trpB constructed in thesame genetic background (D/UW-3/CX) as our wild-type strain(58). IAA and IPA did not affect A2497 or the D trpB mutant atconcentrations that reduce IFU recovery for D/UW-3/CXby ≥1 log (Fig. 5A). Consistent with this, IPA and IAA alsodid not affect primary inclusion formation or size for A2497 or DtrpB mut (Fig. 5B and SI Appendix, Table S1), but de-repressedthe trpRBA operon in both strains as revealed by RT-qPCR fortrpB (Fig. 5C). Finally, consistent with neither strain producing afunctional tryptophan synthase, IPA and IAA did not inducethem to make ammonia (Fig. 5D). Therefore, for C. trachomatis,ammonia production by β-elimination requires both TrpA andTrpB subunits of tryptophan synthase. The data obtained withA2497 and D trpB mut clearly indicate that tryptophan synthaseactivity in the absence of indole is highly deleterious to C. tra-chomatis. Furthermore, trpRBA de-repression in an indole-freeenvironment is likely relevant to the selection and survival ofoculotropic C. trachomatis strains.

Physiological Oxygen Tension Permits Physiological Concentrations ofIPA and IAA to Be Effective Against Genital C. trachomatis. Ourfindings indicate that de-repression of trpBA in the absence ofindole is deleterious to genital C. trachomatis, and that thisprocess may be driven by indole derivatives produced by the gutmicrobiome. However, the concentrations of these derivativesfound in serum are between 1 and 2 logs lower than the con-centrations we and others have used for experiments in vitro (41,42, 44–47, 49, 50). Our attempts to dissect this discrepancy weredirected by our observation that IAA and IPA had half-lives of∼6 h in cell culture, independent of the vehicle used to solubilizethem. Studies evaluating the neuroprotective properties of IPAin cell culture reveal that while protecting against oxidativeradicals, it is oxidized to kynuric acid (57), the structure of whichrenders it incompatible with functioning as a de-repressor forTrpR. While conducting studies on viral transactivators, we ob-served that epithelial cells cultured under normoxia (20% O2) pro-duce oxidative radicals including hydroxyl radicals and superoxides.This production was decreased by culturing cells under hypoxic

Fig. 2. ILA is not deleterious to C. trachomatis D/UW-3/CX and does not de-repress the trpRBA operon. (A) D/UW-3/CX–infected HeLa cells were exposedto ILA as indicated, and IFU recovery was evaluated at 42 h.p.i. The structureof ILA is shown as an Inset. (B) ILA does not de-repress the D/UW-3/CXtrpRBA operon. trpRBA expression was evaluated as described in Fig. 1. (C)Exposure to ILA does not affect the size of primary inclusions formed by D/UW-3/CX. Infected cells exposed to the indicated ILA concentration werefixed and stained at 36 h.p.i. as described in Fig. 1. (Scale bar: 20 μm.)

Fig. 3. Ammonia is produced by C. trachomatis D/UW-3/CX–infected cellsexposed to IPA and IAA, but not ILA. Cells were infected with D/UW-3/CX asdescribed (Materials and Methods). Indicated concentrations of IPA, IAA,and ILA were added immediately postinfection. Ammonia levels in super-natants were evaluated at 24 h.p.i. as described (Materials and Methods).The white bars indicate ammonia levels detected in supernatants from un-infected cells under the specified condition. The gray bars indicate ammonialevels detected in supernatants from infected cells under the specified con-dition. **P < 0.01, using the Wilcoxon rank sum test.

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12471

MICRO

BIOLO

GY

SEECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

conditions (4% O2) (67–69). Our findings correspond to observa-tions made by others with HeLa cells, in that oxidative radicals havebeen observed at significant levels during normoxic culture (70); incontrast, hypoxia relieves oxidative stress and increases the viabilityof HeLa cells (71). In this regard, physiological oxygen tensions inthe majority of human tissues range from 0 to 5% O2; for example,vaginal oxygen tension is typically 1–2% O2, rising briefly to 5% O2during sexual stimulation (72); a similar range has been observed forcervical and uterine oxygen tension (73). Conjunctival oxygen ten-sion is also low, ranging 0.5–1% O2 (74, 75). Therefore, we testedthe function of IPA and IAA on genital C. trachomatis under hyp-oxic conditions (4% O2). These results are shown in Fig. 6. Underthese conditions, 5 μM IPA and IAA reduced IFU recovery by∼1 log (Fig. 6A) and effectively de-repressed trpBA (Fig. 6B). Wealso observed the generation of ammonia, albeit at a lower level(Fig. 6C). This decrease either reflects reduced activity of tryptophansynthase under these conditions or that ammonia is blown off duringgas exchanges conducted every 4 h to maintain 4% O2. Finally, theprovision of indole rescued the effect of IPA and IAA under hypoxia(Fig. 6D), confirming observations made under normoxic conditions.

DiscussionThe selective pressures that cause the loss of tryptophan synthaseactivity in oculotropic C. trachomatis isolates are enigmatic. Wehave shown that trpRBA operon de-repression in an indole-poorenvironment is a powerful selection against expression of tryp-tophan synthase. Under these conditions, tryptophan synthasegenerates ammonia via serine deamination, as by demonstratedCrawford and Miles and colleagues (12, 15, 16) in vitro. Ourresults prove that serine deamination occurs when tryptophansynthase is expressed in indole-free conditions. Using conditionsthat shift tryptophan synthase’s activity from β-elimination toβ-replacement, our results ascribe deleterious effects to theformer. Finally, our results indicate that both the TrpA and TrpBsubunits of C. trachomatis tryptophan synthase are needed forserine deamination, akin to requirements for β-replacement (4).Mutation in either is protective, explaining why oculotropicstrains have mutations in either trpA or trpB (3).We used IPA and IAA to de-repress the trp operon because these

indole derivatives are known gut microbiome products that arefound in peripheral circulation in low micromolar concentrations

Fig. 4. Indole blocks the deleterious effect of IAA and IPA on C. trachomatis D/UW-3/CX. (A) Fifty micromolar indole along with the indicated concentrationof IAA or IPA was added to D/UW-3/CX–infected HeLa cells. Inclusions were stained as described in Fig. 1. (B) IFU recovery was evaluated at 42 h.p.i. from cellsinfected with D/UW-3/CX and exposed to IAA and IPA alone (gray bars), or in combination with 50 μM indole (white bars). (C) Indole blocks the production ofammonia by HeLa cells infected with D/UW-3/CX and treated with IPA or IAA. Infected cells were treated with IAA (100 μM) or IPA (200 μM) alone, or togetherwith 50 μM indole, following which supernatant ammonia levels were measured at 24 h.p.i. (D) Indole does not prevent de-repression of the D/UW-3/CXtrpRBA operon by IAA and IPA. Infected HeLa cells were exposed to 50 μM indole alone (white bar), or in combination with 100 μM IAA or 200 μM IPA (graybars). TrpRBA expression was evaluated as described. **P < 0.01, using the Wilcoxon rank sum test.

12472 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

(40–43). Furthermore, the mechanism by which they act on E. coliTrpR for trp de-repression (38) is known, permitting us to evaluatethe possibility of their binding chlamydial TrpR before testing themexperimentally. Our findings demonstrate these two biologicallyrelevant indole derivatives can de-repress the chlamydial trpRBAoperon; our structural predictions suggest that de-repression occursby their engaging TrpR (SI Appendix, Figs. S2 and S3), althoughan alternative mechanism of de-repression is not excluded by our

studies. The majority of studies evaluating the effect of IPA andIAA on bacteria and host cells have employed them at concen-trations that are 1–2 logs higher than their levels in serum (40–43).Pertinently, we have found these compounds to be effective attheir serum concentrations provided physiological oxygen tensionis maintained during in vitro culture.IPA and IAA can alter host-cell physiology by binding re-

ceptors like the AhR. However, their deleterious effect on

Fig. 5. IAA and IPA do not affect C. trachomatis strains that lack tryptophan synthase activity. (A) HeLa cells were infected with a trpAmutant C. trachomatisserovar A strain (A2497), or a derivative of C. trachomatis D/UW-3/CX with an inactivating point mutation in trpB (D trpB mut). Infected cells were exposed to100 μM IAA or 200 μM IPA for 42 h, following which IFU recovery was evaluated. (B) IAA and IPA do not affect primary inclusion formation by A2497 or D trpBmut. HeLa cells infected with the indicated strain were exposed to control media or IPA and IAA for 36 h following which chlamydial inclusions were stained.(Scale bar: 20 μm.) (C) IAA and IPA de-repress the trpRBA operon in A2497 and D trpB mut. HeLa cells, infected with A2497 or D trpB mut, were treated with100 μM IAA or 200 μM IPA for 24 h, following which trpRBA expression was evaluated. (D) IPA and IAA do not induce ammonia production from HeLa cellsinfected with A2497 or D trpB mut. HeLa cells infected with A2497 or D trpB mut were treated with 100 μM IAA or 200 μM IPA for 24 h, following whichammonia levels in cell supernatants were evaluated. Control conditions are indicated by the white bar, while ammonia levels after IPA and IAA exposure areindicated by the gray bars. **P < 0.01, using the Wilcoxon rank sum test.

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12473

MICRO

BIOLO

GY

SEECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

C. trachomatis does not result from such interactions because (i)their effect is unabated when C. trachomatis-infected cells areexposed to IPA or IAA in the presence of cycloheximide, whichinhibits host-cell protein translation; and (ii) ILA, an indolederivative structurally close to IPA and IAA, binds cellular re-ceptors bound by them, but has no effect on C. trachomatis.Confirming the mechanism ascribed to IPA and IAA, ILA doesnot de-repress the C. trachomatis trpRBA operon. Our findingswith IPA and IAA may explain the previously observed effects ofthese molecules on Legionella pneumophila (44–46). IPA andIAA reduce L. pneumophila growth under axenic conditions aswell as intracellularly within monocytes. Analogous to C. tra-chomatis, IPA and IAA may be bactericidal by inducing trypto-phan synthase, which deaminates serine. A recent screen of gutmicrobiome metabolites identified IPA as a prominent antitu-bercular compound that was effective against Mycobacteriumtuberculosis (47). While no mechanism was described, it wasproposed that IPA be considered for inclusion in antituberculartherapy (47). The approaches we used can be used to determinewhether trp de-repression underlies IPA’s bactericidal effects on

L. pneumophila and M. tuberculosis. Should that prove true, thesimple point mutations in trpA and trpB that permit C. tracho-matis ocular strains to evade this deleterious effect dictates thatcaution be used while considering IPA as an antibacterial.IPA and IAA are proposed as beneficial indole derivatives

produced by desirable genera within the gut microbiome (40,53). Studies have correlated IPA and IAA levels with betterprognosis for individuals with type 2 diabetes, Crohn’s disease,and inflammatory bowel disease (49, 52–55). IPA was also inclinical trials for its effect against Alzheimer’s disease (56, 57). Inthese conditions, IPA is believed to function as an antiin-flammatory. We suggest in conditions associated with bacterialdysbiosis, such as Crohn’s disease and inflammatory bowel dis-ease, IPA may be directly bactericidal by inducing tryptophansynthase and serine deamination. Its observed antiinflammatoryeffects in conditions like type 2 diabetes may arise from reducingthe overall bacterial burden via this mechanism.IAA is produced by Clostridium sporogenes, and Peptos-

treptococcus spp. including P. russellii, P. anaerobius, and P. stomatis(40, 42, 49). IPA is produced by the same Peptostreptococcus spp.,

Fig. 6. Physiological concentrations of IPA and IAA are deleterious to genital C. trachomatis under hypoxic (4% O2) conditions. (A) D/UW-3/CX–infected HeLacells were treated with 5 and 15 μM of IAA or IPA and incubated in at 4% O2 as described in Materials and Methods. At 42 h.p.i., cells were harvested tomeasure IFUs released. (B) Physiological concentrations of IAA and IPA de-repress the D/UW-3/CX trpRBA operon. trpRBA expression was evaluated as de-scribed in Materials and Methods. (C) Ammonia is generated by D/UW-3/CX–infected cells incubated with physiological concentrations of IAA and IPA underhypoxic conditions. Ammonia levels were measured from supernatants obtained at 24 h.p.i. as described earlier. (D) Indole alleviates the deleterious effects of IAA andIPA on genital C. trachomatis growth. HeLa cells infected with genital C. trachomatiswere exposed to 5 and 15 μMof IAA and IPA concurrently with 50 μM indole andincubated under hypoxic conditions. IFU release was measured at 42 h.p.i. *P < 0.05, using the Wilcoxon rank sum test, and **P < 0.01, using the same test.

12474 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

and a broader spectrum of Clostridium spp. including C. sporogenes,C. botulinum, C. caloritolerans, C. cadaveris, and C. paraputrificum(40, 42, 49, 76–78). We were curious how IPA- and IAA-producingspecies evaded their bactericidal effects. Pertinently, no bacterialspecies that makes IAA or IPA has a trp operon or trpR. Thus, IPAand IAA producers are immune to the mechanism by which thesecompounds are bactericidal. For this reason, we believe that IPAand IAA are made as antibiotics that permit colonization by specificspecies over other species competing for the same niche.The invariant capacity of genital C. trachomatis to maintain an

active tryptophan synthase is thought to exemplify a pathogen fi-nessing metabolites produced by a niche-specific microbiome toevade an IFN-γ–driven protective host immune response (3, 6, 7).Indole produced by dysbiotic genital microbiomes can be salvagedby C. trachomatis to evade tryptophan starvation imposed by IFN-γ(3, 6, 7). While indole-producing bacterial species can be isolatedfrom vaginal samples (6), IFN-γ levels found at infection sites arelikely insufficient by themselves to drive tryptophan starvation (6,63, 79). Although a role for other cytokines in driving tryptophanstarvation is likely, it should be noted that significant levels of cer-vicovaginal tryptophan continue to be detected in the majority ofwomen who have spontaneously cleared their chlamydial infection(79). Therefore, we suggest that clearance may result from a com-bination of multiple factors, including (i) a protective immune re-sponse that decreases tryptophan availability; and (ii) de-repressionof trpRBA by indole derivatives. Lowered tryptophan and de-repression both promote expression of tryptophan synthase. Theoutcome of tryptophan synthase expression remains dependent onthe prevalent genital microbiome. Genital microbiomes that lackindole producers, such as the “normal” vaginal microbiome, favorC. trachomatis clearance by (i) preventing tryptophan synthesis viaindole salvage; and (ii) permitting serine deamination to prevailover indole-requiring β-replacement. In contrast, dysbiotic micro-biomes with indole producers will hinder clearance by (i) permittingtryptophan synthesis via indole salvage; and (ii) creating conditionsthat favor indole-requiring β-replacement over serine deamination.It should also be noted that because tryptophan and de-repressorscompete for binding TrpR (37–39), dysbiotic genital microbiomeswill also decrease the efficacy of de-repressors by increasing intra-inclusion tryptophan concentration.In summary, our studies reveal that expression of tryptophan

synthase can be deleterious to C. trachomatis if it occurs in anindole-poor environment. The paucity of indole producers in theocular microbiome likely provides a strong selective pressureagainst maintaining this enzyme in that environment. In contrast,for genital infections, indole-producing dysbiotic microbiomesprevent immune clearance by two closely related mechanismsthat reflect the activities of tryptophan synthase. The presence ofindole blocks serine deamination and simultaneously permitstryptophan biosynthesis to evade starvation. We have demon-strated that gut microbiome-produced indole derivatives canpromote tryptophan synthase expression, with deleterious effectsin the absence of indole. Our studies suggest a need to evaluatethe genital microenvironment for the presence and levels ofmolecules that can function as trpRBA de-repressors to de-termine their contribution toward clearance, and the mechanismby which they synergize with IFN-γ.

Materials and MethodsStructural Prediction of TrpR from C. trachomatis D/UW-3/CX. TrpR from C.trachomatis D/UW-3/CX (accession no. NP_219672) was aligned with E. coli

TrpR (accession no. AKD90255) using T-COFFEE (80) with default parameters.SWISS-MODEL (59) was used to create a structural model for C. trachomatisTrpR based on the structure of E. coli TrpR (Protein Data Bank ID code 3WRP)(60). Structures were visualized using EzMol (81). Predicted structures forTrpR and tryptophan synthase from C. trachomatisD/UW-3/CX can be obtainedfrom the Zenodo repository (https://doi.org/10.5281/zenodo.2662318).

Cell Culture, Media Additives, and C. trachomatis Infections. HeLa cells werecultured as described (82, 83). Postinfection, they were fed DMEM synthe-sized as described earlier (82, 83), supplemented with 5% triple-dialyzed calfserum. Indicated concentrations of indole derivatives, prepared freshly inDMSO, were added to postinfection media. IPA (Sigma; catalog #57400), IAA(Sigma; catalog # I2273), ILA (Sigma; catalog #I5508), and indole (Sigma;catalog #I3408) were stored under vacuum. The C. trachomatis strainsserovar D (D/UW-3/CX), D trpB-null (single point mutation of TrpB subunit oftryptophan synthase), and serovar A (A2497) were used as indicated. Cellswere infected as described previously at a m.o.i. of 1 (82, 83). IFU recoverywas measured at 42 h.p.i. as described previously (82, 83).

Immunofluorescence, Imaging, and Inclusion Area Measurement. Control andinfected cells were stained using a FITC-conjugated anti-chlamydial LPS an-tibody (Merifluor; catalog #500111; Meridian Bioscience) as described pre-viously (82, 83). Stained cells were imaged as described previously (82, 83);images were analyzed using Fiji, version 2 (84). At least 75 inclusions weresized for each experimental condition.

Reverse-Transcriptase–qPCR for trpB Gene Expression. mRNA extracted frominfected cells at 24 h.p.i. using the RNeasy kit (Qiagen; catalog #74104) wasused to prepare cDNA using the iScript gDNA Clear cDNA Synthesis kit (Bio-Rad; catalog #1725035). qPCRs were performed using the SsoAdvancedUniversal SYBR Green Supermix kit (Bio-Rad; catalog #1725271). Reactionswere run in a Bio-Rad CFX 384. The following primers were used for am-plification: CT-16SrRNA_F, TGAGGAGTACACTCGCAAG; CT-16SrRNA_R,GCGGAAAACGACATTTCTGC; CT-trpB_F, GTGGAACGACAGAAACC; and CT-trpB_R, GGCCGATCCTAAGCAATAG. TrpB mRNA levels were quantified rel-ative to 16S rRNA levels as described (75).

Ammonia/Ammonium Quantification. Cell supernatants were recovered at24 h.p.i., 0.2 μm filtered, following which ammonia/ammonium was mea-sured using an Ammonia Assay Kit (Sigma; catalog #AA0100-1KT).

Infections Under Physiological O2 Conditions. A premixed gas mixture (91% N2,5% CO2, 4% O2) was used in these experiments as described previously.Media applied to cells were preexposed to a 4% O2 atmosphere in sealedmodular chambers for at least 24 h for equilibration. HeLa cells were spininfected as described above. Infected cells were fed preequilibrated controlmedia, or media containing IPA or IAA. Cells were placed in sealed cham-bers, flushed for at least 5 min with the gas mixture, and placed in a 37 °Cincubator. Chambers were manually flushed with the gas mixture every 4 h.

Exposure to Ammonia. HeLa cells were infected as described above and exposedto the indicated concentration of ammonia, which was added to media as am-monium hydroxide. Because ammonia is volatile, control and ammonia-exposedcells were placed in chambers in separate incubators. Media ammonia concen-trations were confirmed using the ammonia assay described above.

Statistical Analysis. Experiments were repeated a minimum of three inde-pendent times. Statistical significance was calculated with the Wilcoxon ranksum test (85), using MSTAT, version 6 (N. Drinkwater, McArdle Laboratory forCancer Research, University of Wisconsin Medical School, Madison, WI).

ACKNOWLEDGMENTS. We thank our colleagues Drs. Angela Amedee,Victoria Burke, Arthur Haas, and Patricia Mott for their suggestions anddiscussions during the course of our experiments. We are especially grate-ful to Dr. Harlan Caldwell for the kind gift of the D trpB mut strain ofC. trachomatis, whose use was essential to interpret our findings. This workwas supported by National Institutes of Health Grant AI118860.

1. Carlson JH, Porcella SF, McClarty G, Caldwell HD (2005) Comparative genomic analysis ofChlamydia trachomatis oculotropic and genitotropic strains. Infect Immun 73:6407–6418.

2. Carlson JH, et al. (2004) Polymorphisms in the Chlamydia trachomatis cytotoxin locusassociated with ocular and genital isolates. Infect Immun 72:7063–7072.

3. Caldwell HD, et al. (2003) Polymorphisms in Chlamydia trachomatis tryptophansynthase genes differentiate between genital and ocular isolates. J Clin Invest 111:1757–1769.

4. Fehlner-Gardiner C, et al. (2002) Molecular basis defining human Chlamydia trachomatistissue tropism. A possible role for tryptophan synthase. J Biol Chem 277:26893–26903.

5. Andersson P, et al. (2016) Chlamydia trachomatis from Australian Aboriginal people withtrachoma are polyphyletic composed ofmultiple distinctive lineages.Nat Commun 7:10688.

6. Aiyar A, et al. (2014) Influence of the tryptophan-indole-IFNγ axis on human genitalChlamydia trachomatis infection: Role of vaginal co-infections. Front Cell InfectMicrobiol 4:72.

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12475

MICRO

BIOLO

GY

SEECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

7. Ziklo N, Huston WM, Taing K, Katouli M, Timms P (2016) In vitro rescue of genitalstrains of Chlamydia trachomatis from interferon-γ and tryptophan depletion withindole-positive, but not indole-negative Prevotella spp. BMC Microbiol 16:286.

8. Beatty WL, Belanger TA, Desai AA, Morrison RP, Byrne GI (1994) Tryptophan de-pletion as a mechanism of gamma interferon-mediated chlamydial persistence. InfectImmun 62:3705–3711.

9. Ibana JA, et al. (2018) Chlamydia trachomatis-infected cells and uninfected-bystandercells exhibit diametrically opposed responses to interferon gamma. Sci Rep 8:8476.

10. Shemer Y, Sarov I (1985) Inhibition of growth of Chlamydia trachomatis by humangamma interferon. Infect Immun 48:592–596.

11. Dunn MF, Niks D, Ngo H, Barends TR, Schlichting I (2008) Tryptophan synthase: Theworkings of a channeling nanomachine. Trends Biochem Sci 33:254–264.

12. Miles EW (2013) The tryptophan synthase α2β2 complex: A model for substratechanneling, allosteric communication, and pyridoxal phosphate catalysis. J Biol Chem288:10084–10091.

13. Raboni S, Bettati S, Mozzarelli A (2009) Tryptophan synthase: A mine for enzymolo-gists. Cell Mol Life Sci 66:2391–2403.

14. Hyde CC, Miles EW (1990) The tryptophan synthase multienzyme complex: Exploringstructure-function relationships with X-ray crystallography and mutagenesis. Bio-technology (N Y) 8:27–32.

15. Crawford IP, Ito J (1964) Serine deamination by the B protein of Escherichia colitryptophan synthetase. Proc Natl Acad Sci USA 51:390–397.

16. Miles EW, Hatanaka M, Crawford IP (1968) A new thiol-dependent transaminationreaction catalyzed by the B protein of Escherichia coli tryptophan synthetase. Bio-chemistry 7:2742–2753.

17. Kumagai H, Miles EW (1971) The B protein of Escherichia coli tryptophan synthetase.II. New -elimination and -replacement reactions. Biochem Biophys Res Commun 44:1271–1278.

18. Cerruto-Noya CA, Goad CL, DeWitt CA (2011) Antimicrobial effect of ammoniumhydroxide when used as an alkaline agent in the formulation of injection brine so-lutions. J Food Prot 74:475–479.

19. Mendonca AF, Amoroso TL, Knabel SJ (1994) Destruction of gram-negative food-borne pathogens by high pH involves disruption of the cytoplasmic membrane.Appl Environ Microbiol 60:4009–4014.

20. Silipo A, Lanzetta R, Amoresano A, Parrilli M, Molinaro A (2002) Ammonium hy-droxide hydrolysis: A valuable support in the MALDI-TOF mass spectrometry analysisof lipid A fatty acid distribution. J Lipid Res 43:2188–2195.

21. Seo JH, Fox JG, Peek RM, Jr, Hagen SJ (2011) N-methyl D-aspartate channels linkammonia and epithelial cell death mechanisms in Helicobacter pylori infection. Gas-troenterology 141:2064–2075.

22. Ahmed SA, Martin B, Miles EW (1986) Beta-elimination of indole from L-tryptophancatalyzed by bacterial tryptophan synthase: A comparison between reactions cata-lyzed by tryptophanase and tryptophan synthase. Biochemistry 25:4233–4240.

23. Ahmed SA, Ruvinov SB, Kayastha AM, Miles EW (1991) Mechanism of mutual acti-vation of the tryptophan synthase alpha and beta subunits. Analysis of the reactionspecificity and substrate-induced inactivation of active site and tunnel mutants of thebeta subunit. J Biol Chem 266:21548–21557.

24. Brzovi�c PS, Hyde CC, Miles EW, Dunn MF (1993) Characterization of the functionalrole of a flexible loop in the alpha-subunit of tryptophan synthase from Salmonellatyphimurium by rapid-scanning, stopped-flow spectroscopy and site-directed muta-genesis. Biochemistry 32:10404–10413.

25. Raboni S, Bettati S, Mozzarelli A (2005) Identification of the geometric requirementsfor allosteric communication between the alpha- and beta-subunits of tryptophansynthase. J Biol Chem 280:13450–13456.

26. Schneider TR, et al. (1998) Loop closure and intersubunit communication in trypto-phan synthase. Biochemistry 37:5394–5406.

27. Weyand M, Schlichting I, Herde P, Marabotti A, Mozzarelli A (2002) Crystal structureof the beta Ser178→Pro mutant of tryptophan synthase. A “knock-out” allostericenzyme. J Biol Chem 277:10653–10660.

28. Ozkan J, et al. (2019) Biogeography of the human ocular microbiota. Ocul Surf 17:111–118.

29. Ozkan J, Coroneo M, Willcox M, Wemheuer B, Thomas T (2018) Identification andvisualization of a distinct microbiome in ocular surface conjunctival tissue. InvestOphthalmol Vis Sci 59:4268–4276.

30. Wen X, et al. (2017) The influence of age and sex on ocular surface microbiota inhealthy adults. Invest Ophthalmol Vis Sci 58:6030–6037.

31. Ozkan J, et al. (2017) Temporal stability and composition of the ocular surface mi-crobiome. Sci Rep 7:9880.

32. Zhou Y, et al. (2014) The conjunctival microbiome in health and trachomatous dis-ease: A case control study. Genome Med 6:99.

33. Carlson JH, Wood H, Roshick C, Caldwell HD, McClarty G (2006) In vivo and in vitrostudies of Chlamydia trachomatis TrpR:DNA interactions. Mol Microbiol 59:1678–1691.

34. Akers JC, Tan M (2006) Molecular mechanism of tryptophan-dependent transcrip-tional regulation in Chlamydia trachomatis. J Bacteriol 188:4236–4243.

35. Wood H, et al. (2003) Regulation of tryptophan synthase gene expression in Chla-mydia trachomatis. Mol Microbiol 49:1347–1359.

36. Belland RJ, et al. (2003) Transcriptome analysis of chlamydial growth during IFN-gamma-mediated persistence and reactivation. Proc Natl Acad Sci USA 100:15971–15976.

37. Marmorstein RQ, Sigler PB (1989) Stereochemical effects of L-tryptophan and its an-alogues on trp repressor’s affinity for operator-DNA. J Biol Chem 264:9149–9154.

38. Lawson CL, Sigler PB (1988) The structure of trp pseudorepressor at 1.65A shows whyindole propionate acts as a trp “inducer.” Nature 333:869–871.

39. Marmorstein RQ, Joachimiak A, Sprinzl M, Sigler PB (1987) The structural basis for theinteraction between L-tryptophan and the Escherichia coli trp aporepressor. J BiolChem 262:4922–4927.

40. Roager HM, Licht TR (2018) Microbial tryptophan catabolites in health and disease.Nat Commun 9:3294.

41. Alexeev EE, et al. (2018) Microbiota-derived indole metabolites promote human andmurine intestinal homeostasis through regulation of interleukin-10 receptor. Am JPathol 188:1183–1194.

42. Dodd D, et al. (2017) A gut bacterial pathway metabolizes aromatic amino acids intonine circulating metabolites. Nature 551:648–652.

43. Rosas HD, et al. (2015) A systems-level “misunderstanding”: The plasma metabolomein Huntington’s disease. Ann Clin Transl Neurol 2:756–768.

44. Grossowicz N (1990) Phytohormones as specific inhibitors of Legionella pneumophilagrowth. Isr J Med Sci 26:187–190.

45. Inoue H, Yajima Y, Kawano G, Nagasawa H, Sakuda S (2004) Isolation of indole-3-aldehyde as a growth inhibitor of Legionella pneumophila from Diaion HP-20 resinsused to culture the bacteria. Biocontrol Sci 9:39–41.

46. Mandelbaum-Shavit F, Barak V, Saheb-Tamimi K, Grossowicz N (1991) Susceptibility ofLegionella pneumophila grown extracellularly and in human monocytes to indole-3-propionic acid. Antimicrob Agents Chemother 35:2526–2530.

47. Negatu DA, et al. (2018) Whole-cell screen of fragment library identifies gut micro-biota metabolite indole propionic acid as antitubercular. Antimicrob Agents Che-mother 62:e01571-17.

48. Kaufmann SHE (2018) Indole propionic acid: A small molecule links between gutmicrobiota and tuberculosis. Antimicrob Agents Chemother 62:e00389-18.

49. Wlodarska M, et al. (2017) Indoleacrylic acid produced by commensal Peptos-treptococcus species suppresses inflammation. Cell Host Microbe 22:25–37.e6.

50. Yisireyili M, Takeshita K, Saito S, Murohara T, Niwa T (2017) Indole-3-propionic acidsuppresses indoxyl sulfate-induced expression of fibrotic and inflammatory genes inproximal tubular cells. Nagoya J Med Sci 79:477–486.

51. Zelante T, et al. (2013) Tryptophan catabolites from microbiota engage aryl hydro-carbon receptor and balance mucosal reactivity via interleukin-22. Immunity 39:372–385.

52. de Mello VD, et al. (2017) Indolepropionic acid and novel lipid metabolites are as-sociated with a lower risk of type 2 diabetes in the Finnish Diabetes Prevention Study.Sci Rep 7:46337.

53. Gao J, et al. (2018) Impact of the gut microbiota on intestinal immunity mediated bytryptophan metabolism. Front Cell Infect Microbiol 8:13.

54. Ranhotra HS, et al. (2016) Xenobiotic receptor-mediated regulation of intestinalbarrier function and innate immunity. Nucl Receptor Res 3:101199.

55. Tuomainen M, et al. (2018) Associations of serum indolepropionic acid, a gut micro-biota metabolite, with type 2 diabetes and low-grade inflammation in high-risk in-dividuals. Nutr Diabetes 8:35.

56. Bendheim PE, et al. (2002) Development of indole-3-propionic acid (OXIGON) forAlzheimer’s disease. J Mol Neurosci 19:213–217.

57. Chyan YJ, et al. (1999) Potent neuroprotective properties against the Alzheimer beta-amyloid by an endogenous melatonin-related indole structure, indole-3-propionicacid. J Biol Chem 274:21937–21942.

58. Kari L, et al. (2011) Generation of targeted Chlamydia trachomatis null mutants. ProcNatl Acad Sci USA 108:7189–7193.

59. Waterhouse A, et al. (2018) SWISS-MODEL: Homology modelling of protein structuresand complexes. Nucleic Acids Res 46:W296–W303.

60. Lawson CL, et al. (1988) Flexibility of the DNA-binding domains of trp repressor.Proteins 3:18–31.

61. Doolittle WF, Yanofsky C (1968) Mutants of Escherichia coli with an alteredtryptophanyl-transfer ribonucleic acid synthetase. J Bacteriol 95:1283–1294.

62. Gunsalus RP, Miguel AG, Gunsalus GL (1986) Intracellular Trp repressor levels in Es-cherichia coli. J Bacteriol 167:272–278.

63. Lewis ME, et al. (2014) Morphologic and molecular evaluation of Chlamydia tracho-matis growth in human endocervix reveals distinct growth patterns. Front Cell InfectMicrobiol 4:71.

64. Filardo S, et al. (2017) Diversity of cervical microbiota in asymptomatic Chlamydiatrachomatis genital infection: A pilot study. Front Cell Infect Microbiol 7:321.

65. Antonenko YN, Pohl P, Denisov GA (1997) Permeation of ammonia across bilayer lipidmembranes studied by ammonium ion selective microelectrodes. Biophys J 72:2187–2195.

66. Walter A, Gutknecht J (1986) Permeability of small nonelectrolytes through lipid bi-layer membranes. J Membr Biol 90:207–217.

67. Washington AT, Singh G, Aiyar A (2010) Diametrically opposed effects of hypoxia andoxidative stress on two viral transactivators. Virol J 7:93.

68. Aras S, Singh G, Johnston K, Foster T, Aiyar A (2009) Zinc coordination is required forand regulates transcription activation by Epstein-Barr nuclear antigen 1. PLoS Pathog5:e1000469.

69. Singh G, Aras S, Zea AH, Koochekpour S, Aiyar A (2009) Optimal transactivation byEpstein-Barr nuclear antigen 1 requires the UR1 and ATH1 domains. J Virol 83:4227–4235.

70. Park WH (2014) Anti-apoptotic effect of caspase inhibitors on H2O2-treated HeLa cellsthrough early suppression of its oxidative stress. Oncol Rep 31:2413–2421.

71. Setty BA, et al. (2017) Hypoxia-induced proliferation of HeLa cells depends on epi-dermal growth factor receptor-mediated arginase II induction. Physiol Rep 5:e13175.

72. Wagner G, Levin R (1978) Oxygen tension of the vaginal surface during sexual stim-ulation in the human. Fertil Steril 30:50–53.

73. Yedwab GA, Paz G, Homonnai TZ, David MP, Kraicer PF (1976) The temperature, pH,and partial pressure of oxygen in the cervix and uterus of women and uterus of ratsduring the cycle. Fertil Steril 27:304–309.

12476 | www.pnas.org/cgi/doi/10.1073/pnas.1821652116 Sherchand and Aiyar

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020

74. Nisam M, Albertson TE, Panacek E, Rutherford W, Fisher CJ, Jr (1986) Effects of hy-

perventilation on conjunctival oxygen tension in humans. Crit Care Med 14:12–15.75. Haljamäe H, Frid I, Holm J, Holm S (1989) Continuous conjunctival oxygen tension

(PcjO2) monitoring for assessment of cerebral oxygenation and metabolism during

carotid artery surgery. Acta Anaesthesiol Scand 33:610–616.76. Elsden SR, Hilton MG, Waller JM (1976) The end products of the metabolism of ar-

omatic amino acids by Clostridia. Arch Microbiol 107:283–288.77. Wikoff WR, et al. (2009) Metabolomics analysis reveals large effects of gut microflora

on mammalian blood metabolites. Proc Natl Acad Sci USA 106:3698–3703.78. Williams BB, et al. (2014) Discovery and characterization of gut microbiota de-

carboxylases that can produce the neurotransmitter tryptamine. Cell Host Microbe 16:

495–503.79. Jordan SJ, et al. (2017) Lower levels of cervicovaginal tryptophan are associated with

natural clearance of Chlamydia in women. J Infect Dis 215:1888–1892.

80. Di Tommaso P, et al. (2011) T-coffee: A web server for the multiple sequence align-ment of protein and RNA sequences using structural information and homology ex-tension. Nucleic Acids Res 39:W13–W17.

81. Reynolds CR, Islam SA, Sternberg MJE (2018) EzMol: A web server wizard for the rapidvisualization and image production of protein and nucleic acid structures. J Mol Biol430:2244–2248.

82. Sherchand S, Ibana JA, Quayle AJ, Aiyar A (2016) Cell intrinsic factors modulate theeffects of IFNγ on the development of Chlamydia trachomatis. J Bacteriol Parasitol 7:282.

83. Sherchand SP, Ibana JA, Zea AH, Quayle AJ, Aiyar A (2016) The high-risk humanpapillomavirus E6 oncogene exacerbates the negative effect of tryptophan starvationon the development of Chlamydia trachomatis. PLoS One 11:e0163174.

84. Rueden CT, et al. (2017) ImageJ2: ImageJ for the next generation of scientific imagedata. BMC Bioinformatics 18:529.

85. Wilcoxon F (1945) Individual comparisons by ranking methods. Biom Bull 1:80–83.

Sherchand and Aiyar PNAS | June 18, 2019 | vol. 116 | no. 25 | 12477

MICRO

BIOLO

GY

SEECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Aug

ust 1

9, 2

020