3083Research Article

IntroductionGlycosaminoglycans (GAGs) are a widely distributed, structurallydiverse family of sulfated, unbranched polysaccharides that areexpressed abundantly on the surface of cells and incorporated intoextracellular matrix (ECM) (Bishop et al., 2007). GAGs haveemerged as important regulators of the signaling involved in cellgrowth, tumorigenesis and inflammation (Iozzo, 2005; Parish, 2006;Taylor and Gallo, 2006). One species of GAG that is uniquelyimportant in morphogenesis, cell division and cartilage developmentis chondroitin sulfate, the carbohydrate component of chondroitinsulfate proteoglycans (CSPGs), molecules that are spatiotemporallyregulated during brain development (Hwang et al., 2003; Knudsonand Knudson, 2001; Laabs et al., 2005; Sirko et al., 2007) andupregulated after injury in the central nervous system (CNS)(Chung et al., 2000; Silver and Miller, 2004).

During development, several different CSPGs have beenlocalized to specific regions, such as the optic chiasm, where theyappear to provide chemorepulsive signals to guide axonal growth(Bandtlow and Zimmermann, 2000; Chung et al., 2000; Ichijo andKawabata, 2001). In the adult nervous system, high levels ofCSPGs are found in perineuronal nets, where they are thought tostabilize synaptic connections. Removal of chondroitin sulfateGAG chains with chondroitinase ABC (cABC) restores oculardominance plasticity in the adult visual cortex of rats (Pizzorussoet al., 2002). Even higher levels of CSPGs are found after injuriesto the adult mammalian CNS, where CSPGs are a majorcomponent of the glial scar that impedes axonal regeneration(Silver and Miller, 2004). cABC treatment enhances axonalgrowth and functional recovery after spinal cord injury (Bradburyet al., 2002). However, the distinctive features of chondroitin

sulfate GAG chains involved in these processes have not beenfully identified.

Chondroitin sulfate GAG chains are complex unbranchedpolysaccharides of variable length with a backbone structurecomposed of a repeating disaccharide unit consisting of D-glucuronic acid (GlcA) and N-acetyl-D-galactosamine (GalNAc).This simple repetitive structure then can undergo extensivemodification by sulfation at the C2 position of GlcA and/or the C4or C6 position of GalNAc residues during biosynthesis. Thelocation of modifications by distinct sulfotransferases is nottemplate-driven, leading to a huge number of potential combinationsof sulfation along the carbohydrate backbone. Whether specificsulfation in chondroitin sulfate regulates biological events is a matterof conjecture.

In this study, we use axonal guidance/growth and specificmodifications of the sulfation of chondroitin sulfate GAG chainsas a model to decipher the nature and importance of specificsulfation and the mechanisms by which it coordinates biologicalevents. We present evidence that small changes in 4-sulfation ofchondroitin sulfate GAG chains have major effects on the potencyof CSPGs to impart guidance cues to neurons. These results supportthe concept that distinct sulfation along the carbohydrate backbonecarries instructions to regulate neuronal function.

Results4-sulfation of chondroitin is critical for axonal guidanceWe performed axonal guidance spot assays (Meiners et al., 1999)to determine the behavior of axons as they encounter immobilizedCSPGs. Axonal behavior of cultured mouse cerebellar granuleneurons (CGNs) was analyzed near a defined region of chicken

Glycosaminoglycan (GAG) side chains endow extracellularmatrix proteoglycans with diversity and complexity based uponthe length, composition and charge distribution of thepolysaccharide chain. Using cultured primary neurons, we showthat specific sulfation in the GAG chains of chondroitin sulfatemediates neuronal guidance cues and axonal growth inhibition.Chondroitin-4-sulfate (CS-A), but not chondroitin-6-sulfate(CS-C), exhibits a strong negative guidance cue to mousecerebellar granule neurons. Enzymatic and gene-basedmanipulations of 4-sulfation in the GAG side chains alter theirability to direct growing axons. Furthermore, 4-sulfated

chondroitin sulfate GAG chains are rapidly and significantlyincreased in regions that do not support axonal regenerationproximal to spinal cord lesions in mice. Thus, our findings showthat specific sulfation along the carbohydrate backbone carriesinstructions to regulate neuronal function.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/121/18/3083/DC1

Key words: Chondroitin sulfate proteoglycan, Sulfation, Axonalguidance, Axonal growth

Summary

Chondroitin-4-sulfation negatively regulates axonalguidance and growthHang Wang1,*, Yasuhiro Katagiri1,*,‡, Thomas E. McCann1, Edward Unsworth2, Paul Goldsmith2, Zu-Xi Yu3,Fei Tan1, Lizzie Santiago1, Edward M. Mills4, Yu Wang5, Aviva J. Symes5 and Herbert M. Geller1

1Developmental Neurobiology Section and 3Pathology Core, National Heart, Lung and Blood Institute, and 2Basic Research Laboratory, Center forCancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA4Division of Pharmacology/Toxicology, College of Pharmacy, The University of Texas at Austin, Austin, TX 78712, USA5Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, MD 20814, USA*These authors contributed equally to this work‡Author for correspondence (e-mail: katagir@helix.nih.gov)

Accepted 25 June 2008Journal of Cell Science 121, 3083-3091 Published by The Company of Biologists 2008doi:10.1242/jcs.032649

Jour

nal o

f Cel

l Sci

ence

3084

CSPGs immobilized onto poly-L-lysine (PLL)-coated coverslips.As observed previously (Laabs et al., 2007), most axons weredeflected and few crossed onto the CSPG-rich area of the coverslip(Fig. 1A). Time-lapse imaging with adult mouse dorsal rootganglion neurons showed that filopodia dynamically sampled theCSPG spot (red), and that the growing axons turned at the interfacebetween PLL and CSPG, and continued to extend along theinterface, which is in contrast to growth cone collapse (Supplementalmaterial Movie 1). Removal of the chondroitin sulfate GAG chainsby cABC abolished this negative axonal guidance cue, indicatingthat the repellant activity of CSPGs is specifically mediated by thechondroitin sulfate GAG chains (Fig. 1B).

We examined whether chondroitin sulfate GAG chains alone couldrepel axons. When 4-sulfate-enriched (84%, determined by HPLC;supplementary material Fig. S1) CS-A was spotted onto PLL, axonswere repelled at the interface in a manner comparable to native CSPGs(Fig. 1C,G). This repellent activity of CS-A was found to be verysensitive to cABC treatment. CS-A partially digested with cABC wasprecipitated with ethanol to remove disaccharides from the fractions,immobilized as spots and subjected to axonal guidance spot assays.Digestion by the enzyme of less than 2% of the total GAG abolishedits activity (Fig. 1D). This indicates that a small portion of chondroitinsulfate GAG chains is essential for neuronal guidance activity. Moresurprising is that 6-sulfate-enriched (84%) CS-C had no inhibitoryactivity, because axons and cell bodies grew well on immobilizedCS-C (Fig. 1E). These results suggest that sulfation at the C4 positionof the GalNAc moiety presents a specific negative guidance cue toaxons. Axons of dissociated embryonic mouse cortical neuronsshowed the same behavior as immobilized CS-A and CS-C(supplementary material Fig. S2).

The role of chondroitin sulfate 4-sulfation in axonal guidancewas further confirmed by the observation that chondro-4-sulfatasetreatment of CS-A totally abolished the axon-repellant action (Fig.1F,G), despite only a modest reduction in 4-sulfation (Table 1). Thisresult strengthens the idea that subsets of the sulfation are crucialfor its biological activity. To exclude the possibility that thepresence of cABC in the chondro-4-sulfatase preparation wasresponsible for the drastic change in its biological activity, weconducted axonal guidance spot assays with CSPGs after treatmentwith chondro-4-sulfatase. Note that chondroitin sulfate disaccharidesare good substrates for chondro-4-sulfatase, but intact CSPGs arenot (Yamagata et al., 1968). Axons were repelled by sulfatase-treatedCSPGs at comparable levels to non-treated CSPGs (data notshown). CS-A was then extensively digested with chondro-4-sulfatase at 37°C for 16 hours and subjected to fluorescent labelingwithout cABC treatment. Since the appearance of chondroitin sulfatedisaccharides is dependent upon cABC activity, the presence orabsence of fluorescent signals derived from chondroitin sulfatedisaccharides allows us to determine whether cABC is a contaminantof the chondro-4-sulfatase. Although we observed clear fluorescentsignals in HPLC analysis with cABC treatment (Table 1), there wasno signal derived from chondroitin sulfate disaccharides whencABC treatment was skipped after chondro-4-sulfatase digestion(data not shown). Both of these experiments strongly suggest thatit is the chondro-4-sulfatase that alters the biological activity ofCS-A.

CSPGs produced by reactive astrocytes attenuate axonalgrowthTo explore the functional consequences of sulfation of chondroitinsulfate GAG chains on axonal behavior, we examined neuron-

astrocyte interactions using a co-culture system, which is morephysiologically relevant than studying cells in isolation. In the adultCNS, astrocytes are generally supportive of neuronal function.However, injuries to the CNS induce a gliotic reaction characterizedby the presence of reactive astrocytes, which are major componentsof the glial scar, which is considered to be detrimental to axonalregeneration. TGFβ is rapidly upregulated after CNS injury in vivoand is important both as a soluble regulator of ECM formation andin inducing reactive astrocytes (Flanders et al., 1998; Smith andStrunz, 2005). Confluent cultures of astrocytes were pretreated withTGFβ1 for 7 days; dissociated CGNs were plated onto thesemonolayers and co-cultured in fresh medium without TGFβ1 for2 days, followed by measurement of axonal length. Whereas axonsof CGNs growing on untreated astrocytes elaborated long and thinprocesses (Fig. 2A) (process length: 93±4 μm, mean ± s.d.), theaxons of neurons cultured on TGFβ1-treated astrocytes hadsignificantly shorter processes (54±2 μm, P<0.01 compared withuntreated astrocytes; Student’s t-test). This reduction in axonalgrowth was also observed when neurons alone were cultured inconditioned medium derived from TGFβ1-treated astrocytes (Fig.2B). To exclude the possibility that TGFβ1 directly affects axonal

Journal of Cell Science 121 (18)

Fig. 1. CS-A, but not CS-C, repels axons in a 4-sulfation-dependent manner.(A-F) Axonal guidance spot assays were performed with (A) chicken CSPG,(B) chicken CSPG treated with cABC, (C) CS-A, (D) CS-A partially digestedwith cABC, (E) CS-C, (F) CS-A treated with chondro-4-sulfatase. Each testsubstance was immobilized onto a PLL-coated coverslip and the behavior ofaxons at the interface between PLL and the sample (red) was quantified asdescribed in the Materials and Methods. (G) Quantitative analysis of axonalbehavior at the interface. Data are expressed as the mean ± s.d. Scale bar:25 μm.

Jour

nal o

f Cel

l Sci

ence

3085Axonal guidance and chondroitin sulfate

growth, a potent TGFβ type I receptor inhibitor, SB-431542, wasadded to conditioned medium derived from TGFβ1-treatedastrocytes. SB-431542 addition failed to restore neuronal growth,confirming that TGFβ1-dependent axonal growth inhibition ismediated through its action on astrocytes and not neurons.

Consistent with axonal growth inhibition, CSPG production wasincreased in TGFβ1-treated astrocytes as determined biochemically(Fig. 2C) and cytochemically (supplementary material Fig. S3) usingan antibody recognizing 4- and 6-sulfated chondroitin sulfate.Increased production of CSPGs in conditioned medium and celllysates was observed after 3 days of treatment with TGFβ1. It shouldbe noted that CS-56-positive bands were sensitive to cABCtreatment and migrated faster and less diffusely on SDS-PAGE underreducing conditions than non-reducing conditions (supplementarymaterial Fig. S3). However, production of laminin, a major growth-permissive component of the ECM, was not altered in responseto TGFβ1 treatment (data not shown). More quantitatively,accumulation of CSPGs by reactive astrocytes was detected inconditioned medium using an ELISA as early as 1 day after TGFβ1treatment (Fig. 2D). Quantitative RT-PCR revealed that mRNAlevels of genes encoding neurocan and versican were upregulatedafter TGFβ1 treatment (Asher et al., 2000). These data indicate thatthe increased production of CSPGs by reactive astrocytes is likelyto be responsible for inhibition of axonal growth.

To firmly establish the involvement of CSPGs in this inhibition,we performed axonal guidance spot assays with immobilizedconditioned medium derived from astrocytes (Fig. 3). Axonsfavored growth on PLL compared with the spot where concentratedTGFβ1-treated conditioned medium was immobilized, and thispreference was abolished by cABC treatment (Fig. 3A,B),demonstrating that it is the chondroitin sulfate GAG chains in theconditioned medium that impart neuronal guidance cues. Next, weexamined the effect of GAG synthesis inhibitors on axonal growth.Astrocytes were pretreated with TGFβ1 together with xyloside orsodium chlorate, and neurons were cultured on the monolayers (Fig.3C). Reduction of axonal growth by TGFβ1 treatment was preventedwhen the covalent attachment of GAG chains to the core proteinwas competitively inhibited by treatment of astrocytes withxylosides, or when sulfation was blocked by sodium chlorate.Together, these data provide substantial evidence that chondroitinsulfate GAG chains produced by reactive astrocytes mediate axonalgrowth inhibition.

Reactive astrocytes show increased production of 4-sulfatedchondroitin sulfate GAG chainsWe next determined whether TGFβ1 treatment regulates thesulfation of chondroitin sulfate GAG chains. Immunoblot analysesof conditioned medium with monoclonal antibodies 2B6 and 3B3(specific for 4-sulfated and 6-sulfated chondroitin sulfate GAGchains, respectively) showed substantial increases in 4-sulfation anda slight increase in 6-sulfation 3 days after TGFβ1 addition (Fig.4A). This was confirmed quantitatively by an ELISA with anotherset of sulfation-specific monoclonal antibodies (MAB2030 and2035) (Fig. 4B). It is noteworthy that only 4-sulfated chondroitinsulfate was acutely induced within 24 hours of TGFβ1 exposure,and that accumulation rates of 4-sulfated and 6-sulfated chondroitinsulfate thereafter were similar.

The finding of this dramatic change in 4-sulfation led us toexamine chondroitin sulfotransferases that are responsible for thesulfation in GalNAc. Consistent with our ELISA data, quantitativeRT-PCR revealed a 3.8-fold induction in chondroitin 4-O-sulfotransferase 1 (C4ST1, official gene symbol Chst11) mRNA asearly as 8 hours after TGFβ1 treatment that endured for 48 hours(Fig. 4C). By contrast, levels of chondroitin 6-O-sulfotransferase1 (C6ST1, official gene symbol Chst3) mRNA remainedunchanged (Fig. 4D). Other chondroitin sulfotransferases

Table 1. Disaccharide composition analysis of CS-A, CS-Cand chondro-4-sulfatase-treated CS-A

CS-C CS-A CS-A treated with 4-sulfatase

ΔDi-0S 0.69±0.61 1.43±0.75 6.90±0.94ΔDi-4S 9.30±1.18 83.79±1.04 77.43±1.07ΔDi-6S 83.62±1.16 8.67±0.09 8.42±0.13ΔDi-2,6S 6.26±0.44 0 0.07±0.11ΔDi-4,6S 0.14±0.24 0.39±0.06 0.54±0.42ΔDi-2,4,6S 0 1.08±0.96 1.03±0.90

Unsaturated disaccharides generated by digestion with cABC wereanalyzed by anion-exchange HPLC after labeling with the fluorophore 2ABas described in the Materials and Methods. The values obtained from threeindependent experiments were used to calculate the percentage of eachunsaturated disaccharide (mean ± s.d.). ΔDi-0S, ΔHexUA-GalNAc; ΔDi-4S,ΔHexUA-GalNAc(4-O-sulfate); ΔDi-6S, ΔHexUA-GalNAc(6-O-sulfate);ΔDi-2,6S, ΔHexUA(2-O-sulfate)-GalNAc(6-O-sulfate); ΔDi-4,6S, ΔHexUA-GalNAc(4,6-O-disulfate); ΔDi-2,4,6S, ΔHexUA(2-O-sulfate)-GalNAc(4,6-O-sulfate).

Fig. 2. Reactive astrocytes induced by TGFβ1 produce more CSPGs. (A) Monolayers of astrocytes were cultured with (bottom) or without (top)TGFβ1 for 7 days in the absnce of serum. CGNs were plated onto theastrocyte monolayers. After 48 hours, neurons were visualized and axonallength was analyzed. Scale bar: 25 μm. (B) Conditioned medium derived fromTGFβ1-treated astrocytes inhibited axonal outgrowth. Conditioned mediumwas collected from untreated astrocytes (Control) or astrocytes treated withTGFβ1 for 7 days. Dissociated CGNs were then cultured for 48 hours inconditioned medium, alone or with the addition of SB-431542. Relative axonallength was measured and analyzed (*P<0.01; Student’s t-test). (C,D) Increasedproduction of CSPG by TGFβ1-treated astrocytes detected by immunoblot (C)and ELISA (D) using CS-56. Open column, control conditioned medium;filled column, TGFβ1-treated conditioned medium. Data are expressed as themean ± s.d.

Jour

nal o

f Cel

l Sci

ence

3086

[chondroitin 4-O-sulfotransferase 2 (C4ST2), chondroitin 6-O-sulfotransferase 2 (C6ST2), and GalNAc 4-sulfonate 6-O-sulfotransferase (GalNAc4S-6ST)] were not altered upon TGFβ1treatment (data not shown). Upregulation of C4ST1 protein inreactive astrocytes was also confirmed using an anti-C4ST1 peptideantibody (Fig. 4E). The fact that the increase in C4ST1 mRNA uponTGFβ1 treatment was not observed in Smad3-null astrocytes(supplementary material Fig. S3) demonstrates that the rapid changein sulfation of chondroitin sulfate is mediated by TGFβ signalingthrough the Smad pathway.

4-sulfated chondroitin sulfate GAG chains have crucial roles inneuron-astrocyte interactionsTo investigate whether 4-sulfation of chondroitin sulfate GAGchains is crucial for the regulation of axonal growth, loss- and gain-of-function experiments were performed. Introduction of siRNAagainst C4ST1 into astrocytes decreased levels of C4ST1 proteinin whole cell lysates, and correspondingly reduced the accumulationof 4-sulfated chondroitin sulfate in conditioned medium (Fig. 5A-C). Importantly, the TGFβ1-mediated increase in 4-sulfatedchondroitin sulfate and C4ST1 was blocked by C4ST1 siRNA. Wethen performed axonal guidance spot assays with conditionedmedium from astrocytes treated with combinations of TGFβ1 andC4ST1 siRNA. Conditioned medium from astrocytes treated withthe combination of C4ST1 siRNA and TGFβ1 was significantly

less potent than conditioned medium from astrocytes treated withTGFβ1 alone (Fig. 5D). Transfection of C4ST1 siRNA did not affectthe induction of neurocan mRNA by TGFβ1 (data not shown).

Because 6-sulfated GAG chains have also been suggested to beinvolved in the brain-injury response (Properzi et al., 2005), wesimilarly examined the effects of alteration of C6ST1 and 6-sulfatedGAG chains. Astrocytes treated with siRNA directed against C6ST1showed a reduction of both mRNA level and the production of 6-sulfated chondroitin sulfate (Fig. 6B,D). By contrast, treatment withC6ST1 siRNA did not alter the levels of C4ST1 transcript nor 4-sulfated CS. Furthermore, TGFβ1 treatment still elicited an increasein C4ST1 mRNA and 4-sulfated chondroitin sulfate (Fig. 6A,C).More importantly, depletion of C6ST1 did not alter the inhibitoryproperties of TGFβ1-treated conditioned medium in the axonalguidance assays (Fig. 6E). Moreover, C4ST1 siRNA treatment didnot alter the level of the mRNA encoding C4ST2, C6ST2 orGalNAc4S-6ST (data not shown). These results demonstrate theessential roles of C4ST1 and 4-sulfated chondroitin sulfate GAGchains in the induction of repellent activity of astrocytes by TGFβ1treatment.

In gain-of-function experiments (Fig. 7), astrocytes weretransfected with either an empty vector, wild-type C4ST1 or a

Journal of Cell Science 121 (18)

Fig. 3. Increased production of CSPGs by reactive astrocytes is responsiblefor reduced neuronal growth. (A,B) Astrocytes were treated with TGFβ1 for7 days and conditioned medium was collected and concentrated. Afterincubation at 37°C for 3 hours with or without cABC, the conditionedmedium was immobilized on PLL-coated coverslips, and axonal guidancespot assays were performed. (A) Although axons did not cross the interfacebetween PLL and conditioned medium (arrows, left), many axons cross ontoconditioned medium after cABC treatment (right). Scale bar: 25 μm.(B) Quantitative analysis of axonal behavior at the interface. The percentageof axons crossing onto the immobilized conditioned medium was calculated(*,#P<0.05; ANOVA). (C) Inhibition of GAG chain biosynthesis restoresneuronal growth. Confluent monolayers of astrocytes were pretreated withTGFβ1, with or without the GAG-chain synthesis inhibitors for 3 days, andneurons were co-cultured for 2 days, followed by the analysis of relative axonlength. PNP, p-nitro-phenyl-β-D-xylopyranoside (1 mM); Mu, methyl-umbelliferyl β-D-xyloside (1 mM); SC, sodium chlorate (20 mM) (*P<0.01compared with TGFβ1-treated astrocytes; ANOVA). Data are expressed asthe mean ± s.d.

Fig. 4. Reactive astrocytes produce more 4-sulfated than 6-sulfatedchondroitin sulfate GAG chains. (A) Conditioned medium from 3 day culturewas concentrated and digested with cABC, followed by immunoblot analysis.(B) Conditioned medium collected at indicated time was treated with cABCand subjected to ELISA without concentration. Monoclonal antibodies2B6/MAB2030 and 3B3/MAB2035 were used against 4-sulfated and 6-sulfated GAG chains, respectively. (C) C4ST1 mRNA was rapidly increasedupon induction of reactive astrocytes by TGFβ1. RNA was prepared fromastrocytes at indicated time after TGFβ1 treatment and quantitative RT-PCRwas performed. Open column, control; filled column, TGFβ1. (D) Transcriptof the gene encoding C4ST1 but not C6ST1 was upregulated 3 days afterTGFβ1 treatment of astrocytes. Open column, control; filled column, TGFβ1.(E) Upregulation of C4ST1 protein was detected with chicken anti-C4ST1peptide antibody 3 days after TGFβ1 treatment. Lysates from HeLa cellstransfected with pTracer-C4ST1 were used as a positive control.

Jour

nal o

f Cel

l Sci

ence

3087Axonal guidance and chondroitin sulfate

mutated form of C4ST1 that fails to bind 3�-phosphoadenosine 5�-phosphosulfate and CGNs were plated on the monolayers of theseastrocytes. Although similar levels of exogenous proteins wereexpressed in astrocytes (Fig. 7A), cells expressing wild-type C4ST1produced more 4-sulfated CSPG in the conditioned mediumcompared with vector-transfected astrocytes (Fig. 7B), whereasastrocytes expressing the mutated form showed lower levels of 4-sulfated GAG chains. Neurons growing on astrocytes expressingC4ST1 had shorter axons than those growing on either vector-transfected astrocytes or those expressing the mutant C4ST1 (Fig.7D). HPLC analysis of conditioned medium confirmed that theproduction of 4-sulfated GAG was highly correlated withperturbations in C4ST1 expression (Fig. 5C, Fig. 7C). We wereunable to demonstrate an effect of overexperssion of C6ST1because when exogenous C6ST1 was expressed in astrocytes, thecells looked unhealthy and survival was compromised (data notshown). Taken together, the loss- and gain-of function experimentsestablish a pivotal role of 4-sulfated GAG in axonal growthregulation by reactive astrocytes.

4-sulfated chondroitin sulfate GAG chains are rapidlyincreased after spinal cord injuryIn vivo experiments confirmed that 4-sulfated chondroitin sulfateGAG chains might be a critical determinant of CNS regenerativefailure (Fig. 8). A dorsal overhemisection of the spinal cord wasmade in mice and we examined expressions levels of 4-sulfatedand 6-sulfated GAG chains, as well as glial fibrillary acidic protein

(GFAP), a well-established marker of reactive astrocytes (Lemonset al., 1999; Pekny and Pekna, 2004) with specific antibodies.Although we observed very low levels of immunoreactivity for 6-sulfated chondroitin sulfate GAG chains, we found substantialstaining for 4-sulfated chondroitin sulfate GAG chains proximal tothe lesion as early as 1 day post injury (Fig. 8A,D). A similar increasein GFAP immunoreactivity was observed with similar proximity toand specificity for the lesion site. Colocalization of 4-sulfated GAGand GFAP was also apparent microscopically (Fig. 8B,C).Upregulation of 4-sulfated GAG chains upon spinal cord injury wasalso apparent when chondroitin sulfate disaccharides were extractedfrom uninjured/injured tissues and analyzed by HPLC (Fig. 8E).Thus, these data confirm a specific upregulation and deposition of4-sulfated GAG by reactive astrocytes after CNS injury in an animalmodel.

DiscussionCSPGs are ECM molecules that have a critical role in modulatingaxonal growth and guidance during development and also after

Fig. 5. Depletion of C4ST1 in TGFβ1-treated astrocytes reduces theproduction of 4-sulfated GAG chains as well as repellent activity ofconditioned medium. (A) Conditioned medium derived from C4ST1 siRNA-transfected astrocytes treated with or without TGFβ1 was subjected to ELISAto measure the amount of 4-sulfated GAG chains with MAB2030. (B) C4ST1protein level in the cell lysates was checked by immunoblotting with anti-C4ST1 peptide antibody. Actin was used as loading control. (C) Disaccharidecomposition analyses of conditioned medium (CM). The values obtained fromthree experiments were used to calculate pmol of ΔHexUA-GalNAc(4-O-sulfate) (ΔDi-4S) per 1 ml conditioned medium. Data are expressed as themean ± s.d. (D) Axonal guidance spot assay. More axons that crossed theinterface were observed in C4ST1 siRNA conditioned medium compared withTGFβ1 conditioned medium (*P<0.01 compared with scrambled siRNAwithout TGFβ1 and C4ST1 siRNA with TGFβ1; ANOVA).

Fig. 6. Depletion of C6ST1 by siRNA does not alter the production of 4-sulfated chondroitin sulfate GAG chains nor repellent activity in reactiveastrocytes. Astrocytes transfected with C6ST1 siRNA were treated with orwithout TGFβ1 as in Fig. 5, and RNA and conditioned medium were prepared.Quantitative RT-PCR for (A) C4ST1, (B) C6ST1. ELISA to measure theamount of (C) 4-sulfated GAG chains with MAB2030, (D) 6-sulfated GAGchains with MAB2035. (E) Axonal guidance spot assay was performed(*P<0.01 compared with scrambled siRNA without TGFβ1; ANOVA).Although C6ST1 siRNA reduced C6ST1 mRNA and production of 6-sulfatedGAG chains, induction of C4ST1 mRNA and 4-sulfated GAG chains byTGFβ1 were unaffected, and repellent activity of TGFβ1-treated conditionedmedium was observed.

Jour

nal o

f Cel

l Sci

ence

3088

nervous system injury. Although much evidence has accumulatedsuggesting that it is the GAG chain moieties of CSPGs that arerecognized by neurons, the particular features of GAG chains thatsignal to growing axons are still a matter of contention. In thismanuscript, we present compelling evidence that this signaling ismediated through specific sulfation, specifically 4-sulfation, of thechondroitin sulfate GAG chains. First, CS-A, but not CS-C, exhibitsnegative guidance cues to axons in a 4-sulfation-dependent manner,with comparable efficacy to native CSPGs. Second, reactiveastrocytes in culture produce more 4-sulfated chondroitin sulfateGAG chains and knockdown of C4ST1 protein reduces the levelof 4-sulfation in chondroitin sulfate GAG chains, resulting in a lessinhibitory ECM. Third, overexpression of C4ST1 in culturedastrocytes increases 4-sulfation and reduces their ability to supportneuronal growth. Finally, 4-sulfated chondroitin sulfate GAG chainsare acutely upregulated and deposited by reactive astrocytes in ananimal model of spinal cord injury. This combination of biochemicaland physiological approaches synergistically demonstrate the majorrole of 4-sulfated GAG chains in astrocyte/neuron interactions.

The fact that CS-A, but not CS-C, repels axons highlights theexquisite structural specificity for signaling by the sulfateddisaccharides that comprise chondroitin sulfate chains. Both CS-Aand CS-C carry a similar charge distribution, demonstrating thatthese effects are not simply mediated by negative charge carriedby the sulfate groups. Although 6-sulfation of chondroitin sulfateGAG chains has been reported to correlate with axonal inhibition(Properzi et al., 2005), we did not find any inhibitory action of CS-C in our axonal guidance assays, and siRNA-based depletion ofC6ST1 in reactive astrocytes showed no effect on axonal guidance.

Only a small change in 4-sulfation significantly alters the abilityof CS-A to impart neuronal guidance, suggesting that subsets ofsulfation are critical determinants of function. This notion issupported by the finding that the biological activity of CS-A is

eliminated after only a short duration of treatment with cABC, whichdigests as little as 2% of the GAG. Conversely, only a smallpercentage of 4-sulfation was reported to increase in vivo followinginjury, even though 4-sulfated disaccharides are the predominantspecies in the normal brain (Gris et al., 2007; Mitsunaga et al., 2006;Properzi et al., 2005). These data suggest that it is not the level of4-sulfation per se that contributes to GAG chain signaling. It hasbeen proposed that distinct motifs of sulfation (a ‘sulfation code’)along the polysaccharide chain in heparan sulfate encodeinformation required for substrate binding and growth regulation(Bülow and Hobert, 2004; Holt and Dickson, 2005). Althoughheparan sulfate and chondroitin sulfate are structurally different,our findings might suggest the presence of a sulfation code inchondroitin sulfate GAG chains that exhibits negative guidance cuesto axons and inhibit axonal growth.

The direction and rate of axonal extension can be independentlymodulated by the ECM (Powell et al., 1997). The axonal guidancespot assays used in this study focus simply upon axonal guidance:axons growing on the PLL substrate turn as they encounter CS-A,and continue to extend along the interface (data not shown). Similarbehavior is observed in vivo when growing axons encounter theCSPG-rich glial scar (Davies et al., 1997). By contrast, axonalgrowth depends upon both cell adhesion and neuriteinitiation/extension, and alterations in either of these conditions willresult in measurable changes. It is intriguing that 4-sulfation ofchondroitin sulfate GAG chains both alters axonal direction andlimits the rate of axonal extension.

Journal of Cell Science 121 (18)

Fig. 7. C4ST1 overexpression renders astrocytes far less permissive toneuronal growth. Wild-type or inactive form of C4ST1 was transfected intoastrocytes and neurons were co-cultured on monolayers. Expression levels ofrecombinant C4ST1 (A) and 4-sulfated GAG chains (B) were examined inimmunoblot with anti-DsRed antibody and LY111 (anti-4-sulfated GAG),respectively. Internal cleavage of DsRed fusion protein was detected.(C) Disaccharide composition analyses of conditioned medium (CM) wereperformed as in Fig. 5. (D) Relative axonal length was measured. (*P<0.01compared with vector; ANOVA.) Axonal growth was reduced by increasedproduction of 4-sulfated GAG chains in astrocytes.

Fig. 8. 4-sulfated GAG chains are acutely upregulated in spinal cord lesion.One day after spinal cord injury, cryosections were prepared and stained withLY111 (green, anti 4-sulfated GAG in A-C), MC21C (green, anti 6-sulfatedGAG in D) and anti-GFAP antibody (red). Arrows indicate the injury sites.The area far from the injury site (asterisk) showed lower levels of LY111immunoreactivity. Boxed regions in A are shown at higher magnification(B,C), revealing colocalization of 4-sulfated GAG with GFAP, an astrocytemarker (arrowheads). Scale bars: 200 μm (A), 40 μm (B). (E) Coronalcryosections were prepared from uninjured and injured spinal cords andtreated with cABC. Disaccharide composition analysis was performed.Upregulation of ΔDi-4S was observed upon spinal cord injury.

Jour

nal o

f Cel

l Sci

ence

3089Axonal guidance and chondroitin sulfate

Paradoxically, tissues that express CSPGs do not alwaysexclude the entry of axons, and in some cases, CSPG stainingcoincides with developing and regenerating axon pathways(Bicknese et al., 1994; McAdams and McLoon, 1995). Axonalextension during development and after injury to the adult CNSis a balance of inhibitory and promotional cues in the localenvironment consisting of several ECM molecules, cell adhesionmolecules and growth factors (Lu et al., 2007; McKeon et al.,1995; Walsh and Doherty, 1996). In addition, changes in sulfationof chondroitin sulfate GAG chains are likely to contribute to thedetermination of the success or failure of axonal regeneration.Several in vitro studies suggest that CSPGs can promote ratherthan inhibit neurite outgrowth (Faissner et al., 1994; Fernaud-Espinosa et al., 1994; Garwood et al., 1999). These promotionaleffects have been attributed to the ‘oversulfated’ chondroitinsulfates: CS-D (disulfated at the C2 position of GlcA and C6position of GalNAc) and CS-E (disulfated at the C4 and C6positions of GalNAc), both of which stimulate neurite growth inculture (Deepa et al., 2002; Gama and Hsieh-Wilson, 2005; Gamaet al., 2006; Nadanaka et al., 1998). Axonal growth promotionhas also been observed with an artificial tetrasaccharide with 4,6-sulfation, suggesting that a short stretch of sulfated GAG chainsis sufficient to promote neurite outgrowth (Gama et al., 2006).Interestingly, when we used CS-D and CS-E in our axonalguidance assays, we did not observe any positive haptotacticeffects of these sugars. Because oversulfated chondroitin sulfatechains have been shown to bind several different growth-promoting factors and cytokines (Deepa et al., 2002; Shipp andHsieh-Wilson, 2007), the growth-promotional actions of thesechondroitin sulfate sugars may be indirect.

In the developing brain, astrocytes are a preferred substrate foraxonal growth and neuronal migration, whereas reactive astrocytesin the injured brain are detrimental to neuronal regeneration. Themajor difference in this functional shift is the increased productionof sulfated proteoglycans by reactive astrocytes. Using aphysiologically relevant system, we found that modulation of thesulfation in astrocytic CSPGs changes the interaction betweenastrocytes and neurons in vitro. Combined with our observationthat 4-sulfated CSPGs are robustly and rapidly deposited withinCNS lesions in animals, these findings suggest that modulation ofsulfation in CSPGs serves as a signal to restrict axonal regrowthand may be an important new therapeutic direction for regenerativebiomedicine.

Materials and MethodsCell cultureCultures of dissociated mouse CGNs were prepared from C57BL/6 mice (P5-8) asdescribed previously (Levi et al., 1984; Romero et al., 2003). Dissociated cells werecultured in Neurobasal-A medium containing B27 supplement and 25 mM KCl. Inco-culture experiments, dissociated CGNs were plated at a density of 6�104

cells/well onto a confluent monolayer of astrocytes in 24-well plates (see below).When neurons were cultured in conditioned medium, 2% (v/v) of B27 supplementwas added. Primary cortical neuron cultures were prepared from E16-E18 mouseembryos as previously described (Dulabon et al., 2000).

Primary cultures of cerebral cortical astrocytes were prepared from newbornC57BL/6 mice and Smad3-null mice (Wang et al., 2007) (P1-2) as previously described(Petroski et al., 1991). Confluent cultures of astrocytes were treated with TGFβ1 (10ng/ml, R&D Systems) in the absence of serum for 7 days and dissociated CGNs wereplated on the monolayers. Two days after plating, cells were fixed and stained withanti βIII-tubulin antibody (Sigma), followed by the incubation with FITC-anti-mouseIgG antibody (Jackson ImmunoResearch Laboratories). When astrocytes were treatedwith inhibitors, monolayers of astrocytes were incubated with TGFβ1 in combinationwith those inhibitors for 72 hours, after which neurons were plated on top and allowedto grow for 48 hours before analysis.

Axonal guidance spot assay and axonal outgrowth assayAxonal guidance spot assays were performed as described previously (Meiners etal., 1999). To quantify the behavior of axons, an interface between PLL and samplewas created by placing a 5 μl drop of chicken CSPG (Millipore, 12.5 ng/spot) orchondroitin sulfate GAG chains (Seikagaku, Japan) with Texas Red in the center ofa PLL-coated glass coverslip. Texas Red was used to visualize the interface and wasused alone for negative control experiments. Dissociated CGNs were seeded ontothe coverslips at a density of 6�104 cells/well and cultured for 2 days. Cells werefixed and stained with anti-βIII-tubulin antibody (Sigma), followed by the incubationwith FITC-anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories).Fluorescence images were acquired on a Nikon TE2000 inverted microscopeequipped with a CCD camera (Orca-ER, Hamamatsu) driven by Metamorph imagingsoftware (Universal Imaging). Only single, non-fasciculated axons within 10 μm ofthe protein-PLL interface were considered for the analysis. In addition, only axonsgrowing toward the immobilized sample were counted and no axon whose soma wassitting on the interface was scored. Each experiment was performed in triplicate. Fortreatment with cABC (Seikagaku), samples were digested with 10 mU of the enzymeat 37°C for 3 hours. Chondro-4-sulfatase (Seikagaku) digestion was carried out with8 mU of the enzyme in 0.1 M ammonium acetate buffer (pH 7.0) at 37°C for 4 hours,followed by the inactivation of the enzyme at 95°C for 5 minutes.

Axonal outgrowth assays were performed as described previously (Meiners et al.,1999). Axonal length was measured using the ImageJ program (available at:http://rsb.info.nih.gov/nih-image/). A sample of 100 neurons with processes equal toor greater than one cell soma was considered for each condition. The total length ofeach primary process was measured for each neuron. For some experiments, relativeaxonal length was also obtained using a stereological technique from a large sampleof neurons (Rønn et al., 2000). When neurons were co-cultured with astrocytesoverexpressing C4ST1, astrocytes were first transfected with appropriate DNAconstructs, followed by replacement of the media 1 day after transfection and anadditional 1 day culture, and neurons were then plated onto the monolayer ofastrocytes. Cells were fixed, stained with anti-βIII-tubulin antibody, and relative axonallength was measured as described above. Astrocyte-derived conditioned media andcell lysates were collected 2 days after transfection for immunoblot and disaccharidecomposition analysis.

Statistical analysisComputed values were compared between the different conditions using eitherStudent’s t-test or one-way ANOVA, as appropriate.

DNA constructs, transfection and protein analysisThe cDNA for chondroitin 4-sulfotransferase 1 (C4ST1) was obtained by RT-PCRfrom mouse astrocyte RNA using the following primers; 5�-TAGAATTCACTAGTATGAAG CCGGCGCTGC TGGAAG-3� and 5�-ATGAATTCCACTCGAGTCCA ACTTCAGGTA GTTTGG-3�. PCR product was digested withEcoRI, followed by subcloning into the EcoRI site of pDsRed2-N1 (BD Biosciences)and pTracer-EF/V5His (Invitrogen). An inactive form of C4ST1 was generated bythe introduction of mutations (R186A, S194A) into the putative PAPS binding sitewith QuikChange (Stratagene, CA) using the following primers; 5�-GTTCCTGTTCGTGGCTGAGC CCTTCGAGAG G-3� and 5�-GAGCCCTTCG AGAGACTAGTGGCTGCCTAC CGCAAC-3�. The cDNA for mouse chondroitin 6-sulfotransferase1 (C6ST1) was obtained by RT-PCR using the following primers; 5�-ATGAATTCACTAGTATGGAG AAAGGACTCG CTTTGC-3� and 5�-AAAAGCTTCTACGTGACCCA GAAGGTGC-3�. PCR product was digested with EcoRI/HindIII,followed by subcloning into the EcoRI/HindIII sites of pDRed2-N1 (BD Biosciences).

Transient transfection was performed using the Nucleofector (Amaxa, Cologna,Germany) with a protocol specifically designed for mouse astrocytes. Aftertransfection, astrocytes were plated on a 35 mm dish and grown to confluency.

CSPGs in conditioned medium and cell lysates derived from astrocyte cultureswere separated by SDS-PAGE under reducing conditions and examined withimmunoblot analyses as described previously (Katagiri et al., 2000). When conditionedmedium was concentrated with a Centricon 100 (Millipore), a protease inhibitorcocktail (Calbiochem) was added to prevent protein degradation. Samples to beincubated with the 2B6, 3B3 (Seikagaku), MAB2030 or MAB2035 (Millipore)antibodies required prior digestion with cABC (10 mU/ml, 37°C for 3 hours) to exposethe antigen. For immunoblotting of C4ST1, we generated a custom chicken anti-C4ST1 peptide antibody (Gallus Immunotech) against the peptide sequenceRRQRKNATQEALRKGDDVKC. HeLa cell lysates expressing recombinant C4ST1with a V5 epitope tag (pTracer-C4ST1) were used as positive controls forimmunoblotting. Chicken CSPGs (Millipore) used in this study contained neurocanand phosphocan, confirmed by cABC digestion and tryptic digestion, followed bymass spectrometry, but we did not exclude the presence of other core proteins (datanot shown).

ImmunocytochemistryTGFβ1-treated astrocytes cultured for 7 days on glass coverslips were rinsed withDMEM and incubated with CS-56 (Sigma) for 30 minutes at 4°C, followed byincubation with FITC-anti-mouse IgM antibody (Jackson ImmunoResearch

Jour

nal o

f Cel

l Sci

ence

3090

Laboratories). Cells were then fixed and incubated with rabbit anti-GFAP antibodyfollowed by Rhodamine anti-rabbit IgG antibody.

siRNA knockdown Chemically synthesized siRNA targeting C4ST1, C6ST1 and scrambled siRNA (asa negative control) were obtained from Dharmacon (siGENOMETM SMARTpool®).Transient transfection into primary cultured astrocytes with 50 nM siRNA was carriedout using the mouse astrocyte Nucleofector kit (Amaxa). Transfection efficiency wasmore than 80% based the simultaneous transfection of pmaxGFPTM. Medium wasreplaced with DMEM 1 day after transfection and the cells were cultured for twofurther days. The cells were then treated with TGFβ1 for 24 hours and conditionedmedium was collected for axonal guidance spot assays, immunoblotting and ELISA.

Quantitative RT-PCRTotal RNA was isolated from cultured astrocytes with the Absolutely RNA purificationkit (Stratagene). Genomic DNA was removed by DNaseI treatment following themanufacturer’s protocol. RNA was reverse transcribed using SuperScript III(Invitrogen) and real-time PCR was performed on a Chromo4 (MJ Research) withDyNAmoTTM HS SYBR Green qPCR kit (MJ Research). PCR conditions consistedof a 15 minutes hot start at 95°C, followed by 45 cycles of 15 seconds at 94°C, 15seconds at 57°C and 25 seconds at 72°C. All samples were run in triplicate and resultswere normalized to the level of GAPDH. The primer sequences are as follows: C4ST1;5�-GAAGAGGCTC ATGATGGTCC-3� and 5�-GAGAGAGTAG ACCGTCTG CC-3�, C6ST1; 5�-GGATTCCACC TTTTCCCATCTG-3� and 5�-TGCCCTGCTGGTTGAAGAAC-3�, and GAPDH; 5�-AAGGTGGTGA AGCAGGCATC TG-3� and5�-TGGGTGGTCC AGGGTTTCTT AC-3�. cDNAs for C4ST1, C6ST1 and GAPDHwere used as a template for PCR to obtain standard curves.

ELISARelative CSPG amounts were measured by ELISA. Briefly, 96-well microtiter plates(Immulon 4; Dynex Technologies) pretreated with poly-L-lysine were coated withconditioned medium of astrocytes treated with or without TGFβ1. After blocking,appropriate antibodies were incubated, followed by incubation with anti-mouseantibody F(ab�)2 fragment conjugated with HRP (Abcam). Binding was measuredwith a microplate reader (Labsystems Multiskan, MCC/340) using SureBlue TMBMicrowell Peroxidase Substrate (KPL) as a substrate.

Spinal cord injuryAll experiments strictly adhered to the NIH guidelines on the care and use of animalsin research. Adult mice (8-12 weeks old) were deeply anesthetized with ketamine-xylazine (100 and 14 mg/kg, respectively). A laminectomy was performed at thelevel of T12-L1 and the spinal cord was exposed. A dorsal overhemisection wasmade at T12. After the injury, the subcutaneous tissue and skin were sutured in layers.One day after surgery, animals were anesthetized then perfused intracardially withPBS, followed by 4% paraformaldehyde. Spinal cords were removed and frozen.Sagittal serial sections were cut on a cryostat (15 μm) and processed for histologicalanalyses. Monoclonal antibodies LY111 and MC21C (both Seikagaku), were used todetect changes in 4-sulfation and 6-sulfation in intact chondroitin sulfate GAG chains,respectively, and polyclonal anti-GFAP antibody (Dako) was used to visualize reactiveastrocytes, followed by incubation with FITC-conjugated anti-mouse μ chain antibody(Abcam) and Alexa Fluor 633-conjugated anti-rabbit Ig antibody (Molecular Probes).Fluorescent images were acquired with a confocal laser-scanning microscope (LeicaSP1, Leica, Germany).

Sugar analysisDisaccharide composition analysis was performed essentially as described previously(Kinoshita and Sugahara, 1999) with minor modification. Briefly, chondroitin sulfateoligosaccharides in 0.1M ammonium acetate buffer (pH 7.0) were treated with cABCas described above and lyophilized. Derivatization of the oligosaccharides with 2-aminobenzamide (2AB, Sigma) was carried out with 5 μl of 0.35 M 2AB, 1.0 MNaCNBH4, 30% acetic acid in DMSO at 65°C for 2 hours. Fluorescently taggedoligosaccharides were separated by HPLC on an amine-bound silica PA03 column(Waters). The HPLC system was equilibrated with solvent A (15 mM ammoniumphosphate containing 5% methanol) and solvent B (1.5 M ammonium phosphatecontaining 5% methanol). At a uniform flow rate of 0.75 ml/minute, a gradient wasdeveloped by holding solvent B at 0% for 5 minutes, then increasing from 0 to 18%over 14 minutes and changing from 18% to 50% over 11 minutes. Separation wasmonitored using a L-7485 fluorescence detector (Hitachi, Japan) with excitation andemission wavelengths of 330 nm and 420 nm, respectively. When conditioned mediumwas used as a source for CSPGs, concentrated samples were digested with proteinaseK extensively, followed by cABC treatment. 3�-Sialyl-N-acetyllactosamine (DextraLaboratories, UK) was added to GAG-containing fraction as an internal control.Disaccharide composition analysis was performed as described above.

Disaccharide composition of chondroitin sulfate chains in the spinal cord sectionson the glass slides were determined as described previously (Mitsunaga et al., 2006).Briefly, coronal cryosections of spinal cords were treated with cABC (25 mU/ml)for 16 hours at 37°C together with 3�-Sialyl-N-acetyllactosamine on the glass slides.The solution was recovered and disaccharide fractions were enriched by size

exclusion chromatography (Superdex Peptide10/300 GL, GE Healthcare) in 150 mMammonium bicarbonate at a flow rate of 0.3 ml/minute. Separation was monitoredusing a L-7400 UV detector (Hitachi, Japan) with absorbance of 232 nm. Purifieddisaccharides were derivatized with 2-AB.

Partial digestion of CS-A was performed with cABC (10 mU/ml) at roomtemperature and the digestion was monitored by measuring the absorbance at 232nm. The digestion degree was calculated based on the comparison of the absorbancemeasured at 232 nm at the time of aliquot removal and the one at the time of reactioncompletion. After heat inactivation of the enzyme, chondroitinase-treated CS-A wasprecipitated with ethanol and subjected to axonal guidance spot assays.

Time-lapse microscopyAdult mouse dorsal root ganglia (DRG) prepared from C57/BL6 were used for axonguidance spot assay and images of the cells were acquired every minute over a periodof 2 hours. Images were acquired on a TE-2000 Nikon and transferred to a computerusing Metamorph software.

We thank M.V. Sofroniew for spinal cord tissues, and R. Adelstein,J. Sellers, N. Epstein, and Z. H. Sheng for critical comments; S. Wen,T. Laabs, K. Vartanian, and Y. Tailor for technical support. We aregrateful to R. F. Shen and C. A. Combs for help with data collectionat Proteomics Core Facility and Light Microscopy Core Facility inNational Heart, Lung, and Blood Institute, NIH.

ReferencesAsher, R. A., Morgenstern, D. A., Fidler, P. S., Adcock, K. H., Oohira, A., Braistead,

J. E., Levine, J. M., Margolis, R. U., Rogers, J. H. and Fawcett, J. W. (2000). Neurocanis upregulated in injured brain and in cytokine-treated astrocytes. J. Neurosci. 20, 2427-2438.

Bandtlow, C. E. and Zimmermann, D. R. (2000). Proteoglycans in the developing brain:new conceptual insights for old proteins. Physiol. Rev. 80, 1267-1290.

Bicknese, A. R., Sheppard, A. M., O’Leary, D. D. and Pearlman, A. L. (1994).Thalamocortical axons extend along a chondroitin sulfate proteoglycan-enriched pathwaycoincident with the neocortical subplate and distinct from the efferent path. J. Neurosci.14, 3500-3510.

Bishop, J. R., Schuksz, M. and Esko, J. D. (2007). Heparan sulphate proteoglycans fine-tune mammalian physiology. Nature 446, 1030-1037.

Bradbury, E. J., Moon, L. D., Popat, R. J., King, V. R., Bennett, G. S., Patel, P. N.,Fawcett, J. W. and McMahon, S. B. (2002). Chondroitinase ABC promotes functionalrecovery after spinal cord injury. Nature 416, 636-640.

Bülow, H. E. and Hobert, O. (2004). Differential sulfations and epimerization defineheparan sulfate specificity in nervous system development. Neuron 41, 723-736.

Chung, K. Y., Taylor, J. S., Shum, D. K. and Chan, S. O. (2000). Axon routing at theoptic chiasm after enzymatic removal of chondroitin sulfate in mouse embryos.Development 127, 2673-2683.

Davies, S. J. A., Fitch, M. T., Memberg, S. P., Hall, A. K., Raisman, G. and Silver, J.(1997). Regeneration of adult axons in white matter tracts of the central nervous system.Nature 390, 680-663.

Deepa, S. S., Umehara, Y., Higashiyama, S., Itoh, N. and Sugahara, K. (2002). Specificmolecular interactions of oversulfated chondroitin sulfate E with various heparin-bindinggrowth factors. Implications as a physiological binding partner in the brain and othertissues. J. Biol. Chem. 277, 43707-43716.

Dulabon, L., Olson, E. C., Taglienti, M. G., Eisenhuth, S., McGrath, B., Walsh, C. A.,Kreidberg, J. A. and Anton, E. S. (2000). Reelin binds alpha3beta1 integrin and inhibitsneuronal migration. Neuron 27, 33-44.

Faissner, A., Clement, A., Lochter, A., Streit, A., Mandl, C. and Schachner, M. (1994).Isolation of a neural chondroitin sulfate proteoglycan with neurite outgrowth promotingproperties. J. Cell Biol. 126, 783-799.

Fernaud-Espinosa, I., Nieto-Sampedro, M. and Bovolenta, P. (1994). Differential effectsof glycosaminoglycans on neurite outgrowth from hippocampal and thalamic neurons.J. Cell Sci. 107, 1437-1448.

Flanders, K. C., Ren, R. F. and Lippa, C. F. (1998). Transforming growth factor-betasin neurodegenerative disease. Prog. Neurobiol. 54, 71-85.

Gama, C. I. and Hsieh-Wilson, L. C. (2005). Chemical approaches to deciphering theglycosaminoglycan code. Curr. Opin. Chem. Biol. 9, 609-619.

Gama, C. I., Tully, S. E., Sotogaku, N., Clark, P. M., Rawat, M., Vaidehi, N., Goddard,W. A. 3rd, Nishi, A. and Hsieh-Wilson, L. C. (2006). Sulfation patterns ofglycosaminoglycans encode molecular recognition and activity. Nat. Chem. Biol. 2, 467-473.

Garwood, J., Schnadelbach, O., Clement, A., Schutte, K., Bach, A. and Faissner, A.(1999). DSD-1-proteoglycan is the mouse homolog of phosphacan and displays opposingeffects on neurite outgrowth dependent on neuronal lineage. J. Neurosci. 19, 3888-3899.

Gris, P., Tighe, A., Levin, D., Sharma, R. and Brown, A. (2007). Transcriptionalregulation of scar gene expression in primary astrocytes. Glia 55, 1145-1155.

Holt, C. E. and Dickson, B. J. (2005). Sugar codes for axons? Neuron 46, 169-172.Hwang, H. Y., Olson, S. K., Esko, J. D. and Horvitz, H. R. (2003). Caenorhabditis

elegans early embryogenesis and vulval morphogenesis require chondroitin biosynthesis.Nature 423, 439-443.

Journal of Cell Science 121 (18)

Jour

nal o

f Cel

l Sci

ence

3091Axonal guidance and chondroitin sulfate

Ichijo, H. and Kawabata, I. (2001). Roles of the telencephalic cells and their chondroitinsulfate proteoglycans in delimiting an anterior border of the retinal pathway. J. Neurosci.21, 9304-9314.

Iozzo, R. V. (2005). Basement membrane proteoglycans: from cellar to ceiling. Nat. Rev.Mol. Cell. Biol. 6, 646-656.

Katagiri, Y., Takeda, K., Yu, Z. X., Ferrnas, V. J., Ozato, K. and Guroff, G. (2000).Modulation of retinoid signalling through NGF-induced nuclear export of NGFI-B. Nat.Cell Biol. 2, 435-440.

Kinoshita, A. and Sugahara, K. (1999). Microanalysis of glycosaminoglycan-derivedoligosaccharides labeled with a fluorophore 2-aminobenzamide by high-performanceliquid chromatography: application to disaccharide composition analysis andexosequencing of oligosaccharides. Anal. Biochem. 269, 367-378.

Knudson, C. B. and Knudson, W. (2001). Cartilage proteoglycans. Semin. Cell Dev. Biol.12, 69-78.

Laabs, T., Carulli, D., Geller, H. M. and Fawcett, J. W. (2005). Chondroitin sulfateproteoglycans in neural development and regeneration. Curr. Opin. Neurobiol. 15, 116-120.

Laabs, T. L., Wang, H., Katagiri, Y., McCann, T., Fawcett, J. W. and Geller, H. M.(2007). Inhibiting glycosaminoglycan chain polymerization decreases the inhibitoryactivity of astrocyte-derived chondroitin sulfate proteoglycans. J. Neurosci. 27, 14494-14501.

Lemons, M. L., Howland, D. R. and Anderson, D. K. (1999). Chondroitin sulfateproteoglycan immunoreactivity increases following spinal cord injury and transplantation.Exp. Neurol. 160, 51-65.

Levi, G., Aloisi, F., Ciotti, M. T. and Gallo, V. (1984). Autoradiographic localization anddepolarization-induced release of acidic amino acids in differentiating cerebellar granulecell cultures. Brain Res. 290, 77-86.

Lu, P., Jones, L. L. and Tuszynski, M. H. (2007). Axon regeneration through scars andinto sites of chronic spinal cord injury. Exp. Neurol. 203, 8-21.

McAdams, B. D. and McLoon, S. C. (1995). Expression of chondroitin sulfate and keratansulfate proteoglycans in the path of growing retinal axons in the developing chick. J.Comp. Neurol. 352, 594-606.

McKeon, R. J., Hoke, A. and Silver, J. (1995). Injury-induced proteoglycans inhibit thepotential for laminin-mediated axon growth on astrocytic scars. Exp. Neurol. 136, 32-43.

Meiners, S., Mercado, M. L., Nur-e-Kamal, M. S. and Geller, H. M. (1999). Tenascin-C contains domains that independently regulate neurite outgrowth and neurite guidance.J. Neurosci. 19, 8443-8453.

Mitsunaga, C., Mikami, T., Mizumoto, S., Fukuda, J. and Sugahara, K. (2006).Chondroitin sulfate/dermatan sulfate hybrid chains in the development of cerebellum.Spatiotemporal regulation of the expression of critical disulfated disaccharides by specificsulfotransferases. J. Biol. Chem. 281, 18942-18952.

Nadanaka, S., Clement, A., Masayama, K., Faissner, A. and Sugahara, K. (1998).Characteristic hexasaccharide sequences in octasaccharides derived from shark cartilage

chondroitin sulfate D with a neurite outgrowth promoting activity. J. Biol. Chem. 273,3296-3307.

Parish, C. R. (2006). The role of heparan sulphate in inflammation. Nat. Rev. Immunol.6, 633-643.

Pekny, M. and Pekna, M. (2004). Astrocyte intermediate filaments in CNS pathologiesand regeneration. J. Pathol. 204, 428-437.

Petroski, R. E., Grierson, J. P., Choi-Kwon, S. and Geller, H. M. (1991). Basic fibroblastgrowth factor regulates the ability of astrocytes to support hypothalamic neuronal survivalin vitro. Dev. Biol. 147, 1-13.

Pizzorusso, T., Medini, P., Berardi, N., Chierzi, S., Fawcett, J. W. and Maffei, L. (2002).Reactivation of ocular dominance plasticity in the adult visual cortex. Science 298, 1248-1251.

Powell, E. M., Meiners, S., DiProspero, N. A. and Geller, H. M. (1997). Mechanismsof astrocyte-directed neurite guidance. Cell Tissue Res. 290, 385-393.

Properzi, F., Carulli, D., Asher, R. A., Muir, E., Camargo, L. M., van Kuppevelt, T.H., ten Dam, G. B., Furukawa, Y., Mikami, T., Sugahara, K. et al. (2005). Chondroitin6-sulphate synthesis is up-regulated in injured CNS, induced by injury-related cytokinesand enhanced in axon-growth inhibitory glia. Eur. J. Neurosci. 21, 378-390.

Romero, A. A., Gross, S. R., Cheng, K. Y., Goldsmith, N. K. and Geller, H. M. (2003).An age-related increase in resistance to DNA damage-induced apoptotic cell death isassociated with development of DNA repair mechanisms. J. Neurochem. 84, 1275-1287.

Rønn, L. C., Ralets, I., Hartz, B. P., Bech, M., Berezin, A., Berezin, V., Moller, A. andBock, E. (2000). A simple procedure for quantification of neurite outgrowth based onstereological principles. J. Neurosci. Methods 100, 25-32.

Shipp, E. L. and Hsieh-Wilson, L. C. (2007). Profiling the sulfation specificities ofglycosaminoglycan interactions with growth factors and chemotactic proteins usingmicroarrays. Chem. Biol. 14, 195-208.

Silver, J. and Miller, J. H. (2004). Regeneration beyond the glial scar. Nat. Rev. Neurosci.5, 146-156.

Sirko, S., von Holst, A., Wizenmann, A., Gotz, M. and Faissner, A. (2007). Chondroitinsulfate glycosaminoglycans control proliferation, radial glia cell differentiation andneurogenesis in neural stem/progenitor cells. Development 134, 2727-2738.

Smith, G. M. and Strunz, C. (2005). Growth factor and cytokine regulation of chondroitinsulfate proteoglycans by astrocytes. Glia 52, 209-218.

Taylor, K. R. and Gallo, R. L. (2006). Glycosaminoglycans and their proteoglycans: host-associated molecular patterns for initiation and modulation of inflammation. FASEB J.20, 9-22.

Walsh, F. S. and Doherty, P. (1996). Cell adhesion molecules and neuronal regeneration.Curr. Opin. Cell Biol. 8, 707-713.

Wang, Y., Moges, H., Bharucha, Y. and Symes, A. (2007). Smad3 null mice displaymore rapid wound closure and reduced scar formation after a stab wound to the cerebralcortex. Exp. Neurol. 203, 168-184.

Yamagata, T., Saito, H., Habuchi, O. and Suzuki, S. (1968). Purification and propertiesof bacterial chondroitinases and chondrosulfatases. J. Biol. Chem. 243, 1523-1535.

Jour

nal o

f Cel

l Sci

ence