Class 10 Dr. Pittler

The Inherited Retinal Degenerations fall into 2 broad categories:

1) The Retinitis Pigmentosa Family in which rod photoreceptors are first affected. Thus, peripheral vision and low light vision are lost first. Vision loss can be very early or somewhat later in life.

2) The Macular Degeneration Family in which cone photoreceptor are first affected. Thus, central, sharp vision and color vision are affected first. They can strike in early childhood (Stargardt Disease) or much later (AMD).

Prevalence: 100-200,000 affected in USA; general prevalence of about 1:3,400

Genetics: dominant, recessive and X-linked genetic forms (also mitochondrial and syndromic).

Over 130 gene mutations identified yielding many phenotypes (physical characteristics), e.g.

Usher Syndrome – early onset hearing loss (some have balance problems) along with RP vision loss. 25 K affected; 11 genes identified.

Leber Congenital Amaurosis – very early, severe vision loss (often congenital); nystagmus. 10-15 K affected; 9 genes identified.

Bardet-Beidl Syndrome – vision loss with many other (e.g., mental) problems. 10 K affected. 12 genes identified.

Choroideremia – choroid involved; 10 K affected. Gene defect known

Retinoschisis – retina “splitting”. 6 K affected.Gene defect known.

Many others………

Clinical – what the professional sees:- thinning of the retina, mainly rod photoreceptor loss

- attenuated blood vessels - abnormal pigment clumping (bone spicule) Visual – what the patient sees: - loss of peripheral vision (tunnel vision) - loss of night vision Progression is variable sometimes very fast,

sometimes slower. Inexorable constriction of visual field in most cases. Loss of functional vision or total blindness are often the end results.

SEE THE LIGHT

What a patient with retinitis pigmentosa sees.

Our Goal:

To rapidly move from research at the laboratory bench to the clinic such that we can deliver preventions, treatments and cures to all patients with inherited retinal degenerations (RDs). This includes RP, AMD and all the rare RDs such as Stargardt, Usher, Leber, choroideremia, etc.

How do we reach the Goal?

The path starts with scientific Proof of Principle. Basic scientists have done a thorough job providing much information on the RDs including potential treatments and cures. We must now move to Clinical Trials that lead to effective treatments.

1) Basic Science – start with progress in genetics, cell biology, etc.

2) Proof of Principle - establish animal models, understand disease mechanisms and design modes of treatment. This is called “Proof of Principle” – it works!

3) PreClinial Trials – work with companies; do efficacy and safety trials in animals; drug delivery studies, etc. Much money is needed.

4) Clinical Trials – get government approval and move to and through the human Clinical Trial to a successful conclusion. This usually occurs collaboratively with a biotech or pharmaceutical company.

Phase I: Phase I is designed to test safety and to

determine the best and safest dose of treatment. The main question here is” “How well is the new treatment tolerated in a small number of patients? Are there bad side effects?”

Thus, a Phase 1 trial is not designed to see if the treatment works. Rather, only to see if it is safe in a small number of patients.

Phase II is designed to determine whether the treatment has any positive effect in the human. Hopefully this “efficacy” phase shows a useful effect of the treatment in man as it did in animals. It usually uses a larger number of patients than in Phase I.

Another aim is to provide more information on safety and any side effects.

Phase III is designed to fully evaluate the effectiveness of a treatment.

Usually, it involves a larger number of patients than in Phase II. One of the main problems we will encounter in a Phase III trial for RP patients is the very small patient population. This makes it difficult to recruit enough patients such that enough data are collected to make the results statistically significant.

The whole Clinical Trial process usually takes 2-5 years and costs a lot of money. Therefore, working with pharmaceutical companies is essential.

In 1990, the first gene mutation was found in the rhodopsin gene (Humphries; Dryja et al.).

A defective gene can be replaced with a new

functional one. This is the simplest form of Gene Therapy. However, you must know the gene mutation first!

Retinitis pigmentosa, autosomal dominant

16 15

Retinitis pigmentosa, autosomal recessive

19 15

Retinitis pigmentosa, X-linked

6 2

Macular degeneration, autosomal dominant

12 6

Macular degeneration, autosomal recessive

2 2

Other retinopathy, autosomal dominant

9 4

Other retinopathy, autosomal recessive

13 11

Other retinopathy, mitochondrial

6 6

Other retinopathy, X-linked

9 7

TOTALS   192 144

RE

TN

ET

RE

TIN

AL

DIS

EA

SE

DA

TA

RE

TN

ET

RE

TIN

AL

DIS

EA

SE

DA

TA

http

://w

ww

.sph

.uth

.tm

c.ed

u/R

etne

t/su

m-d

is.h

tm

mapped cloned197 (2009)

154 (2009)

RETNET RETINAL DISEASE DATARETNET RETINAL DISEASE DATA

http://www.sph.uth.tmc.edu/Retnet/sum-dis.htm

D. Graph

No Longer Science Fiction◦ Significant advances have been made in research on

neurodegeneration and treatment across a range of eye diseases (retinitis pigmentosa, macular degeneration and others)

is the introduction of genetic material into an organism to slow, prevent or reverse the progression of disease. It involves replacement of defective or absent proteins in the case of loss of function defects or the inhibition of new function in gain of function defects.

One of several potential interventions◦ Pharmacological (drug intervention)◦ Surgical ◦ Prosthetics◦ Cell replacement (or tissue/organ transplantation)

Challenges facing gene therapy

Controlling gene expression. For some diseases, the correct amount of protein has to be made for the right amount of time. Genetic diseases like cystic fibrosis need a continual supply of the therapeutic protein throughout a patient’s lifetime to keep the disease in check. Other diseases don’t require such tight control. For different reasons, gene expression also sometimes works poorly or shuts off altogether shortly after it has been introduced. Scientists are not yet able to control gene activity after it’s been introduced into the body. Getting genes to their proper targets. One big problem is getting the corrected gene into the right cells and functioning at the desired site. Often, cells other than the intended targets take up the gene as well.Preventing destruction of the introduced gene. Some enzymes will chew up DNA that is not protected. In other cases, the immune system will recognize a viral vector and destroy both it and the inserted gene.Delivery methods. Another challenge is how to most effectively administer the gene so that it ends up where you want it. In some cases, it’s possible to take the desired cells out of the body and insert the gene. Others inject the gene directly into specific sites, such as heart muscle.Condition of the host. For some genetic diseases, irreparable damage occurs early in life. In cystic fibrosis, for example, the lungs are damaged during childhood. Treating some of these diseases will mean having to intervene before permanent damage has already occurred.Host immune response. Another concern is how the person’s immune system will react to a foreign protein for the first time. Alternatively, the immune system may not react adversely the first time the vector or gene product (the protein) is encountered but can mount a severe response on subsequent exposures .

Targets the actual cause of the disease rather than symptoms

Expression of the desired gene may exceed the duration of action of currently available drugs

Gene expression may be targeted to a specific cell type (using a specific promoter to achieve spatial regulation)

Gene expression may be regulated, i.e. turning the gene on and off (using a regulatory cassette to achieve temporal regulation)

The advantage of ocular tissue for gene therapy

◦ Small size◦ Easily accessible◦ Immune-privileged◦ Tissue boundaries that prevent leakage of the

therapeutic material to other sites and separation from the systemic circulation

Where – mode of delivery

What – knowledge on the genetic cause of the blinding disease (for specific treatment)

How – expression in the right place

Functional copy of the gene◦ Gene replacement for recessive mutations

Ribozymes, antisense oligonucleotides, siRNA◦ Gene silencing for dominant mutations (new -small

interference RNA) Genes encoding cytokines, growth factors,

neuroprotecting agents, and anti-apoptotic products◦ Slows or prevents degeneration but does not cure

or restore

rd1 mouse◦ Premature stop codon mutation in the gene encoding the rod

photoreceptor cGMP phosphodiesterase β subunit◦ Deliver functional PDEβ gene through Ad, lentivirus, AAV rescued

photoreceptors in the rd1 mouse

rds mouse◦ Lacking a functional gene for peripherin-2

RPE65 mutation◦ Leber congenital amaurosis◦ Canine model

RPE65-deficiency, a 4 bp deletion resulting in a premature stop and truncation of the protein product. The dogs are vision-impaired

AAV-mediated delivery of the normal RPE65 gene restored vision.

Ribozyme therapy Antisense therapySiRNA

Suicide gene therapyGrowth factor

therapy

Gene replacement therapy

Ribozyme therapy: Ribozymes hybridize with mRNA from a mutated gene. The ribozyme enzymatically cleaves the mRNA and functionally silences the gene by preventing synthesis of the abnormal protein from the transcript

Antisense therapy: Complementary DNA molecules hybridize with the mRNA from the mutated gene. The ribosomes cannot bind to the doublestranded heteroduplex, preventing synthesis of the abnormal protein

Suicide gene therapy: Gancyclovir isconverted to a cytotoxic nucleotide by a transfected viral thymidine kinase. The drug inhibits DNA synthesis, leading to cell death. Dying cells are also cytotoxic to nearby untransduced cells, causing the “bystander effect”

Growth factor therapy: Growth factors are synthesized and secreted from cells expressing growth factor transgenes. The growth factors have positive neurotrophic effects on surrounding retinal cells and also on the secreting cells via specific receptors

Gene replacement therapy: Mutated genes causing autosomal recessive retinal degenerations can be replaced using viral or non-vial methods

Contain highly conserved sequences that direct catalytic hydrolysis of the mRNA at specific tri-nucleotide motifs

Contain variable sequences that determine the specificity of the ribozyme for its target

Each can catalyze the hydrolysis of many transcripts within the cell

Two commonly used ribozymes◦ Hammerhead and hairpin ribozyme◦ Hammerhead ribozymes have been used more

commonly, because the target site has few limitations

Secondary structures of some naturally occurring ribozymes

green-ribozyme or intron regionblack-substrate or exon region

Takagi, Y. et al. Nucl. Acids Res.29, 1815-1834 (2001)

GGAGCUACACGCCUCGAUGUGC

GCAGG GUCC

U AU AC GA UA UU AU AG CG CU AC

AA

CUGAU

GA

5’-m7GpppG

3’-nAAA

AAAn-3’5’-m7GpppG

cleavage site

Zhao, J. J. and Pick, L. Nature 365, 448-451 (1993)

wildtype

+ ftz ribozyme

+ ftz ribozyme

Inhibition of ftz synthesis by a ftz hammerhead ribozyme

red-ftz mRNAgreen-ribozyme

AG

A

G

Uninjected eye from a rat at P130.

P23H transgenic rat retinas taken at postnatal day P130

Retina from the opposite eye from the same rat as in A, which was injected subretinally with Hh13 ribozyme at day p15 now at P130.

Uninjected eye from a rat at P240.Retina from the opposite eye of the same rat in C, which was injected with Hh13 ribozyme at P15 now at P240.

RibozymeTherapy

Growth Factor Therapy

The majority of vectors available today to deliver genes to cells are of viral origin◦ Viruses, by means of their own nature, infect cells

very efficiently

Adenovirus◦ Non-enveloped, double-stranded DNA virus◦ Infects a broad range of human and non-human cell types by

binding to specific cell-surface receptors◦ The virus in not incorporated into the genome (remains as an

episome within the nucleus)◦ The episome is eventually degraded or lost – transient nature of

gene expression (peak expression – 2 d to 2 wks)◦ Infectious nature◦ Tissue inflammation◦ need to use replication-defective or helper-dependent Ad

Adeno-associated virus◦ Non-enveloped, single-stranded DNA parvovirus◦ efficiently infects dividing and non-dividing cells◦ Inserts into the host genome at specific locus (stable

expression)◦ Not associated with any known human infectious disease◦ Less tissue inflammation than Ad◦ distinct differences among the cell-targeting specificities of

the 8 serotypes For RPE, AAV1, AAV2 or AAV5 For photoreceptors, AAV2 or AAV5

◦ AAV capsid proteins affect both cellular tropism and the speed of onset and intensity of gene expression

RPE65 is a pigment epithelium protein that is required for regeneration of 11-cis retinal in the visual cycle

RPE65 is the retinal isomerase that converts all-trans retinol to 11-cis retinol In humans defects in the gene cause Leber congenital amaurosis, the

congenital form of retinitis pigmentosa Defects in the corresponding gene in Briard dogs have also been found. Researchers at the University of Pennsylvania created an adeno-associated

gene transfer vector to replace the defective Briard dog RPE65 gene.

photoreceptor promoter

RPE65 protein coding region

AAV genome, selectable markers, and replication origin

Functional recovery in RPE65 mice

An exciting new area of transplantation study is that of Stem Cell research. Stem cells are primitive, undifferentiated cells that have the ability to differentiate into many types of mature, adult cell types – liver, skin, photoreceptor cells.

Where are stem cells found? Stem cells are, of course, present in embryonic tissue. However, small numbers have recently been found in many adult tissues. For example, Van der Kooy et al. was the first to find stem cells at the edge of the retina in the eye of the adult mouse.

The Needs and Challenges:Source: We need good sources of stem cells. We already

have evidence that stem cells from different sources such as the brain can be transplanted into the retina.

Development: We need to determine the factors that will push the stem cells to develop into mature, functioning cells such as photoreceptor cells.

Thus, stem cell research has a long way to go before it fulfills its promise.

Adult stem cells are plastic to some extent, but how useful remains to be determined.

Again, we do not know how to guide adult stem

cells to differentiate into a particular type of cells.

Issues with Stem Cells

The use of nutritional supplements as a therapy in RD has been controversial but now must be taken seriously in prevention or at least slowing down the RDs, especially AMD.

In 1983, Converse et al. found that the concentration of a fatty acid called DHA was abnormal in the blood of some RP patients. DHA is heavily concentrated in photoreceptor outer segments and is thought to be vital for their functioning. Two human Clinical Trials have been conducted to examine the effects of DHA supplementation on RP patients (no results yet).

In 1993, Berson et al. found that vitamin A supplementation slows RP to a small extent in some RP patients. This was the first agent shown to be effective in treating RP.

The AREDS Clinical Trial of the NEI has ended after many years of study. It found that some nutritional supplements helped in delaying the progression of AMD. The nutrients studied were zinc, B-carotene and vitamins C and E.

Lutein is a nutrient that is highly concentrated in the macula. It is thought to be an antioxidant and thus may protect photoreceptor cells in the macular region. It is currently being tested as to its effects in both AMD and RP.

These fall into 2 categories:1)Brain (cortical) electronic implants2)Retinal implants – in front or behind the

retinaFor the retinal implants, there are many

different designs and surgical approaches from groups around the world.

Cortical Implant

The Active Implantable Device:◦ Uses electrical stimulation to bypass defective

or dead photoreceptors and stimulate remaining viable, non-photoreceptor cells of the retina.

◦ Image data from an external camera is wirelessly transmitted to the implant which stimulates electrodes in an array on the retina to produce formed vision.

1) A small video camera and a transmitter are hidden behind glasses worn by the patient. The camera captures the visual images.

2) The images are relayed to a small computer. The computer processes the signals and sends them to the electrode array implanted on the retina.

3) The implant electronically stimulates the retina, mimicking the original visual image.

4) The inner retinal neurons biologically process the signal and pass it down the optic nerve for final processing in the brain.

Visual Prosthetic Devices

The Retinal Chip The Retinal Chip Electrode

Chronic studies on human implants have been done at Doheny/USC on the Argus 16 electrode device -- from 2/02 and yet continuing with functional testing.

Six patients were implanted. NO device failures. All subjects saw discrete visual images

(phosphenes) and could perform visual spatial and motion tasks.

Mobility (walking and navigation) has been improved

One device had to be removed for unrelated health reasons.

The remaining 5 patients use the device at home.

The new device has 60 electrodes – not just 16. This does allow for much finer detail in the visual image.

The Argus II is much smaller than the first generation device. It is designed to last a lifetime.

An Argus III 200 electrode array device is now in development.

Years

Vis

ion

Peo

ple to

be H

elped

in th

e US

2002 2006 20142010

Hand Motion

Finger Count

Face Recognition 1,000,000

60 electrodes

240 electrodes

2018

20/20

Progress of the Artificial Retina

100,000

12,000,000

1000 electrodes

16 electrodes