Chlor(am)ine disinfection of human pathogenic viruses in ... · This report presents data for...

June 2012 © Copyright Smart Water Fund 2009 – Chlor(am)ine disinfection of human pathogenic viruses.

Page 1

SWF62M-2114

June 2012

Final Report

Chlor(am)ine disinfection of human pathogenic viruses in recycled waters

Dr Alexandra Keegan, Dr Satiya Wati and Bret Robinson Australian Water Quality Centre

June 2012 © Copyright Smart Water Fund 2012 – Chlor(am)ine disinfection of human pathogenic viruses. Page 2

1.1 Copyright and Intellectual

Property This publication is copyright. Other than for the purposes of and subject to the conditions prescribed on the Copyright Act 1968, no part of any Material in this Report may in any form or by any means (including optical, magnetic, electronic, mechanical, microcopying, photocopying or recording) be reproduced, broadcast, published, transmitted, adapted, or stored without the express written permission of the copyright owner. All other rights are reserved. “Smart Water Fund” is a registered trademark, jointly owned by the Smart Water Fund participants, and is protected by laws governing intellectual property. The Smart Water Fund trademark and logo must not be used except as part of any authorised reproduction of the Report as set out above. The Smart Water Fund logo must not be modified in any way.

1.2 Disclaimer The material contained in this Report has been developed for the Smart Water Fund. The views and opinions expressed in the Report do not necessarily reflect the views, or have the endorsement of the Victorian Water Utilities or the Department of Sustainability and Environment, or indicate the Victorian Water Utilities or the Department of Sustainability and Environment commitment to a particular course of action.

1.3 Enquiries For enquiries or copies of this report please contact: Smart Water Fund Knowledge Transfer Manager Email: [email protected] Phone: 1800 882 432 (freecall) Quote Project SWF 62M - 2114 © Copyright Smart Water Fund, 2012

mailto:[email protected]


Executive Summary

Effective disinfection of human infectious viruses in wastewater (WW) can be adversely affected by a range of factors present in WWs including particles, turbidity, aggregation and cell association. USEPA Guideline disinfection values for viruses have been set based on drinking water systems with turbidity of <1NTU for both chlorine and chloramines. With the increase in use of recycled waters, investigations were required to determine whether effective virus inactivation is achieved with chlorine and chloramine disinfection for waters with turbidity of >1NTU.

A number of viruses causing gastroenteritis are shed in faeces and these include enteroviruses, adenovirus, hepatitis A and E virus, astroviruses and caliciviruses. Through WW treatment processes, the intent is to remove the viruses through a multiple barrier approach including a range of secondary and tertiary treatment processes and polishing steps. These steps vary from plant to plant and include activated sludge and clarification, lagooning, filtration, dissolved air flotation filtration and disinfection with chlorine, chloramines, chlorine dioxide, ozone and/ or UV. Disinfection is the final critical step in the treatment process. If effective disinfection has not occurred, the potential exists for viruses to be released either into receiving environments or into recycled water systems.

Chlorine disinfection is widely used at WW treatment plants around Australia. Due to the significant increase in reuse of WWs including stormwater and treated effluent, new disinfection values were suggested by the South Australian Department of Health, setting the chlorine contact time (Ct- mg.min/L) at Ct 10 for water with a turbidity of <1 NTU and Ct 30 where the turbidity is greater than 1 NTU. In the application of reuse water, achievement of turbidity < 1NTU, water would require membrane filtration. The conservative safety factor, three times the drinking water standard, has been applied for water > 1NTU. The Victorian DHS is yet to set a guidance figure for Victoria due to the lack of available data.

In this report we investigated the required chlorine Cts for inactivating Coxsackie B5 (CB5), an enterovirus known to be highly resistant to chlorine in WW of varying turbidity (0.2, 2, 5 and 20 NTU) and pH (7, 8 and 9) at 10°C. Due to low levels of CB5 virus in secondary treated WW, cultured CB5 virus was used in these experiments to spike WW with different turbidities. CB5 was exposed to different chlorine concentrations and contact times to determine Cts for up to 4 log10 virus inactivation. Infectivity of viruses was determined using optimised cell culture conditions by determining plaque forming units (PFU/mL) in BGM cells. Results demonstrated a small increase in Ct with lower turbidity (0.2, 2 and 5 NTU) and much higher Cts with turbidity of 20 NTU. Similarly an increase in pH also increased the Ct values. Despite the higher Ct values the results of this study demonstrate that CB5 can be effectively disinfected in WW destined for recycling at turbidity up to 20 NTU. However, current guidelines require modification to reflect the outcomes of this study to ensure that the disinfection process will be effective. Results presented in this report will be applied to development of new guidelines for WW disinfection in Australia and possibly internationally as well.


Further to the chlorine Cts there is a need for more information regarding monochloramine disinfection efficacy for viruses at WW treatment plants around Australia. A lack of data exists for the determination of the requirements of monochloramine contact time (Ct) for the inactivation of waterborne viruses in water where turbidity is greater than 1. A series of reports are available that have influenced standards and guidelines including the USEPA (1999). Published material included in this guideline utilises data from experiments using virus in buffered demand free water (DFW) (Sobsey et al., 1988 and 1991) which were used to derive the USEPA (1999) guidelines.

In this report we also investigated the required preformed monochloramine Cts for inactivating adenovirus 2, a respiratory virus known to be highly resistant to monochloramine, in WW of varying turbidity (2, 5 and 20 NTU) and pH (7, 8 and 9) at 10°C. Cultured adenovirus 2 virus was used in these experiments to spike WW with different turbidities and exposed to preformed monochloramine concentrations and contact times to determine Cts for up to 4 log10 virus inactivation. Infectivity of viruses was determined using optimised cell culture conditions by determining plaque forming units (PFU/mL) in the A549 cell line. Results demonstrated increasing Cts with increase in turbidity. Similarly, an increase in pH also increased the Ct value. Despite the higher Ct values the results of this study suggest that adenovirus 2 can be effectively disinfected in WW destined for recycling at varying turbidities, although the chemical dose required is significantly higher than the published Cts for monochloramine and potentially unachievable in WW treatment plants. Although it is understood that in situ formation of monochloramine is more effective than laboratory produced pre-formed monochloramine, as demonstrated in this report, further research at higher temperatures may be useful in decreasing the required Cts as those reported in this part of the project are exceedingly high and may be not be practical.

This report presents data for chlor(am)ine Cts required to inactivate two resistant viruses over a range of turbidities (up to 20 NTU) and pHs (7, 8 and 9) at 10°C in WW (Table 1E and 2E). This set of data is robust, uses a very conservative approach and will be useful in development of guidelines required for adequate disinfection of viruses in WW, thus providing an important barrier against transmission of waterborne viruses.


Table 1E. Free available chlorine Ct values for CB5 virus calculated by determining the integral of residual chlorine vs time for WW of various turbidities and pHs at 10°C

pH Log10 inactivati

on

Ct (mg.min/L) 0.2 NTU

using 6.5 mg/L chlorine

Ct (mg.min/L) 2 NTU


Ct (mg.min/L) 5 NTU


Ct (mg.min/L) 20 NTU

using 9 mg/L chlorine

7 1 2.05 2.13 2.24 2.55 2 3.29 3.37 3.71 5.95 3 4.41 4.75 4.88 16.47 4 5.44 5.46 5.99 25.81 8 1 5.72 6.67 7.78 7.99 2 9.6 10.32 13.16 15.09 3 12.8 12.90 17.79 24.81 4 15.49 15.68 21.94 34.52 9 1 8.25 8.94 9.66 13.70 2 14.06 15.5 16.33 28.73 3 19.10 20.88 22.03 41.32 4 23.97 26 27.93 51.89

Table 2E. Preformed monochloramine Ct values for adenovirus 2 calculated by determining the integral of residual monochloramine vs time for WW of various turbidities and pHs at

10°C pH Log10

inactivation

Ct (mg.min/L) 2 NTU

using 15 mg/L monochloramine

Ct (mg.min/L) 5 NTU




7 1 969 1204 1375 2 1688 1903 2175 3 2393 2638 2970 4 3082 3337 3757

8 1 1482 1590 3148 2 2326 2546 4070 3 3160 3490 4904 4 3949 4426 5900

9 1 2992 4364 6001 2 4592 6032 8114 3 5716 7511 9544 4 6746 9096 10718


Table of contents

Page Contents 3-5 Executive Summary 9 Abbreviations

10 Acknowledgements 11-62

11 12 12 13 13 14 14 15 15 16 16 17 17 18 21 21 22 22 24 24 28 33 35 37 38 39 44 44 44 45 45 46 46 47 48 50 55 58

Chapter 1: Review of the Literature and Key Findings 1.1 Overview 1.2 Viruses of interest in WW effluents

1.2.1 Adenovirus 1.2.2 Astrovirus 1.2.3 Calicivirus 1.2.4 Enterovirus 1.2.5 Hepatitis A virus 1.2.6 Hepatitis E virus 1.2.7 Reovirus

1.3 Viral Indicators of interest in WW effluents 1.3.1 Enteric virus genomes 1.3.2 Somatic bacteriophage 1.3.3 F-specific bacteriophage

1.4 Numbers of viruses in wastewaters targeted for recycling 1.5 Free Chlorine Disinfection

1.5.1 Calculation of Ct value 1.5.2 Temperature effects on Chlorination 1.5.3 pH effects on Chlorination 1.5.4 Chlorine disinfection of viruses in wastewaters 1.5.4.1 Free Chlorine Ct used in USEPA Guidance Manual 1.5.4.2 Relative resistance of viruses to chlorine disinfection 1.5.4.3 Viruses on the USEPA contaminant candidate list 1.5.4.4 Effect of virus aggregation verses dispersion on free chlorine Ct

1.6 Matrix effect on Disinfection Ct 1.7 Use of Laboratory versus environmental virus to derive Ct values 1.8 Virus selection matrix for chlorine disinfection 1.9 Models for the analysis of disinfection data 1.10 Chloramine based disinfection

1.10.1 Chloramine disinfection 1.10.2 Temperature effect on chloramines disinfection 1.10.3 pH effects in chloramines disinfection

1.11 Chloramine disinfection of viruses in WW 1.11.1 Chloramine Ct values used in USEPA guidance manual 1.11.2 Relative resistance of viruses to chloramination 1.11.3 Effect of virus aggregation versus dispersal of chloramines Ct 1.11.4 Virus selection matrix for chloramine experiments

1.12 Effect of particulates and turbidity on disinfection 1.13 Effect of increased ionic strength on disinfection efficacy


58 58 59 59 60 60 60 60 61

1.14 Summary 1.14.1 Reason for need to develop additional guidelines for recycled water 1.14.2 Addition of viruses is necessary to establish Ct values 1.14.3 Choice of target virus for establishing Ct values 1.14.4 Use of dispersed virus to establish Ct values 1.14.5 Use of laboratory grown virus to establish Ct values 1.14.6 Use of microbial indicators to establish Ct value. 1.14.7 Effects of particle association on Ct values. 1.14.8 Recommendation for further research

62-77 63 63 63 64 64 64 65 65 65 65 66 67 67 68 68 68 69 69 69 70 70 70 71 71 71 73 73 74 74 74 75 76

Chapter 2: Methodology 2.1 Virus enumeration 2.1.1 Cell culture 2.1.2 Virus propagation 2.1.3 Virus culture from environmental samples 2.1.4 Virus enumeration 2.1.4.1 Plaque forming units assay 2.1.4.2 Most probable number (MPN) calculation of viruses 2.1.5 Virus concentration 2.1.5.1 Virus concentration by ultrafilteration 2.1.5.2 Virus concentration using PEG 2.1.6 PCR assays for Viruses 2.1.6.1 Nucleic Acid extraction 2.1.6.2 Enterovirus Taqman RT-PCR 2.1.6.3 Adenovirus Taqman qPCR 2.1.6.4 Reovirus RT-PCR using SYT09 2.1.6.5 Norovirus Taqman RT-PCR 2.1.6.6 Rotavirus RT-PCR using SYT09 2.2 F-RNA Bacteriophage Plaque assay 2.3 Somatic Bacteriophage Plaque assay 2.4 Methods for Chlorine Ct experiments 2.4.1 Virus Culture 2.4.2 Glassware and water preparation 2.4.3 Determining chlorine demand of WW and adjustment of pH 2.4.4 Chlorine stock, chlorine analysis and Ct calculation 2.4.5 Experimental protocol 2.5 Methods for monochloramine 2.5.1 Virus Culture 2.5.2 Glassware and water preparation 2.5.3 Determining monochloramine demand 2.5.4 Monochloramine stock analysis and Ct calculation 2.5.5 Experimental protocol 2.5.6 In situ monochloramine formation

78-89 78 78 80 81 82 83 84 86

Chapter 3: Virus numbers in wastewaters 3.1 cell line for optimal detection and enumeration of enteroviruses and adenovirus 3.1.1 CB5 and poliovirus enumeration using MPN and PFU methods using 5 cell lines 3.1.2 Determination of best cell line for culturing enteric adenovirus 40 and 41 3.1.3 determination of best cell line for culturing adenovirus 2 3.2 Evaluation of virus culture method 3.3 Optimised methods of concentrating viruses from wastewaters 3.4 Cell line selection for native virus isolation 3.4.1 Levels of culturable enterovirus and adenovirus in Bolivar and Glenelg secondary


87 88 98

treated WW 3.5 Bacteriophage number present in secondary treated wastewaters 3.6 PCR detection of non culturable and culturable viruses 3.7 Outcomes/Discussion

90-115 90

91

92

110 115

Chapter 4: Chlorine disinfection of Coxsackie B5 (CB5) 4.1 Effect of pH change for virus recovery? Change in pH of WW had no effect on virus recovery numbers 4.2 Determination of CB5, Ct values for chlorine in BDF water for purposes of replicating published work 4.3 Determination of Ct for CB5 in WW 4.4 Water quality Characteristics and trouble shooting 4.5 Outcomes/Discussion

116-141 116 119 130 134 141

Chapter 5: Monochloramine disinfection of adenovirus 2 5.1 Problems with monochloramine formation in situ 5.2 Determination of Ct for adenovirus 2 in WW using preformed monochloramine 5.3 Water quality characteristics 5.4 Tailing effect-Inactivation of native and F-RNA phage and E. coli in wastewaters 5.5 Outcomes/Discussion

142 Conclusions 143 References 150 Appendices


Abbreviation

AD40 adenovirus strain 40

AGWR Australian Guidelines for Water Recycling (2006)

ASP activated sludge plant

BDF buffered demand free (water)

CB5 Coxsackie B5 virus

CCL contaminant containment list

CPE cytopathic effect

Ct disinfectant dose (mg/L) x contact time (min)

DNA deoxyribonucleic acid

DPD-FAS N, N, Diethyl-P-Phenylenediamine-ferrous ammonium sulphate

FAC free available chlorine

FBS Foetal Bovine Serum

FCV Feline calicivirus

LRV Log10 Reduction Value

MOI multiplicity of infection

MPN most probable number

NTU nephelometric turbidity unit

PEG polyethylene glycol

PCR polymerase chain reaction

PFU plaque forming units

PV1 poliovirus 1

RNA ribonucleic acid

RT-PCR reverse transcription polymerase chain reaction

USEPA United States Environmental Protection Agency

UV ultraviolet light

WW wastewater

WWTP wastewater treatment plant


Acknowledgements

The authors wish to thank the Smart Water Fund of Victoria for funding this project work. We especially acknowledge Dr Judy Blackbeard, John Mieog of Melbourne Water and Dr Dan Deere of Water futures for their invaluable expertise, advice and involvement in ensuring useful and applicable outcomes. The authors wish to express gratitude to the Microbiology Research Team at Australian Water Quality Centre (AWQC), Water Treatment Group at AWQC and both South Australian and Victorian Departments of Health for their valuable support and advice throughout the project. Finally the authors would like to thank Renae Phillips for the invaluable cell culture assistance and technical support during the duration of the project.


Chapter 1: Review of the Literature and Key Findings

1.1 Overview

Due to the presence of viruses in wastewater (WW), the need for effective removal and inactivation is essential for waters that are targeted for reuse and recycling. The integration of a range of WW treatment processes forms an effective barrier for the removal of a high level of the viral load. For application to recycling of WW, disinfection is a critical step in this process.

A number of issues arise when investigating the inactivation of waterborne viruses via disinfection, most especially when dealing with inactivation in WWs. These issues include: (i) the potential issue of the chlorine demand due the varying water quality, (ii) the formation of chloramines (a slower acting form of disinfectant) due to the presence of ammonia in the WW, (iii) the issue of particulates and the protection that the formation of particulates offers to viruses trapped within particulates and (iv) viral aggregation.

In Australia, an increasing importance has been placed on recycling of a range of water sources including WW and, more recently, stormwater. In South Australia, SA Water has a target of recycling 34.8% of metropolitan WW and 29.3% of country WW recycled by 2014, while the Victorian Government has a target of 20% WW recycling by 2010. The recycled water is targeted for non-potable purposes such as agricultural/horticultural irrigation, watering parks and recreational areas, some industrial processes, toilet flushing and garden watering in urban areas.

A range of treatment options are available for WW. The level of microbial contamination within WW varies and the treatment is designed with the end use in mind so that the water is “fit for purpose”. Effective disinfection is of great public health importance especially when treated WW has food crop and recreational area irrigation applications.

Much of the research performed for virus inactivation has been based on drinking water and water with turbidity of less than 1 NTU. This research is also often based on the use of demand free waters or buffers for the disinfection experiments, which results in an empirical disinfection and inactivation kinetic. When the disinfection tests are applied to natural waters, many effects take place that may or may not have an effect on disinfection. The published data has been presented within this review with reference to the different viruses tested, the variability of inactivation observed for a range of viruses, test waters, and both chlorine and chloramines disinfectants, where data was available.

There is a large range of material available in the public domain regarding virus disinfection, disinfectant concentration, contact time (Ct) estimation and recommendations. The experimental protocols tend to be quite varied in their set up, investigation and calculations and offer little consistency in methodology, making it difficult to interpret the results from those experiments. Direct comparison of the results is also made more difficult due to the range of ways in which the results are presented.


1.2 Viruses of interest in WW effluents

There are more than 100 known enteric viruses that are excreted in large numbers in human faeces and are potentially transmitted by water. Those of particular significance include hepatitis A viruses, enteroviruses, Norwalk-type viruses, rotaviruses, adenoviruses and reoviruses (Gerba 1984). With the increase in use of recycled water, the potential exists for increased contact and potential transmission of viruses present in WWs if adequate treatment and disinfection are not applied. A range of assays are used to detect waterborne viruses including cell culture (where an adequate cell culture assay is available). Where a cell based assay is not available, molecular methods are utilised such as polymerase chain reaction (PCR) for DNA based viruses and reverse-transcription polymerase chain reaction (RT-PCR) for RNA based viruses. Many factors influence the recovery and enumeration of viruses from a WW sample. The methods used for concentration of viruses, such as filtration or polyethylene glycol (PEG) precipitation, will vary in the amount of virus recovered based on the matrix tested. The culture methods vary depending on the cell type used for enumeration, the specificity of the virus for the chosen cell type and the culturability of the virus. For non-culturable viruses, molecular methods have been developed to allow enumeration that detects all virus particles (live and dead particles, while culture detects live, potentially infective viruses that are capable of growing in the culture system provided). This results in variability of the final results which can result in the overestimation or underestimation of viruses in a WW sample.

The range of viruses that are of significance in WW streams are listed below. Viruses are shed in faeces and urine in high numbers and directly contribute to the viral load in WWs. The viruses in WW are dependent on the viruses circulating within the community.

1.2.1 Adenovirus

A large range of adenoviruses are known to infect humans with the majority causing upper respiratory tract infections that are not associated with enteric symptoms. Two adenovirus serotypes are known to cause gastroenteritis (types 40 and 41), and are shed in high numbers in faecal material. Numbers of adenoviruses in WWs ranged from less than 0 to 102/L by culture (Sedmak et al., 2005) that tends to be lower than the enterovirus numbers detected at WW treatment plants. Standard cell culture methods are used for the enumeration of adenoviruses and PCR assays are also available. Estimations in the AGWR (2008) suggest adenoviruses are present in raw WW at 101-104 /L by culture.

A risk assessment study suggested that adenoviruses were among the most thermally resistant viruses (Gerba et al., 2002) and thus able to withstand conditions in WW treatment processes. Other studies have shown that adenoviruses survive longer in water than enterovirus and hepatitis A virus (Enriquez et al., 1995). Sirikanchana et al., (2008) used adenovirus serotype 2 as a model for adenovirus disinfection trials with chloramines. Adenovirus 2 is a respiratory virus but has been detected in WW as it is shed in faeces and has a high level of resistance to chloramine disinfection while being highly susceptible to free chlorine disinfection. Adenoviruses are rated as highly important to the industry on the basis of their resistance to low pressure UV and their use by health regulators as one of the


criteria in the assessment of the safety of recycled water. Adenoviruses have also been selected as a target organism in the criteria for the assessment of the safety of reuse water based on cell culture results, adenovirus numbers were reduced by 85%, while reovirus was reduced by 28% and enteroviruses by 93% across activated sludge treatment and disinfection (Long and Ashbolt, 1994). Reovirus may be more difficult to remove than adenovirus and enteroviruses through secondary treatment processes (Irving and Smith, 1981).

1.2.2 Astrovirus

Astroviruses have been increasingly recognised as a significant cause of diarrhoea in children although the illness is of low severity and has a shorter duration than rotavirus. The virus causes gastroenteritis and predominantly diarrhoea, mainly in children under five years of age (although it has been reported in adults). Viral pathogen detection in water, especially in WW, is difficult and PCR is widely used to detect these viruses, although a culture based system does exist but is not frequently utilised (Abad et al., 1997). Astrovirus genomes were detected at the entrance to the sewage treatment plant, with a mean value of 4.1 x 106 astrovirus genomes per 100 mL and effluents were less strongly contaminated, with a mean value of 1.01 x 104 astrovirus genomes per 100mL (LeCann et al., 2004). Morsey El-Senousy et al., (2007) observed varied removal of group A and group B human astroviruses with group A more effectively removed across WW treatment including primary sedimentation and activated sludge treatment. RNA copies were compared to infectious units in a cell culture assay and 2-3 log10 higher numbers were detected in the RNA copies, although this was not consistently observed. PCR detects all viruses whether potentially infectious or inactivated and can overestimate the viral load for potentially infectious virus, while culture based methods can underestimate the viral load due to the limitations of the culture systems available. Dose response curves are usually determined with culturable viruses using culture methods to determine the titre of infectious viruses before and after disinfection. This allows the level of virus inactivation to be determined from exposure to the disinfectant.

1.2.3 Calicivirus

Caliciviruses are most commonly known as Noroviruses (formerly Norwalk-like viruses) and Sapoviruses (formerly Sapporo like viruses). Noroviruses are the most common cause of gastroenteritis in developed regions (Lopman et al., 2003) and are broadly distributed. The illness, although severe, is of short duration and severe complications are rare. Currently, a reliable culture system for the human caliciviruses is not available and relies on molecular methods for the detection, enumeration and speciation of noroviruses. The virus outbreaks are seasonal and tend to occur in winter in the northern hemisphere and are termed “winter vomiting disease”, while in the southern hemisphere, the opposite is true with most outbreaks occurring during summer months (Sinclair et al., 2005). Numbers of human infectious noroviruses in WW influent range from 102.5 to 107 genome copies per Litre (Laverick et al., 2004; Lodder and de Roda Hussman 2005), while levels in effluent range from 101.6 to 105 genome copies per Litre prior to disinfection (effluent treatment consisted


of primary settling, activated sludge process, and phosphorus removal)(Lodder and de Roda Husman, 2005). Estimates in the AGWR (2008) suggest 101-104/L. Noroviruses are listed on the USEPA Contaminant Containment List (1998).

1.2.4 Enterovirus

Enteroviruses are members of the genus Enterovirus within the Picornaviridae family. This large genus of viruses includes coxsackie A and B virus, echovirus, enterovirus types 68-71, and poliovirus. Symptoms from poliovirus infection include fever, fatigue, headaches, vomiting and muscle and joint pain, with the majority of cases being asymptomatic. Poliovirus has been eradicated in most countries due to the vaccination programmes, with wild-type poliovirus only occasionally isolated from human populations (Mulders et al., 1995). The vaccination program previously used a live attenuated virus and now utilises a heat inactivated /killed virus so no replication of the virus occurs. The exception for poliovirus eradication is some areas of Africa and Asia where the virus remains endemic.

Other members of the Enterovirus genus have been associated with a wide range of symptoms and illnesses including fever, vomiting, diarrhoea skin rashes, jaundice and conjunctivitis, however many of the infections are believed to be asymptomatic and resolve quickly and without ongoing problems. A small number of cases result in more serious complications including meningitis, encephalitis and polio-like paralysis.

Coxsackie viruses A and B cause hand, foot and mouth disease in children (often Coxsackie virus A 16) resulting in blisters on the hands and feet, in the mouth, and on the tongue and gums. Most cases have flu-like symptoms and occur most often in summer and autumn but occur year round in tropical climates. Enterovirus 71 causes similar symptoms as observed in hand, foot and mouth disease (and some severe cases progress to meningitis, encephalitis and paralysis). Enterovirus 71 does not cause gastroenteritis, although the virus is shed in faeces for periods up to 2 months after infection.

Echovirus infections occur mainly in children, are highly infectious and cause acute fever in infants with early infections in infants having the potential to cause complications and fatalities.

Enteroviruses have been detected in WW influent at concentrations of <100 to 102 /L culturable (Sydney Water Corp, pers. comm.) and up to 104/1L (Sedmak et al., 2005). AGWR (2008) suggest 102-106 /L. Enteroviruses are detected by cell culture base methods using plaque assays and PCR based molecular techniques are also available for enteric genome quantitation.

1.2.5 Hepatitis A virus

Hepatitis A virus (HAV) has its own genus, Heparnavirus, within the Picornaviridae family. HAV is a relatively common infection even in developed countries, but many cases are believed to pass unrecognised as they involve mild symptoms. Serious illness with significant inflammation of the liver is more common when infection occurs later in life (Sinclair 2005) and the symptoms can be debilitating. In Australia, there are approximately 300-500 cases


of HAV reported annually. The number of cases has been declining nationally since the late 1990’s. In Australia, infection with HAV is more likely to occur in particular locations including childcare centres and preschools, residential care facilities and travellers to countries where the infection is common (Asia, Africa South Pacific, Central and South America). Infection from contaminated food or water is rare in Australia (Hepatitis Australia.com.au). HAV is listed on the USEPA contaminant containment list. HAV has been rated important to the water industry as it is used by health regulators for assessing the quality of reuse waters. The methods of detection and enumeration include PCR based assays and a culture based method using a radio-immunofocus assay or molecular methods such as RT-PCR.

1.2.6 Hepatitis E virus

Hepatitis E virus has emerged relatively recently and is a significant waterborne pathogen in developing countries (Asia, Africa, the Middle East and Central America) (Aggarwal and Krawczynski, 2000). The illness is generally asymptomatic but is problematic for women in their third trimester of pregnancy as infection produces a high mortality rate (25%). The disease is not a common cause of liver disease in Australia. Over the last 6 years, there have been approximately 10-30 cases of HEV diagnosed and reported to the government each year. HEV causes an acute illness but does not cause chronic infection. Detection of the virus has been via serological detection and RT-PCR based assays with no culture method available currently.

1.2.7 Reovirus

These viruses have a broad host range and infect a number of other mammals as well as humans. Reovirus infections appear to be very common but mostly asymptomatic, and their role if any, in producing significant human disease is not clear. Reoviruses are detected through cell culture assays with discernable cytopathic effects or molecular detection using RT-PCR (Spinner and Di Giovanni, 1996).

The genus Rotavirus is included in the Reoviridae family. Rotaviruses are the major cause of severe diarrhoea in young children in both developed and developing countries. Worldwide, this virus is estimated to be responsible for over 130 million episodes of gastroenteritis, 2 million hospitalisations and 440,000 deaths per year. In Australia about 42% of cases are babies under 12 months of age and 92% of cases are children under 5 years of age. Rotavirus infections tend to be seasonal with the majority occurring in the winter months. The observation that rotavirus is highly prevalent among young children in both developed and developing countries, despite major differences in drinking water quality and sanitation, suggests that other modes of transmission are more important for this virus (Sinclair 2005). In 2007 a routine vaccination program was introduced in Australia (and other developed countries) for children up to 6 months of age. This may potentially eliminate a broad spectrum of the disease in the community. The virus may still be detected in sewage as the vaccine is a live virus which may replicate in the host and be shed in faeces.


The ideal in vitro system for rotaviruses has not yet been elucidated and as such rotaviruses are not culturable in the laboratory, and are thus detected by RT-PCR. Investigations have been performed with the surrogate rotavirus – simian rotavirus (SA-11) but this has been limited to the indicator.

Rotaviruses were detected by RT-PCR at 101- 105 genomes /L (AGWR, 102-105/L) in WW influent and similar levels in the effluent, with 101.6-105 genomes /L indicating minimal removal of rotavirus (Lodder and deRoda Husman, 2005). Reoviruses were detected at 103.6-103 pfu /L using a culture based method in wastewater influent with a reduction to 101-102

pfu /L prior to disinfection, indicating 1-2 log10 reduction in reoviruses from primary to secondary treatment processes. The observed reduction in reovirus may be due to removal and/or inactivation of the virus while the consistent rotavirus numbers indicates no removal of this virus and cannot establish loss of infectivity.

1.3 Viral indicators of interest in WW effluents

1.3.1 Enteric virus genomes

Molecular detection of water borne viruses has been utilised in the past for those viruses where a suitable culture method was not available, such as noroviruses and rotaviruses. Quantitative PCR for DNA based viruses (adenovirus) or RT-PCR for RNA based viruses (Picornaviruses, reoviruses) is now widely available for both culturable and non culturable viruses as an alternative to the cell culture detection methods, and these have been investigated by a number of researchers. The method involves recovery of the viral particles from a water sample, extraction of the nucleic acid (DNA or RNA) and quantification of the virus present using an internal standard with PCR and specific primers to allow detection of the viruses of interest. The methods are reliant on the selection of specific primers for the virus(es) of interest, adequate optimisation of the assay and determination of non-specific amplification of other closely related viruses. The sensitivity of individual assays also requires determination to ensure low levels of viruses are detectable. The limitation of the method is that both infectious and non-infectious virus particles will be detected, possibly providing an overestimate of the health risk. In contrast, culture based enumeration using cytopathic effect (or plaque formation) can fail to detect a large number of viruses as suitable culture systems do not exist and as a result can potentially underestimate the number of infectious virus particles present (Lee and Jeong, 2004). Gantzer et al., (1998) found no correlation between the presence of infectious enterovirus and enterovirus genomes. Choi and Jiang (2005) found no correlation for the direct detection of adenovirus or enterovirus genomes with infectious virus. When assessing disinfection kinetics, the detection of false positives i.e. detection of inactivated virus would be encountered unless degradation of the nucleic acid was achieved during the disinfection process.

Viral genomes (either enterovirus or adenovirus based) are becoming more widely accepted as an indicator of the removal of viruses though treatment processes and is suitable for most processes. The exception for viral genomes is the assessment of disinfection efficacy, where the virus may be damaged and unable to replicate within a suitable host, but is still capable of being detected through PCR. This includes treatments such as UV, chlorine,


chloramines and ozone. Culture based methods are better suited to determining inactivation due to a disinfectant.

Enteric genomes tend to be present at significantly higher numbers when compared to cultured viruses. Numbers for astrovirus have been reported previously in this report and demonstrated between 2 and 4 log10 more virus particles detected than cultured numbers. For adenoviruses, numbers detected were between 103 to 106 PFU/L by PCR (Keegan et al., 2009), while cultured adenovirus numbers are usually between 100-102 /L (Sedmak et al., 2005).

1.3.2 Somatic bacteriophage

Somatic coliphage have been studied in the WW treatment process and are always present at much higher numbers than observed for the viruses. Studies have generated conflicting results. Gantzer et al., (1998) found a significant correlation between the presence/absence of infectious enterovirus and the number of somatic coliphage in samples after secondary treatment. However, Harwood et al., (2005) found no correlation between coliphage and enteric virus removal by WW treatment processes (in particular filtration and disinfection). Carducci et al., (1995) found that coliphage numbers were similar irrespective of the presence or absence of enteric viruses. Concentrations in WW influent has been reported at 106 PFU/L (AGWR, 2008, 106-109 PFU/L), while concentrations in effluent decreased to 105 PFU/L (Lodder and de Roda Husman 2005). Conditions are not favourable within WW for replication of the phage, which require host bacteria to be present and in log phase growth (Muniesa and Joffre, 2004), which is characteristic of viruses as they cannot replicate outside a host cell.

1.3.3 F-specific bacteriophage

F-RNA bacteriophage have been utilised in WW treatment process analysis as a surrogate for waterborne viruses with conflicting results. Tree et al., (2005) suggested the use of MS-2 as a conservative indicator as they are more chlorine and UV resistant than E. coli and poliovirus. However, Harwood et al., (2005) found no correlation between F-RNA phage and enteric viruses (enteric viruses were greatly affected by filtration and disinfection). Similarly, Simpson et al., (2003) found no correlation between traditional indicators (including F-RNA phage) and the presence of enteric viruses. Concentrations of F-RNA phage in waste influent were 104.5- 107 PFU/L (AGWR, 2008; 105-107 PFU/L) and 101.5-103 PFU/L in waste effluent (Lucena et al., 2004). F-RNA does have similar sensitivity to poliovirus when disinfected with chlorine (Duran et al., 2003). F-RNA phages are unable to replicate in WW due to requirements for host cell density, growth phase and temperature conditions (Woody and Cliver, 1995, 1997).


1.4 Numbers of viruses in wastewaters targeted for recycling

Virus numbers in WWs vary from plant to plant with the numbers influenced by (i) the inputs to sewage (whether domestic or industrial wastes or a mixture of both), (ii) the incidence of disease within the community (a number of viruses are seasonal), (iii) the treatment processes used at the WW treatment plant and (iv) the end point use of the water (this affects the level of treatment applied to the WW). In the literature, this variation is also in part, due to the range of concentration, recovery and detection methods that are used for viruses. Few studies have investigated the removal of viruses across the full treatment train with the inclusion of a large range of pathogens and indicators for assessment. The numbers of viruses in primary WWs varies considerably and has been reported in the AGWR, with enteroviruses present at 102-106/L, adenovirus at 101-104/L, norovirus at 101-104/L, rotavirus at 102-105/L, somatic coliphage at 106-109/L and F-RNA coliphage at 105-107/L.

In the published literature, the numbers of viruses in primary WW vary considerably. Rose et al., (2003), investigated the presence and removal of pathogens and indicators across the treatment train at 6 WW treatment facilities analysing raw WW, activated sludge, biological nutrient removal, filtration (various) and chlorination. Harwood et al., (2005) demonstrated that culturable enteroviruses were present at 5 orders of magnitude lower than the indicators in raw water and were present at 102-105 most probable number (MPN)/ 100L (or 100-103/L) (Rose et al., 1996). Reduction of pathogens through biological treatment demonstrated a significant reduction of 100-102 MPN/100L in the number of viruses present across the 6 plants. Culturable virus numbers ranged from 1-102 MPN/100L in filtered effluent. In disinfected effluents, pathogenic virus levels were below detection limits in the majority of samples or were extremely low (3.1x100 MPN/100L). Rose et al., (1996) tested removals of pathogenic and indicator microorganisms by a full scale water reclamation facility with disinfected effluent having between 0.01- 5.0 enteroviruses per 100L.

Other researchers have shown the range of virus numbers at treatment plants. Sedmak et al., (2005) enumerated the culturable viruses (enterovirus, adenovirus and reovirus) at the Milwaukee Jones Island WWTP from 1994 to 2003. The treatment train consisted of preliminary, primary and secondary treatment (activated sludge), followed by phosphorus removal and disinfection. The viruses were detected frequently in the WWTP influent (105 of 107 samples), and were detected less frequently in effluent waters (32 of 107 samples). Although viruses from the three groups were frequently detected, large fluctuations in titre (MPN/L) by month were observed. Titres were generally highest for reovirus (range 0- 12,027 MPN/L), enteroviruses (range 0- 3347 MPN/L), and adenovirus that were present at considerably lower numbers (range 0- 250 MPN/L). Total culturable virus present in the influent waters ranged from 0-12,820 MPN/L with an average of 264-3,086 MPN/L. and the effluent total culturable virus numbers were 0-233 MPN/L with a mean of 0-26 MPN/L. This demonstrated an influent-effluent log10 difference of means of 1.17-3.19 log10 removal/inactivation (mean of 2.41 log10 removal), although experiments did not include a spiked control to account for differences in recovery from the different matrices. The removal of viruses and other pathogens did correlate with solids removal (MacDonald et al., 1998). There was no analysis of the virus numbers after individual treatment processes.


Variation was in part due to seasonal effects (different viruses causing disease in the community at different times of the year- with reovirus and enterovirus occurring more frequently in July to December (in the Northern hemisphere).

Earlier data from Hejkal et al, (1981) sampled primary influent, unchlorinated effluent and chlorinated effluent. Virus numbers averaged 87 PFU/L in influent waters, 7.4 PFU/L in unchlorinated effluent and 1.3 PFU/L in chlorinated effluent (plant utilised activated sludge with chlorination). This demonstrated a 0.75 log10 inactivation due to disinfection.

Lodder and de Roda Husman (2005) tested raw and un-disinfected treated sewage (treatment consisted of primary settling, activated sludge and phosphorus removal). Enteroviruses, reoviruses, noroviruses and rotaviruses were enumerated and numbers varied across the testing period of 3 months, enteroviruses (average 7-39 PFU/L), reoviruses (average 8-96 PFU/L), Noroviruses (average 896-7499 PCR detectable units (PDU)/L) and rotaviruses (average 4891-2.9 x 104 PDU/L). Although the norovirus and rotavirus numbers are high, when looking at disinfection a culture based assay is required and as these viruses do not have appropriate culture systems available, their use would not be advantageous. The numbers of the culturable viruses are somewhat low to allow effective evaluation of the disinfection abilities of either chlorine or chloramines in recycled waters.

Estimated log10 removals of viruses and bacteriophage for individual processes are provided in Table 1. The virus log10 removals are process dependant and reductions are dependent on specific features of the process, including detention times, pore size, filter depths and disinfectant type). When under consideration by the South Australian and Victorian Departments of Health (DoH), a system or process will be attributed the default minimum log10 credit listed in Table 1 unless it has been proven otherwise that greater removal of inactivation is achievable. The default values are accumulated across the treatment train processes for a total log10 removal achievable by the system with a maximum of 4 log10 credit for any single process. The level of removal required is dependent on the quality required in the product water whether it be Class A, Class B or other. The indicative log10 removals have been included for both viruses and bacteria (Table 1).


Table 1: Indicative log10 removals of enteric viruses and indicator organisms (amended from AGWR, 2006).

Indicative log10 removalsa

Treatment Viruses (including adenoviruses,

rotaviruses and enteroviruses)

Phage E. coli Bacterial pathogens

Primary treatment 0-0.1 N/A 0-0.5 0-0.5

Secondary treatment 0.5-2.0 0.5-2.5 1.0-3.0 1.0-3.0

Dual media filtration with coagulation

0.5-3.0 1.0-4.0 0-1.0 0-1.0

Membrane filtration 2.5->6.0 3.0->6.0 3.5->6.0 3.5->6.0

Reverse osmosis >6.0 >6.0 >6.0 >6.0

Lagoon storage 1.0-4.0 1.0-4.0 1.0-5.0 1.0-5.0

Chlorination 1.0-3.0 0-2.5 2.0-6.0 2.0-6.0

Ozonation 3.0-6.0 2.0-6.0 2.0-6.0 2.0-6.0

UV light >1.0 adenovirus

>3.0 enterovirus, hepatitis A virus

3.0-6.0 2.0->4.0 2.0->4.0

a Reductions depend on specific features of the process, including detention times, pore size, filter depths, disinfectant. Sources: WHO (1989), Rose et al., (1996, 2001), Bitton, (1999), USEPA (1999, 2003, 2004), Mara and Horran (2003).

When dealing with a treated WW, the numbers of naturally present viruses are significantly reduced. By utilising naturally present viruses for disinfection experiments, there would be a limitation on the determination of the total log10 inactivation achievable with individual disinfectants. This limits the determination of the successful disinfection practices if numbers of viruses present, for example in prechlorinated samples, were 7.4 PFU/L (7.4 x 102 PFU/100L) as detection of even lower numbers of viruses post disinfection would not allow the determination of the total log10 credit achievable by the disinfectant. As such, it is anticipated that spiking of cultured virus would be necessary to determine the CTs required for 2, 3 and 4 log10 inactivation.

In Australia, the WWs that targeted for reuse where there is the potential for human contact are required to achieve a range of pathogen removal depending on the end use. The log10 removals for viruses are shown in Table 2 as part of the Australian Guidelines for Water Recycling (2008).


Table 2: Log10 reductions of viruses for priority uses of recycled water from treated sewage (from AGWR, 2006).

Activity Route of exposure Exposure (litres) x freq (per year)

Log10 reduction Rotavirus

Log10 reduction Campylobacter

Commercial food crops

Ingestion -Lettuce -Other produce Total

0.005 x 70 0.001 x 140 0.49

6.1

5.0 Dual Reticulation Garden irrigation Ingestion of sprays

Ingestion-low -high Total

0.0001 x 90 0.001 x 90 0.1 x 1 0.02

5.8

4.6 Garden food crops Ingestion -lettuce

-other produce Total

0.005 x 7 0.001 x 50 0.09

5.3

4.2 Internal uses Toilet flushing Washing machine Cross-connections Total internal use (no garden use) Total residential use (garden + internal)

Ingestion of sprays Ingestion of sprays Ingestion

0.00001 x 1100 0.00001 x 100 1 x 0.365 0.38 0.67

4.5 3.5 6.1

6.1

6.3

3.3 2.3 4.8

4.8

5.1

Municipal irrigation Ingestion of sprays 0.001 x 50 5.2 4.0 Dual reticulation plus municipal irrigation

Ingestion water and sprays

0.72 6.4 5.1

Fire fighting Ingestion water and sprays

0.02x 50 6.5 5.3

Log10 reduction calculations: Rotavirus= Log10 (number of organisms in sewage x exposure (L) x frequency ÷2.5 x 10-3). Campylobacter = Log10 (number of organisms in sewage x exposure (L) x frequency ÷3.8 x 102).

1:5 Free Chlorine Disinfection

1:5:1 Calculation of Ct value

Chlorine disinfection relies on the ability of the chemical disinfectant molecules to come in contact with the target organism. Where particles are present, effective disinfection may be impeded because particles interfere with contact between the disinfectant and the target organism (Templeton et al., 2008). Chemical based disinfection (such as chlorination) is quantified in terms of the product of the disinfectant dose applied or the residual (mg/L) and the contact time (min). This product is called the Ct and has units of mg-min/L. The USEPA method (USEPA 1999) of calculating Ct is done by measuring chemical disinfectant


residual is measured at the end of each treatment step. The contact time used is T10, the length of time during which no more than 10% of the influent water would pass through that process, thus ensuring that 90% of the water has a greater contact time. In SA and Victoria, chlorine is applied at a dose which is sufficient to satisfy the demand and retain a residual and establishment of the total contact time while in the system to ensure effective inactivation of 2 log10 of viruses. Chlorine dosing is monitored and adjusted when required to ensure the demand and residuals are met.

The Ct required to achieve a certain log10 inactivation of a target organism via chlorination is dependent on the pH and temperature of the water, since chlorination efficiency increases with reducing pH and increasing temperature (Templeton et al., 2008) and will be affected by the chlorine demand of the water.

1.5.2 Temperature Effects on Chlorination

Temperature affects the rate of the disinfection reaction. Disinfection Cts required for pathogen inactivation typically halve with every 10°C increase in temperature. Operating temperatures of WWTP’s in Australia vary depending on geographical distribution. Based on seasonal variation, Victorian WWTP’s operate in the range of 9.2-25°C while South Australian plants operate at 10-27°C. Plants in tropical regions operated at higher temperatures, up to 29°C.

1.5.3 pH Effects on Chlorination

The pH of the disinfectant solution also affects reaction kinetics. It is a critical factor in the effectiveness of disinfection, and hence process Ct requirements for both chlorination and chloramination require consideration. pH effects the relative concentrations of chlorine and chloramine species present in the water, particularly as some species of chlorine are more effective at inactivation of pathogens than others (Figure 1). Where chlorination is employed, disinfection is most efficient within the pH range of 6-7, at which free available chlorine is most abundant in the form of hypochlorous acid rather than hypochlorite ion (White, 1999). The germicidal efficacy of hypochlorous acid (HOCl) is much higher than that of the hypochlorite ion (OCl-).


Figure 1: Distribution of chlorine species with pH (White 1999)

Microbial inactivation is generally expected to increase in a log-linear fashion as the disinfectant dose increases, but this is not always the case with disinfection kinetics often being biphasic, or multiphasic. Under optimal chemical and physical conditions, maximum disinfection efficiency is reached when the chemical has unhindered access to the target organism. However particulate matter may interfere with the process, either by acting chemically to create a disinfectant demand or by physically shielding the organism from the disinfectant. It has been speculated that small organisms, such as viruses, may be afforded much greater disinfection protection than larger organisms under lower turbidity conditions (Stewart and Olson, 1996) and by smaller particles (Emerick et al., 2000).


1.5.4 Chlorine disinfection of viruses in wastewaters

1.5.4.1 Free Chlorine Ct Values Used in the USEPA Guidance Manual for compliance with the filtration and disinfection requirements for Public Water sources (1989) and USEPA ‘Disinfection profiling and benchmarking guidance manual’ (USEPA 1999) The USEPA published the ‘Guidance Manual for compliance with the filtration and disinfection requirements for Public Water sources’ (USEPA 1989) and USEPA ‘Disinfection profiling and benchmarking guidance manual’ (USEPA 1999) which defines the required disinfection for virus inactivation in drinking waters. Ct values, for 2 to 4 log10 viral inactivation by chlorine at different temperature and pH conditions are listed in the manual and are provided in Tables 3-5. Guidance manual (USEPA 1989) Ct values were calculated by taking Ct values obtained from the bench scale experiments performed by Sobsey et al., (1988) conducted with dispersed hepatitis A virus in buffered, chlorine demand free water and applying a safety factor of 3 x and has grouped pH range 6-9 inclusive and pH 10. No information was included regarding the selection of the safety factor. The Ct required for disinfection within the pH range of 6-9 covers the most effective disinfection (at pH 7) and the least effective at pH 9. The results are presented in Tables 3 and 5. The data generated by Sobsey et al., (1988) is provided in Tables 6 and 7. Table 6 includes the data for hepatitis A virus while that in Table 7 is for a range of viruses including HAV, CB5, and coliphages MS2 and ØX174. Neither Tables 6 nor 7 include safety factors. The results demonstrated that CB5 was more resistant to disinfection than HAV and the indicators bacteriophage MS-2 and ØX174 across the range of pH values tested.

Considerations for selection of the target virus for use in setting guidelines included the following (Sobsey et al., 1991; Cotruvo, J., pers. Comm. 29-4-2009):

(i) the occurrence of the virus in water incidents,

(ii) the seriousness of the illness,

(iii) the concentration excreted in faeces,

(iv) the length of time of excretion in faeces ,

(v) stability in faeces, water and WW,

(vi) the effect of the treatment process and complete treatment train,

(vii) validation of the treatment process,

(vii) cost of inactivation of the particular virus.

Based on these selection criteria, hepatitis A virus was selected for the USEPA Guidelines, although it is not the most chlorine resistant virus.


Table 3: Ct values (mg.min/L) for inactivation of viruses by free chlorine, pH 6.0-9.0 (USEPA 1999) including 3x safety factor. A dispersed HAV inoculum in 0.01M buffered chlorine demand free water at 5°C was used to derive the data.

Temperature °C

Inactivation

(log10)

0.5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

2 6.0 5.8 5.3 4.9 4.4 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0 1.8 1.6 1.4 1.2 1.0 1.0 1.0 1.0 1.0 1.0

3 9.0 8.7 8.0 7.3 6.7 6.0 5.6 5.2 4.8 4.4 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0 1.8 1.6 1.4 1.2 1.0

4 12.0 11.6 10.7 9.8 8.9 8.0 7.6 7.2 6.8 6.4 6.0 5.6 5.2 4.8 4.4 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 2.4 2.2 2.0

Source AWWA, 1991. Modified by linear interpolation between 5°C increments. US EPA (1999)


Table 4: Ct values for inactivation of viruses by chloramines. (USEPA 1999). No safety factor is included in these data as it is understood that chloramine formation is less stable in the laboratory than in the field. A dispersed HAV inoculum in 0.01M buffered chlorine demand free

water at 5°C and pH 8 was used to derive the data.

Temperature °C

Inactivation

(log10)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

2 1243 1147 1050 954 857 814 771 729 686 643 600 557 514 471 428 407 385 364 342 321 300 278 257 235 214

3 2063 1903 1743 1583 1423 1352 1281 1209 1138 1067 996 925 854 783 712 676 641 605 570 534 498 463 427 392 356

4 2883 2659 2436 2212 1988 1889 1789 1690 1590 1491 1392 1292 1193 1093 994 944 895 845 796 746 696 646 597 547 497

Source AWWA, 1991. Modified by linear interpolation between 5°C increments. US EPA (1999).


Table 5: Ct values for inactivation of viruses by free chlorine (USEPA 1989) incorporating a 3x safety factor (USEPA, 1991). A dispersed HAV inoculum in 0.01M buffered halogen demand free water at 5°C was used to derive the data.

Log10 inactivation

Temperature (°C)

2.0 3.0 4.0

pH 6-9 pH 10 pH 6-9 pH 10 pH 6-9 pH 10

5 4 30 6 44 8 60

10 3 22 4 33 6 45

15 2 15 3 22 4 30

20 1 11 2 16 3 22

25 1 7 1 11 2 15


Table 6: Free chlorine Ct values for inactivation of dispersed Hepatitis A virus (mg.min/L) (Sobsey et al., 1988) at 5°C in 0.01M phosphate buffer.

Inactivation

pH

6 7 8 9 10

2 log10 1.18 0.7 1 1.25 19.3

3 log10 1.75 1.07 1.51 1.9 14.6

4 log10 2.33 1.43 2.03 2.55 9.8* *This data point has been confirmed in the USEPA (1991) Guidance Manual for compliance with the filtration and disinfection requirements for public water systems using surface water sources.

Table 7: Four log10 Inactivation of HAV, CB5, and coliphages MS-2 and ØX174 at 5°C in 0.01M phosphate buffer by initial free chlorine concentration of 0.5mg/L free chlorine at pH 6, 7, 8, 9, and 10 and 10mg/L monochloramine at pH8 (Sobsey et al., 1988). Original data was presented as time for 99.99% inactivation, for ease of comparison data has been converted to Ct by multiplying the time by the initial chlorine concentration (0.5mg/L) or initial chloramine concentration (10mg/L).

Chlorine form pH

Minutes and (Estimated Ct (mg min/L)) for 99.99% inactivation

HAV CB5 MS2 ØX174

Free 6 6.5 (3.25) 13.2 (6.6) 1.2 (0.6) 0.5 (0.25)

7 3.6 (1.8) 24 (12) 4.4 (2.2) 0.4 (0.2)

8 5.6 (2.8) 52.5 (26.25) 16.7 (8.35) 0.8 (0.4)

9 7.7 (0.85) 108 (54) 16 (8) 4.6 (2.3)

10 49.6 (24.8) 826 (413) 26.5 (13.25) 111 (55.5)

Monochloramine 8 117 (1170) 104 (1040) 420 (4200) 31.4 (314)

1.5.4.2 Relative resistance of viruses to chlorine disinfection

Early research by Liu et al., (1971) investigated the relative resistance of 20 human enteric viruses to 0.5mg/L free chlorine in partially treated (water treatment consisted of coagulation with aluminium hydroxide and slow sand filtration) Potomac River water (pH 7.8 and 2°C) and chlorine demand free (distilled) water. The study initially determined the inactivation of 6 viruses in both water types to ensure the river water was not causing inactivation due to chemicals contained within. The results demonstrated virus inactivation from chlorination was slightly slower in Potomac River water than in demand free water. The remaining viruses were tested only in Potomac River water. The viruses were dispersed with less than 0.1% present in aggregates. This study differs from that of Sobsey et al.,


(1988) in that water matrix was not buffered chlorine demand free water, but chlorine demand free river water.

The results provided in Table 8 show the results and highlight the inconsistency of virus susceptibility to chlorine at the genus level. Cts were estimated from the published data using the chlorine concentration established 2 hours after the disinfectant was added to the water to allow it to stabilise. The virus was added to the reaction vessel at the 2 hour time point, with no further chlorine concentration tested suggesting an overestimation of the Ct. Adenovirus 3 (Ct<2.15 mg.min/L) required significantly less Ct than adenovirus 7a (Ct 6.25 mg.min/L) and adenovirus 12 (Ct 11.75 mg.min/L) for 4 log10 inactivation. The most chlorine resistant viruses in this study were echoviruses 11 (Ct>13.05) and 12 (Ct >60), coxsackievirus A5 (Ct 26.75 mg.min/L), B3 (Ct 17.5 mg.min/L) and B5 (Ct 19.75 mg.min/L), and poliovirus 3 (Ct 15 mg.min/L) with Cts representing a minimum of 4 log10 inactivation. Disinfection kinetics was of the first order in most instances. The data generated by Liu et al., (1978) was similar to Sobsey et al., (1988) for CB5 at pH 7.8 and 8.0 respectively. HAV, MS-2 and Øx-174 were not tested in by Liu et al., (1978).

Further data supporting the identification of CB5 as one of the most resistant enteric viruses to 0.5 mg/L free chlorine disinfection at ph 6-10 was presented by Englebrecht et al., (1980). They compared chlorine based disinfection of 6 viruses, including Coxsackievirus A9 and B5, echovirus 1 and 5 and polioviruses 1 and 2 and ranked the viruses for ease of inactivation. Limited results with sucrose gradients suggested that virus aggregates or clumping amounted to 0.5 to 8% of the virus stock preparations but results for individual viruses were not provided. Results presented in Table 9 demonstrated that the viruses displayed a wide range of susceptibility to chlorine disinfection, with Coxsackievirus B5 generally the most resistant virus at pH range 6-10.


Table 8: Relative resistance of 20 human enteric viruses for 4 LRV to 0.5mg/L free chlorine in Potomac water (pH 7.8 and 2°C)( Liu et al., 1971 modified in Gerba et al., 2003) estimated from data , No/N, or calculated from data cited in reference. Virus stock contained 0.1% or less aggregated virus. For Potomac River water, chlorine was added 2 hours prior to the virus. At 2 hours the residual free chlorine was stabilised at the desired level. No further chlorine concentrations were determined. Cts were calculated by Gerba et al., (2003) by multiplying time required for 4 LRV by initial free chlorine concentration. Virus Time (mins)* Ct (mg.min/L)** Reovirus 1 2.7 1.35 Reovirus 3 <4.0 <2.0 Reovirus 2 4.2 2.1 Adenovirus 3 <4.3 <2.15 Coxsackievirus A9 6.8 3.4 Echovirus 7 7.1 3.55 Coxsackievirus B1 8.5 4.25 Echovirus 9 12.4 6.2 Adenovirus 7a 12.5 6.25 Echovirus 11 13.4 6.7 Poliovirus 1 16.2 8.1 Echovirus 29 20 10 Adenovirus 12 23.5 11.75 Echovirus 11 26.1 13.05 Poliovirus 3 30 15 Coxsackievirus B3 35 17.5 Coxsackievirus B5 39.5 19.75 Poliovirus 2 40 20 Coxsackievirus A5 53.5 26.75 Echovirus 12 >60.0 >30.0 *estimated min required to kill 99.99% of virus i.e. 4LRV ** estimated Ct from Min* data, Minutes required to kill 99.99% of virus.


Table 9: Time required for 99% (2 LRV) inactivation by free residual chlorine at 5±0.2 °C in chlorine demand free 0.05M sodium phosphate buffer for pHs 6 and 8, sodium borate buffer without KCl for pH 10. Majority of virus was dispersed with 0.5-8% as particles in the virus stocks. All viruses were long term laboratory strains (Engelbrecht et al., 1980). Ct was not provided in the article and has been estimated based on free chlorine present 3at the end of each experiment.

pH Free chlorine

(mg/L) Virus type

Time for 99% inactivation minutes (est. Ct

mg.min/L)) Rank 6 0.46-0.49 Coxsackie A9 0.3 (0.138-0.147) 1 6 0.48-0.49 Echo 1 0.5 (0.24-0.245) 2 6-6.02 0.48-0.51 Polio 2 1.2 (0.576-0.612) 3 6-6.03 0.38-0.49 Echo 5 1.3 (0.494-0.637) 4 6 0.47-0.49 Polio 1 2.1 (0.987-1.029) 5 6-6.06 0.51-0.52 Coxsackie B5 3.4 (1.734-1.768) 6 Coxsackie A9 ND 7.81-7.82 0.47-0.49 Echo 1 1.2 (0.564-0.588) 1 Polio 2 ND 7.79-7.83 0.48-0.52 Echo 5 1.8 (0.864-0.936) 3 7.8-7.84 0.46-0.51 Polio 1 1.3 (0.598-0.663) 2 7.81-7.82 0.48-0.5 Coxsackie B5 4.5 (2.16-2.25) 4 10-10.01 0.48-0.50 Coxsackie A9 1.5 (0.72-0.75) 1 10-10.41 0.49-0.51 Echo 1 96 (47.04-48.96) 6 9.89-10.03 0.48-0.50 Polio 2 64 (30.78-32) 4 9.97-10.02 0.49-0.51 Echo 5 27 (13.23-13.77) 3 9.99-10.40 0.50-0.52 Polio 1 21 (10.5-10.92) 2 9.93-10.05 0.50-0.51 Coxsackie B5 66 (33-33.66) 5 ND, not determined

Black et al., (2009) determined the Ct values for chlorine disinfection of resistant enteroviruses. A review of literature suggested echovirus 1, and 12, and coxsackievirus B5 are the most resistant to chlorine inactivation (Liu et al., 1971; Payment et al., 1985) in drinking water. The results are provided in Table 10 and demonstrate that CB5 is more resistant to chlorine based disinfection than echovirus 1, 12 or poliovirus 1 at both pH 7.5 and 9.0 using a starting chlorine concentration of 1.0 mg/L and initial chlorine residual at 1 minute of 0.62 mg/L (pH 7.5) and 0.88 mg/L (pH 9.0) and final residual at 30 minutes of 0.52 and 0.78 mg/L respectively. The predicted Ct values for CB5 at 5°C and pH 7.5 exceeded those values listed in the USEPA guidance manual for a 2, 3 and 4 log10 inactivation whereas echovirus 1 and 12, as well as poliovirus 1 did not. At pH 9.0, all three viruses along with poliovirus 1 exceeded the Ct values listed in the USEPA Manual (Table 12). The greater


resistance of CB5 to disinfection is attributed to purified CB5 aggregating rapidly at all pH values (Jensen et al., 1980).

Table 10: Predicted Ct values using the Efficiency Factor Hom (EFH) model and EPA Guidance Manual values for echovirus 1 and 12, CB5 inactivation experiments in BDF water (5°C, pH 7.5 and 9.0) (Black et al., 2009). It was assumed the viruses were monodispersed with cellular material removed, excepting coxsackievirus B5 which was considered clumped due to its clumping nature.

pH Inactivation

Ct value (mg.min/L)

EPA Guidance manual

CoxB5 Echo1 Echo12 PV-1

7.5 2 log10 5.4 1.6 2.1 1.4 4 3 log10 8.4 3.5 4.4 3 6 4 log10 11.5 6.2 7.4 5.3 8 9.0 2 log10 14 3.3 8.4 8.2 4 3 log10 18.7 8.5 18.5 14.7 6 4 log10 22.9 16.6 32.3 22.3 8


1.5.4.3 Viruses on the USEPA Contaminant Candidate List

A review of the disinfection resistance of waterborne pathogens on the United States EPA’s contaminant candidate list (CCL) (USEPA 1998), included a range of viruses including coxsackievirus A and B, echoviruses, adenoviruses and caliciviruses (Gerba et al., 2003). The results demonstrated a large variation in the estimated Ct required for 2 LRV. Data from 5 research papers were compared for CB5 with the Ct for 2 LRV varying significantly depending on water type, temperature, pH, free chlorine residual (Table 11). Where similar temperature (5°C) and pH 6 were used, estimated Ct for 2 LRV for CB5 varied from 1.73-3.25 mg.min/L. When the pH was increased to 8.0, the Ct was higher as expected, ranging from 2.16-9.15 mg.min/L. The higher Ct results (Sobsey et al., 1988) utilised 0.01M phosphate buffered demand free water, while the lower results (Engelbrecht et al., 1980) used 0.05 M sodium phosphate buffered chlorine demand free water. Results from Payment et al., (1985) demonstrated significantly higher Cts of 40 and 400 mg.min/L (presented in Gerba et al., 2003) at pH 7 for 2 LRV in 0.01M calcium chloride solution. The presence of aggregates or free virions was not established in this report and may be the reason for the high Cts reported. Comparing this to the data for dispersed HAV, the CB5’s are significantly more resistant to chlorine based disinfection. For cell associated HAV, the Cts are slightly higher for the cell associated virus than CB5, but direct comparison cannot be done as different pHs were tested in the respective studies.


Table 11: Inactivation of Coxsackie B5 viruses by chlorine (adapted from Gerba et al., 2003). Note: data from Payment et al., 1985 represents 98.9-99.92% reduction (as presented in Gerba et al., 2003).

Virus (strain) Water

Free Cl2 residual (mg/L)

Temp (°C) pH

Time (min)

Reduction (%)

Est. Ct99 mg.min/L Reference

Coxsackie B5 BDF 0.5 5 6 6.5 99 3.25* Sobsey et al ., 1988

Coxsackie B5 BDF 0.5 5 8 19 99 9.5* Sobsey et al., 1988

Coxsackie B5 Tap 11.8 25 8.1 5* 99 59* Grabow et al., 1984

Coxsackie B5 HTE 27 25 8.5 4* 99 108* Grabow et al., 1984

Coxsackie B5 CDF 0.51-0.52 5±0.2 6.0-6.06 3.4 99 1.73* Engelbrecht et al., 1980

Coxsackie B5 CDF 0.48-0.50 5±0.2 7.81-7.82 4.5 99 2.16* Engelbrecht et al., 1980

Coxsackie B5 CDF 0.5-0.51 5±0.2 9.93-10.05 66 99 33.0* Engelbrecht et al., 1980

Coxsackie B5# CaCl2 0.4 5 7 1000 99.92* 400*

Payment et al., 1985

Coxsackie B5‡ CaCl2 0.4 5 7 1000 99.95* 400*


Coxsackie B5‡ CaCl2 0.4 5 7 100 99.8* 40* Payment et al., 1985

Coxsackie B5 (Lab strain) CaCl2 0.4 5 7 100 98.8* 40*


Coxsackie B5 PEW 0.5 2 7.8 39.5 99.99 19.8* Liu et al., 1971

Coxsackie B5 ASE 7.8 15 7.2 ND 99 ND Harakeh, 1987

Tap- treated drinking water, CDF- chlorine demand free, BDF- buffer demand free, HTE- humus tank effluent, * -estimated from the data N0/N1, or calculated from data in cited reference PEW- Potomac estuarine water, CaCl2- calcium chloride, #-isolated from raw sewage, ‡-isolated from chlorinated water. ASE =activated sludge effluent


1.5.4.4 Effect of virus aggregation versus dispersion on free chlorine Ct

Virus particles can exist as single particles (monodispersed particles), as aggregates or clumps (grouping of 2 or more virus particles) and associated with the host cellular material. Thurston-Enriquez et al., (2003) compared chlorine inactivation of three viruses in BDF water and the effect on disinfection if viruses were aggregated rather than dispersed. The viruses used in the study were adenovirus type 40 (dispersed only), feline calicivirus (FCV) (aggregated and dispersed virus) and poliovirus 1 (PV1) (aggregated and dispersed virus) (Table 12). CTs for aggregated viruses (where tested) were significantly higher than the dispersed virus. For dispersed virus, adenovirus 40 Ct values were higher at pH 8 than at pH 6, higher at 5°C than 15°C. The results also demonstrated that the Cts were higher for dispersed adenovirus 40 than dispersed FCV at pH 6 and 7, while lower for dispersed adenovirus 40 than dispersed FCV at pH 8 in BDF water. When tested in groundwater, at 15°C and pH 8 to 8.2, the Ct for dispersed adenovirus 40 was higher than for FCV and higher than those observed in BDF water. Both viruses were more sensitive to free chlorine than PV1 (Table 12). Aggregated viruses were significantly more resistant to disinfection with FCV and poliovirus 1 being 31 and 2.8 times more resistant than dispersed virus. Results were compared with the USEPA Guidance Manual for compliance with the filtration and disinfection requirements for public water sources (USEPA Guidance manual 1989) and demonstrated that for dispersed and aggregated virus in BDF water (and dispersed virus in treated ground water) the CT values were close to or lower than the USEPA Guidance Manual (1989) values and those for treated groundwater. As viruses from WW are being targeted, the virus is most likely to be in aggregated form and associated with organic or inorganic matter making it less susceptible to disinfection. Re-evaluation of the USEPA Guidance manual (1989) Ct values is necessary, since they would not be useful for ensuring inactivation of viruses in these states.


Table 12: Predicted Ct values and EPA Guidance Manual ranges for dispersed FCV, AD40 and PV-1 chlorine inactivation experiments in buffered demand free water

(5°C, pHs 6, 7 and 8) Thurston-Enriquez et al., 2003.

pH

Log10

inactivation

CT value/range (mg.min/L)

Dispersed FCV Aggregated

FCV Dispersed

D40 Dispersed PV-1 Aggregated

PV-1

6 2 0.02(<0.04) NAa 0.05(0.04-0.13) 0.93(1.0-2.75) 2.58(2.5-5.0)

3 0.07(0.04-0.08) NA 0.11(0.09-0.17) 2.87(1.0-5.0) 7.60(7.5-2-2.5)

4 0.19(0.11-0.15) NA 0.22(0.17-0.34) 6.36(<10) 16.36(7.5-22.5)

7 2 0.05(<0.08) 1.55(0.25-3) 0.15(0.04-0.17) NAa NA

3 0.06(<0.08) 8.74(5-10) 0.38(0.34-0.85) NA NA

4 0.07(<0.08) 29.60(NOb) 0.75(NOb) NA NA

8 2 0.18(<0.32) NA 0.11(<0.08-0.16) NA NA

3 0.23(<0.32) NA 0.17(0.16-0.23) NA NA

4 0.27(<0.32) NA 0.24(0.16-0.23) NA NA a (experiments not conducted), bamount of inactivation not observed in actual experiment

CV= calicivirus; AD40 = adenovirus 40; PV-1 =poliovirus 1. Predicted CT values is expressed first followed by EPA ranges().

Jensen et al., (1980) investigated methods to achieve dispersed CB5 as dispersed virus has generally been utilised in many disinfection experiments including those by Sobsey et al., (1988). Dispersal is generally achieved through chemical treatment of the virus aggregates and purification through sucrose gradients with high speed centrifugation, allowing separation of the particles based on weight. For CB5, dispersal could only be achieved by incorporating a chemical (diethylaminoethyl dextran) which interacted with chlorine, making it impossible to test the dispersed form of the virus. Many of the enteric viruses have been observed in stool samples as aggregates or complexes (Saif et al., 1978, Narang and Codd, 1981). Viruses appearing to be membrane associated (a form of aggregation) include rotavirus (Williams, 1985; Narang and Codd, 1981), adenovirus, astrovirus, and ‘small round’ viruses (Narang and Codd, 1981) which are frequently shed into the gastrointestinal tract in clumps of variable size. Although single virus particles can be recovered for all of the viruses, CB5 appears to aggregate quickly at all pHs tested (Jensen et al., 1980). Purified CB5 aggregated rapidly at all pH values while other viruses such as CB3 and poliovirus aggregated in the acid range but not at pH 7 and above. Attempts to disperse the virus were unsuccessful except by the addition of diethylaminoethyl dextran, which would react with the chlorine. No data was collected by Jensen et al., (1980) for dispersed CB5. This was not observed for all reports including Liu et al., (1971), that found less than 0.1% of viruses were in an aggregated form for the 20 viruses tested in Potomac water including CB5 and more recently in Black et al., (2008) where the prepared virus was anticipated to be single virions (due to chloroform treatment of the virus), although this was not determined.


1.6 Matrix Effects on Disinfection Ct

A factor of concern in characterising the response of enteric viruses to disinfection processes is the role of the association of viruses with solids in the water. There is considerable evidence that most viruses in water are embedded in or otherwise associated with suspended solids and that such association often interferes with virus inactivation during disinfection. High pH favours free virus while low pH favours adsorbed virus (Hejkal et al., 1979; 1981; Gerba et al., 1980). Gerba et al., (1980) investigated spiking activated sludge with a range of enteroviruses and found the degree of adsorption to be both type and strain dependant. The percentage adsorbed ranged from 77% for echovirus V248 to 99.8% for CB3. Treatment through WW processes aims for the effective removal of particles and as such a great majority of virus is removed through treatment.

Further investigation into the inactivation of HAV was performed by Sobsey et al., (1991) looking at the effects of cell-associated and dispersed HAV in water. Cell associated virus was produced by laboratory culture in cells followed by recovery of the cell monolayer and use directly in experiments. Results for 4 LRV (99.99% inactivation of virus) demonstrated cell associated HAV was about 10 fold more resistant than dispersed HAV to free chlorine at pH 6 (dispersed 2.3 mg.min/L, associated 29 mg.min/L) and 8 (dispersed 2.0 mg.min/L, associated 27 mg.min/L), and about fivefold more resistant at pH 10 (dispersed 19.3 mg.min/L, associated 104 mg.min/L) (Sobsey et al., 1991) (data is provided in Table 13).

Black et al., (2009) demonstrated the 4 LRV values for 4 viruses CB5, echovirus 1, echovirus 12 and poliovirus 1. CB5 was most resistant to free chlorine inactivation (11.5 mg.min/L at pH 7.5 and 22.9 mg.min/L at pH 9), at pH 7.5 and pH 9, although at pH 9 was similar to poliovirus 1 (CT= 22.3 mg.min/L). The cell associated HAV Ct is slightly higher than the Ct required for CB5. The cell associated virus would be more easily removed through the treatment process via sedimentation processes when compared to single virions. The greater resistance to inactivation by free chlorine and monochloramine of cell associate versus dispersed HAV observed in Sobsey et al., (1991) was consistent with previous findings for other viruses including simian rotavirus SA 11 (Berman et al., 1984) and poliovirus 1. The form of the virus as either part of an aggregate (aggregated) or a single virion (dispersed) can explain the conflicting results observed in the literature.


Table 13: Ct values for 99.99 percent inactivation (4 log10) of dispersed and cell associated hepatitis A virus by doses of 0.5mg/L free chlorine and 10 mg/L monochloramine at 5°C in halogen demand free 0.01M phosphate buffers, pH 6-10. (Sobsey et al., 1991).

State of virus Disinfectant pH Ct (mg.min/L) HAV dispersed Free Cl2 6 2.3

HAV cell-associated Free Cl2 6 29 HAV dispersed Free Cl2 8 2

HAV cell-associated Free Cl2 8 27 HAV dispersed Free Cl2 10 19.3

HAV cell-associated Free Cl2 10 104 HAV dispersed monochloramine 8 1225

HAV cell-associated monochloramine 8 1740

Hejkal et al., (1981) noted that small viral aggregates or viruses attached to submicron particles (<0.3 micron) represented the major portion of solids associated virus in treated sewage. This demonstrates the importance of effective disinfection for small aggregates.

From the data presented in the literature, coxsackievirus B5 is currently the most highly resistant known enteric virus as individual virions or clumped viruses. However, when comparing to cell associated HAV, cell associated HAV is more resistant than clumped CB5 to free chlorine disinfection. The level of resistance of the cell associated virus is most likely the level of protection that the cell debris provides the virus while CB5 protection may be due to the clumping or aggregation that occurs naturally for the virus which allows protection of the virus within the aggregate. If virus is associated with cellular material and particles, it may be more readily removed by treatment processes where exclusion, coagulation or precipitation occurs, leaving non cell associated virus in the waste stream. Thus, measuring the Ct value for cell associated virus would be unduly conservative. It is thus suggested that CB5 single particles and small aggregates of less than 4 particles (this would not occlude the disinfectant achieving contact with the particles within the aggregate) be used for Ct value establishment for recycled water in place of dispersed HAV. What is not considered within this scope is the potential for the production of greater disinfection by-products.

1.7 Use of Laboratory versus Environmental Virus to Derive Ct Values

A number of researchers have investigated the potential for the isolation and use of non-laboratory cultured (or minimally cultured) viruses rather than long term laboratory cultured viruses which can show greater susceptibility to disinfection (Payment et al., 1985, Shaffer et al., 1980).

Payment et al., (1985) investigated the disinfection of chlorine resistant strains of coxsackievirus and poliovirus isolated from chlorinated drinking waters and chlorinated


sewage and compared this to laboratory cultured strains of the same viruses. Results demonstrated CB5 isolates were more resistant to chlorine than coxsackievirus B4 (CB4), followed by poliovirus 1, 2 and 3 (PV1, PV2 and PV3) in order of decreasing resistance to chlorine (Table 14). The comparison of laboratory strains with environmental virus (limited culture to derive adequate numbers for tests) showed environmental CB-5 (isolated from chlorinated sewage) was more resistant than the laboratory strain tested. There was no further investigation to determine the differences between the viruses. The other environmental isolates tested, including coxsackievirus B4 and poliovirus 1, 2 and 3, were no more resistant to chlorine than their equivalent laboratory strains (data is presented in Table 11). The initial chlorine concentration was 0.4-0.5mg/L free available chlorine, and final chlorine concentrations was 0.4 mg/L at 100 mins and 0.1 mg/L at 16 hours. CT, LRV and % inactivation of the viruses has been estimated based on the data provided. Comparison is made difficult as there is a single value for each time point provided in the data. The Cts are generalised and LRV’s are variable.

1.8 Virus selection matrix for chlorine disinfection

Considerations for the target virus of interest outlined the selection of HAV for the US EPA Guidelines, although it was not the most resistant virus. A decision matrix (Table 15) has been based upon heath impact, presence in Australia and Australian sewage (where information is available), the culturability of the virus, whether a type strain is available, and the current standing in level of resistance of the virus. For chlorine based disinfection, and based on the frequency of gastroenteritis events, Calicivirus, (norovirus) is the virus group of interest. As there is no standardised culture method, it was eliminated from selection. Adenoviruses were found to all have low levels of resistance to chlorine and were eliminated. The methods for the culture and enumeration of Astrovirus are not well established and this was eliminated. In Australia, HAV has a low disease burden in the community. The level of chlorine resistance is moderate and it was decided that a virus with either greater disease burden or higher resistance to chlorine be investigated. HEV prevalence is Australia is extremely low and more significant in developing countries. The reoviruses (reovirus 1, 2 and 3) all have relatively low resistance to chlorination and do not impart a disease burden on the community. Rotavirus, although it causes significant amounts of disease in the community, as no suitable culture method is available.

The enteroviruses make up a large range of viruses causing disease in the community with a number of significantly chlorine resistant viruses such as the coxsackieviruses, echoviruses, polioviruses and enteroviruses (68-71). Of this group, the level of resistance to disinfection varies considerably; there are culture methods available for many of the viruses. CB5 has been selected as the most chlorine resistant virus because it is present in Australian WW, the methods are available for enumeration and culture, and it has a high level of resistance to chlorine (this ensures all other viruses will be effectively disinfected on inactivation of CB5). It should be noted, however, that it is currently not known to cause a high disease burden in the population.


Table 14: Virus survival after 1, 10, 100, and 1000 minutes of contact with an initial concentration of 0.4mg free residual chlorine per litre (pH 7, in 0.01M CaCl2, 5°C)(Payment et al., 1985). Virus stocks were prepared without a chloroform step and it has been assumed that some of the virus would be aggregated. The initial chlorine concentration was 0.4mg/L which was maintained up to 100 minutes, at the 16 hour time point (1000 min) the chlorine concentration was 0.1mg/L. % reductions, LRV’s and Cts were not provided in the article and have been estimated as follows: % reduction= Nt/No x100; LRV= Log10 Nt/No; Ct=chlorine concentration at time (where a result was achieved) x time (minutes).

Virus source

% survival after min contact:

1 10 100 1000 Est. % reduction

Est. LRV

Est. Ct (mg.min/L)

Coxsackievirus B5 raw sewage 83.33 70 21.67 0.079 99.92

3.1

100***

Coxsackievirus B5 chlorinated water 78.43 60.78 11.77 0.053 99.95

3.27

100***


3.38

40***

Coxsackievirus B5 laboratory 19.82 1.44 1.22 <0.001 98.8

1.95

40**

Coxsackievirus B5 laboratory 19.82 1.44 1.22 <0.001 99.99

5

100**

Coxsackievirus B4 treated sewage 3.92 1.62 0.74 0.012 99.99

3.92

100***


3.85

100***


3.89

100***

Coxsackievirus B4 laboratory 4.7 0.79 0.025 0.016 99.98

3.80

100***


3.96

100***

Poliovirus 1 raw sewage 10.49 0.9 0.029 0.014 99.99

3.85

100***

Poliovirus 1 Mahoney laboratory 8.95 0.72 0.029 <0.001 99.97

3.53

40**

Poliovirus 1 Sabin laboratory 1.17 0.023 0.004 <0.001 99.99

4.39

40**

Poliovirus 1 raw sewage 0.87 0.009 <0.001 <0.001 99.99

4.05

4**

Poliovirus 2 chlorinated water 0.96 0.1 0.033 <0.001 99.97

3.48

40**

Poliovirus 2 chlorinated water 1.33 0.092 0.02 0.002 99.98

3.69

100***

Poliovirus 2 MEF-1 laboratory 1.23 0.09 0.01 <0.001 99.99

4.0

40**


4.22

40**

Poliovirus 2 chlorinated water 1.13 0.021 <0.001 <0.001 99.98

3.68

4*


3.95

4*


5.0

4*

Poliovirus 3 raw sewage 7.14 0.024 0.019 <0.003 99.98

3.72

40**


4.0

40**

Poliovirus 3 Saukett laboratory 5.87 0.004 <0.003 <0.003 99.96

4.39

4*


4.5

4*

Poliovirus 3 raw sewage 0.13 <0.003 <0.003 <0.003 99.87

2.88

0.4

Poliovirus 3 chlorinated water 0.42 <0.003 <0.003 <0.003 99.58

2.38

0.4


3.22

0.4


3.40

0.4


3.22

0.4


Virus source % survival after min

contact:

1 10 100 1000 Est. % reduction

Est. LRV

Est. Ct (mg.min/L)


3.52

0.4

Poliovirus 3 chlorinated water 0.08 <0.003 <0.003 <0.003 99.92 3.09 0.4

Poliovirus 3 chlorinated water 0.01 <0.003 <0.003 <0.003 99.99 4.0 0.4 * calculation based on % survival at 10 minutes, ** calculation based on % survival at 100 minutes, *** calculation based on % survival at 1000 minutes.


Table 15: Decision matrix for selection of virus for chlorine based disinfection experiments (level of resistance Low, Medium and High; NT=not tested) Virus Health Impact Presence in

Australia/sewage Culturability Type strain

available Level of resistance to chlorination (L, M, H)

Decision on use

Adenovirus 40 41 Others (incl. type 2, 3, 7a, 12)

Gastroenteritis Gastroenteritis Upper respiratory tract infections, can be shed in faeces for long periods

Y Y y

Y Y Y

Y Y y

L- highly susceptible

No, causes gastro and present in sewage but highly susceptible to chlorine

Astrovirus Gastroenteritis low severity and shorter duration than rotavirus

Y Y but more often detected by PCR

Y M No, culture method not well established

Calicivirus Norovirus Sapovirus

Gastroenteritis, severe disease but short duration, causes approx 10% or more of all gastro in community. Feline calicivirus used as surrogate Milder gastroenteritis

Y Y N

N detected by RT-PCR N detected by RT-PCR Y

N Y Y

Not tested L Not tested

No, culture method not available for noroviruses or saporoviruses No,surrogate rather than human virus. No, no culture method available

Enterovirus Coxsackie A and B virus (A9,B1, B3, B4 and B5)

Low-Hand foot and mouth disease in children, gastrointestinal distress

Y

Y

Y

CA5 H CA9 L CB1 L CB3 M CB4 H CB5 H

Yes, CA5, CB4, and CB5 and all high level resistance


Enterovirus 68-71 Echovirus (1,5, 7,11, 12, 29) Poliovirus (1, 2, 3)

71 non gastroenteritis infection but shed in faeces up to 2 months, hand foot and mouth, epidemic conjunctivitis Acute fever in infants Fever, fatigue, headache, muscle and joint pain, majority of cases asymptomatic,

Y Y Yes but v low levels due to vaccination program with inactivated virus, previously higher with attenuated virus vaccine

Y Y Y

Y Y Y

Not tested 1, 5, 7, 9, 11, 29 L 12 H M

so far untested No, Significantly lower Ct than CB5 No, no longer problematic due to vaccination program, other viruses more significant

Hepatitis A virus 300-500 cases annually in Australia, numbers declining since 1990’s. Chronic infection.

Y Y cell culture with Radioimmunoassay (RIA)

Y L-M No, not major disease burden in Australia; less resistant than CB5

Hepatitis E virus Emergent in developing countries, 10-30 cases annually in Australia. Acute illness

Untested in Australia but disease prevalence is so low, numbers in sewage would be low

Serological and RT-PCR. No culture

N No, not major disease burden in Australia; no culture methods available


1.9 Models for the analysis of disinfection data for chlor(am)ines

Microbial inactivation is generally expected to increase in a log-linear fashion as the disinfectant dose increases, as per first-order Chick-Watson kinetics described by the following equation:

Nf=Nie-kD

Where Nf is the number of surviving organisms, Ni the initial number of organisms prior to disinfection, k the inactivation rate coefficient, and D the disinfectant dose. However, microbial inactivation does not always conform to log-linear or first-order kinetics. Under optimal chemical and physical conditions, maximum disinfection efficiency is reached when disinfectant agent has unhindered access to the target organisms. However, particulate matter may interfere with this process, whether by acting chemically to create a disinfectant demand or by physically shielding the organism from the disinfectant. This results in a tailing effect on the inactivation curve. It is also thought that small microorganisms such as viruses may gain greater protection than larger organisms at lower turbidity conditions and from smaller particles (Templeton et al., 2008).

Efficiency factor Hom model (described by Thurston Enriquez et al., 2005) is an analytical approximation of the incomplete gamma Hom model and is used to describe disinfection kinetics by using mathematical functions available in commonly used computer packages such as Microsoft Excel (Microsoft Corp.). The disinfection kinetics are determined using viral most probable number values for each experiment, grouped by virus type, pH, and temperature conditions and are fitted into the EFH model equation:

lnN/No= -kCotm x [1-exp(-nk’t/m)(nk’t/m)]

Where:

t is the exposure time (min),

k is the viral inactivation rate constant,

n is the coefficient of dilution,

k’ is the first order disinfectant decay rate constant (per min), and

m is the constant for the inactivation rate law which describes deviation from ideal Chick-Watson kinetics.

lnN/No is the natural log of the survival ratio.

1.10 Chloramine based Disinfection

1.10.1 Chloramine formation

Chloramines are formed by the reaction of ammonia with aqueous chlorine (i.e. HOCl). The mixture that results may contain monochloramine (NH2Cl), dichloramine (NHCl2) or nitrogen trichloride (NCl3). In aqueous solutions with pH 7.0-8.5, HOCl reacts rapidly with ammonia to form inorganic chloramines in a series of competing reactions. These competing reactions


are primarily dependant on pH and controlled to a large extent by the chlorine:ammonia nitrogen (Cl2:N) ratio.

1.10.2 Temperature effects on chloramine disinfection

Similar to chlorine based disinfection, the viral inactivation efficiency of chloramines increases with increasing temperature. Moreover, the efficiency dramatically decreases under conditions of high pH and low temperature. The inactivation of poliovirus 1 was two to five times slower at 1-5°C than at 22-25°C with chloramines in buffered demand free water (Kelley and Sanderson, 1958). From the data presented in Table 4, increasing temperature results in a decreased Ct.

1.10.3 pH effects in chloramine disinfection

Disinfection efficacy of chloramines(s) is affected by a number of environmental factors including pH, temperature and organic nitrogen (or other interfering compounds) presence. The effect of pH controls the chloramines species distribution as demonstrated in Figure 2. At low pH (less than pH 2) nitrogen trichloride domaintes the species present. Dichloramine species dominate from pH 3-5.5 and at pH 6-8 and above, monochloramine predominates. Disinfection in WW treatment plants is operated between pH 6 and 8, allowing the dominant chloramines species of monochloramine to be present at the highest concentration. The relative potency of monochloramine is likely to be a function of hydrolysis and thus has a slow rate of diffusion through the cell wall. As a result the rate of inactivation is much slower when compared to free chlorine. The other chloramines species dichloramine> trichloramine> organic chloramines are less effective than monochloramine and are pH dependent at pH levels ranging from pH 1 to 7 making them unstable in wastewater effluents.


Figure 2: Distribution diagram for chloramines species with pH.

1.11 Chloramine disinfection of viruses in WW

Where chloramine is used as the disinfectant of choice in a drinking water disinfection process, chlorine is added prior to ammonia dosing and this provides a very short time for free chlorine inactivation of viruses that are resistant to chloramines. This includes viruses such as rotavirus that are highly resistant to chloramines (Berman and Hoff, 1984). The USEPA Guidance Manual for compliance with the filtration and disinfection requirements for Public Water sources (USEPA 1989) and USEPA Disinfection Profiling and Benchmarking Guidance Manual (1999) also include disinfection based on chloramines with requirements presented in Table 4. The contact times for chloramines are considerably longer than those for free chlorine as it is a slower acting disinfectant.

1.11.1 Chloramime Ct Values Used in the USEPA Guidance Manual for compliance with the filtration and disinfection requirements for Public Water sources (1989) and USEPA ‘Disinfection profiling and benchmarking guidance manual’ (USEPA 1999)

The chloramine Ct values for viruses are presented in Table 4 with the data being generated by Sobsey et al., (1988) (see Table 16). The guideline data were established with dispersed HAV in 0.01M phosphate buffered demand free water at 5°C and monocloramine residual of 10mg/L. As for chlorine based disinfection, operation at higher temperatures provides greater disinfection capabilities and faster disinfection kinetics. No safety factor was applied


to the results as it is generally understood that field application of chloramines is much more effective than laboratory based assays due to the instability of monochloramines in laboratory situations (USEPA Guidance Manual 1989). In many WW treatment plants, ammonia is already present, so on addition of chlorine, chloramines are formed rapidly, precluding exposure to free chlorine. Initial experiments in this project using the addition of free chlorine to wastewater containing ammonia and inoculated with cultured virus demonstrated extremely rapid inactivation of the virus demonstrating that a short exposure to high doses of free chlorine in the presence of ammonia can still result in viral inactivation.

1.11.2 Relative resistance of viruses to chloramination

A summary of the data available for monochloramine disinfection is provided in Table 16. The data is somewhat limited as the majority of the work has concentrated on chlorine based disinfection. As monochloramine is a slower acting form of disinfection, the contact times are significantly longer than observed for chlorine. The species of chloramines were not investigated in any of the publications. The results at pH 8 demonstrated that cell associated HAV was more 1.4 times more resistant to monochloramine than dispersed HAV with the Ct value for dispersed HAV being 1170 mg.min/L and that for cell associated HAV being 1740 mg.min/L (Sobsey et al., 1991). CB5 was shown to be slightly more susceptible to chloramines than HAV, while the reverse applies for resistance to free chlorine. MS2 bacteriophage showed considerably higher resistance (3.4x) to monochloramine than HAV. There was no insight in to why this occurred (Sobsey et al., 1988), although it was noted that the results were consistent with previous research. Rotaviruses have been noted to be highly resistant to monochloramine based disinfection and simian rotavirus was significantly (>3.3x) more resistant than HAV with a Ct of >4000mg.min/L. Norovirus showed a similar susceptibility to chloramination as HAV.

Sirikanchana et al., (2008) utilised 0.01M phosphate buffered saline at pH 8 and 0.01M borate buffered saline at pH 10 to investigate the effect of pH, temperature, disinfectant concentration and ammonia to chlorine molar ratio on the inactivation kinetics of adenovirus serotype 2 with monochloramine in batch reactor experiments. Adenovirus 2 was selected as a model for other adenoviruses (40/41) due to its simpler culture method and comparable UV resistance. The virus causes a respiratory infection but can be shed in faecal material and has been found in untreated WW. Adenovirus 40 and 41 cause gastrointestinal upsets with the virus shed at high rates in faecal material. The virus preparation ensured individual virus particles were utilised in the experiments as removal of aggregates would occur through the 0.45 micron filter step (due to the size of the virus (up to 100 nm in diameter). The inactivation kinetics were independent of monochloramine concentration and ammonia-to-chlorine molar ratio, but had strong pH dependence, with the rate of inactivation decreasing with increasing pH. The kinetics at pH 6 and 8 were consistent with pseudo first order kinetics, while curves at pH 10 were characterised by a lag phase followed by pseudo first order kinetics. The results demonstrated that adenovirus 2 was more resistant to chloramines based disinfection than the other reported virus.

Recently, Cromeans et al., (2010), demonstrated echovirus 11 was more resistant to monochloramine disinfection than adenovirus 2 (see Table 15) at pH 7, while at pH 8,


adenovirus 2 was more resistant than echovirus 11. All other enteroviruses had low levels of resistance to monochloramine disinfection (Ct< 510 mg/L.min) for 2 log inactivation at pH 7, 5°C).

Although adenovirus 2 causes respiratory symptoms, rather than gastrointestinal effects such as adenovirus 40 and 41 which are shed in faeces, the level of resistance of adenovirus 2 to chloramines is significantly higher than that of other waterborne viruses. Adenovirus 2 is more resistant to chloramines than HAV cell associated virus, HAV dispersed virus and CB5. Selection of adenovirus 2 as the virus of choice for determining the Ct values would ensure disinfection was conservative for all known viruses. The potential issue with this is the increase in disinfection by-product formation e.g. nitrosamines, due to the higher doses of chloramines applied to the water.

1.11.3 Effect of virus aggregation versus dispersal on chloramine Ct

Two reports tested the sensitivity of cell associated and dispersed viruses to monochloramine (Table 16). The results demonstrate that Ct values for cell associated rotavirus and HAV were higher than those observed for the dispersed viruses, 1.5 x for HAV and 1.42x for rotavirus respectively (Sobsey et al., 1991 and Berman and Hoff, 1984).


Table 16: Summary of virus inactivation by monochloramines.

State of virus Water

Initial NH3Cl conc (mg/L) pH Temp °C

# log10 inactivation

Time (Min)

CT (mg.min/L) Reference

HAV Disperse

0.01M PB HDFRW 9.7 8 5 4 116 1225 Sobsey et al., 1991

HAV cell assoc

0.01M PB HDFRW 10.2 8 5 4 170 1740 Sobsey et al., 1991

HAV Disperse 0.01M Buffer 10 8 5 4 117 1170 Sobsey et al., 1988

CB5 Disperse 0.01M Buffer 10 8 5 4 104 1040 Sobsey et al., 1988

MS2 Disperse 0.01M Buffer 10 8 5 4 420 4200 Sobsey et al., 1988

Øx174 Disperse 0.01M Buffer 10 8 5 4 31.4 314 Sobsey et al., 1988

Simian rotavirus Disperse

0.05M buffer 9.98-10.6 8 5 2

6.75 hours 4050

Berman and Hoff, 1984

Simian rotavirus cell assoc

0.05M buffer 9.78-10.28 8 5 2

10.2 hours 6120

Berman and Hoff, 1984

Norwalk virus Disperse 0.01M Buffer 2 8 5 2

6.45 hours 775

Shin and Sobsey 1998

Murine Norovirus Disperse

0.01M buffer 1 7 5 2 26

Cromeans et al., 2010


0.01M buffer 1 7 5 3 70



0.01M buffer 1 7 5 4 150


poliovirus 1 Disperse 0.01M Buffer 2 8 5 1 180 360


MS-2 Disperse 0.01M Buffer 2 8 5 1 180 360


Adeno 2 Disperse 0.01M PBS 1-11 8 10 2

20s-18h ≥1500

Sirikachana et al., (2008)


20s-18h ≥2200



20s-18h ≥2900



20s-18h ≥600



20s-18h ≥900



20s-18h ≥1200


Adeno 2 Disperse 0.01M BBS 1-11 10 10 2

20s-18h ≥6800



20s-18h ≥9000



20s-18h ≥11200



20s-18h ≥2900



20s-18h ≥3900



20s-18h ≥4800


Adeno 2 disperse 0.01M buffer 1 7 5 2 600


Adeno 2 disperse 0.01M buffer 1 7 5 3 1000



State of virus Water

Initial NH3Cl conc (mg/L) pH Temp °C

# log10 inactivation

Time (Min)

CT (mg.min/L) Reference

Echo 11 disperse 0.01M buffer 1 7 5 2 1000








Key: PBHDFRW=phosphate buffered halogen demand free river water, PBS= phosphate buffered saline. BBS= borate buffered saline.

1.11.4 Virus selection matrix for chloramines experiments

The selection of a target virus for chloramine based disinfection has been summarised in Table 17 using the same criterion as outlined for chlorine. Ideally, the virus of choice would be the virus causing a high disease burden in the community, but due to lack of culturability, norovirus cannot be tested. Chloramine based Cts have not been established for many of the viruses. Based on the culturable viruses, with a moderate to high level of resistance to monochloramine, adenovirus 2 (high resistance), echovirus 11 (high resistance, variable at different pHs), HAV (moderate resistance) and CB5 (moderate resistance) are potential candidates. Adenovirus 2, although a respiratory disease, is shed in faeces for up to 2 months and due to its high level of resistance to chloramination has been selected as the target virus in this project.


Page 52

Table 17: Chloramination decision matrix for viruses (level of resistance Low, Medium and High or NT=not tested)

Virus Health Impact Presence in Australia/sewage

Culturability Type strain available

Level of resistance to chloramination (L, M, H)

Decision on use

Adenovirus 40 41 Others (incl. type 2, 3, 7a, 12)

Gastroenteritis Gastroenteritis Upper respiratory tract infections, can be shed in faeces for long periods

Y Y Y

Y Y Y

Y Y Y

40 L 41 L 2 H

No-Ad40 and 41 have low resistance to chloramination. Yes-Adenovirus 2 is highly resistance and can be shed in faeces for long periods

Astrovirus Gastroenteritis low severity and shorter duration than rotavirus

Y Y more often detected by PCR

Y NT No- short duration disease, culture method not well established

Calicivirus Norovirus Sapovirus

Gastroenteritis, severe disease but short duration, causes approx 10% or more of all gastro in community. Murine norovirus used as surrogate Milder Gastroenteritis

Y Y N

N detected by RT-PCR N detected by RT-PCR Y

N Y Y

NT L NT

No- culture method not available for noroviruses or saporoviruses No - no surrogate other than human virus No- no culture method available





Decision on use

Enterovirus Coxsackie A and B virus (A9,B1, B3, B4 and B5) Enterovirus 68-71 Echovirus (1,5, 7,11, 12, 29) Poliovirus (1, 2, 3)

Hand foot and mouth disease in children, gastrointestinal distress 71 non gastroenteritis infection but shed in faeces up to 2 months Acute fever in infants Fever, fatigue, headache, muscle and joint pain, majority of cases asymptomatic,

Y Y Y Y but v low levels due to vaccination program with inactivated virus, previously higher with attenuated virus vaccine

Y Y Y Y

Y Y Y Y

CB3 L CB5 M Not tested 1 L 11 H L

No, not highly resistant to monochloramine No, not highly resistant to monochloramine Unknown level of resistance to monochloramine. Does not cause gastroenteritis. Echo 11 possible No, no longer problematic due to vaccination program, other viruses more significant.

Hepatitis A virus

300-500 cases annually in Australia, numbers declining since 1990’s. Chronic infection.

Y Y cell culture with Radioimmunoassay (RIA)

Y M No, Low disease burden





Decision on use

Hepatitis E virus

Emergent in developing countries, 10-30 cases annually in Australia. Acute illness

Untested in Australia but disease prevalence is so low, numbers in sewage would be low

Serological and RT-PCR. No

culture

N Not Tested No, Not significant in Australia

Reovirus Reovirus 1, 2 or 3 Rotavirus

Common asymptomatic, role in disease is unclear Major cause of gastroenteritis in children. Vaccination introduced in 2007 (live virus)

Y Y

Y RT-PCR no culture available Simian rotavirus can be cultured as a surrogate

Y Jones, Lang and Dearing

type strains

Y Y- one Tissue Culture adapted

Not tested Not tested H

No, Not significant disease burden Chloramine resistance unknown No, No culture method; Chloramine resistance unknown No, Not human pathogen; Indicator rather than pathogen and animal not human host


Page 55

1.12 Effect of particulates and turbidity on disinfection

As previously discussed, studies have shown that viruses are often observed as aggregates in faecal material or frequently attached, enmeshed, or suspended in particles in WWs and this virus-particle association can impede disinfection processes in some instances. While WW treatment processes aim to physically remove particulates upstream of disinfection, particles and particle associated viruses may still be present due to the size of the aggregate due to upset conditions or due to practical design limitations of the particle removal processes. The types of particles present in WWs may be organic, or inorganic with, some particles being colloids. Colloidal particles comprise a large proportion of turbidity causing substances in water (Templeton et al., 2008). In WW, total suspended solids measurements are typically used to measure particulate content while in drinking water turbidity is used as an indicator of the removal of a range of particulates. Studies have assessed the link between particle removal and pathogen removal. The reduction of turbidity and particle count is not linked to the removal of pathogens such as Cryptosporidium by water treatment processes (Le Chevalier et al., 1991) or to virus removal (Rose et al., 2004).

The size, type and concentration of particles in water can have a profound effect on turbidity (Berman et al., 1988). Small particles (<0.1 µm in diameter) do not scatter visible light effectively, so water could contain large numbers of small particles but still give a low turbidity reading. The size of larger particles (0.1-0.8 µm), such as clays or plankton, is near the wavelength of visible light (0.4-0.8 µm). These particles scatter light more efficiently and yield higher turbidities. Edzwald (1983) showed that 50mg/L of kaolinite (0.2-0.4 µm) gave a turbidity of around 80 NTU, while 50mg/L of humic acid (5,000-100,000 dalton) gave a turbidity reading slightly above 3 NTU. In drinking water, Hoff and Akin (1986) reported that poliovirus associated with either bentonite (7.1 NTU) or aluminium phosphate (5 NTU) was inactivated by chlorine at the same rate as unassociated virus (0.15-0.28 NTU). However cell associated poliovirus was protected from chlorine inactivation. Berman et al., (1988) investigated the inactivation of particle associated coliforms by chlorine and chloramines in primary sewage. Indigenous coliforms in the <7 µm fraction were inactivated more rapidly at pH 7 with 0.5 mg/L chlorine at 5°C than coliforms associated with the > 7 µm fraction. With 1 mg/L monochloramine at 5°C and pH 7, particle size had no appreciable effect on the rate of inactivation. At pH8 however, the <7 µm fraction was inactivated more rapidly than the >7 µm fraction. Time required for 2 log10 inactivation of the coliforms with chloramine was 20-50x that required for chlorine based disinfection. Coliforms were inactivated more rapidly with chlorine than the slower acting chloramines, but some level of protection was observed in the >7 µm particles.

Homogeneity of the sample was also investigated by Berman et al., (1988) who showed greater numbers of coliforms were detected as a result of breaking apart the >7 µm particles by homogenising the sample thoroughly. Homogeniety has also been observed for enteroviruses by Hejkal et al., (1981), where 97% of the viruses in unchlorinated effluent was grouped as either free or associated with particles of <0.3 µm. In this study a threefold increase in virus titer was observed in virus titer upon sonication of particles suggesting that


small aggregates were of importance and viruses are not just cell associated but form particulate associated aggregates.

Further work investigated the effects of turbidity on the disinfection of purified (single virions) and aggregated HAV, PV1 and echovirus 1 using chlorine demand free water and the same water with 10 mg/L of a 1:1 mixture fulvic and humic acids and bentonite and 1-7 mg/L free chlorine (Sobsey and Alexander, 2002). HAV was rapidly inactivated under all conditions with 4 log10 inactivation achieved in <8 minutes. Four log10 of PV1 and echovirus 1 was also rapidly inactivated at pH 4.5 and 7. However, at pH 9.5 and 5°C, PV1 and echovirus 1 were inactivated more slowly than HAV by a 1 mg/L dose of free chlorine with an inactivation time of > 57 minutes. This study did not investigate why PV1 and echovirus were inactivated at a much slower rate under these conditions but showed that the viruses tested could be adequately inactivated in presence of excessive amounts of dissolved and colloidal organic matter and turbidity .

Generally water is not supplied at high pH values >8.5 hence this finding is not of much importance for disinfection of recycled water. Virus inactivation by free chlorine was similar in the phosphate buffered demand free water and substance modified waters, indicating that humic and fulvic acids and clays do not appreciably reduce chlorination efficacy against enteric viruses. What is limiting in the research is the effect of faecal based compounds, more likely to be present in wastewater, that may not behave like the clays and humic acids encountered in the environment from which drinking water is generally sourced. Results demonstrated the decreasing sensitivity to disinfection by free chlorine with HAV more sensitive than echovirus 1 which in turn is more sensitive than PV1.

The mechanism of particle and virus interaction is a complex process involving the isoelectric point of the virus of interest and the particulate matter, the pH of the solution and the hydrophobicity of the particles. The isoelectric point of a range of viruses is given in Table 16 which, while using different test methods, still shows that there is little predictability in the isoelectric point for an enteric virus group and, as such, a single virus type cannot be used to assess viral removal or inactivation of that group through the treatment processes. At a characteristic pH, defined as the isoelectic point (Ip), the virus has a zero net charge and is more likely to aggregate or attach to a particle. Viruses will be positively charged below their isoelectric point while above that pH, the virus will have a negative charge (Templeton et al., 2008). In general, high pH favours free virus and low pH favours adsorbed virus, although isolectric points of both the virus and the particle surface play roles in the interaction (Gerba, 1984). The Ip of poliovirus strains varies widely from 4.5-8.2 which may result in varied removal of the virus though conventional treatment processes. For the human infectious viruses the range is 3.8-8.2 while the bacteriophage (as potential indicators for human infectious viruses) range from 3.9-9.0.


Table 16: Isoelectric points of Waterborne Viruses and common solids Virus Virus Type pH of Isoelectric point (Ip)

Reovirus 3 Mammalian 3.8, 4.0 Vaccinia Mammalian 3.9, 4.8 Coxsackie A21 Mammalian 4.8, 6.1 Poliovirus type 1 (Brunhilde) Mammalian 4.5, 7.0 Poliovirus type 1 (Mahoney) Mammalian 8.2 Echovirus 1 (V248) Mammalian 5.0 Echovirus 1 (V212) Mammalian 6.4 Tobacco mosaic virus Plant 3.8, 4.1 MS2 Bacterial phage 3.9 T2 Bacterial phage 4.2 T4 Bacterial phage 4.2 Qβ Bacterial phage 4.1, 5.3 Fr Bacterial phage 9.0 Solids Solids type pH of isoelectric point (Ip)

Quartz Mineral 2.0-3.5 Kaolinite Mineral 2.0-4.6 Humic matter Organic <3.0 Cellulose nitrate Filter material 1.5-2.0 Note: More than one Ip value shown for the same virus strain reflects results of different pI measurement methods. From Templeton et al., (2008), modified from Fuhs and Taylor, (1982), Gerba (1984) and Sakoda et al., (1997).

Added to this is the mode of interaction of the virus with the particle depending on how the virus orientates when associating with the particle (ie head- or tail – attached to particle). Studies have shown that viruses are already associated with faecal material and other particles in WW (Hejkal et al., 1979 and 1981). The distribution of solids-associated viruses in WW was studied to determine the effect of treatment processes (activated sludge, clarification and disinfection) on viruses associated with solids (Kejkal et al., 1981) in a full scale process. Significant removal of virus associated particles was observed across the ASP for particles greater than 0.3µm. The remaining virus i.e. that not removed by the activated sludge process, was associated with particles smaller than 0.3µm, which can include those in viral aggregates or associated with submicron solids. Resistance to disinfection with chlorine was evident and attributed to protection due to association with the particulates or viral aggregates. Disinfected samples were sourced from the treatment plant and had a residual of 1.5mg/L total chlorine with a contact time of 15-20 mins (Kejkal et al., 1981) with the resultant LRV being 0.74 of enteroviruses and Ct estimated at 22.5-30 mg.min/L.

The impacts of particles in WW on disinfection processes has been investigated for a wide range of processes, most commonly chlorine and ultraviolet light (UV). All disinfectants rely on the ability of the chemical molecule (or photons in the case of UV) to come in contact


with the target organism. If the contact between the disinfectant and the organism is reduced or prevented, e.g. if the virus is contained within a particle, microbial aggregate or cell membrane associated aggregate, then disinfection may be impeded. Under optimal chemical and physical conditions, maximum disinfection efficacy is reached when the chemical agent has unhindered access to the target organism. However, in WWs, particulate matter may interfere with the process, either by acting chemically to create a disinfectant demand or by physically shielding the organism from the disinfectant (Haas et al., 1996; Stewart and Olsen, 1996). Due to the size of the viruses, it is anticipated that protection from disinfection would be greater than compared to larger microorganisms such as bacteria (Templeton et al., 2008).

1.13 Effect of increased ionic strength on disinfection efficacy

The effect of ionic strength on disinfection efficiency was demonstrated by Jensen et al., (1980) in the inactivation of coxsackievirus B3 and B5. The addition of 0.1M NaCl to the buffer at pH 6 did not influence aggregation of CB5 or the rate of chlorine action on either CB3 or CB5. However at pH 10, it increased the disinfection activity of OCl- for both viruses by roughly 20-fold. Interestingly KCl was the most active of the chemicals trialled including NaCl, KCl and CsCl making the inactivating effects of OCl- at pH 10 about the equivalent to that of HOCl at pH6. Increased salt concentration (0.1M NaCl) also aided in preventing or slowing virus clumping (Sharp et al., 1980).

1.14 Summary

1.14.1 Reason for need to develop additional guidelines for recycled water.

Guidelines for the inactivation of waterborne viruses using chlorine based disinfection were developed based for potable waters having a turbidity of <1 NTU. Due to the effects of an extended drought/climate change, greater emphasis has been placed on recycling of WW and stormwater for a wide range of applications including agriculture, home garden irrigation, and toilet flushing, and potentially potable reuse. This reuse of WW requires the implementation of effective barriers for the removal or inactivation of pathogenic microorganisms present within the water where potential exposure to the public may occur. This therefore requires that the chlorine based disinfection processes be effective in achieving the required log10 inactivation of viruses in water despite the water frequently having a turbidity of >1NTU, which may have negative consequences for effective disinfection efficiency due to the presence of particles that could protect viruses from effective disinfection. This has not been fully investigated for recycled waters and requires the establishment of Cts specifically for this purpose.


1.14.2 Addition of viruses is necessary to establish Ct values.

Ideally, indigenous viruses in recycled waters would be targeted to determine the Cts required for effective disinfection. The numbers of viruses present in WW is dependent on the level of infection within the community, seasonal affects for individual viruses, and the level of treatment applied to the WW. Treatment of WW to a particular quality may involve primary grit removal and settling, activated sludge treatment and disinfection or application of additional tertiary treatment processes such as lagoon treatment, media or membrane filtration, dissolved air flotation filtration, UV or ozone, to name a few. By increasing the number of processes in the treatment train, the quality of the water can be improved, however the necessity for this is dependent on the final use of the water i.e. the water must be fit for purpose. This, therefore effects the number of viruses present in the treated WW (which would be further treated by disinfection) and in most cases renders it too low to allow effective determination of the disinfection log10 reduction values that may be achieved. Thus, from the information presented, the recommendation is for the addition of laboratory cultured virus prior to disinfection as indigenous viruses will not be present in sufficient quantities to allow for 4 log10 inactivation to be determined.

1.14.3 Choice of target virus for establishing Ct values

From the data presented within this review, it is apparent that Coxsackievirus B5 is to date the most resistant enteric virus to free chlorine tested to date, but its’ resistance to chloramines is similar to monodispersed HAV. Adenovirus 2 (a respiratory virus) is to date the most resistant virus to chloramines. By selecting CB5 as the virus to determine free chlorine and adenovirus 2 for monochloramine, the Cts generated within this project, it will be ensuring all other known enteric viruses have been appropriately inactivated when using chlorine and chloramine disinfection. For chloramines disinfection, it is understood that laboratory scale production of monochloramine is less effective than full scale application in a WW treatment plant. Therefore selection of a less resistant virus such as CB5 may be suitable for determining chloramines Cts. This needs to be balanced against the Ct requirements in the field, the cost of application of the disinfectant at a potentially higher dose, the formation of chlorine disinfection by-products, the involvement of the virus in water incidents, the seriousness of the illness caused by this virus, and the levels of virus shed in faeces. HAV was selected in the USEPA Guidelines as it fulfilled most of the above criteria and methods were available. Further investigations demonstrated that cell associated HAV was more resistant to chlorine based disinfection than mono dispersed HAV. Rather than using cell associated HAV, monodispersed and small aggregate CB5 could be utilised in the experiments. Choice of CB5 as the test virus could be questioned as it causes foot and mouth disease, a commonly illness generally only occurring in children and having minimal health effects. Its use could only be justified on the basis that it could represent viruses causing more severe illness but for which Ct values have not yet been identified. The conservatism embodied in such an approach could well lead to excessive chlorination and formation of unwanted DBPs.


1.14.4 Use of dispersed virus to establish Ct values

The state of the virus when testing is performed is critical as this can greatly affect the ability of the disinfectant to come into contact with the virus. When viruses are shed from the gastrointestinal tract, virus particles may be monodispersed, cell associated or present in aggregates or clumps. Monodispersed virions are more easily disinfected when appropriate Cts are applied as the disinfectant access to the virus is unhindered but are less effectively removed through physical treatment processes. Cell associated viruses, although having a greater level of protection, would be more easily removed through the treatment process due to the size of the cell associated aggregates. Individual virus particles, are recommended as the target virus form.

1.14.5 Use of laboratory grown virus to establish Ct values

The source of the virus has been demonstrated to be important only for CB5 where minimally passaged virus was tested against longer term laboratory passaged virus for to establish disinfection Ct values. All other longer term laboratory passaged viruses tested had disinfection rates that were similar to that of virus recently isolated from the environment i.e. had experienced minimal laboratory passaging. Because of this and for other practical reasons, it is recommended that laboratory culture CB5 is used to establish Ct values rather than isolating an environmental isolate.

For chloramination experiments, adenovirus 2 is the most chloramine resistant virus tested to date, no Cts have been established for laboratory cultured versus newly isolated virus, it is recommended that a laboratory adenovirus 2 be utilised.

1.14.6 Use of microbial indicators to establish Ct values.

Limited data is available for the potential incorporation of an indicator micro-organism such as MS-2 bacteriophage. MS-2 was shown to be significantly more susceptible to free chlorine and considerably less susceptible to monochloramine than HAV. Another phage tested, øx174, was highly susceptible to chloramination being 4x and 6x more susceptible than dispersed and cell associated HAV respectively. Ideally indicators are more resistant to disinfection than the target virus, hence both of these frequently chosen indicators appear to be unsuitable for this application. MS-2 bacteriophage will be used as a conservative indicator for the chloramine experiments.

1.14.7 Effect of particle association on Ct values.

Due to the presence of particles and turbidity within recycled waters, it is assumed that there will be an effect on disinfection. Although it has been demonstrated that compounds such as clays, humic acids and fulvic acids have no effect on disinfection, the association of the virus with cells, cell debris and viral aggregates is of significance, although it is assumed


these will be more easily removed through flocculation, coagulation or sedimentation processes. Hejkal et al., (1981) investigated the effect of virus sizes and their disinfection efficiency and found variation in size of particles also had an effect on inactivation of viruses from the waste stream. Virus associated with particles < 7 µm diameter were more effectively inactivated than virus associated with the > 7 µm diameter particle fraction. Virus was more frequently associated with particles of <0.3 microns (Hejkal et al., 1981) but on chlorination an increase was observed in virus associated with particles >0.3 microns, most likely due to protection by the particle.

Particle size appears to have no discernable effect on the disinfection effectiveness of monochloramine where extended contact times are required for effective disinfection which allows time for the chemical to permeate the aggregate. As it is not possible to use native virus present within particles for the experimental work, the protective nature of the particles will be assessed using native E. coli.

1.14.8 Proposed Research to fill in gaps

Future work to establish disinfection Ct values for free chlorine and chloramine should use CB5 for free chlorine and adenovirus 2 together with MS-2 bacteriophage for chloramination. It is acknowledged that CB5 does not completely satisfy the chlorine selection criteria (Table 15) in that it does not have a major impact on human health in Australia.

Laboratory cultured virus is considered suitable for use and will be added to the test matrix because indigenous virus numbers will not be sufficiently high to demonstrate the required LRVs.

The pH range to be explored should be 7.0-9.0 as water is unlikely to be supplied outside this range. Values derived for pH 7.0 will be protective for lower pHs.

The temperatures considered should be 10.0°C. Although much of the published experiments were performed at 5°C, the increase in temperature has been selected to establish a reasonable lower operating range for recycled water schemes in winter in Australia.

Chloramine: Cl2:N ratio of 4:1 is typically accepted as optimal for chloramination and this will be utilised in the experimental process. As most WW will already contain ammonia, the experimental set up will include determining the amount of chlorine required to satisfy the ammonia demand, and determine the monochloramine concentration produced in the reaction vessel. Free and total ammonia will be measured using the Hach colourimetric method. The experiments will then utilise additional laboratory prepared monochloramine solution to achieve the required residual of 10mg/L. The monochloramine residual will be monitored over the test period. Five samples will be taken across the incubation period up to 4 hours, dependant on the pH of the solution.

The suspending medium will be Bolivar secondary treated recycled water (prior to disinfection) as the presence of salts can lead to more effective disinfection. The TDS will be


set at 600mg/L using dilution with distilled water to mimic TDS concentrations observed at Victorian recycled water plants

Turbidity effects of 0.2 NTU, 2 NTU, 5 NTU and 20 NTU will be explored. The most conservative way to do this is to add turbidity concentrated from the Bolivar recycled water. The turbidity concentrate will be added into the Bolivar water to achieve the required turbidities, or where required dilution will be performed with filtered Bolivar water. The proportion of organic particles will be characterised using TOC, DOC, TSS, VSS.

Virus samples will be taken from the reaction vessel and processed in triplicate using a plaque assay with 4 replicates per dilution and three dilutions per sample. The experiment will be repeated to ensure the data is reproducible.

Field samples will be assessed for virus inactivation in water provided by recycling plant operators. Water will be spiked with the virus of choice and disinfectant will be applied with a residual of 0.5mg/L for chlorination plants and 10mg/L for chloramination plants. Disinfection efficacy will be compared based on plaque assay and chemical analysis of water quality.

Indigenous E. coli will be monitored to identify disinfection tailing effects.


Chapter 2: Methodology

2.1 Virus enumeration

2.1.1 Cell culture – A number of cell types as shown in the cell line Table 2.1 below, including A549, BGM, Hep-2, LLC-MK2, MRC-5 and PLC/PRF/5 were used for virus infections. The cells were cultured in complete Eagle’s minimum essential medium (MEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco), 2mM L-glutamine and 10mM non-essential amino acid (NEAA; Gibco).

Table 2.1 Cell lines used for viral culture

Cell culture designation

Origin Passage numbers

Type of cells

A549 ATCC (CCL-185) 20-70 Human lung adenocarcinoma epithelial cell line

BGM Commonwealth Serum Laboratories, Parkville Victoria)

87-120 Buffalo Green Monkey Kidney cell line

HEp- 2 ATCC (CCL-23) 20-90 Human larynx epidermoid cell line

LLC-MK2 ATCC (CCL-7)

20-60 Rhesus Monkey Kidney cell line

MRC ATCC (CCL-171) 20-50 Human fetal lung fibroblast cell line

PLC/PRF/5 ATCC (CRL-8024) 20-50 Human liver cell line

ATCC = American Type Culture Collection

2.1.2 Virus propagation - ATCC VR-185TM Coxsackievirus B5 (CB5) and ATCC VR-192 Poliovirus were cultured in BGM cell line, adenovirus 2 was obtained from National Institute of Allergy and Infectious Diseases (NIAID) and cultured in A549 cell line, ATCC VR-931 adenovirus 40 and ATCC VR-930 adenovirus 41 were cultured in PLC/PRF/5 cell line (Virus strains and cell lines cultures are summarised in virus culture Table 2.2 below). Confluent cell monolayers in 175cm3 flasks were rinsed with PBS and infected with respective virus at a concentration of approximately 1 multiplicity of infection (MOI), diluted in 3 mL media without FBS. The flasks were incubated at 370C in a C02 incubator for 90 minutes with rocking every 10 minutes, after which the inoculum was replaced with 15 mL of complete media. Infected flasks were incubated at 370C in a C02 incubator until >90% cell monolayer destruction, due to cytopathic effect (CPE), was observed. One to three freeze-thaw steps were performed to release virus particles from host cells. The supernatant was centrifuged at 40C and 10, 000g for 10 minutes to remove cell debris. Further purification was accomplished by filtering supernatant through a 0.2 µm Acrodisc syringe (Pall Life Sciences, USA). All viral stocks were titred using the plaque assay method as described below and stored in 1 mL lots at -800C.


Table 2.2 Strains of virus used and the cell lines used for virus culture

Virus Strain and details Cell line for virus culture

Coxsackie B5 Faulkner-ATCC VR-185TM BGM

Poliovirus 1 Chat-ATCC VR-192 BGM

Adenovirus 2 NIAID 202 A549

Adenovirus 40 Tak - ATCC VR-931 PLC/PRF/5

Adenovirus 41 Dugan - ATCC VR-930 PLC/PRF/5

2.1.3 Virus culture from environmental samples in cell lines

A confluent monolayer, of (3-5 day old) cultured cells in 24 well plates, was used for virus inoculation. All specimens were diluted in serum free media (SFM) containing penicillin (0.03 µg/ml) and streptomycin (0.05 µg/ml) except when the centrifugation process was involved where 2% FBS was also added. The specimens were mixed well on a vortex mixer to obtain a homogenous suspension prior to inoculation onto cell monolayers. After inoculation, the micro-well plates were either centrifuged at 900 x g for 1 hour at room temperature in a Beckman Coulter Allegra X-12R plate centrifuge followed by incubation at 370C for 1 hour, or incubated in a 370C incubator for 90 minutes with gentle rocking of plates every 10 minutes. The medium was replaced with complete media containing 10% FBS and the cultures were observed for CPE over 7 days. In some cases, wells that were negative after 7 days were freeze thawed three times (at -800C to release viruses from inside cells into the media, filtered through a 0.2 µM filter and re-inoculated onto fresh cell monolayers. This process was repeated again for negative wells after 7 days, giving slow growing virus a total of 21 days to replicate and show CPE. CPE positive wells were confirmed by PCR for the presence of adenovirus or enterovirus and the results were used to calculate MPN/L (see below).

2.1.4 Virus enumeration

2.1.4.1 Plaque forming units assay –Filtered cell culture supernatants from infected cells and water samples were assayed for infectious virus by plaque assay. Viruses were enumerated by plaque forming unit (PFU) method in 12 or 6 well tissue culture plates. Overnight confluent cell monolayers were washed and infected with 100 or 200 µl of serially diluted (10-1 – 10-6) supernatant or water sample as described above. Following infection, inoculum was removed and cells were washed and overlaid with 2 or 4 ml of a 1:1 mix of 2% SeaPlaque Agarose (Lonza Rockland, Inc, USA) and 2X MEM plus 10% FBS (for adenovirus an additional 25mM MgCl2 was added to the media (Williams 1970)). Agarose was allowed to set, and plates were inverted and incubated at 37°C for 3 or 10 days for enterovirus or adenovirus respectively. After appropriate incubation time, cells were fixed with 1% formalin for 30 minutes. The overlaid agar was removed and cells were stained with 0.2% crystal violet and rinsed with distilled water to visualise the plaques. Levels of infectious


virus were reported as PFU per mL. The reproducibility of the plaque assay results was determined by multiple measurement of the same sample (n = 3) in two different experiments, yielding 5 and 10% variation from the mean, respectively, and routinely detected >50 PFU/mL.

2.1.4.2 Most probable number (MPN) calculation of viruses – The viral most probable number (MPN/L) for enteroviruses and adenoviruses in secondary treated WW was determined using the MPN General Purpose program by Hurley and Roscoe (Hurley and Roscoe 1983).The program uses the number of replicate wells inoculated (usually four for each dilution), the number of positive replicates (CPE-positive wells in 24-well cell culture plates), and the inoculation volume to calculate the MPN. This program also calculates 95% confidence intervals for MPN titres.

2.1.5 Virus concentration

2.1.5.1 Virus concentration by ultra-filtration To concentrate viruses present in 10- 20L of WW to manageable smaller volumes the WW was drawn into an ultra-filtration unit via an inlet hose using a peristaltic pump (Masterflex, Cataloque number 07591-07) allowing water samples to go through the cartridge fibers of Hemoflow F filters (Fresenius Medical Care AG & Co). In this process a portion of the sample passes through the fibre walls (into the outside of the hollow fibre cartridge) and passes out of the unit via the waste permeate hose. The fibre wall is impermeable to virus particles, which are retained within the fibres or become adsorbed to the fibre wall (due to a combination of physical pressure and electrostatic forces). The retentate was allowed to return to the sample container via the outlet hose and was recirculated through the system. The rate at which the sample passes through the fibre membrane was controlled by applying back pressure to the fibres by closing a valve in the retentate hose, thereby forcing water back down the fibres (in the opposite direction to the sample flow) and increasing the internal pressure against the fibre walls). Following the concentration the majority of the virus particles in the sample were detached from the fibre walls by a combination of back flushing with deionised water and elution with carbonate buffer pH 9.6.

2.1.5.2 Virus concentration using PEG-6000

This procedure was used either for further concentration of samples after ultra-filtration or for the concentration of 700 mL of water samples directly without filtering. Water samples (700 mL) or ultra-filtration concentrate was placed into sterile centrifuge bottles. PEG-6000 was added to a final concentration of 8% (w/v), 1% (v/v) Tween-80 and 0.5% (v/v) 1M calcium chloride and was stirred for 24 hours at 40C. Samples were centrifuged in a Sorvall RC3C Plus centrifuge for 1 hour at 7250 g, 40C. The pellet was dissolved in minimal amount of MEM (10 - 40 mL), sonicated for 1 minute using a Ney Ultra-sonik sonicator, and centrifuged at 7250 g (Sorvall RC3C Plus) for 30 minutes. The supernatant was carefully decanted and filtered using 0.45 µm filter. Penicillin and streptomycin (5000 µg/ml) was added to the supernatant. Dilutions of the sample concentrate were made in MEM and


inoculated onto confluent cells to isolate viruses or DNA/RNA was extracted from unfiltered sample concentrates to determine viral genome copy number.

2.1.6 PCR assays for Viruses

All Reverse Transcription-PCR (RT-PCR) and PCRs were performed on RotorGene 6000 (Corbett Life Sciences, Sydney, Australia) and amplification signal was detected on the Green (FAM) channel (excitation at 470nm, detection at 510nm).

Quantification was done using DNA/RNA standards prepared from modified purified PCR products. For RNA virus standards, PCR products were synthesised with an inserted T7 promoter sequence. The primer Table (Table 2.3) below shows the sequences of promoter primers (pp). One PP and one normal primer was used in the PCR to amplify the target sequence. This modified amplified PCR product was purified using UltraClean TM PCR Clean-up (Mo Bio) as per the manufacture’s instruction. The purified DNA was then transcribed in-vitro using MEGAshortscriptTM T7 Kit (Ambion) as per the manufactures instructions. Remaining PCR products were removed with RNase-free DNase supplied in the same kit as per manufacturer’s instructions. This was to ensure that there were no errors in spectrophotometric determination of RNA concentration and to remove the potential to serve as a template in the subsequent PCR steps. The RNA concentration was determined by spectrophotometry and the copy number of standard RNA molecules were calculated using the formula = (X g/µl RNA/(transcript length in nucleotides x 340)) x 6.022 x 1023 = Y molecules/µl.

For DNA virus standards the PCR product was cloned using TC cloning Kit (Invitrogen) as per the manufacturer’s instruction. The plasmid was purified using the QIAprep mini kit (QIAGEN Doncaster, NSW, Australia) as per manufacturer’s instructions. After spectrophotometric determination of plasmid DNA concentration, the copy number of standard DNA molecules was calculated using the following formula: (X g/µl DNA/(plasmid length in basepairs x 660)) x 6.022 x 1023 = Y molecules/µl.

Table 2.3: Primers used in all (RT)-PCR’s and synthesis of copy number standards

Virus Primer Name Orientation Sequence Publisher

Poliovirus ENT1 Forward 5’-GGCCCCTGAATGCGGCTAAT-3’ Donaldson et al., 2002

ENT2 Reverse 5’-CACCGGATGGCCAATCCAA-3’ Donaldson et al., 2002

ENTERO taqman 5’-FAM-CGGACACCCAAAGTAGTCGGTTCCG-BHQ1-3’

Donaldson et al., 2002

Reovirus ReoL3f Forward 5’-CAGTCGACACATTTGTGGTC-3’ Spinner and Di Giovanni, 2001

ReoL3r Reverse 5’-GCGTACTGACGTGGATCATA-3’ Spinner and Di Giovanni, 2001

GroupII Norovirus GIIf Forward 5’-CArGArbCnATGTTyAGrTGGATGAG-3’ Trujillo et al.,

2006 GIIr Reverse 5’-TCGACGCCATCTTCATTCACA-3’ Trujillo et al.,


2006 NORO taqman 5’-FAM-GAGGGCGATCGCAATCT-BHQ1-3’ Radcliff pers

comm.. Adenovirus AQ1 Forward 5’-GCCACGGTGGGGTTTCTAAACTT-3’ Heim et al.,

2003 AQ2 Reverse 5’-GCCCCAGTGGTCTTACATGCACATC-3’ Heim et al.,

2003

Adeno taqman 5’-FAM-TGCACCAGACCCGGGCTCAGGTACTCCGA-BHQ1-3’

Heim et al., 2003

Rotavirus MRD145 Forward 5’-GCTGGCGTGTCTATGGATTCA-3’ Fout et al., 2003

MRD155 Reverse 5’-CAAAACGGGAGTGGGGAGC-3’ Fout et al., 2003

T7 promoter sequence plus enhancer 5’ GGATCCTAATACGACTCACTATAGG* *GGATCC enhances RNA polymerase binding and initiation of transcription.

Primers were sourced from Geneworks (Hindmarsh, SA, Australia). Primers were resuspended in sterile nucleases-free water (Sigma, Castle Hill, N.S.W. Australia) to make a 100 µM working stock and stored at -20oC. Primers were sequencing/PCR grade, while probes were HPLC purified.

2.1.6.1 Nucleic Acid Extraction

Samples were subjected to both DNA and/or RNA extraction. DNA extraction of 200 µl of sample was performed using the DNAEasy kit (Qiagen, Doncaster, NSW, Australia) in accordance to manufacturer’s protocol. DNA extracts were eluted in 200 µl of nuclease free water (Sigma) and stored at -200C until analysed.

RNA extraction was performed using the QIAamp Viral RNA Mini extraction kit (Qiagen, Doncaster, NSW, Australia), according to the manufacturer’s instructions with a starting volume of 140 µl of sample. RNA extracts were eluted in 60 µl of nuclease free water (Sigma) and stored at -800C until analysed.

2.1.6.2 Enterovirus Taqman RT-PCR

One step RT-PCR was performed in order to detect and quantify enterovirus. RNA template (up to 5 µl) was added to mastermix solution containing 0.2mM dNTP (ATP,GTP,CTP,TTP) (Applied Biosystems Pty Ltd., Scoresby, VIC, Australia), 3 mM MgCl2 1 x PCR buffer (Applied Biosystems), 2.5 units of Amplitaq GoldTM DNA Polymerase, 0.6 µM ENT1 and ENT2 primers, 5 units MuLV Reverse Transcriptase (Applied Biosystems), 20 units of RNAse Inhibitor (Applied Biosystems), and 0.4 µM of Entero Taq (Taqman probe). The total reaction volume was 25 µl. Initial reverse transcription was performed at 430C for 30 minutes, followed by inactivation of the reverse transcriptase and DNA polymerase activation at 950C for 10 minutes, followed by 45 cycles of; 950C for 10 seconds, followed by 550C for 15 seconds and


720C for 15 seconds. Signal was acquired on the Green (FAM) channel. Positive control material utilised was attenuated Poliovirus 1 strain CHAT (ATCC VR-192).

2.1.6.3 Adenovirus Taqman qPCR

Detection and enumeration of adenovirus was performed using a Taqman PCR. The reaction was composed of 0.2mM dNTP (ATP,GTP,CTP,TTP) (Applied biosystems Pty Ltd., Scoresby, VIC, Australia), 3 mM MgCl2 1 x PCR buffer (Applied biosystems), 2.5 units of Amplitaq GoldTM DNA Polymerase, 0.5 µM of each forward (AQ1) and reverse (AQ2) primer, 0.3 µM Adeno Taqman probe and DNA. The total reaction volume was 25 µl. Taq DNA Polymerase activation was performed at 950C for 10 minutes, followed by 40 cycles of 940C for 5 seconds, 590C for 20 seconds, and 720C for 10 seconds. Amplification signal was collected at the end of the annealing step using the Green (FAM) channel. Positive control material was extracted from adenovirus type 41 (ATCC VR-930).

2.1.6.4 Reovirus RT-PCR using SYT09

Detection and enumeration of reovirus was performed in a 25 µl reaction mix, composed of 0.2mM dNTPs, 2 mm MgCl2, 1 x PCR Buffer, 1 unit of Amplitaq DNA polymerase, 1 µM of forward and reverse primers ReoL3f and ReoL3, 5 units of MuLV reverse transcriptase, 10 units of RNase inhibitor, 2.5 µM of SYT09 (a double stranded DNA-specific intercalating dye, Invitrogen, Mulgrave, Vic, Australia) and 2 µl of sample. Reverse transcription was conducted at 420C for 30 minutes, followed by inactivation of the reverse transcriptase and inactivation of the DNA polymerase at 950C for 10 minutes, followed by 40 cycles of 940C for 20 seconds, 550C for 30 seconds and 720 for 20 seconds. Amplification signal was acquired at the end of the extension (720C) step using the Green (FAM) channel. DNA melt curve analysis were conducted using a ramping rate of 0.20C for 30 seconds from 800C to 950C, with signal acquisition to the green (FAM) channel with the gain setting to set 1. Visualisation of the analysed (differentiated) data was performed with the digital filter option set to ‘none’. Positive control material was extracted from a culture of reovirus type 3 strain Dearing (ATCC VR-82).

2.1.6.5 Norovirus Taqman RT-PCR

Detection and enumeration for Norovirus was done in a two-step RT-PCR. Reverse transcription was performed in 10 µl reaction volume composed of 0.2mM dNTP, 3mM MgCl2, 1 x PCR Buffer, 0.6 µM reverse primer (GIIr, refer to primers Table), 5U of MuLV (Invitrogen), 20U RNase inhibitor (Invitrogen), and 2µl RNA. Reverse transcription was performed at 430 C for 30 minutes to produce cDNA. PCR of cDNA was performed in a 25 µl reaction mix composed of 0.2mM dNTP, 3 mM MgCl2 1 x PCR buffer (Applied Biosystems), 1 unit Amplitaq Gold DNA Polymerase (Applied Biosystems), 0.6 µM forward primer (GIIf) and 0.3 µM reverse primer (GIIr), 0.4 µM of DNA probe, and 1µl of cDNA template. The two step RT-PCR was used for Noroviruses as the reaction conditions were optimised in this format and could not be achieved in a onestep format. Positive control material was obtained from Dr Jane Arthur (IMVS, Adelaide, SA, Australia)


2.1.6.6 Rotavirus RT-PCR Using SYT09

Rotavirus detection and enumeration was performed in 25 µl reaction mix composed of 0.2 mM dNTP, 3 mM MgCl2 1 x PCR Buffer (invitrogen), 1 U Amplitaq Gold DNA Polymerase, 0.5 µM of forward primer MRD145 and reverse primer MRD 155, 5 U MuLV reverse transcriptase, 10 U RNase inhibitor and 2.5 µM SYT09 and 1 µl of sample extract. The one step RT-PCR protocol was reverse transcribed at 430C for 30 minutes, followed by reverse transcriptase inactivation and DNA polymerase activation at 950C for 10 minutes, followed by 40 cycles of 950C for 30 seconds, 520C for 60 seconds and 720C for 45 seconds, with signal acquisition at the end of each 720C step on the Green (FAM) channel. DNA Melt analysis was measured from 70-900C with a ramping rate at 0.50C/30 seconds. Signal was acquired on the Green (FAM) channel. Melt curve data was visualised by digital filtering set to ‘none’. Positive control material was obtained from Dr TuckWeng Kok (IMVS, Adelaide, SA, Australia).

2.2 F-RNA Bacteriophage Plaque assay

Analysis of samples for F-RNA bacteriophage was performed using the double agar overlay method (Adams, 1959). For host E.coli (ATCC 700891) preparation, a single typical colony from a working culture plate was inoculated in 5 mL of Tryptone Soya Broth (TSB) (Oxoid) supplemented with ampicillin and streptomycoin (150 µg/mL each) and placed on a shaker at 350C for 4-5 hours. Samples to be assayed were serially diluted at 1/10 dilution intervals in TSB. An aliquot, 100 µL, of sample dilution and 20 µL of host E. coli were added in 5 mL of melted overlay composed of TSB with 0.5% Bacteriological agar #1 (Oxoid) which was maintained at 500C in a water bath. The mixture was then poured over a pre-dried Tryptone Soya Agar (TSA) (Oxoid) supplemented with 150 µg/mL ampicillin plate and left to set at room temperature and then incubated at 330C for 24 hours. Plaques were enumerated, with numbers expressed in PFU/mL.

All dilutions and plating were performed in triplicate.

2.3 Somatic Bacteriophage Plaque Assay

The bacterial host used for Somatic bacteriophage assay was E. coli (ATCC 700078). This method is based on the method published by Grabow et al., (1998). For host E.coli preparation, 1 mL of an overnight culture was inoculated into 100 mL of Nutrient Broth (NB) (Oxoid) and placed on a shaker at 35°C for 4-5 hours. Samples to be assayed were serially diluted at 1/10 dilution intervals in Peptone Saline Solution (PSS) (Oxoid). Ten mL of diluted sample, 20 µL of antifoam and 5 mL of host E. coli were added in 25 mL of overlay solution composed of TSB with 0.5% Bacteriological agar #1 (Oxoid) which was maintained at 50°C in a water bath. The mixture was then poured over pre-dried Tryptone Soya Agar (TSA) (Oxoid) plates (a total of 3 (140mm) plates for each dilution) and left to set at room temperature and then incubated at 33°C for 24 hours. Plates were enumerated, and numbers expressed as PFU/10mL. All dilutions and plating were performed in triplicate.


2.4 Methods for chlorine Ct experiments

2.4.1 Virus Culture

Coxsackie B5 (Faulkner, ATCC- VR185) was grown and assayed in Buffalo Green Monkey Kidney (BGM) cells. Supernatant from 2 day old infected cells showing 90% cytopathic effect were centrifuged at 10 000g for 10 minutes at 4°C to remove cell debris and further purified by filtering through a 0.2 µm filter. The virus was enumerated by the plaque forming (PFU) method in 6 well tissue culture plates (Kahler et al., 2011). Ten fold dilutions of the supernatant were prepared in Minimum Essential Medium (MEM) without Foetal Bovine Serum (FBS) and inoculated onto monolayers. After a 90 minute adsorption period the monolayers were washed and overlayed with 1% Sea Plaque agarose containing 2X MEM and 5% FBS. Following 2 day incubation (at 37°C, 5% CO2), a second agarose overlay containing 2% neutral red was added to visualise plaques within 8-24 hrs.

2.4.2 Glassware and water preparation

All glassware was made chlorine demand free by acid washing with 10% nitric acid as per AS/NZS 5667.1.1998. Secondary treated WW was used from Bolivar WW Treatment Plant (WWTP). The water collected had undergone primary sedimentation, activated sludge treatment (ASP) including clarification, and was sampled prior to entry to the lagoon (sample point 4004). WW was stored at 4°C for up to 7 days without negligible change in water chemistry. TDS of Bolivar WW was normally around 1000 mg/L and therefore the lagoon influent was collected and diluted with ultra pure water to obtain TDS of approximately 600 mg/L to match Victorian WWTP conditions (this was routinely a 60% dilution). This was done to overcome the effects of potentially improved disinfection efficacy. Higher TDS has been previously shown to improve inactivation rates through the presence of increased ionic strength in the form of NaCl or KCl (Jensen et al., 1980). WW treatment processes vary from plant to plant hence to ensure coverage of the range of water qualities produced at different plants, the range of turbidities 0.2-20 NTU were tested. The turbidity was adjusted by either filtering water through a Dialyser –Hemoflow-HF80s (Fresenius) to remove most of the suspended particulate matter (0.2 NTU), diluting water (2 NTU), or concentrating suspended particulates by filtering through a 0.45µm filter from this water type and resuspending in WW to obtain 5 and 20 NTU.

Basic chemistry tests performed on all waters included pH, TDS, Volatile Suspended Solids (VSS), Dissolved Organic Carbon (DOC), Total Suspended Solids (TSS), ammonia, Total Kjeldahl Nitrogen (TKN), Biochemical Oxygen Demand (BOD5), Chemical Oxygen Demand (COD) and Total Phosphorous using Australian Standard Methods at AWQC.

Buffered demand free (BDF) water was also used to reproduce published results and was prepared by dissolving 0.54 g of Na2HPO4 (anhydrous) and 0.88g of KH2PO4 (anhydrous) per litre of ultra pure water (Black et al., 2009). The pH was adjusted to pH 9 using 1N sodium hydroxide.


2.4.3 Determining chlorine demand of WW and adjustment of pH

The chlorine demand of the virus and water was obtained to determine the amount of chlorine to add to get measurable free available chlorine (FAC) at the 30 minute time point post chlorination (preferably 0.5 mg/L) in test flasks. This was obtained by adding known concentrations of chlorine to flasks containing 200 mL of WW spiked with CB5, incubating in a shaking water bath at 10°C (similar to test flasks below) for 30 minutes. The FAC residuals were measured at 30 minutes post chlorination and the chlorine amount chosen to test each water type was based on the lowest amount of FAC initially added that gave a measurable FAC at 30 minutes for each of the water types tested. Comparison of WW with and without virus showed the virus (prepared as described in section 2.1.2) used in these experiments had a chlorine demand of approximately 0.5 mg/L.

These experiments involved use of an aqueous chlorine stock solution (described below) as the source of chlorine and large amounts (6.5-9 mg/L) were required to achieve FAC after satisfying the WW and virus demand. It was necessary to adjust the pH prior to addition of chlorine to allow for the instant decrease in pH observed on addition of the chlorine stock solution. This observation has not been reported in published literature as the amounts (1-3 mg/L) used in those studies were significantly lower and used demand free buffered water. The pH was adjusted with 1 N sodium hydroxide to obtain the desired pH±0.5 being tested within the 30 minute time frame for each experiment. The pH was determined at the start and end of each experiment to ensure that the disinfection experiments were carried out at the desired pH ± 0.5.

2.4.4 Chlorine stock, chlorine analysis and Ct calculation

Free chlorine stock solution was prepared by bubbling gaseous chlorine through ultrapure water to give a stock concentration of 1000 mg/L of FAC. Concentration of FAC in the stock solution and sample during the course of the experiments were measured by the standard N, N, Diethyl-P-Phenylenediamine-ferrous ammonium sulphate (DPD-FAS) titration method (APHA, 1998). For virus inactivation purposes the important parameters were the concentration of free available chlorine and the time over which the virus was exposed to chlorine. The appropriate degree of inactivation was obtained by determining the Ct where concentration is multiplied by time of chlorine exposure. Therefore Ct for 1 to 4 log10 inactivation value of CB5 in these experiments was calculated by determining the area under a curve of chlorine concentration vs. time (previously described by Ho et. al., 2006). Combined chlorine residuals were also measured but were not used for Ct calculation due to presence of low levels of other species and the fact they do not significantly contribute to disinfection in the short 30 minute exposure time of these experiments where FAC is present.

2.4.5 Experimental protocol

Two parameters, pH and turbidity, were varied to determine Ct values for inactivation of CB5 in secondary treated WW. This included four different turbidities 0.2, 2.5, 5, 20 and pH


7, 8 and 9 at a constant temperature of 10°C (Table 2.4). Chlorine disinfection experiments were performed in a bench-scale batch system using chlorine demand-free glassware in a 10°C shaking water-bath. Each experimental condition was tested in triplicate with controls alongside each test flask to determine the initial virus concentration in the reaction flask and to evaluate whether virus inactivation occurred under the tested pH, NTU, temperature and WW condition in the absence of chlorine (Figure 2.1).

Table 2.4. WW conditions being tested at 10ºC in a shaking water bath

Turbidity (NTU) pH 7 pH 8 pH 9 < 0.2 (Membrane process) x X X

2 (Membrane Bioreactors) x X X

5 (Media filter with elevated turbidity) x X X

20 (Lagoon system experiencing elevated turbidity)

x X X

(i) Determination of chlorine demand: This was obtained by adding known concentrations of chlorine to flasks containing 200 mL of WW spiked with CB5 (estimated amount of CB5 added), incubating in a shaking water bath at 10°C (similar to test flasks below) for 30 minutes. The FAC residuals were measured at 30 minutes post chlorination using the DPD-FAS method (APHA, 1988) and the chlorine amount chosen for each water type was based on the lowest amount of FAC initially added that gave a measurable FAC at 30 minutes for each of the water types tested.

(ii) Determination of virus inactivation by chlorine: A total of six flasks containing 200 mL of WW with pre-adjusted pH and turbidity were inoculated with CB5 (4-5 x105 PFU/mL) at a concentration that would allow detection of a 4 log10 inactivation of CB5 (Figure 2.1). Flasks were incubated in a 10°C shaking water-bath (approximately 60-70 oscillation per minute) for at least 2 hrs prior to the experiment to allow equilibration and mixing of the virus with the particulate matter in WW. The pre-determined concentration of chlorine stock solution was added to the 3 test flasks (in succession). In order to determine viral inactivation by free chlorine, one mL samples at the pre-determined time points (0.5, 1, 1.5, 2.5, 5, 10, 20 and 30 minutes) were taken and neutralised with 2% sodium thiosulphate in 1 mL of 2 x MEM. Note virus sample at time 0 was only taken from the three control flasks. Virus samples were stored at 4°C for 1 to 2 hrs before being assayed.

Determination of chlorine decay kinetics: To determine chlorine decay during the experiment, 20 mL samples from the same test flask in (ii) above was taken at time points 0.5 (as soon as practicable after addition of chlorine), 2.5, 5, 10, 20 and 30 minutes and the residual free chlorine and other chlorine species was measured immediately using the DPD-FAS method (APHA, 1998).

Determination of virus persistence in absence of disinfection (control): sampling from the control flask (no chlorine added) was done at time-points 0 and 30 minutes and consistently showed negligible variation in virus numbers during its exposure to the different experimental water types during the 30 minute time period of study. Turbidity and pH of WW in these control flasks was kept the same as test flasks.


Figure 2.1. Sampling times and conditions for triplicate test and control flasks during the course of the chlorine Ct experiment

E. coli, coliforms and bacteriophage numbers were found to be insufficient to use as surrogates in the experiments presented in Chapter 4 due to storage of WWs up to 7 days. Experiments using these surrogates were done separately and results are included in Chapter 5.

2.5 Methods for monochloramine Ct experiments

2.5.1 Virus Culture

Adenovirus 2 (obtained from NIAID and genome confirmed by sequencing) was grown and assayed in Human lung adenocarcinoma epithelial cell line (A549) cells. Supernatant from 5-7 day old infected cells showing 90% cytopathic effect was centrifuged at 10 000g for 10 minutes at 4°C to remove cell debris and further purified by filtering through a 0.2 µm filter. The virus was enumerated by the plaque forming (PFU) method in 6 well tissue culture plates (Kahler et al., 2011). Ten fold dilutions of the supernatant were prepared in Minimum Essential Medium (MEM) without Foetal Bovine Serum (FBS) and inoculated onto monolayers. After a 90 minute adsorption period the monolayers were washed and overlayed with 1% Sea Plaque agarose containing 2X MEM and 5% FBS. Following 7 day


incubation (at 37°C, 5% CO2), a second agarose overlay containing 2% neutral red was added to visualise plaques within 24-72 hrs.

2.5.2 Glassware and water preparation

As described in section 2.2.2

2.5.3 Determining monochloramine demand of WW

The monochloramine demand of the virus and test WW was obtained to determine the amount of preformed monochloramine required to obtain a measurable monochloramine concentration (preferably 10 mg/L) at the final time point post chloramination in test flasks. This was obtained by adding known concentrations of preformed monochloramine to flasks containing 200 mL of WW spiked with adenovirus 2, incubating in a shaking water bath at 10°C (similar to test flasks below) for the required time. The monochloramine residuals were measured at 22 hrs post chloramination and the monochloramine dose for each water type was based on the lowest amount of preformed monochloramine initially added that gave no less than 10 mg/L monochloramine.

The pH was determined at the start and finish of each experiment to ensure that the disinfection experiments were carried out at the desired pH ± 0.5. Unlike FAC experiments no pH adjustment was required.

2.5.4 Monochloramine stock, monochloramine analysis and Ct calculation

Monochloramine stock solution was produced by reacting sodium hypochlorite and ammonium sulphate in 4:1 ratio by weight. pH was adjusted using sodium hydroxide. The monochloramine concentration ranged from 1.5-2 g Cl2/L and pH value was between 9 and 10. The prepared monochloramine was stored in a dark bottle for a maximum 2 weeks with minimal deterioration.

Concentration of monochloramine in the stock solution and sample during the course of the experiments were measured by the standard N, N, Diethyl-P-Phenylenediamine-ferrous ammonium sulphate (DPD-FAS) titration method (APHA, 1998). For virus inactivation purposes the important parameters were the concentration of monochloramine and the time over which the virus was exposed to monochloramine. The appropriate degree of inactivation was obtained by determining the Ct where concentration is multiplied by time of monochloramine exposure. Therefore Ct for 1 to 4 log10 inactivation value of adenovirus 2 in these experiments was calculated by determining the area under a curve of monochloramine concentration vs. time (previously described by Ho et. al., 2006). Combined chlorine residuals were also measured but were not used for Ct calculation due to presence of low concentrations of other species.


2.5.5 Experimental protocol

Two parameters pH and turbidity were tested to determine monochloramine Ct values for inactivation of adenovirus 2 in secondary treated WW. This included three turbidities 2, 5, 20 NTU and pHs 7, 8, 9 at a constant temperature of 10°C (Table 2.5). Monochloramine disinfection experiments were performed in a bench-scale batch system using chlorine demand-free glassware in a 10°C shaking water-bath. Each experimental condition was tested in triplicate with controls alongside each test flask to determine the initial virus concentration in the reaction flask and to evaluate whether virus inactivation occurred under the tested pH, NTU, temperature and WW condition in the absence of monochloramine (Figure 2.2).

Table 2.5. WW conditions being tested at 10°C Turbidity (NTU) pH 7 pH 8 pH 9 2 (Membrane Bioreactors) x x X 5 (Media filter with elevated turbidity) x x X 20 (Lagoon system experiencing elevated turbidity)

x x X

(i) Determination of preformed monochloramine demand: This was obtained by adding known concentrations of preformed monochloramine to flasks containing 200 mL of WW spiked with adenovirus (approximately 105 PFU/mL adenovirus was added), incubating in a shaking water bath at 10°C (similar to test flasks below) for 22 hrs. The monochloramine residuals were measured at 22 hrs post chloramination and the monochloramine amount chosen for each water type was based on the lowest amount of monochloramine initially added that gave a up to 10 mg/L residual at 22 hrs for each of the water types tested.

(ii) Determination of virus inactivation by monochloramine: A total of six flasks for each pH and turbidity combination, containing 200 mL of WW with pre-adjusted pH and turbidity, were inoculated with adenovirus 2 (6-9 x105 PFU/mL) at a concentration of preformed monochloramine that would allow detection of up to 4 log10 inactivation of adenovirus 2 (Figure 2.2). Flasks were incubated in a 10°C shaking water-bath (approximately 90-100 oscillation per minute) overnight prior to the experiment to allow equilibration and mixing of the virus with the particulate matter in WW. Overnight incubation was necessary for monochloramine experiments for practicality due to longer duration of these experiments than the free chlorine 30 minute experiments. The pre-determined concentration of monochloramine stock solution was added to the 3 test flasks (in succession). In order to determine viral inactivation by monochloramine, one mL samples at the set time points were taken and neutralised with 2% sodium thiosulphate in 1 mL of 2 x MEM. Virus samples were stored at 4°C for up to 24 hrs before being assayed.

Determination of monochloramine decay kinetics: To determine monochloramine decay during the experiment, 5-10 mL samples from the same test flask in (ii) above was taken at set time points (the first reading was done as soon as practicable after addition of monochloramine), and the residual free chlorine and other chlorine species was measured immediately using the DPD-FAS method (APHA, 1998).


Determination of virus persistence in absence of disinfection (control): sampling from the control flask (no monochloramine added) was done at time-points 0 and final time point and consistently showed negligible variation in virus numbers during its exposure to the different experimental water types during the time period of study.

Figure 2.2. Sampling times and conditions for triplicate test and control flasks during the course of the monochloramine Ct experiment.

E. coli, coliforms and bacteriophage numbers were found to be insufficient to use as surrogates in the experiments due to storage of WWs up to 7 -10 days. Experiments using these surrogates were done separately.

2.5.6 In situ monochloramine formation (chlorine and ammonia and (4:1)) to inactivate adenovirus 2 (to mimic field settings)

Attempts were made to replicate in situ formation of monochloramine in WW samples to establish the Cts. Bolivar WWTP lagoon influent was adjusted to the required pH (7, 8 and 9), TDS (600 mg/L) and 2 NTU and spiked with adenovirus 2 (4 x106 PFU/mL). Ammonia was added first (e.g. 3 mg/L) to virus spiked WW incubating in a shaking water bath. After 2 hrs incubation, free chlorine (e.g. 12 mg/L) was added while the sample was vigorously stirred on a magnetic stirrer allowing chlorine to be rapidly converted to monochloramine. In order


to determine viral inactivation by monochloramine, one mL samples at the pre-determined time points (0.5, 1, 1.5, 2.5, 5, 10, 20, 30, 60 and 90 minutes) were taken and neutralised with 2% sodium thiosulphate in 1 mL of 2 x Minimum Essential Medium. To determine monochloramine decay during the experiment, 5-10 mL samples from the same test flask were also taken at the same time points (the first reading was done as soon as practicable after addition of monochloramine), and the residual free chlorine and other chlorine species was measured immediately using the DPD-FAS method (APHA,1998). Virus samples were stored at 4°C for 1 to 2 hrs before being assayed. In between sampling times the test flask was incubated in a 10°C in a shaking water bath. Controls consisted of flasks containing spiked WW without ammonia or chlorine added. The levels of virus at the start and end of each experiment were determined by sampling from controls. The virus was enumerated by the plaque forming (PFU) method in 6 well tissue culture plates (Kahler et al., 2011). Ten fold dilutions of the supernatant were prepared in Minimum Essential Medium without Foetal Bovine Serum and inoculated onto monolayers. After a 90 minute adsorption period the monolayers were washed and overlayed with 1% Sea Plaque agarose containing 2X MEM and 5% FBS. Following 10 day incubation (at 37°C, 5% CO2), a second agarose overlay containing 2% neutral red was added to visualise plaques within 8-24hrs.


Chapter 3: Virus numbers in wastewaters

The objective of Chapter 3 was to determine whether there were adequate numbers of native viruses present in secondary treated WW for the disinfection experiments to be performed in Chapters 4 and 5. The use of viruses in their native state, i.e. planktonic, attached to or bound within particulates, would be ideal provided numbers were adequate for determining up to 4 log10 inactivation, and numbers were reproducible between batches of water sourced for the experiments. Alternative cell lines were identified in the literature that may enhance the level of detection of viruses including PLC/PRF/5, BGM and A549 when compared to the traditional cell lines used for virus culture in the AWQC laboratory (LLC-MK2, HEp2A and MRC-5). In this chapter, methods were developed to determine the cell line capable of detecting the highest titre of virus, optimizing the virus culture conditions and virus concentration methods to improve virus recovery from secondary treated WW. Methods were optimised based on enterovirus and adenovirus as these are the most significant human pathogenic viruses in WWs. These optimised methods were used to determine titres of these viruses in secondary treated WW for suitability to use in Ct experiments.

3.1 Cell line for optimal detection and enumeration of enterovirus and adenovirus in wastewaters

3.1.1 CB5 and Poliovirus enumeration using MPN and PFU methods using five cell lines Traditionally, cell lines used in our laboratory for detection and enumeration of waterborne viruses have been LLC-MK2, MRC-5 and HEp2A. Alternative cell lines which provide improved recovery have been suggested in the literature. BGM is generally the most common cell line for enterovirus detection from water, in particular poliovirus and CB5 virus, and it is one of the cell lines recommended for the total culturable viral assay (TCVA) (USEPA 1995). TCVA is referred to as the standard method for enumeration of viruses from water in the U.S. Environmental Protection Agency (USEPA) virus monitoring protocols. BGM cell lines have been previously thoroughly optimized for monitoring viruses in the environment (Dahling and Wright 1986) and have been found to be slightly more efficient, when compared to the liver PLC/PRF/5, for isolation of enteroviruses from environmental samples (Grabow, Botma et al. 1999). Five cell types, including those routinely used in our laboratory, were tested for the isolation of CB5 virus from spiked water samples. Laboratory cultured CB5 virus was diluted in Bolivar secondary WW from sample point 4004 (treatment train comprises primary grit removal, screening, activated sludge) at a concentration of 106 virus/mL. These water samples were negative for native enterovirus by culture.

The results (Table 3.1A) show detection of CB5 was greatly improved using PLC/PRF/5 compared to the traditional cell lines. Percentage detections were calculated based on the maximum virus detected in PLC/PRF/5 cells. Detection levels were also higher in


PLC/PRF/5 cells when compared to BGM (100% and 62% respectively) using the MPN method for CB5 after 7 days of incubation compared to BGM cells and these results were based on CPE and confirmation by PCR. The traditional cell lines demonstrated significantly lower levels of detection using both methods (MPN and PFU) with 0.09-2.5% of CB5 detected using the MPN method and no plaques observed for the PFU assay. However, both PLC/PRF/5 and BGM have similar levels of detection using the PFU/mL method (short incubation 72 hrs). This is probably due to both these cell lines being equally efficient in replicating healthy viable viruses which replicate quickly. However the viruses being isolated in these experiments were exposed to WW and the high levels of toxicity in these water types would affect the replication ability of some of these viruses. It has been previously shown that PLC/PRF/5 is very efficient in isolating viruses resistant to disinfection and treatment (Rodriguez, Gundy et al., 2008) and therefore it is likely that the MPN method favours these slower growing viruses in this cell line resulting in higher yields. Both PLC/PRF/5 and BGM cells showed high susceptibility of infection reflected by earlier appearance of CPE (i.e. within the first day) with the MPN method, compared to other cells lines that did not show any visible CPE until at least day 4 of infection.

Similarly, poliovirus was isolated more efficiently in the PLC/PRF/5 cell line using the MPN method however similar levels of detection were seen when using the PFU/ mL method (Table 3.1B). Significantly higher numbers of poliovirus were detected in the PLC/PRF/5 and BGM cell lines (100% and 65% respectively) compared with the traditional cell lines (10-20%). Table 3.1A Enumeration of spiked CB5 virus in common cell lines to determine the best cell

type for CB5 detection Cell type CB5 MPN/mL ± SD

(% detection)

CB5 PFU/mL ± SD

(% detection)

Hep 2 1.5 x 103 ± 5 x 102 (0.09%) 0

LLC-MK 1.5 x 103± 7 x 102 (0.09%) 0

MRC5 4.1 x 104 ± 4.4 x 103 (2.5%) 0

BGM 1.0 x 106 ± 1.2 x 105 (62%) 1.47 x 106 ± 2.6 x 104 (100%)

PLC/PRF/5 1.6 x 106 ± 1.0 x 105(100%) 1.45 x 106 ± 3.5 x 104 (100%)

*Done in triplicate with the mean results shown here.


Table 3.1B Enumeration of spiked poliovirus in common cell lines to determine the best cell type for poliovirus detection

Cell type Poliovirus MPN/mL ± SD

(% detection)

Poliovirus PFU/mL ± SD

(% detection)

Hep 2 4.6 x 105 ± 1.4 x 105 (20%) 4.5 x 105 ± 2.6 x 104 (16%)

MRC5 2.3 x 105 ± 7.2 x 104 (10%) 3 x 105 ± 1 x 104 (11%)

LLC-MK 3.2 x 105 ± 3.3 x104 (13%) 5 x 105 ± 3.8 x 104 (18%)

BGM 1.5 x 106 ± 3.6 x 104 (65%) 2.6 x 106 ± 2.6 x 105 (96%)

PLC/PRF/5 2.3 x 106 ± 3.6 x 104 (100%) 2.7 x 106 ±1 x 105 (100%)

*Done in triplicate with the mean results shown

Outcome:

From these results (Table 3.1A and 3.1B) it was determined that:

(i) the two common enteroviruses CB5 and poliovirus show improved recovery in PLC/PRF/5 and BGM compared to Hep2, MRC5 and LLC-MK.

(ii) For the PLC/PRF/5 cell line, both CB5 and poliovirus were equally well recovered using the MPN or PFU method.

(iii) However, for the BGM cell line, both CB5 and poliovirus showed a slightly lower recovery when MPN was used compared to the PFU method.

As a result, in Chapter 3, both MPN and PFU methods of viral enumeration were used. When isolating native enteroviruses from WW samples using the MPN method, PLC/PRF/5 was the cell line of choice.

For Chapter 4, with the use of cultured virus to determine PFU/mL in Ct experiments, BGM cells were selected as the cell line of choice. This cell line has been routinely used for plaque assays for CB5 in literature and our studies show it is as efficient as PLC/PRF/5. An added advantage of using BGM cells, is the ease of culturing the cell line and its’ rapid growth compared to PLC/PRF/5 cells which are slower growing than BGM. This is beneficial for the assay process as large numbers of cells are required for replication of the Ct experiments.

3.1.2 Determination of best cell line for culturing enteric adenovirus 40 and 41

Adenovirus 40 and 41 are common enteric pathogens in WW. Three commonly used cell lines were tested including BGM, A549 and PLC/PRF/5 to determine the best cell line for enumerating these viruses in secondary WW (Section 3.4) by the standard MPN method (as a standard plague method is not available). The MPN was determined over a 21 day period with 2 subcultures of any culture wells not showing CPE. Virus titres were based on CPE and confirmed by PCR. PLC/PRF/5 showed the best recovery levels (Table 3.1C) with CPE detected 2-6 days post infection, compared to A549 cell line which took 5-7 days and BGM which took 7-10 days. Low levels of both viruses were detected in BGM and A549 (1.5-2% and 10-17% respectively).


Table 3.1C. Adenovirus 40 and 41 enumeration using MPN methods in three cell lines Cell type Adenovirus 40 MPN/ml

(% detection) Adenovirus 41 MPN/ml

(% detection) BGM 4.6 x 101 ± 6 (2%) 4.5 x 101 ± 1.4 x 101 (1.5%)

A549 2.2 x 102 ± 3.3 x 101 (10%) 5 x 102 ± 1.8 x 102 (17%)

PLC/PRF/5 2.3 x 103 ± 3 x 102 (100%) 3 x 103 ± 8.7 x 102 (100%)

*Done in triplicate with mean results shown

Outcome

The level of detection of adenovirus 40 and 41 in the PLC/PRF/5 cell line was significantly higher than numbers observed in all other cell lines. PLC/PRF/5 was hence selected as the cell line of choice for detection of these viruses in secondary treated WW.

3.1.3 Determination of best cell line for culturing respiratory adenovirus 2

Adenovirus 2 has been shown in the literature review in Chapter 1 to be the most resistant virus to chloramines and hence is the virus of choice for chloramine inactivation studies. To determine the best cell line to use for adenovirus 2 plaque assays for chloramine inactivation Ct experiments, three commonly used cell lines were tested for their ability to form plaques. PLC/PRF/5 was the most efficient cell type for plaque assays compared to A549 and BGM (Table 3.1D). These results are similar to published studies for adenovirus 40 and 41 which demonstrate poor growth of adenovirus 2 in BGM cells (a monkey kidney cell line), while improved detection was observed in A549 (a more relevant respiratory tract cell line, as adenovirus 2 is a respiratory virus) and the liver PLC/PRF/5 cell (89% and 100% respectively). The reason for the exceptional susceptibility of the PLC/PRF/5 cell line to adenovirus in this study and others has not been defined and was only been investigated due to its reported sensitivity to various enteric viruses (Grabow, Puttergill et al., 1992; Rodriguez, Gundy et al., 2008) .

Table 3.1D Adenovirus 2 enumeration using PFU method in three cell lines 2 Cell type 3 Adenovirus 2 PFU/ml (% detection)

BGM Could not be determined A549 8.9 x 108 ± 4 x 107(89%)

PLC/PRF/5 1 x 109 ± 1 x 108(100%) Done in triplicate with mean results shown

Outcome

The best cell line for adenovirus 2 plaque formation was PLC/PRF/5 with A549 being the next suitable cell line. Traditionally A549 (a respiratory cell line) has been used for plaque


assays of this respiratory virus and because these cells are a far more rapidly growing cell type and can be easily cultivated to high numbers this was selected as the cell line of choice for work completed in Chapter 5 (monochloramine inactivation of adenovirus 2.

3.2 Evaluation of virus culture method

Optimisation of the virus inoculation conditions was undertaken to test inoculum volumes and centrifugation (as used in the clinical laboratories) for maximum virus adsorption onto cells. The aim was to gain higher yields of all viruses in WW. This was done by trialing the methods with laboratory cultures of known titre for CB5 virus (2.4 x 106 PFU/mL) and poliovirus (1 x 104 PFU/mL) spiked into 10 L secondary treated WW (Bolivar sample point 4004 previously found negative for enterovirus by culture), mixed and left at 4°C overnight. The virus was recovered from 750 mL WW using the direct PEG precipitation.

Virus titres in the WW sample (calculated using MPN/10 L quantitation formulas) were enumerated under three assay conditions using inoculation of 24 well tissue culture plates containing a confluent layer of BGM or PLC cell lines. Assay conditions were:

(A) Standard volume: 500 µL of spiked water samples (with incubation at 370C for 90 minutes and rocking at 10 minute intervals)

(B) Reduced volume: A reduced inoculum volume of 100 µL of spiked water sample allowing increased contact between virus and cell (with incubation at 370C for 90 minutes and rocking of plates at 10 minute intervals), and

(C) Centrifugation of 500 µL of spiked water sample (a procedure routinely done in clinical laboratories) onto cells at 900g for 1 hr (with incubation at 370C for 90 minutes, and rocking of plates at 10 minute intervals).

BGM and PLC/PRF/5 cell lines as shown previously (Table 3.1 A and B) were used for optimal isolation of both the enteroviruses. Using a lower volume of inoculum (method B) increased virus recovery 30 fold while the centrifugation (method C) enhanced virus recovery still further (Table 3.2).


Table 3.2. Virus recovery from spiked secondary treated WW using three viral inoculation methods

Spiked Virus (PFU) in 10L of secondary WW

Cell Type

A Standard vol.

MPN/10L ± SD (% recovery)

B Reduced vol. MPN/10L± SD (% recovery)

C Centrifugation MPN/10L ± SD (% recovery)

2.4 x 106 CB5 BGM 2 x 104 ± 6.3 x 103 (0.83 %)

7.3 x 105 ± 7.3 x 104 (30%)

9.5 x 105± 6.3 x 104

(39%) 2.4 x 106 CB5 PLC 2 x 104 ± 5.4 x 103

(0.83%) 7.6 x 105± 3.6 x 104

(31.6%) 1.1 x 106 ± 4.3 x 105

(45.8%) 1 x 104 poliovirus BGM 2 x 102 ± 4.3 x 10

(2%) 2.9 x 103± 3.9 x 102

(29%) 5.1 x 103± 3.3 x 102

(51%) 1 x 104 poliovirus PLC 1.5 x 102 ± 5.5 x 10

(1.5%) 3.0 x 103± 6.3 x 102

(30%) 5.0 x 103± 5.6 x 102

(50%) *Done in triplicate with mean results shown. Note that no enterovirus was detected in the unspiked water, which was used as a negative control.

Outcome

Centrifugation has not been used in the literature for plaque assays and there may be possibility of virus aggregation during the actual centrifugation step, which would decrease the plaque numbers (Dr. T-W. Kok, Institute of Medical and Veterinary Science, Adelaide, pers. Comm., 2009). However in the MPN method (Table 3.2) virus clumping during centrifugation (which will only occur once the inoculum is in the well) would not hinder the actual counts as this method relies on positive wells rather than individual cells. Therefore, in Chapters 4 and 5 the assays would be used as follows: lower volume inoculums for plaque assay and centrifugation for MPN calculation.

3.3 Optimised methods of concentrating viruses from WW samples

Three 10 L WW samples from BWTP (sample point 4004) were spiked with 4.5 x104 PFU/ 10 L of laboratory cultured CB5 virus. Two methods of virus concentration were assessed for their efficiency in concentrating virus in these water samples:

(1) Use of ultra-filtration (Hemoflow F filters) to filter 9.25 L of the 10 L spiked WW sample. The viruses are entrapped in the cartridge fibers of the Hemoflow F filters, followed by elution using carbonate buffer, and further concentration by PEG precipitation to produce a final volume of 40 mL.

(2) Concentration directly by PEG precipitating the remaining 750 mL of the spiked water to give a final volume of 40 mL.

The concentrated water samples were diluted and inoculated onto the PLC/PRF/5 cell line to determine virus recovery levels using both MPN/10 L and PFU/10 L quantitation formulas. Alongside the spiked samples, a 10 L unspiked sample was also processed to determine the levels of native virus present in this water type. No enterovirus was detected in the control unspiked water samples.


Low recovery levels were observed using the conventional filtration method with 2-5% recovery of the spiked virus using the MPN method and 2% recovery using the PFU method (Table 3.3). Direct PEG precipitation method yielded at least 10 fold better recoveries than the conventional filtration method (Table 3.3) with 26-40% recovery using the MPN method and slightly lower recovery with PFU method (12-20%). The ultra -filtration method is dependent on the filter fibre wall being impermeable to virus particles by either retaining the virus within the fibres or viruses being adsorbed to the fibre wall (due to a combination of physical pressure and electrostatic forces). Retention of viruses from WW in these filters would be hindered by the presence of high levels of salts and particulates found within the WW matrix and also the surface charge of virus particles which varies greatly under these conditions and according to virus type and subtype. Direct PEG precipitation overcomes the limitations of the direct filtration method as it does not involve concentration of > 0.7L of WW at any one time and therefore concentrated WW matrix does not affect PEG precipitation. Outcome

Direct PEG precipitation gave 10 fold improvement in recovery than conventional filter methods. Hence, the PEG precipitation method was adopted for concentrating virus in WWs. Table 3.3 Comparison of conventional filter and direct peg concentration methods for recovery of CB5 virus from spiked water samples Sample Concentration

method MPN/10L ± SD (% recovery)

PFU/10L ± SD (% recovery)

1 Conventional filter 1.63 x 103 ± 2.3 ± 102(4%) 6.8 x 102 ± 1.6 ± 101 (2%) 2 Conventional filter 9.73 x 102± 3.6 ± 102 (2%) 6.8 x 102± 1.4 ± 101 (2%) 3 Conventional filter 2.3 x 103 ± 1.33 ± 102 (5%) 6.8 x 102 ± 3.3 ± 101 (2%) 1 PEG precipitation 1.78 x 104 ± 1.7 ± 103 (40%) 5.3 x 103 ± 1.3 ± 102 (12%) 2 PEG precipitation 1.17 x 104 ± 2.0 ± 103 (26%) 8.88 x 104± 1.8 ± 103 (20%) 3 PEG precipitation 1.7 x 104 ± 1.9 ± 103 (38%) 5.3 x 103 ± 1.0 ± 102 (12%)

Note – WW samples from BWTP (sample point 4004) was spiked with 4.5 x104 PFU/ 10 L of laboratory cultured CB5 virus.

3.4 Cell line selection for native virus isolation The numbers of human pathogenic viruses, including the culturable enterovirus and adenovirus, needed to be established in secondary treated WWs (i.e. after the activated sludge process). This was to determine whether enough of the culturable viruses were present to use in disinfection studies rather than spiking in laboratory cultured virus. Cell lines are fastidious in nature and can be easily affected by dramatic changes in pH, with an optimal range of pH 7.2-7.6. Cell lines may also be affected by the presence of microbial contaminants, yeasts, fungi or toxic chemicals present in WWs. We compared the use of PLC/PRF/5 cell lines with BGM and A549 to culture native adenovirus and enteroviruses from 4 Bolivar secondary treated WW samples (sample point 4004) collected over a 5 month period, that were concentrated by direct PEG precipitation.


These concentrated water samples were analysed by (RT-) PCR to determine presences of common viral genomes and bacteriophage. The specimens were also diluted and inoculated onto cells using our optimised methods. Cell monolayers were observed for CPE after three passages over 21 days as native virus are slower growing compared to laboratory strains. Cell monolayers were observed for CPE and were tested for the presence of adenovirus and enterovirus by PCR or RT-PCR respectively. Enterovirus genomes were not detected in any of the four samples in either the infected cell monolayers or in the original concentrates used to infect these cells. All four samples were positive for adenovirus in the original water concentrate samples used to infect the cell lines and in infected PLC/PRF/5 cell lines (Table 3.4). Results in PLC/PRF/5 cells demonstrated 30-60 MPN adenovirus/L, with confirmation of adenovirus in all samples by PCR. However only 1 out of 4 samples was positive for adenovirus in A549 and none were positive in the BGM cell line (Table 3.4). All wells, including monolayers that did not demonstrate CPE, were tested by PCR for the presence of adenovirus to assess the presence of non cytopathic enteroviruses or adenoviruses on the three cell types. No additional samples were found to be positive by PCR or RT-PCR. Although adenovirus was detected on each sampling occasion in PLC/PRF/5 cell line, the number of viruses present in the secondary treated effluent (30-60 MPN adenovirus/L) was not high enough to allow direct use of the waters in disinfection experiments. To effectively establish the Ct values for up to 4 log10 virus inactivation, we would require > 107 MPN/L. This is to eliminate a concentration process such as PEG and centrifugation, where large numbers of viruses are lost and where large variability would influence the results. As a result, the numbers of virus present in secondary treated WW are not at a level where naturally occurring viruses in WW could be utilised in these experiments. Spiking of laboratory cultured virus was necessary for the Ct experiments.

Table 3.4 Culturable virus concentrations from secondary treated WW obtained using PLC/PRF/5, A549 and BGM cell lines and the detection of enterovirus and adenovirus genomes in infected cells

Virus detection in PLC/PRF/5 cells

Virus detection in A549 Virus detection in BGM

Sample No./Date collected

MPN/L ± SD

Adenovirus confirmed

by PCR

MPN/L ± SD Adenovirus confirmed

by PCR

MPN/L Adenovirus confirmed by

PCR

1-30/11/09 35 ± 12 + 12 ± 2 + <0.96 -

2 -01/2/10 30 ± 8 + <0.96 - <0.96 -

3 -24/2/10 60 ± 16 + <0.96 - <0.96 -

4 -29/3/10 45 ±15 + <0.96 - <0.96 -


Outcome Adenovirus was detected on each sampling occasion in the PLC/PRF/5 cell line; therefore PLC/PRF/5 is the cell line of choice to determine virus numbers in the secondary treated WW. The numbers of culturable adenovirus and enterovirus were deemed too low to use as a virus source in disinfection experiments and thus laboratory cultured virus was recommended for use in determining the Cts for chlorine and chloramines experiments. 3.4.1 Levels of culturable enterovirus and adenovirus in Bolivar and Glenelg secondary treated wastewater Ct experiments require viruses to be at a concentration that can show a four log10 decrease in viruses. To determine levels of native viruses in secondary treated WW, samples from Bolivar and Glenelg were concentrated by PEG precipitation and inoculated onto PLC/PRF/5 cell lines using the optimised methods to determine MPN/L of adenovirus and enterovirus. Levels of adenovirus detected were low (30 – 200 MPN/L) and no enterovirus was detected in either samples as shown in Table 3.5. Data in the literature has been highly variable. The variability in detection was previously observed by Sedmak et al., 2005, over a 9 year period with many no detects observed in the data set and <0 to 102/L by culture in a Milwaukee, USA. Lewis and Metcalf (1988) demonstrated variable recovery of HAV (86%), human rotavirus (77%), simian rotavirus (87%) and poliovirus (68%) using PEG. Rodriguez et al., (2008) demonstrated improved detection of enteroviruses from WWs when PLC/PRF/5 cell line was used compared to the BGM cell line. Increased sensitivity of detection was observed for the detection of adenovirus, coxsackie A viruses, echoviruses and adenoviruses. The viruses at pH 8 would all be positively charged and render them more likely to be particle associated than free in solution and be recovered through PEG precipitation. The absence of enteroviruses in both the Glenelg and Bolivar samples on this occasion may be due to absence of the virus at significant concentrations in the WW (may be reflective of the viruses circulating in the community).

Table 3.5 Enumeration by MPN of native adenovirus and enterovirus in secondary treated WW

Sample location Adenovirus MPN/L Enterovirus MPN/L

Bolivar 30 ± 13 <0.96

Glenelg 200 ± 100 <0.96

*Done in triplicate with mean results shown here

Outcome

Due to the variation in virus recovery, and subsequent variability in culture, it was determined that the native virus would not be present at sufficiently high titre and reproducibly to be suitable for use in disinfection experiments. A range of viruses circulate in the community and consistency of the viruses present in WW cannot be assured. This would introduce additional variability into the Ct results. As a result, cultured virus would be used in laboratory experiments to determine Cts.


3.5 Bacteriophage numbers present in secondary treated wastewaters

Concentrated secondary WW samples used for adenovirus and enterovirus culture (above) were also used to determine bacteriophage numbers. F-RNA and somatic bacteriohage have been targeted due to their use as a surrogate for human enteric viruses. Phage numbers were 100 fold higher than adenovirus in these water types (Table 3.6) and are consistent with numbers reported in the literature (see Chapter 1 Review of Literature).

Table 3.6 Phage numbers in secondary treated WW Sample Location F-RNA phage (phage/L)

± SD

Somatic phage (phage/L)

± SD

Bolivar 5 x 105 ± 3.3 x 105 1.67 x 105± 1.3 x 105

Glenelg 5 x 103 ± 1 x 103 9 x 104± 2.3 x 104

*Done in triplicate, mean results shown here

Outcome

The numbers of phage, although higher than the culturable virus are still not sufficiently high to allow effective determination of disinfection Cts, hence cultured F-RNA phage spiking is required to determine up to 4 log inactivation Ct.

3.6 Polymerase chain reaction (PCR) detection and quantification of non-culturable and culturable viruses in secondary treated wastewaters Concentrated secondary WW samples (from Section 3.5) were used to determine viral genome numbers of non culturable viruses including norovirus and rotavirus as well as genome copy numbers for adenovirus, enterovirus and reovirus. Results show that the genome copy number of adenovirus was 1.59-2.8 x 105 genomes/L, in comparison to the culture results which were 30- 200 MPN/L adenovirus using PLC/PRF/5 cell line (Table 3.7).

Table 3.7 Common viral genome numbers in secondary treated WW samples from 5 Australian WWTPs

Sample Location

Adenovirus genome/L

Enterovirus genome/L

Reovirus genome/L

Norovirus genome/L

Rotavirus genome/L

F-RNA phage/L

Bolivar 1.59 x 105 0 3.7 x 108 2.7 x 105 1.63 x104 5.0 x 105

Bolivar (2) 9.3 x 106 0 0 2.0 x 103 >6.0 x 103 3.7x104

Glenelg 2.8 x 105 0 1.16 x 108 2.3 x 104 1.05 x 104 5.0 x 103

Cairns 8.1 x 105 ND ND ND ND ND

Brisbane 1.7 x 106 ND ND ND ND ND

ACT ND ND ND 4.0 x 103 ND 2.1 x 101

*Done in triplicates mean results shown here, ND = not detected


Outcome

Although high titres of a range of virus genomes were observed, the levels per litre were not high enough to determine Cts with up to 4 log10 inactivation through the disinfection experiments. Although, the viruses can be detected via (RT)-PCR, assessment of the inactivation of the virus is essential to determine effective Ct values, thus requiring a culture based technique. Complete degradation of the viral nucleic acid may not be guaranteed through exposure to the chlorine or monochloramine (Sobsey et al., 1998). Simonet and Gantzer (2006) demonstrated that the target fragment size for the RT-PCR was of importance for detection of poliovirus when inactivated by chlorine dioxide. Targeting the highly sensitive regions such as 5’ and 3’ UTR was suggested to avoid an overestimation of the risk of viral infection although the use of multiple RT-PCR amplification sites, larger RT-PCR genomic targets and immunocapture RT-PCR sometimes reduces, but did not eliminate, the discrepancy between loss of infectivity and loss of RT-PCR titre after treatment with free chlorine, chlorine dioxide and UV radiation (Sobsey et al., 1998).

3.7 Outcomes/Discussion

Evaluation of virus culture methods Virus culture methods were tested by assessing the infection of a number of viruses in a range of cell lines. Significant improvements were made in the detection of human infective viruses using the alternative cell lines PLC/PRF/5 and BGM as alternatives to the traditional cell lines LLC-MK2, Hep2a and MRC5 which are used at AWQC. - PLC/PRF/5 cell line is more sensitive than all other cell lines tested to both adenovirus

and enteroviruses. Our results are similar to other findings (Grabow et al., 1992; and Rodriguez et al., 2008).

- In this study it was determined that the two common enteroviruses, CB5 and polio viruses, show better recovery in PLC/PRF/5 when using the MPN method and similar levels of recovery when using the PFU method in BGM and PLC/PRF/5 cell lines. During the course of Chapter 3, both MPN and PFU methods of viral enumeration were used. From these results it was decided that when isolating native enteroviruses from WW samples using the MPN method, PLC/PRF/5 was the cell line of choice. When using cultured virus to determine PFU/ml in Ct experiments, BGM cells were the cell line of choice. The added advantage of using BGM cells for plaque assays in Ct experiments is the ease of culturing this cell line and its rapid growth compared to the PLC/PRF/5 cell line which is slower growing then BGM.

- In our study no enterovirus were isolated in any of the cell lines tested even though previous studies have shown that PLC/PRF/5 and BGM are the most sensitive cell lines. This was attributed to absence, or presence of very low levels, of enteroviruses in this water type as RT-PCR of the concentrated water samples used to infect these cells failed to pick up any enterovirus genome. This is unexpected as we would expect to isolate some level of enterovirus from WW samples.


- PLC/PRF/5 was most suitable to isolate native adenovirus in WW Numbers of human pathogenic viruses in WW

The numbers of human pathogenic viruses in WWs was established using both culture and (RT-) PCR. Although high numbers of virus genomes were observed for adenovirus and reovirus, detection via the culture method resulted in significantly lower numbers (approximately 3 log10 lower). In published work, adenovirus has been detected at <102 to 105/100 L by culture (Sedmak et al., 2005) and 105-108/100 L by direct PCR (Bofill-Mas et al., 2000). The genome method detects both infectious and non-infectious virus particles while culture detects only those viruses that are suited to the cell line utilised for culture. Although high numbers of genomes are present in secondary treated WW, determining inactivation is essential, hence genomic methods for enumeration cannot be used. As a result, the limited number of culturable viruses present in WW was not sufficiently high for determining Ct curves for up to 4 log inactivation with the disinfectants.

Bacteriophage numbers in secondary treated WW

Bacteriophage numbers in WW were significantly higher than the culturable human infective viruses in this study, 103-105 F-RNA phage/L. In comparison to previously published data, F-RNA numbers ranges between below detection to 107 PFU/L (Harwood et al., 2006). Bacteriophage are often utilised as a surrogate for viruses in WW treatment processes, although dissimilarity of disinfection kinetics for free chlorine limits their usefulness as surrogates for disinfection by free chlorination. However, bacteriophage disinfection kinetics for monochloramine are such that they have been identified as a conservative surrogate for monochloramine disinfection. The numbers of phage present in WWs range from 101 to 103 PFU/L. As such, the numbers of native bacteriophage in the WW are not high enough to be useful for determination of disinfection kinetics. The phage may, however, be useful in determining whether effective disinfection of virus is being achieved within particles present in the water. As such, during disinfection experiments samples will be processed using vortexing to break up particles and plated to estimate the remaining phage numbers within the particles. The same method will be applied to indigenous E. coli and tested using ColilertTM.


Chapter 4

Free available Chlorine disinfection of Coxsackie B5 virus (CB5)

The objective of Chapter 4 was to determine free available chlorine (FAC) Ct values for CB5 in different types of WW. CB5 is the most resistant strain of virus for FAC disinfection. It was determined that this would be the most appropriate virus for assessing chlorine kinetics as this would represent chlorine disinfection for all known viruses. However, the potential exists for these virus Cts to be conservative. Ideally, native virus present in intact particles in WW would be the most suitable to determine the efficacy of the current disinfection Ct targets that were established for drinking water in experiments that used BDF waters. This is not readily achievable as discussed earlier for a number of reasons including the variability of viruses circulating in the community, the number of viruses present in secondary treated WWs and the state in which the viruses are present in WW particulates and hence laboratory cultured CB5 was chosen as a model.

The selection of the culture technique for use in the disinfection experiments was determined based on the results achieved in Chapter 3. Enumeration of CB5 in a range of cell lines demonstrated that virus growth was most well established in BGM and PLC/PRF/5 cell lines using the plaque forming unit method (PFU). This method allows direct enumeration of the number of infectious virus particles when compared to the MPN method. MPN method provides wide confidence intervals while the PFU method provides direct enumeration and a tighter standard deviation/error. Although the recovery of CB5 by the BGM cell line was slightly lower than that of the PLC/PRF/5 cell line, because of the ready cultivability of BGM cells (PLC/PRF/5 cells are slower growing than BGM), it was determined that the BGM cell line would be utilised in preference to the PLC/PRF/5 cell line for the disinfection experiments using CB5 virus. Use of BGM cell lines also allows comparison of data from experiments herein to those published as BGM cell lines have routinely been used for CB5 virus enumeration in disinfection experiments (Black et al., 2009).

4.1 Effect of pH change for virus recovery? Change in pH of WW had no effect on virus recovery numbers

Cts were established in TDS, pH and turbidity adjusted secondary treated WW to reflect a range of recycled water qualities including 0.2, 2, 5 and 20 NTU and pHs 7, 8 and 9. CB5 is most often assumed to be present in clumps and thus more resistant to disinfection. Jensen et al., (1980) has shown purified CB5 aggregate rapidly after purification at all pHs. In this study filtered virus in cell culture supernatant was used without any further purification process. To determine if our stock virus clumped at different pHs, trials were performed by incubating known concentration of viruses for 2 hrs in two different water types at three different pHs (7, 8, and 9). No difference in virus PFU numbers were observed among the 3 pHs tested (Table 4.1). The water quality data used in these experiments is shown in Table 4.8 A-1 (unmodified WW - shaded).


However, there was at least a two-fold decrease in virus recovery from WW samples seen reproducibly in all these experiments (Table 4.1). The levels of inactivation of CB5 by WW alone was consistent among all turbidities (0.2 -20) tested and has not hindered the process of determining Ct as higher doses of virus inocula were added to the experimental flask to factor in the 2 fold decrease in virus infectivity. Survival values were calculated by comparison with the average number of viruses present in WW for the duration of the experiment, not on the initial titre (example: for inactivation of CB5 in WW of 0.2 NTU, pH 7 (Table 4.3), was based on the average virus titres in control flasks that had no FAC at time 0 (start of experiment) and time 30 minutes (end of experiment)). This allowed calculation of the Cts based on virus inactivation due to the presence of FAC rather than loss due to addition to WW. Virus numbers did not vary significantly during the 30 minute experiment at any turbidity (data presented in Tables 4.3–4.6 as PFU/mL at control time 0 and control time 30 minutes).

An additional sonication step (i.e. sonication for 1 minute using a low power sonic bath (Model Ney Ultra-sonik)) was also tested to determine if virus numbers increased due to breaking up of potential virus clumps but no difference in virus numbers were seen with the additional sonication step (Data shown in Table 4.1 and water quality data for the water type used in the sonication is presented in Table 4.8B-2 in this Chapter).

Table 4.1. Infectious CB5 numbers recovered after incubating for 2 hrs in 200 mL of water at three pHs. Average of triplicate experiments.

Water type Original inocula PFU/mL

Sonication pH 7 pH 8 pH 9

BDF 4 x 105 None 3.9 x 105 ± 100 3.95 x 105 ± 120 4 x 105 ± 0 WW 4 NTU 4 x 105 None 1.9 x 105 ± 50 2.0 x 105 ± 320 1.89 x 105 ± 90 WW20NTU 5 x 105 None 2.3 x 105 ± 6807 2.3 x 105 ± 10000 2.3 x 105 ± 3000 WW20NTU 5 x 105 Yes 2.2 x 105 ± 9080 2.3 x 105 ± 7360 2.4 x 105 ± 9000

4.2 Determination of CB5, Ct values for chlorine in BDF water for purposes of replicating published work (Black et al., 2009)

As discussed earlier, published Cts of CB5 have mainly been performed in buffered demand free (BDF) water. To determine if the techniques used in this study gave similar results to published work Cts for CB5 were determined at pH 9, 50C in BDF water as described by Black et al., (2009). The experimental method was executed as described by Black et al., (2009) however Ct calculations were done directly by determining the area under chlorine decay curve of chlorine concentration vs. time (Ho et al., 2006), (Appendix 1 shows an example of the calculation in detail) rather than the Efficiency Factor Hom (EFM) as used in the above paper. The EFM is a mathematical modelling method which uses FAC chlorine values determined at the beginning, middle and end of each experiment to extrapolate Cts values for log10 virus inactivation summarised in Black et al., (2009). The EFH model is particularly useful to extrapolate Ct values for viruses that do not achieve 4 log10 inactivation in the time frame being tested, which was not an issue in these experiments presented herein. The mean Ct values of triplicate experiments were similar to published results (Table 4.2)


demonstrating our methods and results were similar to that of published work, including the disinfection Cts of the type strain of virus in demand free water.

Table 4.2. Inactivation of CB5 using chlorine at 50C, pH 9.

Log 10 inactivation Mean Ct Values for using 1.5 mg/L FAC and 2.65 x 105

PFU/mL CB5

Published Ct values (Black et al., 2009) using 1 mg/L FAC and 3.6 x 105PFU/mL

CB5

2 14.49 14 3 18.30 18.7 4 22.13 22.9

4.3 Determination of Ct for CB5 in WW

For Ct experiments, cultured virus particles at a concentration of 4-5 x 105 PFU/mL were added to the test water and incubated at 10°C in a shaking water bath for at least 2 hours prior to the disinfection experiments. This allowed time for virus particles to interact with WW particulate matter within the test water; although it does not provide integration of virus into the potentially protected areas of the particles, it is still the best available model to imitate native virus conditions.

The chlorine concentrations added to the WW to ensure a measurable residual at the end of the experiment were 6.5 to 9 mg/L, depending on the turbidity of water. However, the FAC degraded rapidly when added to WW. For example in WW with 0.2 NTU, the FAC decreased from 6.5 mg/L to 3 mg within 30 seconds, at the 2.5 minute time point the residual decreased again to 2 mg/L and at 30 minutes the final residual was 0.39 mg/L (Appendix 1, Table A2). Note that chlorine concentration was measured at the shortest intervals practicable early in the experiment to avoid over estimation of the exposure of CB5 to chlorine.

For each of the WW types containing spiked CB5, log10 reduction values are shown in Tables 4.3 to 4.6 and graphs showing the survival curves are presented in Figure 4.1A and 4.1B. The raw data (plaque counts post chlorination) are presented in Appendix 2. The survival curves in Figure 4.1 show mainly linear inactivation of CB5 for most pHs at the lower turbidities (0.2-5 NTU), however, for 20 NTU, at all pHs tested the lines are non linear (curved). It has been previously shown that disinfection inactivation graphs cannot be used to predict the presence of aggregated or dispersed virus in suspensions (Jensen, Thomas et al., 1980) as both forms of virus can show linear or non linear inactivation kinetics.

The predominantly non linear virus inactivation curves in experiments with 20 NTU WW could be due to the possibility that the particulates present in these higher turbidity WW’s have shielded virus from disinfection at earlier time points resulting in delayed virus inactivation.


Table 4.3 Inactivation of CB5 using 6.50 mg/L of free chlorine at 10°C and pH 7, 8 and 9 in WW of 0.2 NTU

pH Time (minute)

Residual* ± std deviation

Titre (PFU/mL)* ± std deviation

Log 10 reduction

7 0.5 3.07±0.07 8443±2142 1.35 1 ND 2010±285 1.97 1.5 ND 17±7.5 4.03 2.5 2.00±0.10 0 >5 5 1.49±0.07 0 >5 10 0.99±0.06 0 >5 20 0.53±0.01 0 >5 30 0.37±0.02 0 >5 Control 0 NA 191000 ± 54065 NA Control 30 NA 186667 ± 23094 NA

8 0.5 2.86±0.31 166667±23713 0.07 1 ND 75467±15184 0.41 1.5 ND 23033±4661 0.93 2.5 2.06±0.36 5089±1148 1.59 5 1.62±0.30 253±98 2.89 10 1.18±0.24 0 >5 20 0.75±0.25 0 >5 30 0.49±0.14 0 >5 Control 0 NA 180000 ± 7000 NA Control 30 NA 210000 ± 17321 NA

9 0.5 3.42±0.01 135667±19629 0.16 1 ND 131100±23065 0.17 1.5 ND 82000±27622 0.38 2.5 2.61±0.03 13567±2136 1.16 5 2.18±0.04 822±277 2.38 10 1.74±0.03 18±4 4.04 20 1.22±0.06 0 >5 30 0.9±0.03 0 >5 Control 0 NA 195667 ± 7506 NA Control 30 NA 195667 ± 14012 NA


Table 4.4. Inactivation of CB5 using 6.87 mg/L of free chlorine at 10°C and pH 7, 8 and 9 in WW of 2 NTU

pH Time (minute)



Log 10 reduction

7 0.5 2.87±0.17 7555 ±1018 1.42 1 ND 978±39 2.31 1.5 ND 54±11.5 3.57 2.5 1.57±0.11 0 > 5 1.07±0.15 0 > 10 0.63±0.08 0 > 20 0.32±0.05 0 > 30 0.22±0.05 0 > Control 0 NA 201667 ± 14012 NA Control 30 NA 200000 ± 0 NA

8 0.5 2.71±0.06 100000±0 0.30 1 ND 93333±0 0.33 1.5 ND 27555±385 0.86 2.5 1.73±0.03 10000±0 1.30 5 1.26±0.08 1000±693 2.30 10 0.78±0.09 18±8 4.04 20 0.50±0.11 0 > 30 0.28±0.02 0 > Control 0 NA 190667 ± 4042 NA Control 30 NA 204333 ± 7505 NA

9 0.5 3.75±0.11 129000±3464 0.24 1 ND 108667±10263 0.31 1.5 ND 75567±10190 0.47 2.5 2.83±0.09 15089±423 1.17 5 2.39±0.04 1642±101 2.1 10 1.72±0.05 22±7.5 4.03 20 1.12±0.06 0 > 30 0.82±0.10 0 > Control 0 NA 229000 ± 10149 NA Control 30 NA 217667 ± 8083 NA


Table 4.5. Inactivation of CB5 using 6.87 mg/L of free chlorine at 10°C and pH 7, 8 and 9 in WW of 5 NTU

pH Time (minute)



Log 10 reduction

7 0.5 3.39 ± 0.029 7111 ± 3732 1.39 1 2.82 ± 0.618 3222 ± 1615 1.74 1.5 2.50 ± 0.057 27 ± 17 3.82 2.5 2.06 ± 0.048 0 > 5 1.63 ± 0.062 0 > 10 1.16 ± 0.037 0 > 20 0.63 ± 0.056 0 > 30 0.43 ± 0.029 0 > Control 0 NA 178000 ± 10149 NA Control 30 NA 173333 ± 13503 NA

8 0.5 3.75 ± 0.03 166333 ± 24132 0.07 1 3.32 ± 0.060 90900 ± 7889 0.33 1.5 3.05 ± 0.021 25133 ± 2873 0.89 2.5 2.68 ± 0.038 3644 ± 1239 1.73 5 2.22 ± 0.015 209 ± 43 2.97 10 1.71 ± 0.065 9 ± 8 4.34 20 1.12 ± 0.085 0 > 30 0.80 ± 0.059 0 > Control 0 NA 180667 ± 6028 NA Control 30 NA 210000 ± 17321 NA

9 0.5 4.16 ± 0.142 115233 ± 29713 0.22 1 3.79 ± 0.146 97567 ± 9877 0.30 1.5 3.56 ± 0.114 73233 ± 17840 0.42 2.5 3.23 ± 0.067 10867 ± 1963 1.25 5 2.73 ± 0.110 1063 ± 484 2.26 10 2.17 ± 0.086 9 ± 7.50 4.34 20 1.50 ± 0.067 0 > 30 1.05 ± 0.065 0 > Control 0 NA 197667 ± 4041 NA Control 30 NA 189000 ± 17088 NA


Table 4.6. Inactivation of CB5 using 9 mg/L of free chlorine at 10°C and pH 7, 8 and 9 in WW of 20 NTU

pH Time (minute)



Log 10 reduction

7 0.5 5.08±0.191 5555 ± 385 1.62 1 ND 2244± 380 2.01 1.5 ND 1022 ± 77 2.36 2.5 3.31±0.144 555 ± 39 2.62 5 2.39±0.178 129 ± 8 3.26 10 1.52±0.121 9 ± 8 4.43 20 0.74±0.133 0 > 30 0.42±0.029 0 > Control 0 NA 232333 ± 6807 NA Control 30 NA 231000 ± 3464 NA

8 0.5 4.62 ± 0.267 71111 ± 7698 0.51 1 ND 37778 ± 3849 0.79 1.5 ND 26000 ±1155 0.95 2.5 2.983 ± 0.267 8444 ± 770 1.44 5 2.113 ± 0.172 1067 ± 67 2.34 10 1.297 ± 0.110 162 ± 3 3.15 20 0.87 ± 0.170 13 ±0 4.25 30 0.487 ± 0.006 0 > Control 0 NA 230000 ± 10000 NA Control 30 NA 232333 ± 6807 NA

9 0.5 4.84 ± 0.043 97778 ± 7698 0.38 1 ND 84444 ± 7698 0.43 1.5 ND 57778 ± 3849 0.60 2.5 3.63 ± 0.086 32445 ± 2036 0.85 5 2.80 ± 0.071 9255 ± 385 1.38 10 1.96 ± 0.144 1200 ± 334 2.28 20 1.07 ± 0.069 62 ± 8 3.57 30 0.63 ± 0.025 9 ± 8 4.42 Control 0 NA 230000 ± 3000 NA Control 30 NA 229000 ± 3464 NA


Figure 4.1A Inactivation of spiked CB5, in WW of varying turbidity (0.2 and 2 NTU) at 10°C using 6.5 - 9 mg/L of free chlorine at pH 7, 8 and 9. The mean PFU/mL numbers of triplicate experiments for each time point has been used to plot the graphs.

0.00001

0.0001

0.001

0.01

0.1

1

0 1 2 3 4 5 6

Log

surv

ival

of C

B5

Time in mins post 6.5 mg/L chlorination

Virus survival NTU 0.2

pH 7

pH 8

pH 9

0.00001

0.0001

0.001

0.01

0.1

1

0 2 4 6 8 10 12

Log

sur

viva

l of C

B5


Virus survival NTU 2

pH 7

pH 8

pH 9


Figure 4.1B. Inactivation of spiked CB5, in WW of varying turbidity (5 and 20 NTU) at 10°C using 6.5 - 9 mg/L of free chlorine at pH 7, 8 and 9. The mean PFU/mL numbers of triplicate experiments for each time point has been used to plot the graphs.

0.00001

0.0001

0.001

0.01

0.1

1

0 2 4 6 8 10 12

Log

sur

viva

l of C

B5



pH 7

pH 8

pH 9

0.00001

0.0001

0.001

0.01

0.1

1

0 5 10 15 20 25 30 35

Log

sur

viva

l of

CB5

Time in mins post 9 mg/L chlorination


pH 7

pH 8

pH 9


Mean Ct values for disinfection of CB5 in recycled waters of turbidities 0.2-20 NTU and pH 7, 8 and 9 are provided in Table 4.7 and represented graphically in Figure 4.2(A and B). SA Department of Health have requested Cts presented in Table 4.7A to be analysed using linear regression equations and rounded off to whole numbers and these values are shown in Table 4.7B. As anticipated, increased pH of WW slowed disinfection, probably due to the known effect of pH on dissociation of HOCl to OCl- (the former the more powerful oxidant). Increases in turbidity (0.2 to 5 NTU) demonstrated only slightly increased Cts to achieve the required log10 inactivation; however the high turbidity (20 NTU) increased Ct > 2 fold for all tested pHs as seen in Table 4.7. Turbidity and ionic strength of water has been previously implicated in playing a role in the different inactivation rates of viruses in WW. Kahler et al., (2010) has reported no difference between increased turbidity and decreased reaction rate, when comparing 0.17, 0.55 and 0.60 NTU. This finding is not considered relevant to this report due to the low turbidities (≤ 0.6 NTU) investigated by Kahler et al., (2010) compared to those in this study. Turbidity (and water quality) plays a role in efficiency of virus disinfection. As discussed earlier ionic strength was kept relatively constant (570-630 mg/L) to ensure comparability of Ct values.

Black et al., (2009) investigated a range of viruses in BDF water at 5°C, pH 7.5 and 9. Cts for CB5 inactivation in BDF water at pH 9, and 5°C were determined to be 14 mg.minute/L for 2 log10 inactivation, 18.7 mg.minute/L for 3 log10 and 22 mg.minute/L for 4 log10 inactivation (Black et al., 2009)(Table 4.7A). In this study Cts of 14.06, 19.10 and 23.97 mg.minute/L are reported for 2 log10, 3 log10, and 4 log10 inactivation of CB5 respectively (Table 4.7A) tested at 0.2 NTU, pH 9 and 10°C in WW.


Table 4.7A. Calculated free chlorine Ct values by determining the integral of residual chlorine vs time of CB5 in WW of various turbidities and pH at 10°C

pH Log10 inactiva

tion



Ct (mg.min/L) 2 NTU


Ct (mg.min/L) 5 NTU




USEPA Guidance Manual Ct

value 7 1 2.05 2.13 2.24 2.55 2 3.29 3.37 3.71 5.95 3 3 4.41 4.75 4.88 16.47 4 4 5.44 5.46 5.99 25.81 6 8 1 5.72 6.67 7.78 7.99 2 9.6 10.32 13.16 15.09 3 3 12.8 12.90 17.79 24.81 4 4 15.49 15.68 21.94 34.52 6 9 1 8.25 8.94 9.66 13.70 2 14.06 *(14) 15.5 16.33 28.73 3 3 19.10 *(18.7) 20.88 22.03 41.32 4 4 23.97*(22) 26 27.93 51.89 6 * Cts in BDF water at pH 9 and 5°C as investigated by Black et al., (2009) for comparison with Cts in WW, at pH 9, 0.2 NTU and 10°C in this study

Table 4.7B. Calculated free chlorine Ct values by using the regression line equations derived from the Cts presented in (Table 4.7A and graphed in Fig 4.2)

pH Log10 inactivation



Ct (mg.min/L) 2 NTU


Ct (mg.min/L) 5 NTU




USEPA Guidance Manual Ct

value 7 1 3 3 3 3 2 4 4 4 9 3 3 5 5 5 17 4 4 6 6 7 25 6

8 1 7 7 9 8 2 10 10 13 17 3 3 13 13 18 26 4 4 16 16 23 34 6

9 1 9 10 10 15 2 14 16 16 28 3 3 19 21 23 41 4 4 25 27 29 53 6


Figure 4.2A. Free chlorine Cts required to inactivate 1 to 4 log10 of CB5 in WW of 0.2 NTU with initial chlorine dose of 6.5 mg/L, 2 NTU with 6.87 mg/L of chlorine, 5 NTU with 6.87 mg/L of chlorine.

y = 1.129x + 0.975R² = 0.9983

y = 3.251x + 2.775R² = 0.9933

y = 5.22x + 3.295R² = 0.9982

0

5

10

15

20

25

30

1 1.5 2 2.5 3 3.5 4

Ct m

g.m

in/L

Log reduction of CB5

NTU 0.2

pH 7

pH 8

pH 9

y = 1.137x + 1.085R² = 0.9843

y = 2.961x + 3.99R² = 0.9939

y = 5.656x + 3.69R² = 0.9965

0

5

10

15

20

25

30

1 1.5 2 2.5 3 3.5 4

Ct m

g.m

in/L


NTU 2

pH 7

pH 8

pH 9


Figure 4.2B. Free chlorine Cts required to inactivate 1 to 4 log10 of CB5 in WW of 5 NTU with 6.87 mg/L of chlorine and 20 NTU with 9 mg/L of chlorine.

y = 1.243x + 1.1R² = 0.9953

y = 4.708x + 3.39R² = 0.9967

y = 6.051x + 3.86R² = 0.9988

0

5

10

15

20

25

30

1 1.5 2 2.5 3 3.5 4

Ct m

g.m

in/L


NTU 5

pH 7

pH 8

pH 9

y = 8.03x - 7.38R² = 0.9634

y = 8.931x - 1.725R² = 0.9949

y = 12.713x + 2.125R² = 0.9938

0

10

20

30

40

50

60

1 1.5 2 2.5 3 3.5 4

Ct m

g.m

in/L


NTU 20

pH 7

pH 8

pH 9


Nitrogen compounds present in WW, particularly ammonia, react rapidly with chlorine (within a few seconds) forming monochloroamine, dichloramine and nitrogen trichloride. These combined chlorine residuals were also measured using the DPD method but were not used for Ct calculations in this study due to presence of low levels of these species and the fact they do not contribute substantially to disinfection in the short (30 minute) exposure time of these experiments. When there is an excess of ammonia ions present in water, monochloramine becomes predominant and this skews the detection of free chlorine using the DPD-FAS method. The results presented here were carried out in water with low ammonia levels (<0.5 mg/L) (Table 4.8A and B) such that chlorination went well beyond breakpoint. WWs generally have high ammonia levels but these studies were done in WW that had been processed through an ASP which reduced ammonia level to <0.5 mg/L (provided treatment processes were working adequately) and is ideal for these types of disinfectant experiments. Graphs of FAC and low levels of cumulative free chlorine species formed during the decay of chlorine when exposed to WW are shown in Figure 4.3(A to F) for each experiment. What is also observed is that at high pH values the FAC chlorine residual is a much higher level than at lower pH values. This is due to the known formation of the more stable hypochlorite ion (OCl-), however the disinfection efficacy of OCl- is inferior to the HOCl (which dissociates readily at higher pHs).


Figure 4.3A. Chlorine species decay curves for Ct experiments in WW of turbidities of 0.2 and 2 NTU and pH 7 at 10°C. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine, and “total” represent a cumulative value of all chlorine species (see Appendix 3 for chlorine decay data).

0

1

2

3

4

5

6

7

0 5 10 15 20 25 30 35

Chlo

rine

spec

ies m

g/L

Time in mins 6.5 mg/L chlorination

Chlorine decay curves for WW NTU 0.2 pH 7

FAC

FAC + mono

Total

0

1

2

3

4

5

6

7

8

0 5 10 15 20 25 30 35

chlo

rine

spec

ies m

g/L


Chlorine decay curves for WW NTU 2 pH 7

FAC

FAC + mono

Total


Figure 4.3B. Chlorine species decay curves for Ct experiments in WW of turbidities of 5 and 20 NTU and pH 7 at 10°C. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine, and “total” represent a cumulative value of all chlorine species (see Appendix 3 for chlorine decay data).

0

1

2

3

4

5

6

7

8

0 5 10 15 20 25 30 35

Chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total

0

1

2

3

4

5

6

7

8

9

10

0 5 10 15 20 25 30 35

Chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total


Figure 4.3C. Chlorine species decay curves for Ct experiments in WW of turbidities of 0.2 and 2 NTU and pH 8 at 10°C. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine, and “total” represent a cumulative value of all chlorine species (see Appendix 3 for chlorine decay data).

0

1

2

3

4

5

6

7

0 5 10 15 20 25 30 35

Chlo

rine

spec

ies m

g/L

Time in mins 6.5 mg/L


FAC

FAC + mono

Total

0

1

2

3

4

5

6

7

8

0 5 10 15 20 25 30 35

chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total


Figure 4.3D. Chlorine species decay curves for Ct experiments in WW of turbidities of 5 and 20 and pH 8 at 10°C. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine, and “total” represent a cumulative value of all chlorine species (see Appendix 3 for chlorine decay data).

0

1

2

3

4

5

6

7

8

0 5 10 15 20 25 30 35

chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total

0

1

2

3

4

5

6

7

8

9

10

0 5 10 15 20 25 30 35

chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total


Figure 4.3E. Chlorine species decay curves for Ct experiments in WW of turbidities of 0.2 and 2 NTU and pH 9 at 10°C. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine, and “total” represent a cumulative value of all chlorine species (see Appendix 3 for chlorine decay data).

0

1

2

3

4

5

6

7

0 5 10 15 20 25 30 35

Chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total

0

1

2

3

4

5

6

7

8

0 5 10 15 20 25 30 35

Chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total


Figure 4.3F. Chlorine species decay curves for Ct experiments in WW of turbidities of 5 and 20 NTU and pH 9 at 10°C. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine, and “total” represent a cumulative value of all chlorine species (see Appendix 3 for chlorine decay data).

0

1

2

3

4

5

6

7

8

0 5 10 15 20 25 30 35

chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total

0

1

2

3

4

5

6

7

8

9

10

0 5 10 15 20 25 30 35

chlo

rine

spec

ies m

g/L



FAC

FAC + mono

Total


4.4 Water quality characteristics and trouble shooting Initially the experimental plan involved collecting water from Bolivar sample point 4004 and storing at 4°C over a two month period to be able to carry out all experiments with the same batch of water. This plan had to be aborted after 6 experiments as water quality characteristics were found to change during storage of water greater than 7 days affecting the Cts (data not shown) due to an increase in ammonia concentration with storage. Experiments had to be repeated using water stored for no more than 7 days. Therefore a fresh batch of water had to be used for each turbidity tested requiring 4 different batches of water.

Water quality characteristics (of water used to generate Cts in Table 4.7) unmodified and the modified are provided in Table 4.8. The quality of water did not vary greatly between the collection days and was reasonably stable during storage for up 7 days. The first batch was collected on 10/3/11 and was used to test 5 NTU, (pH 7, 8 and 9), the second batch was collected 12/4/11 and used to test 0.2 NTU ( pH 7, 8, 9), the third batch was collected 31/5/11 and used to test 2 NTU, (pH 7, 8, 9) and the last batch was collected 14/6/11 used to test 20 NTU (pH 7, 8 and 9). Turbidity adjustment was performed by either dilution or addition of concentrated turbidity isolated from WW (which affects water quality) to the required higher turbidity levels. Characterisation of turbidity was also done by analysing the organic and inorganic nature of modified and unmodified waters (Table 4.8) and particle sizing using laser liquid optical particle counter (Figure 4.4) showing normal distribution of the particle sizes in modified water but numbers varied depending on type of modification.

Up to 5L of each water-type was required on the day of testing for characterising the water quality (Table 9). Obtaining large volumes of water with turbidity of 0.2 and 2 NTU was done by dilution and therefore a relatively simple task. However it was time consuming to obtain enough particulate matter to generate high turbidity waters such as 5 NTU (which required filtering up to 30L of water) and 20 NTU (required filtering up to 90L of water).

Turbidity generated by collecting particulates also had an effect on water characteristics particularly ammonia levels. The concentrated particulates when stored at 4°C generated high levels of ammonia (> 2 mg/L) as it was a concentrated bacterial source and contained high levels of organic nitrogen. When used in the disinfection experiments, the high ammonia levels resulted in the formation of high levels of monochloramines (and other species of chloramines) with negligible FAC detection during the experimental period. Thus to ensure the presence of FAC and avoid high levels of monochloramine, the 20 NTU experiments were repeated using particulate matter that was stored for less than 4 days. To obtain water with turbidity of 20 NTU for determining Ct (as shown in Table 8), 110 L of water was collected form Bolivar on the 14/6/11, 80L of this water was filtered over 3 days and the particulate matter collected was added to the remaining water to obtain the desired turbidity of 20 NTU. The virus disinfection experiments were performed on 17/6/11 and therefore water and particulate matter were only stored for a period of 4 days maximum with resultant ammonia levels <0.5 mg NH3-N/L (Table 4.8A-2).

The pH adjustment varied in experiments and proved difficult for WW experiments. Addition of chlorine (6.5 – 9 mg/L to satisfy demand and provide a FAC residual) to WW initially decreased pH and during the shaking incubation at 10°C for 30 minutes the pH levels tended to increase (Table 4.8). Chlorine was applied in the form of chlorine water stock


solution, based on gaseous chlorine and ultra pure water, which explains the generally observed decrease in the pH of WW due to formation of HCl. As chlorine gas is dissolved in water, it hydrolyses rapidly according to this equation: Cl2 + H2O → H+ + Cl- + HOCl. In these experiments pH was maintained ± 0.5 for the required pH. Initial pH was read within 2 minutes post chlorination in a sample flask (set up similar to test flask). The delayed pH reading time depended on how long it took for the pH meter to give a stabilised reading due to the presence of high ionic solutes present in these types of waters. Final pH readings were taken from the 3 test flasks (in succession) 30 minutes post chlorination. The 20 NTU waters were the most difficult to obtain readings from as the pH meter took a lot longer to stabilise i.e. 3-4 minutes. It is important to note pH changes observed in these experiments were only observed in WW that was diluted to lower TDS and was not observed in undiluted WW or at treatment plants. Dilution of WW diluted its buffering capacity.

As discussed earlier, to date only limited disinfection work has been carried out in water other than buffered demand free water and therefore the problems observed with this water type were not predicted and had to be addressed as they arose.

Table 4.8A-1. Bolivar lagoon influent water quality chemistry (unmodified) Date water collected 12/4/11 12/4/11 12/4/11 31/5/11 31/5/11 31/5/11 Date water tested

14/4/11 19/4/11 21/4/11 2/6/11 3/6/11 6/6/11

Ammonia mg/L <0.5 <0.5 <0.5 <0.5 <0.5 <0.5 Nitrate + Nitrite as N mg/L

ND ND ND 19.7 19.3 19.2

Phosphorous mg/L 0.560 0.763 0.763 3.03 2.90 2.66 TKN mg/L 2.84 3.65 3.65 3.95 4.50 11 DOC mg/L 16.8 15.4 15.4 17.4 17.6 17.7 TOC mg/L 18.5 17.8 17.8 20 19.8 20 TDS mg/L 990 980 980 970 980 970 BOD mg/L 2 6 6 8 6 5 COD mg/L 52 71 71 63 54 98 SS mg/L 5 10 10 12 9 11 VSS mg/L 5 7 7 10 8 10 *The shaded results section represents the same water modified below to give 0.2 NTU *The unshaded section is the same water modified below to give 2 NTU ND = not done


Table 4.8A-2 Modified Bolivar lagoon influent water quality chemistry Date water collected 12/4/11 12/4/11 12/4/11 31/5/11 31/5/11 31/5/11 Date filtered 13/4/11 13/4/11 13/4/11 N/A N/A N/A Date tested 14/4/11 19/4/11 21/4/11 2/6/11 3/6/11 6/6/11 NTU 0.2 0.2 0.2 2 2 2 pH to be tested 7 8 9 7 8 9 pH adjusted pre-chlorination

7.8 8.9 9.6 7.7 9.2 9.8

pH few minutes post-chlorination

7.17 7.74 9.18 6.87 7.6 9.2

pH 30 minutes after chlorination 3 flasks

7.3-7.4 8.1-8.3 8.9-9 7.4-7.5 7.8-7.9 8.97-9

Nitrate + Nitrite as N mg/L

ND ND ND 12.4 12.2 11.8

Ammonia mg/L <0.5 <0.5 <0.5 <0.5 <0.5 <0.5 Phosphorous mg/L 0.221 0.221 0.248 1.78 1.73 1.87 TKN mg/L 1.85 1.85 1.67 2.51 2.43 2.34 DOC mg/L 9.4 9.4 9.7 10.6 10.9 10.8 TOC mg/L 9.8 9.8 10 12.1 12 11.8 TDS mg/L 570 570 580 610 630 620 BOD mg/L <2 <2 <2 5 4 4 COD mg/L 27 27 104 24 40 78 SS mg/L <1 <1 <1 10 5 6 VSS mg/L <1 <1 <1 8 4 6 ND = not done Table 4.8B-1. Bolivar lagoon influent water quality chemistry (unmodified) Date water collected

10/3/11 10/3/11 10/3/11 14/6/11 14/6/11 14/6/11

Date water tested

11/3/11 15/3/11 18/3/11 17/6/11 17/6/11 17/6/11


ND ND ND 23.7 23.7 23.7

Ammonia mg/L <0.5 <0.5 <0.5 <0.5 <0.5 <0.5 Phosphorous mg/L 1.08 0.959 1.06 4.79 4.79 4.79 TKN mg/L 3.48 3.25 3.18 3.21 3.21 3.21 DOC mg/L 14.2 14.2 14.4 13.8 13.8 13.8 TOC mg/L 16.3 16 16.5 15.4 15.4 15.4 TDS mg/L 980 980 970 890 890 890 BOD mg/L 8 7 5 5 4 4 COD mg/L 44 73 61 69 69 69 SS mg/L 10 11 12 8 8 8 VSS mg/L 4 7 8 7 7 7 *The shaded results section represents the same water modified below to give 5 NTU *The unshaded section is the same water modified below to give 20NTU ND = not done


Table 4.8B-2. Modified Bolivar lagoon influent water quality chemistry. Date water collected 10/3/11 10/3/11 10/3/11 14/6/11 14/6/11 14/6/11 Date filtered N/A N/A N/A N/A N/A N/A Date tested 11/3/11 15/3/11 17/3/11 17/6/11 17/6/11 17/6/11 NTU 5 5 5 20 20 20 pH to be tested 7 8 9 7 8 9 pH adjusted pre- chlorination

7.6 8.9 9.7 7.7 9.2 9.8

pH few minutes post-chlorination

6.9 7.764 8.85 6.78 7.6 8.867

pH 30 minutes after chlorination 3 flasks

7.2-7.4 7.89 8.5-8.6 7.1 7.6-7.9 8.6-8.7


ND ND ND 15.9 15.9 15.9

Ammonia mg/L <0.5 <0.5 <0.5 <0.5 <0.5 <0.5 Phosphorous mg/L 0.724 0.718 0.705 4.09 4.09 4.09 TKN mg/L 2.28 2.16 2.09 6.18 6.18 6.18 DOC mg/L 8 7.7 7.8 9.1 9.1 9.1 TOC mg/L 9.6 8.9 9 13.4 13.4 13.4 TDS mg/L 560 600 570 560 560 560 BOD mg/L 6 8 4 16 16 16 COD mg/L 42 103 72 79 79 79 SS mg/L 16 10 8 44 44 44 VSS mg/L 9 9 6 43 43 43 ND = not done


Figure 4.4 Analysis of modified and unmodified water sample particle sizing using laser optical counters for waters set at turbidity 0.2, 2.0, 5.0 and 20 NTU (sizing range from 0.5 – 20 µm).



The results of this study demonstrate that CB5 can be effectively disinfected in waters destined for recycling at varying turbidity but require higher chlorine Cts to factor in the chlorine demand of the WW. This can be achieved by using higher chlorine doses or longer contact times to give higher Cts. The lower turbidities particularly 0.2 and 2 NTU showed no significant difference in Cts. Ct data for 0.2 and 2 NTU have now been combined to represent WW of 0.2 to 2 NTU. As a result monochloramine experiments in chapter 5 were only done using WW of 2 NTU which would represent WWs of 0.2-2 NTU based on the observation of free chlorine work in this chapter.

There has been a lack of data for the determination of Ct requirements for the inactivation of viruses in water where turbidity is greater than 1 NTU, which is directly applicable to recycled WW. There is a general need for relevant data to provide the basis for the development of guidelines required to adequately disinfect viruses in WW to provide an essential barrier against transmission of waterborne viruses. To determine Cts for inactivation of viruses by chlorine in WW requires relevant data using viruses found in WW that are particularly chlorine resistant. CB5 has been reported to have high free chlorine resistance (Black et al., 2009, Liu et al., 1971, Payment et al., 1985) and was hence used to determine Cts required to inactivate these viruses in WW. Cts obtained for inactivation of 4 log10 (99.99%) increased with pH and turbidity as anticipated and exceeding recommended Cts required for disinfecting drinking water (USEPA, 1999). These results show water quality can significantly affect disinfection efficacy of chlorine. The free chlorine demand of the test waters needed to be satisfied before a disinfection residual was measurable.

The United States Environmental Protection Agency’s (USEPA, 1999) recommends disinfection Ct values of 3, 4, and 6 to achieve 2, 3 and 4 log10 inactivation of viruses, respectively with chlorine at 10°C and pH 6 to 9. These guidelines are based on experiments conducted with mono dispersed hepatitis A virus in buffered demand free water and include a safety factor of 3. The data in this study demonstrate that the Cts defined for the drinking water processes (using hepatitis A virus) do not achieve the same level of inactivation of CB5 in a range of WWs. These results suggests that at pH levels greater than 7 and NTU ≥ 2 longer contact times will be required to achieve adequate disinfection of viruses, especially if 3 and 4 log10 reduction of viruses are required. These results also demonstrate that it is possible to disinfect a highly resistant virus such as CB5 at turbidities up to 20 NTU. The particles causing turbidity were predominantly 3 µm in size and organic in origin.


Chapter 5

Monochloramine disinfection of adenovirus 2

The objective of Chapter 5 was to determine monochloramine Ct values for adenovirus 2 in different types of WW. Adenovirus 2 is the most resistant strain of virus for monochloramine disinfection identified to date. It was determined that this would be the most appropriate virus for assessing chloramine kinetics as this would represent monochloramine disinfection for all known viruses. However, the potential exists for these virus Cts to be conservative. Ideally, native virus present in intact particles in WW would be the most suitable to determine the efficacy of the current disinfection Ct targets that were established for drinking water in experiments that used BDF waters. This is not readily achievable as discussed earlier for a number of reasons including the variability of viruses circulating in the community, the number of viruses present in secondary treated WWs and the state in which the viruses are present in WW particulates and therefore laboratory cultured adenovirus 2 was chosen as a model.

The selection of the culture technique for use in the disinfection experiments was determined based on the results achieved in Chapter 3. Enumeration of adenovirus 2 in a range of cell lines demonstrated that virus growth was most well established in A549 cell lines using the plaque forming unit (PFU) method. This method allows direct enumeration of the number of infectious virus particles as compared to the MPN method. MPN method provides wide confidence intervals while the PFU method provides direct enumeration and a tighter standard deviation/error.

5.1 Problems with monochloramine formation in situ

Chloramines are formed by the reaction of ammonia with aqueous chlorine (HOCl) as discussed in Chapter 1. The mixture that results contains monochloramine (NH2Cl), dichloramine (NHCl2), or nitrogen trichloride (NCl3). Monochloramine is the preferred chloramine species for disinfecting drinking water (and WW), as this is more stable than other chlorine species. In aqueous solutions with pH 7-8.5, HOCl reacts rapidly with ammonia to form inorganic chloramines in a series of competing reactions. These competing reactions are primarily dependent on pH and controlled to a large extend by the chlorine:ammonia nitrogen (Cl2:N) ratio. Monochloramine is predominantly formed in pH range of 6.5-8.5 when the applied Cl2:N ratio is less than 5:1 by weight. This study adopted a 4:1 ratio for in situ formation of monochloramine.

An initial attempt was made to determine adenovirus Ct values by using the field approach for formation of monochloramines in WW at pH 7 and 9. Most WWTPs operate within this range. The aim of these experiments was to mimic field conditions giving more accurate and reasonable calculated Cts, however, due to issues discussed below we could not proceed further with these experiments.


In our experiments virus plaque counts within 0.5 minutes post application of free chlorine to ammonia containing WW resulted in a decrease of adenovirus 2 from 106 PFU/mL to 102 PFU/mL for pH 7 (3 mg of free chlorine) and even higher levels of inactivation were seen with increased chlorine concentration as shown in (Table 5.1A). This high degree of inactivation of adenovirus 2 observed at the 30 second time point at pH 7 is not consistent with published data for virus exposed to preformed monochloramine. The initial inactivation must therefore be attributed to exposure to HOCl (free available chlorine) during monochloramine formation, a process described in the USEPA Disinfection Benchmarking Guidance Manual, 1989 for drinking water). Monochloramine formation is pH sensitive. According to White (1992) it takes 0.2 seconds to form monochloramine at pH 7 and 0.069 seconds at pH 8.3 in water of drinking water quality. The times will vary in WW (and may take up to 1-3 minutes). HOCl is less effective in its disinfection properties at pH 9 and therefore only a 1 log10 decrease in virus numbers were observed at pH 9 post chlorination at the 30 second time point (Table 5.1B).

Adenovirus 2 virus was chosen for this study because it has a high level of resistance to monochloramine, however, it is one of the most sensitive viruses to chlorine inactivation (Ct value for 4 log10 inactivation with chlorine at pH 7 and pH 8 was published to be 0.15 and 0.27 mg.min/L respectively in BDF water at 5°C (Cromeans et al., 2010)). Therefore it was decided that the application of preformed monochloramines would be utilised in these studies rather than the 2 step process due to the sensitivity of the virus to free chlorine. In addition, the amount of exposure to free chlorine will be influenced by mixing regime which will vary from treatment plant to treatment plant and is not easy to define. Use of preformed monochloramine will be comparable with USEPA values and will also be conservative, protecting human health.

Experiments from here on in this report have used preformed monochloramine to determine Ct values for inactivation of adenovirus 2.


Table 5.1A: Inactivation of adenovirus 2 after dosing with 3-9 mg of chlorine to flasks containing virus and ammonia spiked WW (dosed with ammonia in a 1:4 ammonia:chlorine

ratio) at pH 7 and 10°C Time Post addition of chlorine (minute)

PFU/mL (3mg Chlorine)

*Mono mg/L


*Mono mg/L


Mono mg/L

Control (Time 0)

1.06 x 106 1.2 x 106 9.3 x 105

0.5 2.66 x 102 - 80 - 53.3 - 1 2.40 x 102 2 80 4.56 53.3 7.94

1.5 2.66 x 102 - 80 - 53.3 - 2.5 2.40 x 102 2 80 4.29 53.3 7.94 5 2.40 x 102 1.92 80 4.22 53.3 7.7

10 1.33 x 102 1.88 80 4.22 53.3 7.7 20 - - - - 53.3 7.68

Control (Time 20)

9.3 x 105 1.06 x 106 9.3 x 105

*Mono represents monochloramine. No free available chlorine (FAC) was detected at any time point. Control - virus numbers are from the chlorine free control flasks. (-) Not done

Table 5.1B: Inactivation of adenovirus 2 after dosing with 3-6 mg of chlorine to flasks containing virus and ammonia spiked WW (dosed with ammonia in a 1:4 ammonia chlorine

ratio) at pH 9 and 10°C Time post addition of

chlorine (minute)


Total *Mono mg/L


Total *Mono mg/L

Control (Time 0)

9.3 x 105 9.3 x 105

1 6.67 x 104 2.34 2.13 x 104 5.3 2.5 6.67 x 104 2.35 1.87 x 104 5.3 5 5.33 x 104 2.28 1.60 x104 5.25

10 6.67 x 104 2.24 1.46 x 104 5.20 20 6.67 x 104 2.22 1.60 x104 5.1 30 6.67 x 104 2.22 1.33 x 104 5.00 60 6.67 x 104 2.21 1.33 x 104 4.95 90 1.33 x 104 2.22 6.66 x 103 4.90

Control (Time 90)

9.3 x 105 8 x 105

*Mono represents monocloramine. No free available chlorine was detected at any time point. Control - virus numbers are from the chlorine free control flasks


5.2 Determination of Ct for adenovirus 2 in WW using preformed monochloramine

For Ct experiments, cultured virus particles at concentration of 6-9 x 105 PFU/mL were added to the test water and incubated at 10°C for at least 16-18 hrs prior to the disinfection experiments. This allowed time for virus particles to interact with WW particulate matter within the test water; although it does not provide integration of virus into the potentially protected areas of the particles, it is still the best model to imitate native virus conditions.

Preformed monochloramine concentrations added to flasks were 15 to 16 mg/L depending on the turbidity and demand of the water with residuals measured at 24 hours of 12-14 mg/L. As expected monochloramine did not degrade rapidly when added to WW. For each of the WW types containing spiked adenovirus 2, log10 reduction values are shown in Tables 5.3-5.5 and graphs showing survival curves are presented in Figure 5.1. The raw data (plaque counts post chloramination) are presented in Appendix 5.

The survival curves in Figure 5.1 show linear inactivation of adenovirus 2 for all pHs tested (i.e. 7, 8, 9) for experiments conducted using 2 NTU WW, and only for pH 7 and 8 for experiments done at 5 NTU. Data for all pHs tested using 20 NTU WW and pH 9 using 5 NTU WW are non linear (i.e. curved). Predominantly non linear virus inactivation curves in experiments with 20 NTU water may be due to the particulates present in the higher turbidity WW’s which have shielded of the virus from disinfection at earlier time points resulting in delayed virus inactivation. A lag phase of virus inactivation is seen with all turbidities and pHs of WW tested followed by a steady rate of inactivation similar to a published study by (Sirikanchana et al., (2008).


Table 5.3. Inactivation of adenovirus 2 using 15 mg/L of preformed monochloramine at 10°C, pH 7, 8 and 9 in WW of 2 NTU turbidity

pH Time (minute)

NH2Cl residual* ± std deviation


Log 10 reduction

7 5 13.43 ± 0.1102 209000±15589 0 10 13.51 ± 0.0231 200000±0 0.002 30 13.46 ± 0.0400 75556±10183 0.425 60 13.43 ± 0.0611 38889±1678 0.713 90 13.36 ± 0.0529 18000±667 1.048 120 13.22 ± 0.0400 2511±402 1.904 150 13.07 ± 0.0306 851±103 2.373 240 12.59 ± 0.1273 0±0 >4.26 Control 0 NA 200000±0 NA Control 360 NA 202222±3810 NA

8 5 13.91 ± 0.0115 222222±21430 -0.010 10 13.89 ± 0.0115 220000±17638 -0.007 30 13.77 ± 0.0462 220000±17638 -0.007 60 13.69 ± 0.0611 117778±13877 0.265 90 13.59 ± 0.0115 75443±3950 0.458 120 13.54 ± 0.0231 13334±2404 1.21 150 13.33 ± 0.0400 8446±2035 1.409 240 13.15 ± 0.0702 129±21 3.226 300 13.15 ± 0.0503 16±3.464 4.13 360 12.97 ± 0.1301 0±0 >5 Control 0 NA 215556±15396 NA Control 360 NA 217778±10183 NA

9 5 14.59 ± 0.0611 337778±27756 -.007 10 14.55 ± 0.0416 331111±10183 0.001 30 14.35 ± 0.0757 346667±11547 -0.018 60 14.30 ± 0.0693 271112±30792 0.088 90 14.24 ± 0.0529 217778±10183 0.183 120 14.19 ± 0.0231 144445±10184 0.361 150 14.16 ± 0.0200 86667±11547 0.584 240 14.07 ± 0.0577 21334±5206 1.192 360 13.89 ± 0.0643 1444±214 2.362 480 13.67 ± 0.0702 32±4 4.021 600 13.39 ± 0.0643 0±0 >5 Control 0 NA 311111 ± 20367 NA Control 600 NA 333334 ± 0 NA


Table 5.4. Inactivation of adenovirus 2 using 15 mg/L of preformed monochloramine at 10°C, pH 7, 8 and 9 in WW of 5 NTU turbidity

pH Time (minute)



Log 10 reduction

7 10 12.68 ± 0.0400 206667±24037 0 30 12.63 ± 0.0503 186667±92376 0.070 60 12.41 ± 0.0231 34445±5747 0.803 90 12.39 ± 0.0231 26000±8110 0.925 120 12.31 ± 0.0611 9934±10123 1.343 150 12.14 ± 0.1562 8311±10122 1.420 180 12.05 ± 0.1447 3555±3854 1.789 210 11.99 ± 0.1007 169±119 3.11 240 11.85 ± 0.1137 69±91 3.502 270 11.79 ± 0.0945 9±14 4.392 Control 0 NA 242222±13878 NA Control 270 NA 195556±33555 NA

8 10 12.83 ± 0.2663 411111±26943 0.013 30 12.69 ± 0.1447 417778±34210 0.006 60 12.63 ± 0.1332 353334±17638 0.078 90 12.53 ± 0.1206 184444±45379 0.361 120 12.39 ± 0.1604 64445±3849 0.817 150 12.29 ± 0.1026 23556±1540 1.255 180 12.21 ± 0.1102 7556±385 1.749 240 12.11 ± 0.1405 1734±231 2.388 300 12.03 ± 0.1419 218±37 3.289 360 11.93 ± 0.2013 45±39 3.978 390 11.86 ± 0.1709 0±0 >5 Control 0 NA 417778± 33554 NA Control 390 NA 428889 ± 21430 NA

9 10 13.81 ± 0.0416 395555±20367 0 30 13.69 ± 0.1273 398334±44938 0 60 13.61 ± 0.0306 368889±78975 0 90 13.55 ± 0.0503 328889±15396 0.00000004 120 13.47 ± 0.0115 306667±24037 0.03 180 13.41 ± 0.0231 222222±20367 0.17 240 13.34 ± 0.0721 97778±10183 0.527 360 13.29 ± 0.0987 21778±1678 1.179 480 13.08 ± 0.1929 1778±77 2.267 600 12.65 ± 0.1514 174±27 3.277 720 12.31 ± 0.2003 20±12 4.217 Control 0 NA 324444±27756 NA Control 720 NA 333333±0.2 NA


Table 5.5. Inactivation of adenovirus 2 using 16 mg/L of preformed monochloramine at 10°C pH 7, 8 and 9 in WW of 20 NTU turbidity

pH Time (minute) Residual* ± std deviation


Log 10 reduction

7 10 13.48 ± 0.1058 340000±33333 0 30 13.43 ± 0.1155 326667±63595 0 60 13.36 ± 0.1058 157778±36718 0.320 90 13.41 ± 0.0231 93333±0.577 0.548 120 13.36 ± 0.0800 22222±1540 1.171 150 13.31 ± 0.0462 2578±308 2.107 180 13.25 ± 0.0611 1645±308 2.302 210 13.23 ± 0.0833 867±200 2.580 240 13.13 ± 0.0611 120±0 3.439 270 13.09 ± 0.0924 52±24 3.806 300 13.03 ± 0.1804 14±7 4.387 360 12.84 ± 0.2800 2±4 5.171 Control 0 NA 342222 ± 36717 NA Control 360 NA 317778 ± 19245 NA

8 10 14.44 ± 0.5091 360000±30551 -.065 30 14.32 ± 0.2117 324445±13877 -.020 60 14.23 ± 0.1155 302222±43376 0.011 90 14.17 ± 0.1286 262000±15577 0.073 120 14.12 ± 0.0693 175556±37909 0.247 150 14.09 ± 0.0611 146667±26667 0.325 180 14.03 ± 0.0611 82222±3849 0.576 240 13.99 ± 0.0611 18889±1678 1.215 300 13.92 ± 0.0400 1778±277 2.241 360 13.85 ± 0.0462 213±29 3.162 420 13.81 ± 0.0462 33±12 3.969 480 13.75 ± 0.0611 7±7 4.670 Control 0 NA 326667±30551 NA Control 480 NA 293334±24037 NA

9 10 14.20 ± 0.1200 244445±21430 0.005 30 14.31 ± 0.0462 262222±37908 -0.025 60 14.29 ± 0.0231 271111±27755 -0.039 90 14.27 ± 0.0231 251111±13878 -0.006 120 14.21 ± 0.0231 204445±20367 0.083 180 14.09 ± 0.0231 204445±25240 0.083 240 14.03 ± 0.0462 120000±6667 0.315 360 13.93 ± 0.0611 60000±11548 0.616 480 13.60 ± 0.0693 11556±770 1.331 600 13.31 ± 0.0462 1823±510 2.133 720 13.08 ± 0.1058 133±0 3.269 840 12.79 ± 0.2603 4±8 4.757 960 12.71 ± 0.2663 0? > 5.0 Control 0 NA 231111 ± 23413 NA Control 30 NA 264222 ± 10548 NA


Figure 5.1. Inactivation of spiked adenovirus 2, in WW of varying turbidities (2 - 20 NTU) at 10°C using 15-16 mg/L of preformed monochloramine at pH 7, 8 and 9. The mean PFU/mL numbers of triplicate experiments for each time point has been used to plot the graphs.

0.00001

0.0001

0.001

0.01

0.1

1

10

0 10 30 60 90 120 180 240 360 480 600 720

Log

surv

ival

of A

deno

viru

s 2

Time in mins post 15 mg/L of monochloramine

Virus survival 5 NTU

pH 7

pH 8

pH 9

0.00001

0.0001

0.001

0.01

0.1

1

10

0 5 10 30 60 90 120 150 240 300 360 480 720

Log

surv

ival

of A

deno

viru

s 2



pH 7

pH 8

pH 9

0.000001

0.00001

0.0001

0.001

0.01

0.1

1

10

0 30 90 150 210 270 360 480 720

Log

surv

ival

of A

deno

viru

s 2



pH 7

pH 8

pH 9


Mean Ct values for disinfection of adenovirus 2 in recycled waters with a range of turbidities (2-20 NTU) and pH 7, 8 and 9 are provided in Table 5.6 and represented graphically in Figure 5.2. The South Australian Department of Health requested Cts presented in Table 5.6 to be smoothed using linear regression equations and rounded off to whole numbers for application in SA Water and Allwater treatment plants and these values are shown in Table 5.7. As expected both pH and turbidity affected inactivation of adenovirus 2. An increase in pH has previously been shown by Sirikanchana et al., (2008) to decrease virus inactivation and has been attributed to the possibility of pH dependence of the reaction involving monochloramine and specific viral molecular components or reactive intermediates such as organic chloramines formed in amino acid side chains of virion capsid protein. The range of turbidities (2-20 NTU) used in this study have not been previously investigated, although Kahler et al., (2011) has shown that low variation in turbidites (0.07- 0.6 NTU) does not have any effect on monochloramine inactivation experiments in source water. In Table 5.6 and 5.7 an increase in Cts can be seen as the turbidity increases. Higher turbidities may potentially protect viral particles by creating a disinfectant demand or by particle shielding of the virion. There is also the possibility that both water types and viral characteristics can affect the inactivation efficiency of monochloramine. Water quality characteristic for these experiments are presented in Table 5.8(A-C) in this chapter. Monochloramine decay curves are shown in Figures 5.3A-C. Monochloramine as expected is much more stable in WW and very low levels of other chlorine species were detected (note no FAC was detected in any of these experiments).

Table 5.6. Calculated Ct values by determining the integral of residual monochloramine vs time of adenovirus 2 inactivation in WW of various turbidities and pH at 10°C

pH Log10 inactiva

tion

Ct (mg.min/L) 2 NTU


Ct (mg.min/L) 5 NTU




*USEPA Guidance Manual Ct

Value(pH 6-9) 7 1 969 1204 1375 2 1688 1903 2175 643 3 2393 2638 2970 1067 4 3082 3337 3757 1491

8 1 1482 1590 3148 2 2326 2546 4070 643 3 3160 3490 4904 1067 4 3949 4426 5900 1491

9 1 2992 4364 6001 2 4592 6032 8114 643 3 5716 7511 9544 1067 4 6746 9096 10718 1491

*Ct values shown in USEPA guidance manual were based on data using preformed chloramines at pH 8 using HAV. No safety factor was applied to laboratory data used to derive the Ct values since chloramination conducted in the field is more effective than using preformed chloramines.


Table 5.7. Calculated Ct values by using the regression line equations of the Cts presented (in Table 5.6 and graphed in Fig 5.2) at 10°C

pH Log10 inactivation

Ct (mg.min/L) 2 NTU


Ct (mg.min/L) 5 NTU




7 1 977 1201 1379 2 1681 1914 2173 3 2386 2628 2967 4 3090 3341 3761

8 1 1494 1596 3143 2 2318 2541 4051 3 3141 3486 4960 4 3965 4431 5869

9 1 3154 4400 6258 2 4393 5967 7816 3 5631 7535 9374 4 6870 9102 10932


Figure 5.2. Monochloramine Cts required to inactivate 1 to 4 log10 of Adenovirus 2 in WW of 2, 5 and 20 NTU. R2 values for pH 7, 8 and 9 linear regression lines shown above range from 0.98-1.

y = 704.4x + 272R² = 0.9999

y = 823.5x + 670.5R² = 0.9998

y = 1238.6x + 1915R² = 0.9886

0

2000

4000

6000

8000

10000

12000

1 2 3 4

Ct (m

g.m

in/L

)

Log reduction of Adenovirus 2

2 NTU

pH 7

pH 8

pH 9

y = 713.4x + 487R² = 0.9999

y = 945.2x + 650R² = 1

y = 1567.5x + 2832R² = 0.9995

0

2000

4000

6000

8000

10000

12000

1 2 3 4

Ct (m

g.m

in/L

)


5 NTU

pH 7

pH 8

pH 9

y = 794.1x + 584R² = 1

y = 909x + 2233R² = 0.9989

y = 1558.1x + 4699R² = 0.9814

0

2000

4000

6000

8000

10000

12000

1 2 3 4

Ct (m

g.m

in/L

)


20 NTU

pH 7

pH 8

pH 9


Figure 5.3A. Monochloramine decay curves for Ct experiments in WW of turbidities of 2, 5 and 20 NTU and pH 7 at 10°C (see appendix 6 for monochloramine and total chlorine values used to plot these graphs).


Figure 5.3B. Monochloramine decay curves for Ct experiments in WW of turbidities of 2, 5 and 20 NTU and pH 8 at 10°C (see appendix 6 for monochloramine and total values used to plot these graphs).


Figure 5.3C. Monochloramine decay curves for Ct experiments in WW of turbidities of 2, 5 and 20 NTU and pH 9 at 10°C (see appendix 6 for monochloramine and total values used to plot these graphs).


5.3 Water quality characteristics Water quality characteristics (of water used to generate Cts in Table 5.6 and 5.7) unmodified and the modified are provided in Table 5.8A-C. The quality of water did not vary greatly between the collection days and was reasonably stable during storage for up to 10 days. Particle sizing was done and is shown in Fig 5.5. No unusual sizes or distribution of particulate matter was observed.

Table 5.8A Bolivar lagoon influent water quality chemistry for 2 NTU (unmodified and modified)

Date water collected

30/1/12 30/1/12 8/2/12 30/1/12 30/1/12 8/2/12

Date tested 2/2/12 6/2/12 10/02/12 2/2/12 6/2/12 9/2/12 NTU ND ND ND 2 2 2 pH to be tested N/A N/A N/A 7 8 9 pH few minutes post-chlorination

ND ND ND 7.2 8.01 8.89

pH post chloramination

ND ND ND 7.4-7.5 8 8.8


20.8 20.3 9.7 12 12.4 8.20

Ammonia mg/L <0.5 <0.5 <0.5 <0.5 <0.5 <0.5 Phosphorous mg/L 4.85 4.61 6.23 3.40 2.57 3.77 TKN mg/L 4.11 4.24 5.15 2.20 2.27 2.84 DOC mg/L 12.6 12.6 12.5 7.5 7.6 7.2 TOC mg/L 13.7 13.8 14.2 7.8 8 8.1 TDS mg/L 900 880 880 520 540 530 BOD mg/L 3 3 3 N/A 3 2 COD mg/L 69 69 68 55 57 56 SS mg/L 4 3 7 3 2 4 VSS mg/L 4 2 6 3 2 3 *The shaded results section represents unmodified water used to obtain turbidity of 2 NTU. The unshaded section represents modified water used in experiments for 2 NTU. ND = not done, N/A = Not applicable


Table 5.8B Bolivar lagoon influent water quality chemistry for 5 NTU WW (unmodified and modified)


10/2/12 10/2/12 21/2/12 10/2/12 10/2/12 21/2/12

Date tested 16/2/12 20/2/12 22/2/12 16/2/12 20/2/12 22/2/12 NTU ND ND ND 5 5 5 pH to be tested N/A N/A N/A 7 8 9 pH few minutes post-chlorination

ND ND ND 7.36 8.35 9.0


ND ND ND 7.5 8.1 8.5-8.6


14.3 14.2 15.6 8.92 8.47 9.68

Ammonia mg/L <0.5 <0.5 <0.5 <0.5 <0.5 <0.5 Phosphorous mg/L 2.03 1.51 6.32 1.51 1.22 4.64 TKN mg/L 3.16 4.83 5.27 <2 4.45 5.90 DOC mg/L 15.3 15.0 13.7 9.6 9.2 9.1 TOC mg/L 17.2 17.3 15.8 13 12.8 11.3 TDS mg/L 940 920 870 590 570 570 BOD mg/L 5 2 4 6 5 4 COD mg/L 54 51 Failed 66 107 94 SS mg/L 7 9 11 12 14 16 VSS mg/L 7 7 10 10 12 14 *The shaded results section represents unmodified water used to obtain turbidity of 5 NTU. The unshaded section represents modified water used in experiments for 5 NTU. ND = not done, N/A = Not applicable, Failed = No laboratory results obtained due to error.


Table 5.8C Bolivar lagoon influent water quality chemistry for 20 NTU WW (unmodified and modified)


24/2/12 24/2/12 6/3/12 24/2/12 24/2/12 6/3/12

Date tested 1/3/12 4/3/12 8/3/12 1/3/12 4/3/12 8/3/12 NTU ND ND ND 20 20 20 pH to be tested NA NA NA 7 8 9 pH few minutes post-chlorination

NA NA NA 7.4 8 8.7


NA NA NA 7.6 8 8.5


14 13.9 12.5 8.50 8.32 8.42

Ammonia mg/L 0.51 0.60 0.54 <0.5 <0.80 <0.5 Phosphorous mg/L 2.02 2.34 2.14 12.9 2.70 2.66 TKN mg/L 4.86 4.67 6.72 8.96 7.54 8.04 DOC mg/L 14.3 14.9 13.6 9.9 10.6 10.5 TOC mg/L 16.3 17.6 15.9 15.4 17.5 17.7 TDS mg/L 870 900 930 700 590 640 BOD mg/L 4 5 4 13 Failed 17 COD mg/L 94 82 93 78 70 121 SS mg/L 7 8 8 43 35 44 VSS mg/L 6 8 7 35 30 42 *The shaded results section represents unmodified water used to obtain turbidity of 20 NTU. The unshaded section represents modified water used in experiments for 20 NTU. ND = not done, N/A = Not applicable, Failed = No laboratory results obtained due to error.


Figure 5.5. Analysis of modified and unmodified water sample particle sizing using laser optical counters for waters set at turbidity 2.0, 5.0 and 20 NTU (sizing range from 0.5 – 20 µm).


5.4 Tailing Effect - Inactivation of native F- RNA phage and E. coli in wastewaters.

The second part of chapter 5 was to determine any tailing effect of disinfection of native F-RNA bacteriophage present in various types of water from Bolivar WWTP and Melbourne WWTPs at 10°C. Water was collected from 3 different sites at Bolivar WWTP: (1) Bolivar lagoon influent (source water for our Ct experiments), (2) Bolivar lagoon effluent and (3) Bolivar post DAFF treatment (prior to chlorination). Bolivar WW treatment consists of primary treatment (screening, grit removal and sedimentation) followed by ASP, lagoon for 16 days, chlorination (or DAFF and chlorination). Water from two different sites at Melbourne WWTPs was also tested for F-RNA phage and E. coli inactivation. The Melbourne WW types were identified in the following tables as MW1 (which underwent primary settling followed by ASP and secondary settling) and MW2 (which underwent an anaerobic digestion process, ASP and lagoon polishing for 26 days). For each of the WW types F-RNA log10 reduction values are shown in Tables 5.9 and 5.10. The raw data (plaque counts post chlorination and chloramination) are presented in Appendix 7.

Inactivation of native E. coli was also assessed only in Melbourne WW (MW1 and MW2). Because of the sample volumes required, free chlorine or monochloramine residuals were measured for each treatment in a separate flask, either sequentially (for chlorination, owing to the short sampling intervals) or in a parallel (for chloramination, where the sampling interval made near-simultaneous sampling more practicable). A single set of decay data applies to both the F-RNA phage and the E. coli inactivation. Water chemistry for these experiments is shown in Table 5.14 and particle sizing is shown in Figure 5.7.

The number of native enteric organisms was very low in all samples except the Bolivar Lagoon Influent and MW-1, so that the numbers surviving disinfection quickly fell below the limit of detection, except in those samples. The only data suitable for graphic representation are the F-RNA phage numbers in Bolivar Lagoon Influent and MW-1 (Figure 5.6; data from Table 5.10), with calculated Cts presented in Table 5.11. There is little evidence of tailing. The inactivation curve for MW-1 could be interpreted as slightly concave (Figure 5.6), but this shape is best explained by the chlorine demand of the sample: since the chlorine concentration (residual) falls rapidly, the inactivation rate also falls and is reflected in the changing slope of the curve. Note MW1 had high amounts of ammonia (3.94 mg/L as seen in Table 5.14) resulting in higher levels of monochloramine formation, however, there were low detectable levels of chlorine which was used to calculate the free chlorine Cts.

The study produced limited data on E. coli inactivation, studied only in the Melbourne samples MW1 and MW2 (inactivation data in Table 5.12; Cts in Table 5.13). E. coli inactivation in sample MW1 exposed to free chlorine was quite low in the time-frame sampled (approximately 0.5 log by 1.0 minute) This water type had a high concentration of ammonia (3.94 mg/L) compared to all other waters tested and thus led to the domination of


monochloramine formation rather than maintaining a high FAC residual. Deliberate chloramination of the same water gave a 5-log Ct close to 74 mg.min/L (Table 5.13). MW2 contained so few E. coli that survival fell below the limit of detection before the first timed sample. There is little evidence of tailing for either chlorination or chlorination.

Calculated Cts for inactivation of F-RNA phage and E. coli (Tables 5.11, 5.13) are considerably lower than equivalent values determined for adenovirus 2 in this study (Table 5.6), and than the Ct values required in drinking water applications that fall under USEPA regulations. The lower Cts for these more susceptible organisms do not diminish the need for higher Cts to provide adequate disinfection to inactivate the more resistant enteric viruses.

Table 5.9: Inactivation of native F-RNA phage using 5 mg/L of free chlorine at 10°C, in 5 different WWs

Water type Time (minute)

Free Chlorine Residual

(mg/L)

Titre (PFU/25 mL)* ± std deviation

Log 10 reduction

Bolivar lagoon influent

Control 0 N/A

98±7

0.00

0.25 1.72 1±0 1.99 0.50 1.37 0±0 >2.468 1.00 1.16 0±0 >2.468 2.00 1.08 0±0 >2.468 Control 2 N/A 82±7 NA

Bolivar DAFF Raw water

Control 0 N/A

1±1 0.0

0.25 1.85 0±0 >0.477 0.50 1.57 0±0 >0.477 1.00 1.30 0±0 >0.477 2.00 1.16 0±0 >0.477 Control 2 N/A 0.3±1 NA

Bolivar DAFF product

Control 0 N/A

0±0

NA

0.25 2.77 0±0 NA 0.50 2.14 0±0 NA 0.75 1.84 0±0 NA 1.00 1.55 0±0 NA Control 2 N/A 0±0 NA

MW1 Control 0 N/A 16±2 0.00 0.25 1.16 2±1 0.93 0.50 0.76 1±1 1.204 0.75 0.47 0.3±1 1.681 1.00 0.27 0±0 >1.681 Control 1 N/A

MW2 0.00 N/A 4.3±3 0.00 0.25 2.23 1.0±1 0.637 0.50 1.54 0.3±1 1.114 0.75 1.22 0±0 >1.114 1.0 0.91 0±0 >1.114

Control 1 N/A


Table 5.10: Inactivation of F-RNA phage using 20 mg/L of preformed monochloramine at 10°C, in 5 different WWs


Monochloramine Residual*

(mg/L)

Titre (PFU/25mL)* ± std deviation

Log 10 reduction

Bolivar lagoon influent

Control 0 N/A

96±7

N/A

1 16.60 ND ND 5 15.70 ND ND 30 15.20 0.7±1 2.158 60 15.04 0.3±0.6 2.459 90 14.88 0±0 >2.459 120 14.60 0±0 >2.459 150 14.48 0±0 >2.459 Control 150 N/A 88.7±18 N/A

Bolivar DAFF Raw water

Control 0 N/A

1.3±1

N/A

1 17.80 ND ND 5 17.00 ND ND 30 16.36 0.3±0.6 >0.602 60 16.12 0±0 >0.602 90 15.36 0±0 >0.602 120 15.20 0±0 >0.602 150 15.16 0±0 >0.602 Control 150 N/A 2.3±2.5 N/A

Bolivar DAFF product

Control 0 N/A 0.3±0.6 N/A

1 18.48 ND ND 5 17.72 ND ND 30 17.08 0±0 60 16.76 0±0 90 15.96 0±0 120 15.80 0±0 150 15.76 0±0 Control 150 N/A 0±0

*MW1 Control 0 N/A 16.3±3 N/A 1 15.32 N/D N/D 5 14.40 2±1 0.912 10 N/D 0.3±0.6 1.69 20 N/D 0.3±0.6 1.69 30 13.90 0±0 >1.69 60 13.74 0±0 >1.69 Control 60 N/A 18.7±2 N/A

MW2 0 N/A 4±1 N/A 1 17.94 N/D N/D 5 17.20 0.7±0.6 0.778 10 0± >1.079 20 N/D 0±0 >1.079 30 16.48 0±0 >1.079 60 16.28 0±0 >1.079 Control 60 N/A 2.7±0.6 N/A


Figure 5.6. Inactivation of native F-RNA in two WWs treated with free chlorine: log survival as a function of time. Note even though there was high level of ammonia free chlorine could still be measured. The apparent difference in inactivation rate is almost certainly due to the difference in chlorine demand, since the 2-log Ct values are very similar (see Table 5.11, lines 1, 4). F-RNA in Bolivar lagoon infl was all inactivated within 0.5 minutes and in 1 minute in MW-1.

Table 5.11. Ct values calculated by determining the integral of residual

chlorine/monochloramine vs time of native F-RNA phage inactivation in various WW at 10°C

Water type Chlorine Ct (mg.min.L-1)

Monochloramine Ct (mg.min.L-1)

Bolivar lagoon influent (2 log inactivation)

0.84* 436

Bolivar DAFF raw water Low numbers of native phage, so no Ct available

Low numbers of native phage, so no Ct available

Bolivar DAFF product water

No native phage detected so no Ct available

No native phage detected so no Ct available

MW1 (1 log inactivation) 0.86* 85 MW2 (1 log inactivation) 1.28* 122 * Ct estimates for free chlorine inactivation of F-RNA phage are likely to be over-estimates. The graphical method assumes a linear decay between t = 0 and the first chlorine residual measurements at 0.25 minutes, whereas there is likely to have been significant almost instantaneous decay. In the Bolivar lagoon influent example, assuming instantaneous decay to 2.5 mg/L changes the Ct estimate to 0.53 mg.min.L-1.

0.001

0.010

0.100

1.000

0.00 0.25 0.50 0.75 1.00

Log

suvi

val

Time in mins

F-RNA phage survival post chlorination

Bolivar lagoon infl

MW-1


Table 5.12: Inactivation of E. coli using 5 mg/L of chlorine or 20 mg/L of monochloramine in Melbourne WWs at 10°C.


Chlorine Residual mg/L

Titre (E. coli/100mL) ± sd

Log 10

reduction MW1 Control 0 N/A 50333±7095 N/A

0.25 1.16 20000±1732 0.401 0.50 0.76 18333±3215 0.439 0.75 0.47 15000±2646 0.526 1 0.27 18000±6083 0.447 Control 1 N/A 58000 N/A

MW2 Control 0 N/A 7.7±3 N/A 0.25 2.23 0±0 >1.362 0.50 1.54 0±0 >1.362 0.75 1.22 0±0 >1.362 1.00 0.91 0±0 >1.362 Control 1 N/A 10 N/A


Monochloramine Residual

mg/L

Titre (E. coli/100 mL) ± sd

Log 10

reduction

MW1 Control 0 N/A 53000±7549 N/A 1 15.32 ND N/A 5 14.40 0±0 >5.2 10 ND 0.3±0.6 5.2 20 ND 0±0 >5.2 30 13.90 0±0 >5.2 60 13.74 0±0 >5.2 Control 60 N/A 33000

MW2 Control 0 N/A 10.3±0.6 0 1 17.94 ND ND 5 17.20 0.3±0.6 >1.49 10 N/D 0±0 >1.49 20 N/D 0±0 >1.49 30 16.48 0±0 >1.49 60 16.28 0±0 >1.49 Control 60 N/A 18


Table 5.13. Ct values calculated by determining the integral of residual chlor(am)ine vs time

of native E. coli inactivation in various MW1 and MW2 at 10°C

Water type Chlorine Ct (mg.min.L-1)

Monochloramine Ct (mg.min.L-1)

MW1 Less than 1 log inactivation in testing time frame

< 74 (5 logs)

MW2 (1 log inactivation)

< 0.74 < 61

Table 5.14. Chemical analysis for the 5 types of WW used for the tailing experiments

Bolivar Lagoon influent

Bolivar Lagoon effluent

Bolivar DAFF

effluent

Melbourne Water-1 Post ASP

and settling

Melbourne Water-2 Lagoon effluent

NTU 4 29 1 4 2 pH 7.3 8.4 7.3 7.33 7.8 Nitrate + Nitrite as N mg/L

13.4 7.11 7.17 7.01 21.1

Ammonia mg/L <0.5 <0.5 <0.5 *3.94 <0.5 Phosphorous mg/L 4.40 2.78 0.591 1.41 6.94 TKN mg/L <2.0 2.97 <2 5.7 <2 DOC mg/L 11.3 12 8 13.4 9.8 TOC mg/L 12.5 12.6 8.3 14.7 9.9 TDS mg/L 860 900 970 490 930 BOD mg/L 3 4 <2 14 <2 COD mg/L 57 80 26 59 43 SS mg/L 10 15 <1 6 <1 VSS mg/L 8 10 <1 6 <1 * Note presence of ammonia which will react with free chlorine leading to formation of chloramines. As a result free chlorine is only transiently available.


Figure 5.7. Particle sizing using laser optical counters for the 5 types of water used for tailing experiments showing majority of particles are ≤ 3µm.

0.00

50000.00

100000.00

150000.00

200000.00

250000.00

300000.00

350000.00

400000.00

450000.00

500000.00

1 2 3 4 5 6 7 8 9 10 11 12

Part

icle

s per

mL

Particle size (µm)

Experiment 1 - Bolivar Lagoon InfluentExperiment 2 - Bolivar Lagoon EffluentExperiment 3 - Bolivar DAFF EffluentExperiment 4 - Melbourne Water Type 1Experiment 5 - Melbourne Water Type 2



The results of this study suggest that adenovirus 2 can be effectively disinfected in waters destined for reuse at varying turbidities and pH values (7 and 9) but require much higher Cts than previously reported in drinking waters. There has been a lack of data for determination of Ct requirements for inactivation of viruses in water where turbidity is greater than 1 NTU, which is directly applicable to WW recycling. There is a general need for relevant data to provide the basis for development of guidelines required to adequately disinfect viruses in WW to provide an essential barrier against transmission of water borne viruses. To determine Cts for inactivation of viruses by monochloramine in WW requires relevant data using viruses found in WW that are particularly monochloramine resistant. Adenovirus 2 has been reported to have high monochloramine resistance (Sirikanchana et al., 2008, Kahler et al., 2011), and hence was used to determine Cts required to inactivate these viruses in WW. Cts obtained for inactivation of 4 log10 (99.99%) increased with pH and turbidity as anticipated and exceeded recommended Cts required for disinfecting drinking water. This study shows water quality (such as turbidity and pH) has significant impact on inactivation of adenovirus 2 when exposed to monochloramine. Application of the Cts as reported within would be difficult to achieve at WW treatment plants and as a result it is recommended that further investigations be performed at higher temperatures which are more typical of full scale WW treatment plant to determine if more practical Cts can be achieved.


Conclusions

• In this work we examined the numbers of culturable viruses present in recycled waters destined for reuse. We found that the numbers of culturable viruses present in WW were not sufficiently high for determining Ct curves for up to 4 log10 inactivation with disinfectants tested. Therefore based on the literature review the most resistant laboratory cultured viruses were used for these disinfection studies. The cell lines (BGM cells for CB5 virus and A549 cells for culturing Adenovirus 2) were determined to be optimal in enumerating these viruses in our laboratory studies and were the same ones used in disinfection experiments in literature allowing comparison of our Ct results to published work. Plaque forming unit analysis was chosen to provide direct enumeration of surviving CB5 virus and Adenovirus 2 in these disinfection experiments as it was shown that this method of enumeration gave a tighter standard deviation error compared to the commonly used MPN method.

• We further demonstrate that the most resistant virus to chlorine (CB5) was effectively disinfected in waters destined for recycling at varying turbidities (0.2-20 NTU) but required higher Cts to factor in chlorine demand. Our results show water quality can significantly affect disinfection efficacy. We now have data available for development of free chlorine disinfection Cts at 10°C for application to the AGWR (2006).

• The preformed monochloramine studies show that highly resistant adenovirus 2 can be effectively disinfected in WWs but would require very high Cts that are not practical in most Australian WWTPs. We showed that both pH and turbidity has an effect on monochloramine disinfection. Our results may be used by water utilities to implement new disinfection guidelines, although further research at higher temperatures (> 10ºC which would be applicable to most treatment plants) may give more useful Cts.


References

Abad F.X., Pinto R.M. Vellena R., Gajardo R., and Bosch A. (1997). Astrovirus survival in drinking water. Appl Environ Microbiol. 63: 3119-3122.

Aggarwal, R. and Krawczynski, K. (2000) Hepatitis E: an overview and recent advances in clinical and laboratory research. J Gastroenterol Hepatol, 15, 9-20.

AGWR, (2008). Australian Guidelines for Water Recycling, Managing Health and Environmental risks. Natural Resource Management Ministerial Council, Environmental Protection and Heritage Council and Australian Health Ministers Conference.

American Public Health Association (APHA), American Water. Works association (AWWA) and water environment Federation (WEF). (1998). “Standard Methods for the Examination of Water and Wastewater”, 20th ed.; APHA-AWWA-WEF: Washington, DC.

AS/NZS (1998) "Water quality – Sampling Part 1: "Guidance on design of sampling programs, sampling techniques and the preservation and handling of samples." 5667,1:98 Berman D and Hoff J.C. (1984). Inactivation of simian rotavirus SA11 by chlorine, chlorine dioxide and monochloramine. Appl. Environ. Microbiol. 48:317.

Black S. Thurston J.A., and C.P. Gerba. (2009). Determination of Ct values for chlorine of resistant enterovirus. J. Environ. Sci. and Health Part A. 44: 336-339.

Blatchley III E.R., Gong W-L., Alleman J.E., Rose J.B., Huffman D.E., Otaki, M., and Lisle J.T. (2005) Effects of wastewater disinfection on waterborne bacteria and viruses. Water Environement Research 79(1): 81-92.

Carducci, A., Arrighi, S. and Ruschi, A. 1995. Detection of coliphages and enteroviruses in sewage and aerosol from an activated sludge wastewater treatment plant. Lett. Appl. Microbiol. 21, 207-209

Choi, S. and Jiang, S.C. (2005) Real-time PCR quantification of human adenoviruses in urban rivers indicates genome prevalence but low infectivity. Appl. Environ. Microbiol., 71, 7426-7433.

Cromeans T.L., Kahler A.M., and Hill V.R. (2010) Inactivation of adenoviruses, enteroviruses and murine norovirus n water by free chlorine and monochloramine. Appl. Environ. Microbiol. 76(4): 1028-1033.

Dahling, D. R. and B. A. Wright (1986). Optimization of the BGM cell line culture and viral assay procedures for monitoring viruses in the environment. Appl Environ Microbiol 51(4): 790-812.


Duran, A.E., Muniesa, M., Moce-Llivina, L., Campos, C., Jofre, J. and Lucena, F. 2003. Usefulness of different groups of bacteriophages as model micro-organisms for evaluating chlorination. J. Appl. Microbiol. 95, 29-37

Edzwald J.K. ( 1983) Coagulation-dsedimentation-filtration processes for removing organic substances from drinking water, p.2664. In B.B. Berger (ed.) Control of organic substances in water and wastewater. EPA 600/8-83-001. U.S. Environmental Protection agency, Cincinnatti, Ohio.

Emerick R.W., Loge F.J., Ginn T., and Darby J.L. (2000). Modeling the inactivation of particle associated coliform bacteria. Water Environ. Res. 72(4): 432-438.

Engelbrecht R.S., Weber M.J., Salter B L., and Schmidt C.A. (1980). Comparitive inactivation of viruses by chlorine. Appl Environ Microbiol. 40, 249-256.

Enriquez C.E., Hurst C.J., and Gerba C.P. (1995). Survival of the enteric adenovirus-40 and adenovirus-41 in tap, sea, and wastewater. Wat. Res. 29: 2548-2553.

Gantzer, C., Maul, A., Audic, J.M. and Schwartzbrod, L. 1998. Detection of infectious enteroviruses, enterovirus genomes, somatic coliphages, and Bacteroides fragilis phages in treated wastewater. Appl Environ Microbiol. 64, 4307-4312

Gerba C.P., Keswick B.H., Dupont H.L., and Fields H.A. (1984). Isolation of rotavirus and hepatitis from drinking water. Monogr. Virol. 15: 119-125.

Gerba C.P., Nwachuku N., and Riley K.R. (2003) Disinfection resistance of waterborne pathogens pn the United States Environmental Protection Agency’s Contaminant Candadate list (CCL). J. Water Supply: Research and Technology- AQUA 52.2: 81-94.

Gerba, C.P., Pepper, I.L. and Whitehead, L.F., 3rd. (2002) A risk assessment of emerging pathogens of concern in the land application of biosolids. Water Sci Technol, 46, 225-230.

Grabow WO, Gauss-Müller V, Prozesky OW, Deinhardt F. Inactivation of hepatitis A virus and indicator organisms in water by free chlorine residuals. Appl Environ Microbiol. 1983;46(3):619-24.

Grabow, W. O., D. L. Puttergill, et al. (1992). Propagation of adenovirus types 40 and 41 in the PLC/PRF/5 primary liver carcinoma cell line. J Virol Methods 37(2): 201-7. Grabow, W.O.K., Vrey, A., Uys, M., and de Villiers, J.C., (1998). Evaluation of the Application of Bacteriophages as Indicators of Water Quality. WRC Report No. 540/1/98, Water Research Commission, Pretoria. 55pp


Grabow, W. O., K. L. Botma, et al. (1999). Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater. Bull World Health Organ 77(12): 973-80. Harwood, V.J., Levine, A.D., Scott, T.M., Chivukula, V., Lukasik, J., Farrah, S.R. and Rose, J.B. (2005) Validity of the indicator organism paradigm for pathogen reduction in reclaimed water and public health protection. Appl Environ Microbiol, 71, 3163-3170.

Hejkal T.W., Wellings F.M., LaRock P.A. and Lewis A.L., ( 1979) Survival of poliovirus within organic solids during chlorination. Appl. Environ Microbiol. 38: 114-118.

Hejkal T.W., Wellings F.M., Lewis A.L., and LaRock P.A. ( 1981) Distribution of viruses associated with particles in wastewater. Appl Environ Microbiol. 41(3): 628-634.

Ho L., Omstad G., Von Gunten U., Rinck-Pfeiffer S., Graig K., Newcombe G. (2006). Differences in the chlorine reactivity of four microcystin analogues. Water Research 40(6): 1200-1209.

Hoff J.C., and Akin E.W. (1986). Microbial resistance to disinfectants: mechanisms and significance. Environ. Health Perspect. 69: 7-13.

Hurley, M. A. and M. Roscoe (1983). Automated statistical analysis of microbial enumeration by dilution series. Journal of Applied Microbiology 55(1): 159-164. Irving, L.G. and Smith, F.A. (1981) One-year survey of enteroviruses, adenoviruses, and reoviruses isolated from effluent at an activated-sludge purification plant. Appl Environ Microbiol, 41, 51-59.

Jensen H., Thomas K., and Sharp D.G. ( 1980). Inactivcation of coxsackieviruses B3 and B5 in water by chlorine. Appl. Environ. Microbiol. 40(3): 633-640.

Kahler A. M., Cromeans T. L., Roberts J. M. And Vincent R. H.(2011). Source water quality effects on monochloramine inactivation of adenovirus, coxsackievirus, echovirus, and murine norovirus. Water Res 45:1745-1751 Keegan A.K., Monis, P.T., Jagals, P., Toze S., and Blackbeard J. (2009). Pathogen risk indicators for wastewater and biosolids 03-HHE-2.Water Environment Research Foundation.

Kelley, S., and Sanderson, W.W. (1958). The effect if chlorine in water on enteric viruses. American Journal of Public Health. 48:1323-1334.

Laverick, M.A., Wyn-Jones, A.P. and Carter, M.J. (2004) Quantitative RT-PCR for the enumeration of noroviruses (Norwalk-like viruses) in water and sewage. Lett Appl Microbiol, 39, 127-136.

LeCann P, Ranarijaona S, Monpoeho S, Le Guyader F, Ferré V.(2004) Quantification of human astroviruses in sewage using real-time RT-PCR. Res Microbiol. 155(1):11-5.


LeChevalier M.W., Norton W.D., and Rose J.B. (1991). Giardia and Cryptosporidium in water supplies. In American Water Works Assoc. Res. Foundation. Denver, CO.

Lee HK, Jeong YS. (2004) Comparison of total culturable virus assay and multiplex integrated cell culture-PCR for reliability of waterborne virus detection. Appl Environ Microbiol. 70(6):3632-6. Liu O.C., Seraichekas H.R., Akin E.W., Brashear D.A., Katz, E.L., and Hill W.J. (1971) Relative resistance of 20 human enteric viruses to free chlorine in Potomac river, p. 171-195. In Proceedings of the 13th Water Quality Conference. Virus and water quality: occurrence and control. University of Illinois bulletin no. 69. University of Illinois.

Lodder, W.J. and de Roda Husman, A.M. (2005) Presence of noroviruses and other enteric viruses in sewage and surface waters in The Netherlands. Appl Environ Microbiol, 71, 1453-1461.

Long, J. and Ashbolt, N.J. (1994). Sydney Water Corporation, Sydney.

Lopman, B.A., Reacher, M.H., Van Duijnhoven, Y., Hanon, F.X., Brown, D. and Koopmans, M. (2003) Viral gastroenteritis outbreaks in Europe, 1995-2000. Emerg Infect Dis, 9, 90-96.

Lucena, F., Duran, A.E., Moron, A., Calderon, E., Campos, C., Gantzer, C., Skraber, S. and Jofre, J. 2004. Reduction of bacterial indicators and bacteriophages infecting faecal bacteria in primary and secondary wastewater treatments. J Appl Microbiol. 97, 1069-1076

MacDonald J.A., Gradus M.S., Sedmak G.V., Singh A., Moser R.J. and Landis D.L. (1998) Pathogen and indicator organism reduction at a large activated sludge wastewater treatment plant. Vol 6, p 413-426. Proc 1998 Water Environ. Fed. Tech Exposition Conf. Orlando, Florida.

Morsy El-Senousy W.., Guix S., Abid I., Pinto, RM., and Bosch A. (2007). Removal of astorvirus from water and sewage treatment plants evaluated by a competive reverse transcription-PCR. Appl Environ Microbiol. 73: 164-167.

Mulders, M.N., Lipskaya, G.Y., van der Avoort, H.G., Koopmans, M.P., Kew, O.M. and van

Loon, A.M. (1995) Molecular epidemiology of wild poliovirus type 1 in Europe, the Middle East, and the Indian subcontinent. J Infect Dis, 171, 1399-1405.

Muniesa, M. and Jofre, J. 2004. Factors influencing the replication of somatic coliphages in the water environment. Antonie Van Leeuwenhoek. 86, 65-76


Narang H.K., and Codd A.A.,( 1981) Frequency of preclumped virus in routine faecal speciments from patients with acute nonbacterial gastroenteritis. J. Clin. Microbiol. 13: 982-988.

Payment P., Tremblay M., and Trudel M. (1985). Relative resistance to chlorine of poliovirus and coxsackievirus isolates from environmental sources and drinking water. Appl Environ Microbiol 49(4): 981-983.

Rodriguez, R. A., P. M. Gundy, et al. (2008). Comparison of BGM and PLC/PRC/5 cell lines for total culturable viral assay of treated sewage. Appl Environ Microbiol 74(9): 2583-7.

Rose, J.B., Farrah, S.R., Harwood, V.J., Levine, A.D., Lukasik, J., Menendez, P., Scott, T.M. (2004) Reduction of pathogens, indicator bacteria and alternative indicators by wastewater treatment and reclaimation processes. Water Environment Research Foundation. IWA Publishing, London.

Saif, L.J., Theil, K.W., and Bohl, E.H. (1978) Morphogenesis of porcine rotavirus in porcine kidney cell cultures and intestinal epithelial cells. J. Gen. Virol. 39:205-217.

Shaffer P.T., Metcalf T.G., and Sproul O.J. (1980). Chlorine resistance of poliovirus isolants recovered from drinking water. Appl Environ Microbiol 40: 1115-1121.

Sedmak, G., Bina, D., Macdonald, J. and Couillard, L. (2005) Nine-year study of the occurrence of culturable viruses in source water for two drinking water treatment plants and the influent and effluent of a Wastewater Treatment Plant in Milwaukee, Wisconsin (August 1994 through July 2003). Appl Environ Microbiol, 71, 1042-1050.

Sharp, D.G., and Leong J. (1980) Inactivation of poliovirus 1 (Brunhilde) single particles by chlorine in water. Appl. Environ. Microbiol. 40(2): 381-385.

Sobsey M.D., Fuji, T., and Schields P.A. (1988). Inactivatio of hepatitis A virus and model viruses in water by free chlorine and monochloramine. Wat. Sci. Tech. 20 (11-12): 385-391.

Sobsey M.D., Fuji, T., and Hall R.M. (1991) Inactivation of cell associated and dispersed hepatitis A virus in water. American Water Works Association, Research and Technology p64-67.

Sobsey M.D., and Alexander L.W. 2002 Effects of water quality on the inactivation of Hepatitis A virus and enteroviruses by free chlorine. Water Environment Federation Disinfection Conference, “Health and Safety achieved through disinfection”, St Petersberg, Florida, 2002.


Simpson, D., Jacangelo, J., Loughran, P. and McIlroy, C. 2003. Investigation of potential surrogate organisms and public health risk in UV irradiated secondary effluent. Water Sci Technol. 47, 37-4.

Sinclair M.I., M.E. Hellard, R. Wolfe, T.Z. Mitakakis, K. Leder AND C.K. Fairley. Pathogens causing community gastroenteritis in Australia. Journal of Gastroenterology and Hepatology 2005 20, 1685-1690.

Sirikanchana K., Shisler J. L. And Marinas B. J. (2008). Inactivation Kinetics of adenovirus serotype 2 with monochloramine. Water Res 42:1467-1474

Spinner M., and DiGiovanni G.(1996). Detection and identification of mammalian reoviruses in surface water by combined cell culture and recerse transcription –PCR. Appl Environ Microbiol. 67, 3016-3020.

Stewart M.H., and Olsen B.H. (1996) Bacterial resistance to potable water disinfectants. In Modelling disease transmission and its prevention by disinfection, C.J. Hurst (ed), Cambridge University Press, Cambridge, pp 140-192.

Templeton M., Andrews R.C., and Hofman R. (2008). PArticel-associated viruses in water: Impacts on disinfection processes. Critical Reviews in Environmental Science and Technology. 38: 137-164.

Thurston- Enriquez J.A., C.N. Haas, J. Jacangelo, and C.P. Gerba. Chlorine Inactivation of Adenovirus Type 40 and Feline Calicivirus. Appl Environ Microbiol, 2003; 69(7), 3979-3985.

Tree J.A., Adams, M.R., and Lees D.N. (2003). Chlorination of indicator bacteria and viruses in primary sewage effluent. Appl Environ Microbiol. 69:2038-2043.

Tree, J.A., Adams, M.R. and Lees, D.N. (2005) Disinfection of feline calicivirus (a surrogate for Norovirus) in wastewaters. J Appl Microbiol, 98, 155-162.

USEPA (1989) Guidance manual for compliance with the filtration and disinfection requirements for public water systems using surface water sources. Office of Water, U.S. Environmental Protection Agency. Washington D.C.

USEPA (1995). Virus monitoring protocols for the information collection requirements rule . PA/814-B95-002. U.S. Environmental Protection agency, Washington, DC USEPA (1999) Disinfection profiling and benchmarking guidance manual. Office of Water, U.S. Environmental Protection Agency. Washington D.C.

USEPA (2002). Treatability screening for CCL Microbial contaminants. EPA/822/R/01/002. Washington DC, USA.


White G.C. ( 1999). Handbook of chlorination and alternative disinfectants, 4th ed. John Wiley and Sons Inc., New York, N.Y.

Williams, J. F. (1970). Enhancement of adenovirus plaque formation on HeLa cells by magnesium chloride. J Gen Virol 9(3): 251-5.

Williams F.P.Jr. (1985) Membrane associated viral complexes observed in stools and cell culture. Appl. Environ. Microbiol. 50:523.

Woody, M.A. and Cliver, D.O. 1995. Effects of temperature and host cell growth phase on replication of F-specific RNA coliphage Q beta. Appl Environ Microbiol. 61, 1520-1526.

Woody, M.A. and Cliver, D.O. 1997. Replication of coliphage Q beta as affected by host cell number, nutrition, competition from insusceptible cells and non-FRNA coliphages. J Appl Microbiol. 82, 431-440.


Appendices Appendix 1

Example of Ct calculation used in this study

To determine Ct (mg.min/L) for 4 log10 virus inactivation, infectious virus (PFU/ml) in each test flask at the appropriate time points was converted to survival values by using the average number of viruses in the control flasks during the experiment as the initial titre (See Figure 2.1). Note that control flasks were supplemented with CB5 virus but no chlorine was applied, and were maintained at the same condition as the test flasks at all times, and were tested in triplicate alongside the test flasks (no chlorine). Samples were assayed at time 0 and 30 minutes from each control flask. Table A1 shows data and calculated survival values for the experiment using WW 0.5 NTU and pH 7, to plot the graph in Figure A1 to calculate the time required to inactivate 4 log10 (99.99%) of CB5.

1. Raw data Table A1. Inactivation of CB5 using 6.5 mg/L of chlorine at 10ºC pH 7 0.2 NTU

Control in triplicates

PFU/mL Time (minutes)

Average PFU/mL of virus surviving after dosing with

6.5 mg/L of chlorine

Survival of CB5

(relative to control)

Log10 inactivation

of CB5

0 188,833 1 0 Time 0 200,000 0.5 8,443 0.05 1.35 Time 0 240,000 1 2,010 0.01 1.98 Time 0 133,000 1.5 17 9.18E-05 4.03 Time 30 200,000 2.5 0 Time 30 200,000 5 0 Time 30 160,000 10 0 Arithmetic Average

188,833 20 0

A line of best fit to the survival data shown in Table A1 was constructed as shown in Figure A1. Lines of linear regression were used only for water with turbidity of 0.2-5 NTU as survival graphs were linear. However, when survival graphs were clearly not linear, as seen in WWs with turbidity of 20 NTU, curves were used. This was mainly because in WWs of 20 NTU, there was a considerably extended inactivation, during which the chlorine decayed significantly. To avoid the assumption that inactivation continued at a single constant rate, a curve was preferred to linear regression.


2. Establishing time required to achieve 4 log10 inactivation of CB5 in WW (0.2 NTU, pH 7) by plotting log10 survival of CB5 vs. time (in minutes) post chlorination.

Figure A1. Survival values of CB5 vs. time showing 4 log10 virus inactivation requires 1.6 minutes in WW 0.2 NTU, pH 7.

3. Determining chlorine contact times for inactivation of 4 Log10 of CB5 in WW (0.2 NTU, pH 7)

Chlorine concentration in test flasks was determined (using the DPD-FAS method) from samples collected at appropriate time points and was used to calculate Ct (mg.min/L) values by a graphical function. Note that chlorine concentration was measured at the shortest intervals practicable early in the experiment (0.5, 2.5 and 5 minutes), to avoid over estimation of CB5 contact with chlorine. The linear decay curve is essential for visualising the Ct, particularly where inactivation times (from Figure A1) fell between experimental times (Figure A2). Chlorine residuals were also plotted logarithmically (not shown) to determine whether the Efficiency Factor Hom (EFH) approach, as used by Black et al. (2009), was appropriate (see Section 4, Appendix 1).


Table A2. AWQC in-house excel program used to calculate Ct required to inactivate 4 log10 of CB5 in WW (0.2 NTU, pH 7)

[Cl2] [mg/L] Time in minutes Average ∆Ct Ct (mg/L-min)

0 6.5 0 0 0.5 2.99 2.3725 2.3725 2.5 1.89 4.88 7.2525 5 1.41 4.125 11.3775

10 0.93 5.85 17.2275 20 0.52 7.25 24.4775 30 0.35 4.35 28.8275

To calculate a point in between mean data

points:

[Cl2] [mg/L]

Time from

curve Average ∆Ct Ct (mg/L-min) 3.692 2.0384 2.0384

1.6 minutes 2.385 2.95625 5.43875 2.37 -5.325 1.9275 1.89 -8.25 3.1275 1.34 -11.35 5.8775 0.86 -13.8 10.6775 0 -5.25 23.5775

The data were also entered into a computational spread sheet that estimates the integral of chlorine concentration between time = 0 and time taken to obtain 4 log10 inactivation shown in Table A2. The chlorine exposure or Ct value for each survival level (1, 2, 3 and 4-log10) was calculated using a computational spreadsheet, shown in Table A2. The spreadsheet interpolates a chlorine concentration for each survival time (where it falls between experimentally determined values) by a simple geometric calculation. Ct is then calculated as the cumulative geometric area under the decay curve between 0 and the interpolated value, as illustrated in Figure A2. Table A2 and Figure A2 illustrate the calculation for three replicate experiments used to calculate Ct for WW (0.2 NTU, pH 7) that took 1.6 minutes to inactivate 4 log10 of virus and the mean Ct from the replicates was 5.44 mg.min/L.


Figure A2. Chlorine decay in the experiment with CB5 in WW (0.2 NTU, pH 7), overlaid with a graphic illustrating the estimation of the Ct (integral) for 4-log10 inactivation at 1.6 minute (time from Figure A1). Free chlorine (u), free chlorine plus monochloramine (n), total chlorine (p).

4. ‘Efficiency Factor Hom’ Approach to Computing Ct.

Black et al. (2009) used the ‘Efficiency Factor Hom’ (EFH) to calculate Ct for virus inactivation

in buffered demand-free water (BDF). In this approach, the rate constant of chlorine decay

is used to calculate the integral

In the study reported here, plotting the data logarithmically showed that the decay kinetics

of chlorine are complex, at least biphasic, probably representing the interaction of HOCl

with ammonia (rapid) and with organic amines and other compounds (slower). Potentially,

two successive rate constants could be estimated. Since this important assumption of the

EFH approach (i.e. that there is a single rate constant for decay) is not met for WW, the

empirical approach described in the previous section was preferred.

∫ t=0

t 4-log

C.dt


Appendix 2

To determine virus survival post chlorination, virus numbers were enumerated by counting plaques formed in diluted water samples (as described in virus culture methods in the methodology section) and converted to plaque forming units/mL (PFU/mL). Plaque counts post chlorination for triplicate experiments are shown in tables below. (ND refers to not done and > refers to too many plaques to count). From preliminary experiments it was determined that some dilutions would give too high numbers to count and therefore were not done (ND).

Table 2A. Plaque counts in 0.2 NTU WW, pH 7 experiments Time in minutes

after adding chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus Titre PFU/mL

0.5 ND > 10,5 2,0 9999.5±4714 0.5 ND > 8,6 2,0 9330±1881 0.5 ND > 5,4 0,0 6000±943 1 ND 20,15 3,1 0,0 2300±424 1 ND 18,12 2,0 0,0 2000±566 1 ND 12,14 2,2 0,0 1730±184 1.5 2,2 0,0 0,0 ND 26±0 1.5 1,1 0,0 0,0 ND 13±0 1.5 0,2 0,0 0,0 ND 13±18.38 2.5 0,0 0,0 0,0 ND 0±0 2.5 0,0 0,0 0,0 ND 0±0 2.5 0,0 0,0 0,0 ND 0±0 5 0,0 0,0 0,0 ND 0±0 5 0,0 0,0 0,0 ND 0±0 5 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 No Chlorine Time 0 ND ND ND 14,16 200000±18856 Time 0 ND ND ND 17,19 240000±18856 Time 0 ND ND ND 10,10 133000±0 Time 30 ND ND ND 15,15 200000±0 Time 30 ND ND ND 15,15 200000±0 Time 30 ND ND ND 11,13 160000±18856


Table 2B. Plaque counts in 0.2 NTU WW, pH 8 experiments Time in minutes


Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus Titre PFU/mL

0.5 ND > > 12,12 160000±0 0.5 ND > > 14,15 193000±9899 0.5 ND > > 10,12 147000±18384 1 ND > > 5,5 66700±0 1 ND > > 8,6 93000±18384 1 ND > > 5,5 66700±0 1.5 ND > 15,15 2,2 20000±0 1.5 ND > 21,20 2,2 28400±566 1.5 ND > 15,16 2,2 20700±990 2.5 > > 5,4 ND 6000±943 2.5 > > 3,6,5 ND 5466±2073 2.5 > > 5,2 ND 3800±2168 5 15,14 2,3 0,0 ND 193±10 5 30,25 4,3 0,0 ND 366±47 5 16,14 2,1 0,0 ND 200±19 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 No Chlorine Time 0 ND ND ND 14,13 180000±9428 Time 0 ND ND ND 15,13 187000±18856 Time 0 ND ND ND 12,14 173000±18855 Time 30 ND ND ND 16,14 200000±18856 Time 30 ND ND ND 17,18 230000±9429 Time 30 ND ND ND 16,14 200000±18856


Table 2C. Plaque counts in 0.2 NTU WW, pH 9 experiments Time in minutes


Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus Titre PFU/mL

0.5 ND > > 12,10 146666±18857 0.5 ND > > 11,11 146666±0 0.5 ND > > 8,9 113333±9428 1 ND > > 10,10 133333±0 1 ND > > 11,12 153333±9429 1 ND > > 8,8 106666±0 1.5 ND > > 9,8 113333±9429 1.5 ND > > 6,5 73333±9428 1.5 ND > > 4,6 60000±9428 2.5 > > 10,8 ND 12000±1885 2.5 > > 12,12 ND 16000±0 2.5 > > 11,8 ND 12666±2828 5 > 3,6 1,2 ND 600±283 5 > 10,7 1,1 ND 1133±283 5 > 5,6 0,0 ND 733±95 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 No Chlorine Time 0 ND ND ND 14,16 200000±18856 Time 0 ND ND ND 14,14 186666±0 Time 0 ND ND ND 15,15 200000±0 Time 30 ND ND ND 17,14 206666±28284 Time 30 ND ND ND 15,15 200000±0 Time 30 ND ND ND 14,13 180000±9428


Table 2D. Plaque counts in 2 NTU WW, pH 7 experiments Time in minutes after adding chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 > > 7,6 ND 8666±943 0.5 > > 6,5 ND 7333±943 0.5 > > 5,5 ND 6666±0 1 > 7,7 0,0 ND 933±0 1 > 8,7 0,0 ND 1000±94 1 > 9,6 1,1 ND 1000±283 1.5 3,4 0,0 0,0 ND 47±9.19 1.5 3,4 0,0 0,0 ND 47±9.19 1.5 5,5 0,0 0,0 ND 67±0 2.5 0,0 0,0 0,0 ND 0±0 2.5 0,0 0,0 0,0 ND 0±0 2.5 0,0 0,0 0,0 ND 0±0 5 0,0 0,0 0,0 ND 0±0 5 0,0 0,0 0,0 ND 0±0 5 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 10 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 No Chlorine Time 0 ND ND ND 16,15 206667±9428 Time 0 ND ND ND 16,16 213333±0 Time 0 ND ND ND 14,14 186666±0 Time 30 ND ND ND 16,14 200000±18856 Time 30 ND ND ND 15,15 200000±0 Time 30 ND ND ND 16,14 2000000±18856


Table 2E. Plaque counts in 2 NTU WW, pH 8 experiments Time in minutes


Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 ND > > 8,7 100000±9428 0.5 ND > > 7,8 100000±9428 0.5 ND > > 8,7 100000±9428 1 ND > > 7,7 93333±0 1 ND > > 7,7 93333±0 1 ND > > 7,7 93333±0 1.5 ND > 20,22 2,3 28000±1886 1.5 ND > 20,21 2,2 27333±943 1.5 ND > 19,22 2,3 27333±2828 2.5 > > 8,7 0,0,0 10000±943 2.5 > > 7,8 0,0,0 10000±943 2.5 > > 8,7 0,0,0 10000±943 5 > 5,4 1,2 ND 600±94 5 > 14,13 1,1 ND 1800±94 5 > 5,4 2,2 ND 600±94 10 2,2 0,0 0,0 ND 26±0 10 1,1 0,0 0,0 ND 13±0 10 1,1 0,0 0,0 ND 13±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 No Chlorine Time 0 ND ND ND 14,14 186666±0 Time 0 ND ND ND 14,15 193333±9429 Time 0 ND ND ND 14,15 193333±9429 Time 30 ND ND ND 16,16 213333±0 Time 30 ND ND ND 15,15 200000±0 Time 30 ND ND ND 16,14 200000±18856


Table 2F. Plaque counts in 2 NTU WW, pH 9 experiments

Time in minutes after adding

chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 ND > > 9,10 126667±9428 0.5 ND > > 10,10 133333±0 0.5 ND > > 9,10 126667±9428 1 ND > > 8,8 106666±0 1 ND > > 9,9 120000±0 1 ND > > 8,7 100000±9427 1.5 ND > > 5,6 73333±9428 1.5 ND > > 7,6 86667±9427 1.5 ND > > 5,5 66666±0 2.5 > > 11,12 ND 15333±943 2.5 > > 12,11 ND 15333±943 2.5 > > 10,12 ND 14667±1886 5 > 12,14 2,1 ND 1733±188 5 > 13,10 1,2 ND 1533±283 5 > 14,10 1,1 ND 1660±377 10 2,2 0,0 0,0 ND 26±188 10 0,2 0,0 0,0 ND 13±282 10 2,2 0,0 0,0 ND 26±376 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 20 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 30 0,0 0,0 0,0 ND 0±0 No Chlorine Time 0 ND ND ND 18,17 227000±9428 Time 0 ND ND ND 18,18 240000±0 Time 0 ND ND ND 15,18 220000±28284 Time 30 ND ND ND 16,16 213333±0 Time 30 ND ND ND 18,17 227000±9428 Time 30 ND ND ND 16,16 213333±0


Table 2G. Plaque counts in 5 NTU WW, pH 7 experiments Time in minutes


Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 > > 7,6,- ND 8667±943 0.5 > > 4,6,5 ND 6667±1334 0.5 > > 4,5,- ND 6000±943 1 > 25,25,25 3,3,3 ND 3333±0 1 > 24,22,23 4,2,2 ND 3066±134 1 > 26,24,25 3,4,3 ND 3266±133 1.5 2,4,3 0,0,0 0,0,0 ND 40±13.5 1.5 3,1,2 0,0,0 0,0,0 ND 27±13.50 1.5 1,1,1 0,0,0 0,0,0 ND 13±0 2.5 0,0,0 0,0,0 0,0,0 ND 0±0 2.5 0,0,0 0,0,0 0,0,0 ND 0±0 2.5 0,0,0 0,0,0 0,0,0 ND 0±0 5 0,0,0 0,0,0 0,0,0 ND 0±0 5 0,0,0 0,0,0 0,0,0 ND 0±0 5 0,0,0 0,0,0 0,0,0 ND 0±0 10 0,0,0 0,0,0 0,0,0 ND 0±0 10 0,0,0 0,0,0 0,0,0 ND 0±0 10 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 No Chlorine Time 0 ND ND ND 14,13 180000±9428 Time 0 ND ND ND 12,13 167000±9428 Time 0 ND ND ND 14,14 187000±0 Time 30 ND ND ND 12,12 160000±0 Time 30 ND ND ND 14,14 187000±0 Time 30 ND ND ND 13,13 173000±0


Table 2H. Plaque counts in 5 NTU WW, pH 8 experiments

Time in minutes after

adding chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 ND > > 10,12,11 146666±13333 0.5 ND > > 14,15,- 193333±9428 0.5 ND > > 12,12,12 160000±0 1 ND > > 5,8,- 86667±28284 1 ND > > 7,8,- 100000±9428 1 ND > > 7,6 86667±9428 1.5 ND > 18,20,16 4,2,3 24400±2667 1.5 ND > 21,20,22 6,1,2 28000±1333 1.5 ND > 18,17,- 2,4,2 22666±943 2.5 ND 21,20,22 3,3,3 0,0,0 2800±133 2.5 ND 38,38,38 4,4,4 0,0,0 5066±0 2.5 ND 23,26,20 3,4,4 0,0,0 3066±400 5 12,12,12 3,2,- 0,0,0 ND 160±0 5 18,18,18 4,2,- 0,0,0 ND 240±0 5 17,16,18 1,2,- 0,0,0 ND 226±14 10 1,1,1 0,0,0 0,0,0 ND 13±0 10 0,0,0 0,0,0 0,0,0 ND 0±0 10 1,1,1 0,0,0 0,0,0 ND 13±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 No Chlorine Time 0 ND ND ND 15,13 186666±18856 Time 0 ND ND ND 15,13 186666±18856 Time 0 ND ND ND 13,13 173333±0 Time 30 ND ND ND 15,15 200000±0 Time 30 ND ND ND 17,17 226666±0 Time 30 ND ND ND 15,15 200000±0


Table 2I. Plaque counts in 5 NTU WW,pH 9 experiments


chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 ND > > 9,8,- 113333±9428 0.5 ND > > 5,8,- 86666±28284 0.5 ND > > 10,12,- 146666±18856 1 ND > > 8,8,8 106666±0 1 ND > > 8,7,- 100000±9428 1 ND > > 7,6,- 86666±94280 1.5 ND > > 7,6,- 86666±94280 1.5 ND > > 4,4,4 53333±0 1.5 ND > > 5,7,- 80000±18856 2.5 ND > 10,8,9 1,1,1 12000±1886 2.5 ND > 8,9,10 1,1,1 12000±1886 2.5 ND > 7,6,- 1,1,- 8666±942 5 > 7,7,7 1,1,1 ND 933±0 5 > 12,12,12 2,1,2 ND 1600±0 5 > 5,5,5 1,1,0 ND 666±0 10 0,0,0 0,0,0 0,0,0 ND 0±0 10 1,1,1 0,0,0 0,0,0 ND 13±0 10 1,1,1 0,0,0 0,0,0 ND 13±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 No Chlorine Time 0 ND ND ND 15,15 200000±0 Time 0 ND ND ND 16,14 200000±18856 Time 0 ND ND ND 16,13 193333±28284 Time 30 ND ND ND 14,12 173333±18855 Time 30 ND ND ND 13,18 206666±47140 Time 30 ND ND ND 14,14 186666±0


Table 2J. Plaque counts in 20 NTU WW, pH 7 experiments


chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 ND > 4,4,4 1,0,0 5333±0 0.5 ND > 4,4,4 0,1,1 5333±0 0.5 ND > 4,5,- 0,0,0 6000±943 1 ND 20,20,20 2,3,2 0,0,0 2667±0 1 ND 17,16,15 2,2,2 0,0,0 2133±94 1 ND 15,14,14 3,2,2 0,0,0 1910±77 1.5 ND 7,7,7 1,0,0 0,0,0 933±0 1.5 ND 8,8,8 1,1,1 0,0,0 1066±0 1.5 ND 7,9,- 2,1,0 0,0,0 1066±189 2.5 > 4,4,4 1,0,1 ND 533±0 2.5 > 5,4,- 0,0,1 ND 600±94 2.5 > 4,4,4 2,0,2 ND 533±0 5 10,10,10 0,0,0 0,0,0 ND 133±0 5 9,9,9 0,0,0 0,0,0 ND 120±0 5 10,10,10 0,0,0 0,0,0 ND 133±0 10 1,1,1 0,0,0 0,0,0 ND 13±0 10 0,0,0 0,0,0 0,0,0 ND 0±0 10 1,1,1 0,0,0 0,0,0 ND 13±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 20 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 No Chlorine Time 0 ND ND ND 18,18 240000±0 Time 0 ND ND ND 17,18 233334±9427 Time 0 ND ND ND 17,17 226666±0 Time 30 ND ND ND 18,17 233334±9427 Time 30 ND ND ND 18,17 233334±9427 Time 30 ND ND ND 17,17 226666±0


Table 2K. Plaque counts in 20 NTU WW, pH 8 experiments


chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 ND > > 5,5,5 66667±0 0.5 ND > > 5,5,5 66667±0 0.5 ND > > 6,6,- 80000±0 1 ND > > 3,3,3 40000±0 1 ND > > 3,3,3 40000±0 1 ND > > 3,2,3 33333±9428 1.5 ND > 20,20,20 2,2,2 26667±0 1.5 ND > 18,19,- 3,2,- 24667±943 1.5 ND > 20,21,19 2,2,2 26667±1885 2.5 > > 6,7,5 0,0,0 8000±1885 2.5 > > 7,6,5 0,1,0 8000±1885 2.5 > > 7,7,7 2,0,0 9333±0 5 > 7,8,- 1,1,1 0,0,0 1000±95 5 > 8,8,8 2,1,1 0,0,0 1067±0 5 > 8,9,- 0,0,1 0,1,0 1133±94 10 12,12,- 2,1,1 1,0,0 ND 160±0 10 11,14,- 0,1,1 0,0,0 ND 166±28 10 12,12,12 1,1,0 0,0,0 ND 160±0 20 1,1,1 0,0,0 0,0,0 ND 13±0 20 2,0,1 0,0,0 0,0,0 ND 13±13 20 1,1,1 0,0,0 0,0,0 ND 13±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 No Chlorine Time 0 ND ND ND 18,18 240000±0 Time 0 ND ND ND 17,18 233333±9428 Time 0 ND ND ND 17,16 220000±9428 Time 30 ND ND ND 17,18 233333±9428 Time 30 ND ND ND 18,18 240000±0 Time 30 ND ND ND 17,17 226667±0


Table 2L. Plaque counts in 20 NTU WW, pH 9 experiments


chlorine

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Virus titre PFU/mL

0.5 ND > > 7,7,7 93333±0 0.5 ND > > 8,6,7 93333±13333 0.5 ND > > 9,7,8 106666±13334 1 ND > > 6,6,6 80000±0 1 ND > > 5,7,6 80000±0 1 ND > > 6,8,7 93333±13334 1.5 ND > > 4,5,- 60000±9428 1.5 ND > > 3,5,4 53333±13334 1.5 ND > > 4,5,- 60000±9429 2.5 ND > 24,22,23 2,2,2 30667±1336 2.5 ND > 28,24,26 2,2,2 34667±2667 2.5 ND > 24,24,24 1,2,- 32000±0 5 > > 7,7,7 ND 9333±0 5 > > 8,6,7 ND 9333±1334 5 > > 7,8,- ND 10000±943 10 > 10,8,9 1,0,1 ND 1200±133 10 > 7,6,- 2,2,2 ND 866±94 10 > 11,12,- 0,2,2 ND 1534±94 20 5,6,4 1,0,0 0,0,0 ND 67±14 20 4,4,4 0,1,0 0,0,0 ND 53±0 20 5,5,5 0,0,0 0,0,0 ND 67±0 30 1,1,1 0,0,0 0,0,0 ND 13±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 30 0,0,0 0,0,0 0,0,0 ND 0±0 No Chlorine Time 0 ND ND ND 17,18 233334±9428 Time 0 ND ND ND 16,18 226667±18856 Time 0 ND ND ND 18,17 233334±9427 Time 30 ND ND ND 16,18 226667±18856 Time 30 ND ND ND 17,17 226667±0 Time 30 ND ND ND 18,17 233334±9427


Appendix 3

Chlorine species decay curves for Ct experiments in WW of turbidities of 0.2, 2, 5, and 20 NTU and pH 7, 8 and 9 at 10°C used to extrapolate graphs in Figures 4.3 A and B in Chapter 4 are shown in the tables below. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine and total represent a cumulative value of all chlorine species.

Table 3A. Chlorine decay data for WW 0.2 NTU, pH 7

Time in

minutes

Replicate 1

Replicate 2

Replicate 3

FAC FAC+mono Total chlorine


FAC FAC + mono Total chlorine

0 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.5

0.5 3.11 3.62 4.18 3.1 3.62 4.18 2.99 3.47 4.06

2.5 2.06 2.58 3.21 2.05 2.52 3.18 1.89 2.41 3.13

5 1.55 2.07 2.8 1.51 2.05 2.76 1.41 1.96 2.66

10 1.04 1.55 2.25 1.01 1.54 2.18 0.93 1.46 2.13

20 0.53 1.08 1.82 0.54 1.1 1.71 0.52 1.03 1.66

30 0.39 0.85 1.56 0.37 0.86 1.58 0.35 0.85 1.58

Table 3B. Chlorine decay data for WW 0.2 NTU, pH 8 Time

in minutes

Replicate 1

Replicate 2

Replicate 3




0 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.5

0.5 3.03 3.65 3.96 2.51 3.25 3.39 3.05 3.63 3.93

2.5 2.36 3.08 3.4 1.66 2.35 2.7 2.16 2.88 3.27

5 1.86 2.59 2.94 1.28 1.92 2.33 1.71 2.37 2.75

10 1.38 2.01 2.47 0.92 1.51 1.88 1.24 1.96 2.37

20 0.89 1.54 2.02 0.46 1.1 1.53 0.9 1.64 2.11

30 0.59 1.29 1.68 0.33 0.95 1.41 0.55 1.23 1.59


Table 3C. Chlorine decay data for WW 0.2 NTU, pH 9 Time

in minutes

Replicate 1

Replicate 2

Replicate 3




0 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.5 6.5

0.5 3.4 4.18 4.32 3.42 4.21 4.34 3.43 4.22 4.39

2.5 2.59 3.28 3.67 2.61 3.31 3.67 2.64 3.33 3.7

5 2.15 2.83 3.24 2.18 2.88 3.27 2.22 2.89 3.3

10 1.73 2.38 2.75 1.72 2.41 2.78 1.78 2.44 2.83

20 1.17 1.79 2.26 1.21 1.84 2.29 1.28 1.91 2.33

30 0.87 1.6 1.97 0.9 1.63 2.02 0.93 1.68 2.05

Table 3D. Chlorine decay data for WW 2 NTU, pH 7

Time in

minutes

Replicate 1

Replicate 2

Replicate 3




0 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87

0.5 2.67 3.06 3.58 2.96 3.4 3.73 2.97 3.34 3.77

2.5 1.45 2.11 2.65 1.61 2.14 2.61 1.65 2.15 2.61

5 0.89 1.5 2.1 1.17 1.68 2.31 1.14 1.66 2.11

10 0.54 1.08 1.64 0.65 1.22 1.74 0.69 1.17 1.74

20 0.3 0.76 1.48 0.38 0.84 1.38 0.28 0.77 1.37

30 0.23 0.69 1.29 0.27 0.68 1.26 0.17 0.62 1.1


Table 3E. Chlorine decay data for WW 2 NTU, pH 8 Time

in minutes

Replicate 1

Replicate 2

Replicate 3




0 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87

0.5 2.66 3.47 3.63 2.71 3.39 3.77 2.77 3.26 3.69

2.5 1.72 2.39 2.6 1.77 2.35 2.7 1.71 2.36 2.7

5 1.28 1.89 2.25 1.32 1.86 2.28 1.17 1.78 2.33

10 0.72 1.29 1.97 0.88 1.46 1.94 0.75 1.4 1.96

20 0.46 0.93 1.56 0.62 1.05 1.51 0.41 0.96 1.6

30 0.29 0.8 1.36 0.3 0.82 1.32 0.26 0.72 1.31

Table 3F.Chlorine decay data for WW 2 NTU, pH 9

Time in

minutes

Replicate 1

Replicate 2

Replicate 3




0 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87

0.5 3.71 4.43 4.77 3.66 4.34 4.65 3.87 4.4 4.78

2.5 2.93 3.73 4.17 2.78 3.6 3.84 2.77 3.58 4

5 2.36 3.11 3.43 2.37 3.17 3.48 2.43 3.1 3.37

10 1.73 2.59 2.94 1.76 2.56 2.9 1.67 2.44 2.85

20 1.16 1.77 2.2 1.15 1.89 2.23 1.06 1.8 2.31

30 0.83 1.46 1.78 0.91 1.55 2.01 0.71 1.39 1.77


Table 3G. Chlorine decay data for WW 5 NTU, pH 7 Time

in minutes

Replicate 1

Replicate 2

Replicate 3




0 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87

0.5 3.42 4.09 4.87 3.35 4 4.74 3.39 4.12 4.9

2.5 2.06 2.42 3.35 2 2.39 3.33 2.12 2.45 3.55

5 1.68 1.99 2.91 1.54 1.95 2.81 1.66 2.01 2.96

10 1.17 1.5 2.35 1.11 1.48 2.28 1.2 1.55 2.39

20 0.61 1.3 1.76 0.58 1.27 1.73 0.71 1.22 1.85

30 0.42 1.22 1.65 0.4 1.05 1.62 0.47 1.02 1.68

Table 3I. Chlorine decay data for WW 5 NTU, pH 8

Time In

minutes

Replicate 1

Replicate 2

Replicate 3




0 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87

0.5 3.78 4.3 4.75 3.75 4.4 4.77 3.72 4.3 4.72

2.5 2.72 3.07 3.62 2.66 3.06 3.59 2.65 3.05 3.55

5 2.23 2.71 3.16 2.22 2.64 3.09 2.2 2.65 3.08

10 1.78 2.23 2.62 1.71 2.19 2.6 1.65 2.16 2.55

20 1.22 1.69 2.23 1.09 1.61 2.16 1.06 1.64 2.19

30 0.87 1.52 2.07 0.76 1.43 2 0.78 1.46 1.93


Table 3J. Chlorine decay data for WW 5 NTU, pH 9 Time

in minutes

Replicate 1

Replicate 2

Replicate 3




0 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87 6.87

0.5 4.25 4.84 5.16 4.24 4.51 5.07 4.00 4.65 5.07

2.5 3.29 3.83 4.14 3.25 3.74 4.06 3.16 3.74 4.06

5 2.82 3.25 3.6 2.77 3.2 3.53 2.61 3.18 3.53

10 2.25 2.72 3.22 2.19 2.69 3.08 2.08 2.67 3.08

20 1.56 2.09 2.61 1.52 2.11 2.6 1.43 2.07 2.6

30 1.11 1.76 2.31 1.05 1.76 2.07 0.98 1.76 2.27

Table 3K. Chlorine decay data for WW 20 NTU, pH 7 Time

in minutes

Replicate 1

Replicate 2

Replicate 3




0 9 9 9 9 9 9 9 9 9

0.5 5.01 5.51 5.55 5.3 5.64 6.13 4.94 5.72 6.13

2.5 3.23 3.74 4.77 3.48 3.85 4.59 3.23 3.56 4.08

5 2.33 2.7 3.5 2.59 2.92 3.65 2.25 2.65 3.59

10 1.43 1.86 3.05 1.66 2.07 3.16 1.48 1.99 3.08

20 0.63 1.22 2.49 0.89 1.35 1.89 0.71 1.14 2.02

30 0.39 0.78 2.26 0.44 1.1 2.07 0.44 0.87 2.21


Table 3L.Chlorine decay data for WW 20 NTU, pH 8 Time

in minutes

Replicate 1

Replicate 2

Replicate 3




0 9 9 9 9 9 9 9 9 9

0.5 4.74 5.32 5.56 4.8 5.32 5.66 4.31 4.87 5.26

2.5 3.17 3.53 4.25 2.95 3.37 4.22 2.83 3.37 4.13

5 2.24 2.75 3.6 2.04 2.49 3.47 2.06 2.69 3.44

10 1.46 1.91 2.69 1.12 1.58 2.86 1.31 1.72 2.63

20 0.88 1.21 2.16 0.86 1.01 2.26 0.87 1.14 2.22

30 0.49 0.92 2.09 0.48 0.78 2.07 0.49 0.73 1.98

Table 3M. Chlorine decay data for WW 20 NTU, pH 9

Time in

minutes

Replicate 1

Replicate 2

Replicate 3




0 9 9 9 9 9 9 9 9 9

0.5 4.82 5.9 6.04 4.8 5.56 6.12 4.9 5.82 6.18

2.5 3.55 4.5 5.04 3.59 4.41 4.96 3.75 4.49 4.99

5 2.7 3.48 4.4 2.82 3.74 4.18 2.87 3.59 4.38

10 1.8 2.71 3.47 1.94 2.86 3.51 2.15 3.02 3.64

20 0.98 1.85 2.67 1.14 2.01 2.9 1.11 2.07 2.92

30 0.6 1.48 2.29 0.66 1.45 2.45 0.63 1.52 2.6


Appendix 4 Example of monochloramine Ct calculation To determine Ct (mg.min/L) for 4 log10 virus inactivation, infectious virus (PFU/ml) in each test flask at the appropriate time points was converted to survival values by treating the average number of viruses in the control flasks during the experiment as the initial titre (See Figure 2.2). Note that control flasks were supplemented with adenovirus 2 virus (with no monochlorine applied), and kept under the same condition as the test flasks at all times, and were tested in triplicate alongside the test flasks with monochloramine. Samples were assayed at time 0 and 390 minutes from each control flask. Table 4A1 shows data and calculated survival values for the experiment using WW 5 NTU, pH 8, used to plot the graph in Figure 4A1 to calculate time required to inactivate 4 log10 (99.99%) of adenovirus 2.

1. Raw data

Table 4A1. Inactivation of adenovirus 2 using 15 mg/L of preformed monochloramine at 10°C pH 8, 5 NTU

Time Average PFU/mL of virus surviving after

dosing with 15 mg/L of monochloramine

Survival of adenovirus 2

relative to control

Log10 inactivation of adenovirus 2

0 423334 1 0 10 411111 0.971 0.013 30 417778 0.987 0.006 60 353334 0.835 0.078 90 184444 0.436 0.361

120 64445 0.152 0.817 150 23556 0.057 1.255 180 7556 0.018 1.748 240 4734 0.004 2.387 300 218 0.0005 3.289 360 45 0.0001 3.978 390 0 0

Control Arith mean

423334

A line of best fit to the survival data shown in Figure 4A1, allowing for the initial lag, was constructed as shown in Figure 4A1. Lines of linear regression were used only for water with turbidity of 2 NTU (pH 7, 8 and 9) and 5 NTU (pH 7 and 8) as survival graphs were linear. However, when survival graphs were clearly not linear, as seen in WWs with turbidity of 5 NTU (pH 9) and 20 NTU (pH 7, 8 and 9), curves were used. The shape of these curves indicates very slow inactivation of viruses, consistent with extended protection of viruses by particulates. To avoid the assumption that inactivation continued at a single constant rate, a curve was preferred to linear regression. Monochloramine has been found


to more effective for biofilm control than free chlorine as it is able to penetrate through thick biofilm and therefore monochloramine may be more effective in disinfecting virus embedded in particulates than chlorine.

2. Establishing time required to achieve 4 log10 inactivation of adenovirus 2 in WW (5 NTU, pH 8) by plotting log10 survival of adenovirus 2 vs. time (in minutes) post

monochloramination.

Figure 4A1. Survival values of adenovirus 2 vs. time showing 1, 2, 3 and 4 log10 virus inactivation requires 126, 204, 282 and 360 minutes respectively in WW 5 NTU, pH 8 with pre-formed monochloramine.

3. Determining monochloramine contact times for inactivation of 4 log10 of adenovirus 2 in WW (5 NTU, pH 8)

Monochloramine concentration in test flasks were determined (using the DPD-FAS method) from samples collected at appropriate time points and were used to calculate Ct (mg.min/L) values using a graphical function. The arithmetically-scaled decay curve is essential for visualising the Ct, particularly where inactivation times (from Figure A1) fell between experimental times (Figure A2). Chloramine residuals were also plotted logarithmically (not shown) to determine whether the Efficiency Factor Hom (EFH) approach, as used by Black et al., (2009), was appropriate (see section 4 of Appendix 4)

1E-05

0.0001

0.001

0.01

0.1

1

0 30 60 90 120 150 180 210 240 270 300 330 360

Surv

ival

of A

deno

viru

s 2

Time in mins post 15 mg/L monochloramination


Table 4A2. AWQC in house excel program used to calculate Ct required to inactivate 1-4 log10 of adenovirus 2 in WW (5 NTU, pH 8) with pre-formed monochloramine

Time(minute) Average ΔCT CT(mg/L-min)

SD of residual

0 15 0 0

0.5 12.96666667 6.991666667

6.991666667

0.233523732

5 12.920 58.245 65.237 0.260 10 12.827 64.367 129.603 0.266 30 12.687 255.133 384.737 0.145 60 12.627 379.700 764.437 0.133 90 12.533 377.400 1141.837 0.121 120 12.387 373.800 1515.637 0.160 150 12.293 370.200 1885.837 0.103 180 12.213 367.600 2253.437 0.110 240 12.107 729.600 2983.037 0.140 300 12.027 724.000 3707.037 0.142 360 11.933 718.800 4425.837 0.201 390 11.860 356.900 4782.737 0.171

To calculate a point in between mean data points:

Time from curve Average ΔCT CT(mg/L-min)

interval 1 15.000 0.000 0.000 interval 2 12.972 -6.485 0.507 interval 3 13.013 -64.833 0.403 interval 4 12.897 -128.617 0.987 interval 5 12.747 -381.500 3.237 interval 6 12.813 -763.200 1.237 interval 7 12.973 -1147.800 -5.963 interval 8 126.000 12.368 74.264 1589.901 interval 9 12.693 -1874.000 11.837 interval 10 204.000 12.171 292.608 2546.045 interval 11 282.000 12.051 507.304 3490.341 interval 12 360.000 11.933 718.800 4425.837 interval 13 12.813 -4454.400 -28.563

Survival expt: Time from curve Calculated Cts

1 log inactiv time 126.000 1589.901 T 2-log 204.000 2546.045 T 3-log 282.000 3490.341 T 4-log 360.000 4425.837

The data were also entered into a computational spread sheet that estimates the integral of monochloramine concentration (Ct) between time = 0 and the time required for each


inactivation level (1, 2, 3 and 4-logs), shown in Table 4A2. The spreadsheet interpolates a monochloramine concentration for each survival time (where it falls between experimentally determined values) by a simple geometric calculation. Ct is then calculated as the cumulative geometric area under the decay curve between t = 0 and the interpolated value, as illustrated in Figure 4A2. Table 4A2 and Figure 4A2 illustrate the calculation used to calculate Ct for WW (5 NTU, pH 8) that took 204 and 360 minutes to inactivate 2- and 4-log10 of virus respectively.

Figure 4A2. Monochloramine decay in the experiment with adenovirus 2 in WW (NTU = 5, pH 8), overlaid with a graphic illustrating the estimation of the Ct (integral) for 2-log10 and 4-log10 inactivation at 204, 360 minute respectively (times from Figure 4A1). Monochloramine (u), total chlorine (n).

Appendix 5

4. ‘Efficiency Factor Hom’ Approach to Computing Ct.

Sirikanchana et. al. (2008) and others used the ‘Efficiency Factor Hom’ (EFH) to calculate Ct for virus inactivation in buffered demand-free water (BDF). In that approach, the rate constant of monochloramine decay is used to calculate the integral

In the study reported here, plotting the monochloramine decay data logarithmically showed that the decay kinetics are complex and at least biphasic. This is similar to the decay kinetics reported for free chlorine in the chapter 4, albeit much slower in the second phase, but the precise mechanisms are not the same. Specifically, the more rapid initial decay is not attributable to interaction of HOCl with NH3. Since the important assumption of the EFH approach that there is a single rate constant for decay is not met for WW, the empirical approach to calculating Ct described in the previous section was preferred.

∫

t=0

t x-log

C.dt


To determine virus survival post chloramination, virus numbers were enumerated by counting plaques formed in diluted water samples (as described in virus culture methods in the methodology section) and converted to plaque forming units/mL (PFU/mL). Plaque counts post chloramination for triplicate experiments are shown in the tables below. (ND refers to not done and > refers to too many plaques to count). From preliminary experiments it was determined that some dilutions would give numbers too high to count and therefore were not done (ND).

Table 5A. Adenovirus 2 plaque counts in 2 NTU WW, pH 7 experiments with pre-formed monochloramine

Time in minutes post chloramination

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1.20000

Virus titre PFU/mL

5 ND ND > 15,15 2,1 200000±0 5 ND ND > 14,20 2,2 266667±40000 5 ND ND > 14,16 2,2 200000±13333 10 ND > > 15,15 1,2 200000±0 10 ND > > 15,15 1,1 200000±0 10 ND > > 15,15 2,2 200000±0 30 > > > 5,6 ND 73334±6667 30 > > > 5,5 ND 66667±0 30 > > > 6,7 ND 86667±6667 60 > > 27,29 3,3 ND 37333±1333 60 > > 29,32 2,3 ND 40667±2001 60 > > 30,28 3,2 ND 38667±1334 90 > > 16,12 1,1 ND 18667±2667 90 > > 12,15 0,1 ND 18000±2000 90 > > 12,14 1,1 ND 17334±1334 120 > 16,16 0,1 0 ND 2133±0 120 > 17,20 0,2 0 ND 2467±200 120 > 22,22 2,2 0 ND 2933±0 150 52,58 6,8 1,1 0,0 ND 733±40 150 68,67 12,10 0,0 0,0 ND 900±7 150 70,68 10,9 0,0 0,0 ND 920±14 240 3,2 0,0 ND ND ND 33±7 240 0,0 0,0 ND ND ND 0±0 240 0,0 0,0 ND ND ND 0±0 No monochloramine controls (minutes)

0 ND ND > 15,15 2,1 200000±0 0 ND ND > 15,15 2,2 200000±0 0 ND ND > 15,15 3,2 200000±0 240 ND ND > 15,15 1,2 200000±0 240 ND ND > 16,15 1,2 206667±6667 240 ND ND > 15,15 2,2 200000±0


Table 5B. Adenovirus 2 plaque counts in 2 NTU WW, pH 8 experiments for preformed monochloramine


Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

5 ND ND ND 16,15 1,0 206667±6667 5 ND ND ND 19,18 0,1 246667±6667 5 ND ND ND 16,16 1,1 213333±0 10 ND ND > 16,15 2,1 206667±6667 10 ND ND > 20,16 2,0 240000±26667 10 ND ND > 14,18 0,1 213334±26667 30 ND ND > 17,17 1,1 206667±11547 30 ND ND > 16,16 1,1 240000±15396 30 ND ND > 20,16 1,1 213334±30792 60 ND ND > 8,8 0,0 106667±0 60 ND ND > 10,7 0,0 113333±20000 60 ND ND > 10,10 0,0 133333±0 90 ND ND > 5,6 ND 73000±6669 90 ND ND > 6,6 ND 80000± 90 ND ND > 5,6 ND 73330±6667 120 ND > 8,8 1,0 ND 10667±0 120 ND > 12,11 0,0 ND 15334±667 120 ND > 11,10 0,0 ND 14000±667 150 ND > 8,8 0,0 ND 10667±0 150 ND > 5,5 0,0 ND 6670±2 150 ND > 6,6 0,0 ND 8000±0 240 8,8 1,0 ND ND ND 106±0 240 12,10 2,1 ND ND ND 147±14 240 10,10 0,0 ND ND ND 133±0 300 2,0 0,0 ND ND ND 14±14 300 3,0 0,0 ND ND ND 20±20 300 2,0 0,0 ND ND ND 14±20 360 0,0 0,0 ND ND ND 0±0 360 0,0 0,0 ND ND ND 0±0 360 0,0 0,0 ND ND ND 0±0 No monochloramine controls (minutes)

0 ND ND ND 16,15 1,1 206667±6667 0 ND ND ND 17,18 1,1 233334±6667 0 ND ND ND 16,15 1,2 206667±6667 360 ND ND ND 18,16 1,2 226667±13334 360 ND ND ND 15,18 2,1 220000±20000 360 ND ND ND 15,16 1,1 206667±6667


Table 5C. Adenovirus 2 plaque counts in 2 NTU WW, pH 9 experiments Time in mins post chloramination

Dilution

1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

5 ND ND > 29,25 2,1 360000±26667 5 ND ND > 25,25 0,1 333333±0 5 ND ND > 26,22 1,0 320000±26667 10 ND ND > 25,25 4,3 333333±0 10 ND ND > 28,20 3,2 320000±53333 10 ND ND > 26,25 2,2 340000±6667 30 ND ND > 29,22 ND 340000±46667 30 ND ND > 26,28 ND 360000±13333 30 ND ND > 29,22 ND 340000±46667 60 ND ND > 20,18 ND 253334±13334 60 ND ND > 24,22 ND 306667±13334 60 ND ND > 18,20 ND 253334±13334 90 ND ND > 15,16 ND 206667±6667 90 ND ND > 18,15 ND 220000±20000 90 ND ND > 16,18 ND 226667±13334 120 ND ND > 10,12 ND 146667±13334 120 ND ND > 10,10 ND 133333±0 120 ND ND > 12,11 ND 153334±6667 150 > > > 6,5 ND 73334±6667 150 > > > 8,6 ND 93334±13334 150 > > > 8,6 ND 93334±13334 240 > > 18,19 1,2 ND 24667±667 240 > > 18,18 1,1 ND 24000±0 240 > > 11,12 1,0 ND 15334±667 360 > 9,9 1,0 0,0 ND 1200±0 360 > 12,11 1,1 0,0 ND 1533±67 360 > 12,12 2,2 0,0 ND 1600±0 480 3,2 0,0 0,0 0,0 ND 34±7 480 2,2 0,0 0,0 0,0 ND 27±0 480 3,2 0,0 0,0 0,0 ND 34±7 600 0,0 0,0 0,0 0,0 ND 34±9 600 0,0 0,0 0,0 0,0 ND 34±0 600 0,0 0,0 0,0 0,0 ND 34±9 No monochloramine control (minutes)



Table 5D. Adenovirus 2 plaque Plaque counts in 5 NTU WW, pH 7 experiments with

preformed monochloramine Time in minutes post chloramination

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

10 ND ND > 18,14 ND 213334±2667 10 ND ND > 14,13 ND 180000±6667 10 ND ND > 18,16 ND 226667±13334 30 ND ND > 10,10 ND 133333±0 30 ND ND > 20,24 ND 293334±26667 30 ND ND > 10,10 ND 13333±0 60 ND ND 24,20 1,2 ND 29334±2667 60 ND ND 32,29 2,3 ND 40667±2000 60 ND ND 24,26 2,4 ND 33334±1334 90 ND ND 15,18 0,1 ND 22000±2000 90 ND ND 25,28 3,2 ND 35333±2000 90 ND ND 16,15 1,0 ND 20667±667 120 ND 20,17 1,0 0,0 ND 2467±200 120 ND > 18,16 2,0 ND 22667±1334 120 ND 23,20 4,3 0,0 ND 4667±667 150 > 18,19 0,0 ND ND 2467±67 150 > > 15,15 ND ND 20000±0 150 > 19,18 1,0 ND ND 2467±67 180 > 13,10 0,0 ND ND 1533±200 180 > > 5,7 ND ND 8000±1333 180 > 9,8 1,0 ND ND 1133±67 210 10,6 0,0 0,0 ND ND 107±27 210 26,20 2,2 0,0 ND ND 306±40 210 9,5 0,0 0,0 ND ND 94±27 240 1,1 0,0 0,0 ND ND 13±0 240 12,14 2,1 0,0 ND ND 173±13 240 2,1 0,0 0,0 ND ND 20±7 270 0,0 0,0 0,0 ND ND 0±0 270 2,2 1,0 0,0 ND ND 27±0 270 0,0 0,0 0,0 ND ND 0±0 No monochloramine controls (minutes)



Table 5E. Adenovirus 2 plaque counts in 5 NTU WW, pH 8 experiments with preformed monochloramine


Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

10 ND > > 26,32 2,2 386667±40000 10 ND > > 36,30 1,2 440000±40000 10 ND > > 29,32 3,2 406667±20000 30 ND > > 28,29 2,1 380000±667 30 ND > > 36,31 2,2 446667±33334 30 ND > > 29,35 1,2 426667±40000 60 ND > > 25,26 2,1 340000±9429 60 ND > > 24,28 2,1 346667±37712 60 ND > > 26,30 1,1 373334±37712 90 ND > > 15,18 0,0 220000±20000 90 ND > > 10,10 1,0 133333±0 90 ND > > 12,18 0,0 200000±40000 120 ND > > 5,5 ND 66667±0 120 ND > > 5,5 ND 66667±0 120 ND > > 5,4 ND 60000±6667 150 ND > 16,18 1,2 ND 22667±1334 150 ND > 20,14 1,3 ND 22667±4000 150 ND > 18,20 1,2 ND 25334±1334 180 > > 6,5 ND ND 7334±667 180 > > 5,6 ND ND 7334±667 180 > > 6,6 ND ND 8000±0 240 > 11,11 2,1 ND ND 1467±0 240 > 13,15 2,2 ND ND 1867±134 240 > 13,15 0,0 ND ND 1867±134 300 19,10 1,1 0,0 ND ND 193±60 300 20,19 2,2 0,0 ND ND 260±7 300 15,15 1,2 0,0 ND ND 200±0 360 5,5 0,0 0,0 ND ND 67±0 360 0,0 0,0 0,0 ND ND 0±0 360 5,5 0,0 0,0 ND ND 67±0 390 C C C C C No result 390 C C C C C No result 390 C C C C C No result No monochloramine control (minutes)

0 ND ND ND 32,36 2,2 453333±26667 0 ND ND ND 30,32 1,2 413334±13334 0 ND ND ND 26,32 2,2 386667±40000 390 ND ND ND 30,32 2,2 413334±13334 390 ND ND ND 36,32 2,3 453334±26667 390 ND ND ND 29,34 2,3 420000±33333 *C=contaminated cultures no results available


Table 5F. Adenovirus 2 plaque counts in 5 NTU WW, pH 9 experiments with preformed

monochloramine Time in minutes

post chloramination

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

10 ND ND > 31,29 ND 400000±13333 10 ND ND > 31,31 ND 413333±0 10 ND ND > 31,25 ND 373333±40000 30 ND ND > 25,38 ND 420000±86667 30 ND ND > 35,27 ND 428334±38334 30 ND ND > 27,26 ND 346667±0 60 ND ND > 25,24 ND 326667±6667 60 ND ND > 24,24 ND 320000±0 60 ND ND > 33,36 ND 460000±20000 90 ND ND > 25,23 ND 320000±13333 90 ND ND > 24,24 ND 320000±0 90 ND ND > 27,25 ND 346667±13334 120 ND ND > 21,21 ND 300000±20000 120 ND ND > 26,24 ND 333334±13334 120 ND ND > 22,21 ND 286667±6667 180 ND ND > 18,16 ND 226667±13334 180 ND ND > 18,18 ND 240000±0 180 ND ND > 14,16 ND 200000±13333 240 ND ND > 7,8 ND 100000±6667 240 ND ND > 7,9 ND 106667±13334 240 ND ND > 6,7 ND 86667±6667 360 > > 18,17 ND ND 23334±667 360 > > 16,14 ND ND 20000±1333 360 > > 14,15 ND ND 22000±2000 480 > 12,14 1,0 ND ND 1734±134 480 > 13,13 0,0 ND ND 1733±0 480 > 16,12 0,0 ND ND 1867±267 600 14,16 0,0 0,0 ND ND 200±13 600 12,14 0,0 0,0 ND ND 174±14 600 10,12 0,0 0,0 ND ND 147±14 720 1,1 0,0 0,0 ND ND 13±0 720 2,3 0,0 0,0 ND ND 33±7 720 1,1 0,0 0,0 ND ND 13±0 No monochloramine control (mins)



Table 5G. Adenovirus 2 plaque counts in 20 NTU WW, pH 7 experiments with preformed monochloramine

Time in mins post chloramination

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

10 ND > > 25,26 ND 340000±6667 10 ND > > 31,25 ND 373333±40000 10 ND > > 26,20 ND 306667±40000 30 ND > > 27,27 ND 360000±0 30 ND > > 26,29 ND 366667±20000 30 ND > > 20,18 ND 253334±13334 60 ND > > 10,8 ND 120000±13333 60 ND > > 12,12 ND 160000±0 60 ND > > 17,12 ND 193334±33334 90 ND > > 6,8 ND 93334±13334 90 ND > > 7,7 ND 93333±0 90 ND > > 7,7 ND 93333±0 120 > > 16,16 ND ND 21333±0 120 > > 18,18 ND ND 24000±0 120 > > 16,16 ND ND 21333±0 150 > 18,18 1,0 ND ND 2400±0 150 > 18,18 0,0 ND ND 2400±0 150 > 22,22 1,0 ND ND 2933±0 180 > 12,10 0,0 ND ND 1467±134 180 > 12,10 0,0 ND ND 1467±134 180 > 15,15 0,0 ND ND 2000±0 210 > 8,8 0,0 ND ND 1067±0 210 > 8,5 0,0 ND ND 867±200 210 > 5,5 0,0 ND ND 667±0 240 10,8 1,0 0,0 ND ND 120±14 240 10,8 1,1 0,0 ND ND 120±14 240 10,8 0,0 0,0 ND ND 120±14 270 6,2 0,0 0,0 ND ND 54±27 270 5,6 0,0 0,0 ND ND 74±7 270 2,2 0,0 0,0 ND ND 27±0 300 1,0 1,0 ND ND ND 7±7 300 2,1 0,0 ND ND ND 20±7 300 2,0 0,0 ND ND ND 14±14 360 0,0 0,0 ND ND ND 0±0 360 1,0 0,0 ND ND ND 7±7 360 0,0 0,0 ND ND ND 0±0 No monochloramine control (mins)



Table 5H. Adenovirus 2 plaque counts in 20 NTU WW, pH 8 experiments with preformed monochloramine

Time in mins post chloramination

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

10 ND ND > 26,27 ND 353334±6667 10 ND ND > 28,22 ND 333333±40000 10 ND ND > 29,30 ND 393334±6667 30 ND ND > 26,25 ND 340000±6667 30 ND ND > 24,23 ND 313334±6667 30 ND ND > 22,26 ND 320000±26667 60 ND ND > 28,24 ND 346667±26667 60 ND ND > 23,22 ND 300000±6667 60 ND ND > 21,18 ND 260000±20000 90 ND ND > 20,22 ND 280000 ±13333 90 ND ND > 18,20 ND 253000±13335 90 ND ND > 22,16 ND 253000±40000 120 ND ND > 16,15 ND 206667±6667 120 ND ND > 16,12 ND 186667±26667 120 ND ND > 12,8 ND 133334±26667 150 ND ND > 12,14 ND 173334±13334 150 ND ND > 12,10 ND 146667±13334 150 ND ND > 6,12 ND 120000±40000 180 ND ND > 5,8 ND 86667±20000 180 ND ND > 6,6 ND 80000±0 180 ND ND > 6,6 ND 80000±0 240 > > 16,15 ND ND 20667±667 240 > > 12,16 ND ND 18667±2667 240 > > 12,14 ND ND 17334±1334 300 > 16,14 0,0 ND ND 2000±133 300 > 12,10 0,0 ND ND 1467±134 300 > 12,16 0,0 ND ND 1867±267 360 15,14 0,0 ND ND ND 193±7 360 21,16 0,0 ND ND ND 247±34 360 18,12 0,0 ND ND ND 200±40 420 5,2 0,0 ND ND ND 47±20 420 1,3 0,0 ND ND ND 27±14 420 2,2 0,0 ND ND ND 27±0 480 1,1 ND ND ND 13±0 480 0,0 ND ND ND 0±0 480 1,0 ND ND ND 7±7 No monochloramine control (mins)



Table 5I. Adenovirus 2 plaque counts in 20 NTU WW, pH 9 experiments with preformed monochloramine

Time in mins after adding chloramination

Dilution 1:2

Dilution 1:20

Dilution 1:200

Dilution 1:2000

Dilution 1:20000

Virus titre PFU/mL

10 ND ND > 15,18 ND 220000±20000 10 ND ND > 19,20 ND 260000±6667 10 ND ND > 17,21 ND 253334±26667 30 ND ND > 16,17 ND 220000±6667 30 ND ND > 20,21 ND 273334±6667 30 ND ND > 22,22 ND 293333±0 60 ND ND > 22,22 ND 293333±0 60 ND ND > 18,18 ND 240000±0 60 ND ND > 24,18 ND 280000±40000 90 ND ND > 18,18 ND 240000±0 90 ND ND > 16,21 ND 246667±33334 90 ND ND > 16,24 ND 266667±53334 120 ND ND > 16,18 ND 226667±13334 120 ND ND > 12,16 ND 186667±26667 120 ND ND > 18,12 ND 200000±40000 180 ND ND > 16,12 ND 186667±26667 180 ND ND > 19,16 ND 233333±20000 180 ND ND > 15,14 ND 193334±6667 240 ND > > 9,10 ND 126667±6667 240 ND > > 8,9 ND 113334±6667 240 ND > > 6,12 ND 120000±40000 360 ND > > 4,4 ND 53333±0 360 ND > > 8,3 ND 73334±33334 360 ND > > 4,4 ND 53333±0 480 ND > 8,8 0 ND 10667±0 480 ND > 8,10 0 ND 12000±1333 480 ND > 10,8 0 ND 12000±1333 600 > 15,14 ND ND ND 1934±67 600 > 14, 5 ND ND ND 1267±600 600 > 17,17 ND ND ND 2267±0 720 10,10 0,0 ND ND ND 133±0 720 12,8 1,0 ND ND ND 133±27 720 10,10 0,0 ND ND ND 133±0 840 1,1 0,0 ND ND ND 13.3±0 840 0,0 0,0 ND ND ND 0±0 840 0,0 0,0 ND ND ND 0±0 960 0,0 0,0 ND ND ND 0±0 960 0,0 0,0 ND ND ND 0±0 960 0,0 0,0 ND ND ND 0±0 No monochloramine controls (mins)

0 ND ND > 15,16 ND 206667±6667 0 ND ND > 15,20 ND 233334±33334 0 ND ND > 22,16 ND 253333±40000 960 ND ND > 18,19 ND 252667±12667 960 ND ND > 25,16 ND 273333±60000 960 ND ND > 22,18 ND 266667±26667


Appendix 6

Chloramine titration data and decay curves for Ct experiments in WW of turbidities of 2, 5, and 20 NTU and pH 7, 8 and 9 at 10°C were used to extrapolate graphs in Figure 5.3 A-C in Chapter 5 are shown in the tables below. FAC represents free available chlorine, FAC + mono represents free available chlorine and monochloramine and total represent a cumulative value of all chlorine species.

Table 6A. Chloramine decay data for WW 2 NTU, pH 7

Time (mins) Replicate 1 Replicate 2 Replicate 3

FAC FAC+mono Total chlorine FAC FAC+mono Total

chlorine FAC FAC+mono Total chlorine

1.0 <0.1 13.62 13.64 <0.1 13.48 13.58 <0.1 13.52 13.58

5.0 <0.1 13.54 13.64 <0.1 13.44 13.64 <0.1 13.32 13.38

10 <0.1 13.52 13.66 <0.1 13.52 13.68 <0.1 13.48 13.58

30 <0.1 13.5 13.66 <0.1 13.42 13.56 <0.1 13.46 13.58

60 <0.1 13.36 13.5 <0.1 13.48 13.58 <0.1 13.44 13.56

90 <0.1 13.34 13.5 <0.1 13.42 13.56 <0.1 13.32 13.52

120 <0.1 13.18 13.34 <0.1 13.22 13.3 <0.1 13.26 13.44

150 <0.1 13.1 13.28 <0.1 13.04 13.18 <0.1 13.06 13.18

240 <0.1 - - <0.1 12.5 12.76 <0.1 12.68 12.92


Table 6B. Chloramine decay data for WW 2 NTU, pH 8




0.5 <0.1 13.96 14.04 <0.1 13.98 14.06 <0.1 13.96 14.06

5 <0.1 13.92 14.04 <0.1 13.90 14.02 <0.1 13.90 13.96

10 <0.1 13.92 14.04 <0.1 13.92 14.00 <0.1 13.84 13.90

30 <0.1 13.72 13.78 <0.1 13.76 13.84 <0.1 13.84 13.92

60 <0.1 13.68 13.78 <0.1 13.68 13.76 <0.1 13.70 13.84

90 <0.1 13.58 13.70 <0.1 13.62 13.76 <0.1 13.58 13.66

120 <0.1 13.58 13.66 <0.1 13.54 13.64 <0.1 13.50 13.60

150 <0.1 13.34 13.48 <0.1 13.40 13.52 <0.1 13.26 13.34

240 <0.1 13.2 13.36 <0.1 13.16 13.32 <0.1 13.10 13.24

300 <0.1 13.28 13.46 <0.1 13.14 13.28 <0.1 13.02 13.22

360 <0.1 12.96 13.16 <0.1 13.00 13.20 <0.1 12.94 13.06


Table 6C. Chloramine decay data for WW 2 NTU, pH 9



chlorine FAC FAC + mono

Total chlorine

0.5 <0.1 14.62 14.70 <0.1 14.70 14.76 <0.1 14.66 14.76

5 <0.1 14.6 14.66 <0.1 14.64 14.72 <0.1 14.52 14.60

10 <0.1 14.56 14.62 <0.1 14.58 14.66 <0.1 14.50 14.60

30 <0.1 14.26 14.34 <0.1 14.40 14.54 <0.1 14.38 14.52

60 <0.1 14.26 14.36 <0.1 14.38 14.50 <0.1 14.26 14.42

90 <0.1 14.22 14.30 <0.1 14.30 14.44 <0.1 14.20 14.32

120 <0.1 14.18 14.28 <0.1 14.22 14.34 <0.1 14.18 14.32

150 <0.1 14.18 14.32 <0.1 14.16 14.26 <0.1 14.14 14.20

240 <0.1 14.14 14.30 <0.1 14.04 14.14 <0.1 14.04 14.12

360 <0.1 13.96 14.12 <0.1 13.86 14.02 <0.1 13.84 13.90

480 <0.1 13.68 13.84 <0.1 13.60 13.78 <0.1 13.74 13.88

600 <0.1 13.44 13.66 <0.1 13.32 13.38 <0.1 13.42 13.48


Table 6D. Chloramine decay data for WW 5 NTU, pH 7




0.5 <0.1 12.94 12.98 <0.1 13.10 13.20 <0.1 13.06 13.18

5 <0.1 12.74 12.80 <0.1 12.82 12.94 <0.1 12.84 12.94

10 <0.1 12.64 12.72 <0.1 12.68 12.80 <0.1 12.72 12.88

30 <0.1 12.58 12.70 <0.1 12.64 12.80 <0.1 12.68 12.84

60 <0.1 12.40 12.52 <0.1 12.40 12.56 <0.1 12.44 12.56

90 <0.1 12.36 12.52 <0.1 12.40 12.56 <0.1 12.40 12.56

120 <0.1 12.24 12.40 <0.1 12.36 12.54 <0.1 12.32 12.50

150 <0.1 11.96 12.16 <0.1 12.22 12.40 <0.1 12.24 12.42

180 <0.1 11.88 12.00 <0.1 12.14 12.28 <0.1 12.12 12.26

210 <0.1 11.88 12.04 <0.1 12.08 12.24 <0.1 12.00 12.14

240 <0.1 11.72 11.86 <0.1 11.88 12.06 <0.1 11.94 12.10

270 <0.1 11.68 11.80 <0.1 11.82 12.04 <0.1 11.86 12.04


Table 6E. Chloramine decay data for WW 5 NTU, pH 8




0.5 <0.1 13.22 13.28 <0.1 12.92 12.96 <0.1 12.76 12.84

5 <0.1 13.18 13.22 <0.1 12.92 12.96 <0.1 12.66 12.76

10 <0.1 13.12 13.18 <0.1 12.76 12.82 <0.1 12.60 12.64

30 <0.1 12.78 12.86 <0.1 12.76 12.84 <0.1 12.52 12.58

60 <0.1 12.74 12.84 <0.1 12.66 12.74 <0.1 12.48 12.54

90 <0.1 12.66 12.74 <0.1 12.52 12.58 <0.1 12.42 12.52

120 <0.1 12.54 12.68 <0.1 12.40 12.50 <0.1 12.22 12.28

150 <0.1 12.38 12.52 <0.1 12.32 12.42 <0.1 12.18 12.26

180 <0.1 12.32 12.44 <0.1 12.22 12.34 <0.1 12.10 12.20

240 <0.1 12.24 12.34 <0.1 12.12 12.26 <0.1 11.96 12.08

300 <0.1 12.18 12.30 <0.1 12.00 12.12 <0.1 11.90 12.06

360 <0.1 12.12 12.24 <0.1 11.96 12.10 <0.1 11.72 11.84

390 <0.1 12.02 12.16 <0.1 11.88 12.04 <0.1 11.68 11.76


Table 6F. Chloramine decay data for WW 5 NTU, pH 9



chlorine FAC FAC + mono

Total chlorine

0.5 <0.1 13.96 14.04 <0.1 14.06 14.14 <0.1 14.04 14.14

5 <0.1 13.92 14.02 <0.1 13.94 14.02 <0.1 13.86 13.92

10 <0.1 13.84 13.94 <0.1 13.76 13.84 <0.1 13.82 13.88

30 <0.1 - 13.62 <0.1 13.60 13.72 <0.1 13.78 13.90

60 <0.1 13.58 13.68 <0.1 13.60 13.70 <0.1 13.64 13.78

90 <0.1 13.54 13.70 <0.1 13.50 13.62 <0.1 13.60 13.76

120 <0.1 13.46 13.58 <0.1 13.48 13.60 <0.1 13.46 13.58

180 <0.1 13.40 13.52 <0.1 13.40 13.52 <0.1 13.44 13.54

240 <0.1 13.28 13.42 <0.1 13.32 13.44 <0.1 13.42 13.60

360 <0.1 13.24 13.40 <0.1 13.22 13.32 <0.1 13.40 13.56

480 <0.1 13.16 13.28 <0.1 12.86 12.98 <0.1 13.22 13.38

600 <0.1 12.72 12.90 <0.1 12.48 12.66 <0.1 12.76 12.90

720 <0.1 12.30 12.50 <0.1 12.12 12.28 <0.1 12.52 12.74


Table 6G. Chloramine decay data for WW 20 NTU, pH 7




0.5 <0.1 14.60 14.76 <0.1 14.68 14.84 <0.1 14.68 14.88

5 <0.1 14.20 14.40 <0.1 14.24 14.44 <0.1 14.16 14.36

10 <0.1 13.40 13.60 <0.1 13.44 13.60 <0.1 13.60 13.92

30 <0.1 13.36 13.56 <0.1 13.36 13.60 <0.1 13.56 13.84

60 <0.1 13.28 13.48 <0.1 13.32 13.52 <0.1 13.48 13.76

90 <0.1 13.40 13.72 <0.1 13.40 13.92 <0.1 13.44 13.80

120 <0.1 13.36 13.64 <0.1 13.28 13.56 <0.1 13.44 13.80

150 <0.1 13.28 13.52 <0.1 13.28 13.52 <0.1 13.36 13.76

180 <0.1 13.20 13.44 <0.1 13.24 13.48 <0.1 13.32 13.60

210 <0.1 13.16 13.36 <0.1 13.20 13.44 <0.1 13.32 13.68

240 <0.1 13.08 13.32 <0.1 13.12 13.32 <0.1 13.20 13.52

270 <0.1 13.04 13.24 <0.1 13.04 13.32 <0.1 13.20 13.48

300 <0.1 12.84 13.08 <0.1 13.04 13.32 <0.1 13.20 13.40

360 <0.1 12.56 12.84 <0.1 12.84 13.12 <0.1 13.12 13.36


Table 6H. Chloramine decay data for WW 20 NTU, pH 8




0.5 <0.1 15.60 15.68 <0.1 15.20 15.28 <0.1 14.84 14.92

5 <0.1 15.36 15.44 <0.1 14.76 14.84 <0.1 14.32 14.40

10 <0.1 14.80 14.92 <0.1 14.08 14.20 <0.1 - -

30 <0.1 14.56 14.68 <0.1 14.24 14.36 <0.1 14.16 14.28

60 <0.1 14.36 14.76 <0.1 14.16 14.36 <0.1 14.16 14.32

90 <0.1 14.32 14.60 <0.1 14.12 14.32 <0.1 14.08 14.24

120 <0.1 14.20 14.48 <0.1 14.08 14.28 <0.1 14.08 14.24

150 <0.1 14.16 14.40 <0.1 14.08 14.28 <0.1 14.04 14.20

180 <0.1 14.08 14.36 <0.1 14.04 14.28 <0.1 13.96 14.16

240 <0.1 14.04 14.32 <0.1 14.00 14.24 <0.1 13.92 14.08

300 <0.1 13.92 14.20 <0.1 13.96 14.28 <0.1 13.88 14.08

360 <0.1 13.88 14.12 <0.1 13.88 14.16 <0.1 13.80 14.00

420 <0.1 13.84 14.08 <0.1 13.84 14.12 <0.1 13.76 14.04

480 <0.1 13.76 14.04 <0.1 13.80 14.00 <0.1 13.68 13.92


Table 6I. Monochlorine decay data for WW 20 NTU, pH 9




0.5 <0.1 15.44 15.64 <0.1 15.36 15.64 <0.1 14.68 14.80

5 <0.1 14.96 15.12 <0.1 14.80 15.16 <0.1 14.64 14.84

10 <0.1 14.08 14.32 <0.1 14.20 14.32 <0.1 14.32 14.64

30 <0.1 14.28 14.52 <0.1 14.28 14.44 <0.1 14.36 14.68

60 <0.1 14.28 14.60 <0.1 14.28 14.56 <0.1 14.32 14.60

90 <0.1 14.24 14.52 <0.1 14.28 14.60 <0.1 14.28 14.56

120 <0.1 14.20 14.40 <0.1 14.20 14.60 <0.1 14.24 14.48

180 <0.1 14.08 14.24 <0.1 14.12 14.48 <0.1 14.08 14.28

240 <0.1 14.08 14.28 <0.1 14.00 14.16 <0.1 14.00 14.24

360 <0.1 14.00 14.24 <0.1 13.92 14.12 <0.1 13.88 14.12

480 <0.1 13.52 14.16 <0.1 13.64 13.88 <0.1 13.64 13.92

600 <0.1 13.28 13.72 <0.1 13.36 13.60 <0.1 13.28 13.60

720 <0.1 13.16 13.32 <0.1 13.12 13.48 <0.1 12.96 13.20

840 <0.1 12.80 12.96 <0.1 13.04 13.52 <0.1 12.52 12.84

960 <0.1 12.84 13.08 <0.1 12.88 13.44 <0.1 12.40 12.72


Appendix 7

Table 7A. Plaque counts post 5 mg/L chlorination for triplicate experiments of native F-RNA phage in 5 WWs.

Water Type Time (min) Plaques per 25 mL - 1

Plaques per 25 mL - 2

Plaques per 25 mL -3

Mean

Bolivar Lagoon Influent

Control 0

91

105

98

98

0.25 1 0 2 1 0.50 0 0 0 0 1.00 0 0 0 0 2.00 0 0 0 0 Control 2 90 79 76 81.7 Bolivar DAFF Raw water

Control 0

2

1

0

1

0.25 0 0 0 0 0.50 0 0 0 0 1.00 0 0 0 0 2.00 0 0 0 0 Control 2 0 0 1 0.3 Bolivar DAFF Product

Control 0

0

0

0

0

0.25 0.25 0 0 0 0.50 0.50 0 0 0 1.0 1.00 0 0 0 2.00 2.00 0 0 0 Control 2 0 0 0 0 MW1 Control 0 16 18 14 16 0.25 2 3 1 2 0.50 2 1 0 1 0.75 1 0 0 0.3 1.00 0 0 0 0 Control 2 MW2 Control 0 4 2 7 0.25 1 2 0 4.3 0.50 1 0 0 1 0.75 0 0 0 0.3 1.00 0 0 0 0 Control 2


Table 7B: Plaque counts post 20 mg/L chloramination for triplicate experiments of native F-RNA phage in 5 WWs.

Water Type Time (min) Plaques per 25

mL - 1 Plaques per 25

mL - 2 Plaques per 25

mL -3 Mean

Bolivar Lagoon Influent

Control 0

102

89

97

96

30 2 0 0 0.7 60 0 1 0 0.3 90 0 0 0 0 120 0 0 0 0 150 0 0 0 0 Control 2 77 109 80 89 Bolivar DAFF Raw water

Control 0

2

0

2

1.3

30 1 0 0 0.3 60 0 0 0 0 90 0 0 0 0 120 0 0 0 0 150 0 0 0 0 Control 2 5 2 0 2.3 Bolivar DAFF Product

Control 0

1

0

0

0.3

30 0 0 0 0 60 0 0 0 0 90 0 0 0 0 120 0 0 0 0 150 0 0 0 0 Control 2 0 0 0 0 MW1 Control 0 20 15 14 16.3 5 3 1 2 2 10 0 1 0 0.3 20 1 0 0 0.3 30 0 0 0 0 60 0 0 0 0 Control 2 17 21 18 18.7 MW2 Control 0 5 3 4 4 5 0 1 1 0.7 10 0 0 0 0 20 0 0 0 0 30 0 0 0 0 60 0 0 0 0 Control 2 3 2 3 2.7


Table 7C. E. coli counts post 5 mg/L chlorination or 20 mg/L chloramination for triplicate experiments in 5 WWs.

Chlorination

Water type Time (min) replicate-1 replicate-2 replicate-3 Mean

MW1 - 0.00 44000 58000 49000 50333.3

0.25 18000 21000 21000 20000.0

0.50 22000 17000 16000 18333.3

0.75 13000 18000 14000 15000.0

1.00 25000 15000 14000 18000.0

control start 58000

MW2 - 0.00 7 5 11 7.7

0.25 0 0 0 0.0

0.50 0 0 0 0.0

0.75 0 0 0 0.0

1.00 0 0 0 0.0

control start 10

Chloramination

MW1 - 0.00 46000 52000 61000 53000.0

5.00 0 0 0 0.0

10.00 0 0 1 0.3

20.00 0 0 0 0.0

30.00 0 0 0 0.0

60.00 0 0 0 0.0

control fin 33000 33000.0

MW2 - 0.00 10 10 11 10.3

5.00 0 0 1 0.3

10.00 0 0 0 0.0

20.00 0 0 0 0.0

30.00 0 0 0 0.0

60.00 0 0 0 0.0

control fin 18 18.0

Date post:	15-Mar-2019
Category:	Documents
Upload:	phungdat
View:	217 times
Download:	0 times

Chlor(am)ine disinfection of human pathogenic viruses in ... · This report presents data for...

Documents