+ All Categories
Home > Documents > Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010...

Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010...

Date post: 05-Apr-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
89
June, 2010 Command Area Development of Small Dams KNOWLEDGE FOR LIFE CABI Ref.: FR/CABI-PK/DR10004/2022 CABI South Asia Opposite 1-A, Satellite Town, Data Gunj Bakhsh Road Rawalpindi Tele: 051-9290132, 9290332: Fax: 051-9290131 E-mail: [email protected]
Transcript
Page 1: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

1

June, 2010

Command Area Development of Small Dams

KNOWLEDGE FOR LIFE

CABI Ref.: FR/CABI-PK/DR10004/2022

CABI South Asia

Opposite 1-A, Satellite Town, Data Gunj Bakhsh Road Rawalpindi

Tele: 051-9290132, 9290332: Fax: 051-9290131

E-mail: [email protected]

Page 2: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

2

Contents Fact sheet of the progress ...................................................................................................................................................................... 4 Acknowledgement .................................................................................................................................................................................. 5 Summary ................................................................................................................................................................................................ 6 Introduction............................................................................................................................................................................................. 7 Objectives .............................................................................................................................................................................................. 7 Methodology ........................................................................................................................................................................................... 8 Activities 2007-08 ................................................................................................................................................................................... 8 Activities 2008-09 ................................................................................................................................................................................. 22 Activities 2009-10 ................................................................................................................................................................................. 30

Annexure 1; ToF / FFS schedule for CAD Small Dam Project .......................................................................................................... 49 Annexure 2; TOF Participants ........................................................................................................................................................... 49 Annexure 3; Command areas under Small Dams ............................................................................................................................. 50 Annexure 4; Farmer Field School, Dungi Dam, Gujar Khan .............................................................................................................. 51 Annexure 5; Farmer Field School Varagujran, Jamergl Dam, Jehlum ............................................................................................... 53 Annexure 6; Farmer Field School Jammergal, Jammergal Dam Jehlum ........................................................................................... 55 Annexure 7; Farmer Field School Dhoke Jumma, Jammergal Dam, Jehlum .................................................................................... 57 Annexure 8; Farmer Field School Qibla Bandi, Qibla Bandi Dam, Attock .......................................................................................... 60 Annexure 9; Farmer Field School Barazai, Qibla Bandi Dam, Attock ................................................................................................ 62 Annexure 10; Farmer Field School Malik Mala, Qibla Bandi Dam, Attock ......................................................................................... 64 Annexure 11; Farmer Field School Dhoke Tahlian, Dhoke Tahlian Dam, Chakwal ........................................................................... 66 Annexure 12; Farmer Field School Kalan Wali, Dhoke Tahlian Dam, Chakwal ................................................................................. 68 Annexure 13; Farmer Field School Jhattla, Dhoke Tahlian Dam, Chakwal ....................................................................................... 70 Annexure 14; Varietals comparison of Spring Maize ......................................................................................................................... 72 Annexure 15; Cost of production of high plastic tunnel ..................................................................................................................... 72 Annexure 16; Resource persons visited to TOF ................................................................................................................................ 73 Annexure 17; Success Story 1 .......................................................................................................................................................... 74 Annexure 18; Success Story 2 .......................................................................................................................................................... 75 Annexure 19; Success Story 3 .......................................................................................................................................................... 76 Annexure 20; Success Story 4 .......................................................................................................................................................... 78 Annexure 21; Success Story 5 .......................................................................................................................................................... 80 Annexure 22; Success Story 6 .......................................................................................................................................................... 81 Annexure 23; Success Story 7 .......................................................................................................................................................... 82 Annexure 24; Success Story 8 .......................................................................................................................................................... 83 Annexure 25; Insect collection kit ...................................................................................................................................................... 84 Annexure 26; Farmers Field Schools visited for back stopping during 2008-09 ................................................................................ 85 Annexure 27; Organizational structure of Joint FFS session at each dam, 2000-10 ......................................................................... 85 Annexure 28; Total Sub FFS at Dungi Dam, 2000-10 ....................................................................................................................... 85 Annexure 29; Total Sub FFS at Qibla Bandi Dam, 2000-10 .............................................................................................................. 86 Annexure 30; Total Sub FFS at Jammergal Dam, 2000-10 ............................................................................................................... 87 Annexure 31; Total Sub FFS at Dhoke Tahlian Dam, 2000-10 ......................................................................................................... 88

Page 3: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

3

Author: Dr. Kauser Khan Project Manager CABI South Asia

Rawalpindi,

Pakistan

Tel: +92 (0) 51 9090132

Email: [email protected]

Page 4: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

4

Fact sheet of the progress Project Title: Project Duration; 4 Years

Total cost; £158,752 (Rs.18, 742,900)

S.# Target Achievements in %age

1 Field Assistant-TOF April, 2007 to December, 2007 100 %

2 Farmers-TOF January, 2008 to June, 2008 100 %

3 Community Based Research Activities 2008 (no. 10); 2009 (no. 15); 2010

(no. 20) 100 %

4 Farmer Field Schools 2007 (no. 10); 2008 (no. 20); 2009

(no. 30); 2010 (no. 40) 100 %

5 Inland Study Tours entire project period (no.2) 100 %

6 Curricula workshops 2007 (no.1); 2008 (no.2); 2009 (no.1) 100 %

7 Training workshop for Quality Assurance &

Monitoring of FFS processes and activities 2007 (no.1); 2008 (no.1); 2009 (no.1) 100 %

8 Enterprise development, quality control in

agricultural produce and marketing 2008 (no.1); 2009 (no.1) 100 %

9 Rural psychology and social issues 2008 (no.1) 100 %

10 Training workshops for skill enhancement

of Agriculture Officers 2007 (no.1); 2009(no.1) 100 %

11 Planning meetings/workshops 2007 (no.1); 2008 (no.1); 2009 (no.1) 100 %

12 Training workshop on Sanitary & Phyto-

sanitary 2009 (no.1) Additional

13 Training on Insect collection & reservation 2009 (no.1) Additional

14 Global Plant Health Clinic Training

Workshop 2009 (no.1) Additional

15 Effective Presentation Skills Workshop 2009 (no.1) Additional

Page 5: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

5

Acknowledgement We are very thankful to Government of Punjab for the provision of the financial assistance to conduct the

Integrated Crop Management through FFS approach in Command areas of small dams of Rawalpindi division.

Special thanks to all the Project Staff.

Very special thanks and appreciations are extended for the very lovely farming community and farmer

trainees for their keen interest and active participation in the training sessions.

The efforts and technical assistance of CABI South Asia team also is greatly acknowledged.

Page 6: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

6

Summary The Govt. of Punjab under the Irrigation and Power department initiated the project entitled Command

Area Development of Small Dams in Rawalpindi Division in close collaboration with CABI South Asia,

to build the capacity of staff and farming community of command areas of small dams of district

Rawalpindi, Attock, Jhelum and Chakwal.

Rawalpindi Division consists of Barani area dependent on rainfall for crop productivity. Farmers of the

area in which small dams are situated, needed intensive training so that they can make judicious use of

scarce source of water for the production of cash crops. The introduction of these cash crops certainly

enhanced the income of the poor farming community.

CABI South Asia has provided technical support for the implementation of Integrated Crop

Management (ICM) through capacity building of extension staff and farmers by effective execution of

Training of Facilitators (ToF) & Farmers Field School (FFS) approaches. CABI South Asia transferred

latest package of technology especially off-season vegetable production under plastic tunnel.

Farmer-led season long participatory training was conducted in Regional Office of CABI South Asia

from April 2007 to June 2008. ToF participants & trained farmers were in a position to follow activities in

the field and could easily produce commodities according to desirable standard.

With the help of ToF/FFS activities, farmers changed their cropping pattern. First time, spring maize,

sada behar chara (fodder) and potato crops were introduced by the project in the command areas.

Farmers become organized, motivated for collectively solving their problems.

CABI South Asia conducted a series of trainings workshops. Inland tours were also arranged for the

field staff of the project to learn of on going research and development activities of off-season

vegetables production under plastic tunnel technology.

The project provided an opportunity to:

• Produce fruits and vegetables in compliance with standards of WTO under environmentally

friendly situation

• Reduce poverty of rural population particularly small farmers and women

• Enhance their income and improve standard of living

• Support village level development and capital building, assistance and training

• Favorable environment for future projects

• Feedback process established with key partners

Page 7: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

7

Introduction The Government of Punjab has initiated the programme for harvesting rain water by building small

dams in the area for providing irrigation water and thus creating vibrant agricultural activity, jobs and

better livelihoods for the poor. Availability of irrigation water has provided opportunity for growing new

cash-crops, and improving existing practices in the traditionally grown crops.

Since farmers had been doing the subsistence agriculture for centuries, there was a huge potential to

introduce new crops, advance technology, farmers’ training that can provide tremendous opportunity to

train them in a new system of produce management, post harvest management, and marketing.

Traditionally in Rawalpindi division, wheat, maize, millet, sorghum, and groundnut have been grown,

with animals being reared on low quality grazing pastures. Poverty is widespread in rural areas causing

adverse effects on the livelihoods of the people.

Apart from scarcity of water in the Rawalpindi division, several other factors are also contributing to

lowest return in agricultural production e.g. poor management practices, lack in farmer’s capacity to

manage the crop issues, time of sowing, poor quality of seeds, poor storage facilities and less

knowledge of grading, packaging and marketing etc

In this regard, CABI South Asia has trained initially, 17 Master trainers from the agriculture extension in

the first cycle of Training of Facilitator (ToF), while during the second phase 20 farmers were trained.

Total 100 Farmer Field Schools (FFS) were established to train farmers though “learning by doing”

approach over a full cropping season. These master trainers gained better understanding of the

problems relating to their crops and providing solutions through the mutual discussions and sharing of

experiences in participatory way. CABI SA helped to address these issues within the context of the

social and cultural climate of the local communities.

Objectives The overall objective of CABI component was to enhance the income of small farmers by helping them

to increase their production. The emphasis was on capacity building of extension staff and farmers by

effective execution of the Training of Facilitators /Farmer Field Schools (ToF/FFS) approaches in the

project area.

The specific objectives were: Facilitate season long ToF/FFS for the implementation of FPTDD-ICM activities in the project area

Facilitate all the training/curricula workshops/meetings/field day/graduation ceremonies etc as listed in

FPTDD-ICM component

Plan and provide all technical support for the implementation of follow up ToF/FFS activities throughout

the project period

Page 8: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

8

Facilitate establishment of networking between FFS and service providers through the department

Methodology The Integrated Crop Management (ICM) using non-formal participatory training methodology has been

identified as a preferred approach to develop capacity of the project staff and farmers for better crop

management and reduce input use especially hazardous pesticides. During the course of project

implementation and due to broad scope of the participatory ICM approach the use of term Good

Agriculture Practices (GAP) has been identified to describe activities under the banner of ICM. The use

of quality seed/crop varieties, best planting time, suitable crop rotation, natural mortality factors, natural

resource management and biological control collectively form the basis for pest control decision-making

in integrated pest management systems. Confidence building and experiential learning by farmers used

to achieve capacity building of extension personnel and farmers using Farmer Field School (FFS)

methodology.

Activities 2007-08 ToF / FFS Schedule Followed The fortnightly schedule was followed during ToF & FFS sessions for Command Area Development of

Small Dam Project (CAD Small Dam) (Annexure 1).

Training of Facilitator (ToF) The project launched on ground a little late and hence ToF

session could start in April, 2007. There were two Training

of Facilitators (ToF) sessions held during the entire project

period i.e. Field Assistant- Training of Facilitators (FA ToF)

(April, 2007 to December 2008) and Farmers- Training of

Facilitators (F ToF) (January, 2008 to June, 2008) while

30 ToF sessions and 14 ToF sessions carried out as FA

ToF and F ToF respectively (Annexure 2). During the

Training of Facilitators different activities were carried out in the ToF as well as in the feed back session

with master trainers on fortnightly basis. All learning’s from ToF sessions then subsequently shared

with FFS participants and implemented in FFS. (Annexure 3)

11%3%

32%54%

Fig:1. Nature of Participation in TOF Sessions Agriculture

Officer

Agri. Reseach Officer Field Assistant

Page 9: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

9

Agenda of Training of Facilitator (ToF) Both ToF sessions were held according to set agenda e.g. start from recitation of Holy Quran and

ended with vote of thanks. There was separate agenda for both ToF and Feed back session. Detail is

given below as example;

ToF Session:

• Recitation from Holy Quran

• Basic characteristics of FFS

• Visit to ToF plot regarding Agriculture Ecosystem Analysis (AESA)

• Tea Break

• Preparation of charts, presentation and discussion

• Prayer & Lunch Break

• Special topic

• Group dynamics

• Planning for next session

• Mood Meter

• Day analysis

Feedback Session of ToF

• Recitation of Holy Quran

• FFS feedback chart preparation

• Presentation of feedback and discussion

• Tea break

• Special topic

• Group dynamics

• Lunch & Prayer

• Recommendation & responsibilities sharing

• Mood Meter

• Day analysis

Training of Facilitator (ToF) Activities Following activities were covered during ToF sessions.

Participatory Situation Analysis (PSA) and Participatory Reflection & Action (PRA) ToF participants gone through exercises of PSA & PRA not only for bench mark survey but also having

command on quality establishment of Farmer Field Schools (FFS) (Annexure 4, 5,6,7,8,9,10,11,12,13)

Page 10: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

10

Norms Setting For smooth running of the sessions, norms were set with participants. Norms strictly followed by

participants and nobody was excluded from the rules. The norms then set out were;

• Time management (9:30 am ToF session starting time)

• No whispering

• To take permission while saying some thing or asking question (raised hand) i.e. one person at

one time

• Respect each one idea

• Cellular phone should be on vibration

• Permission is must while going out side the session

• No irregular or asymmetrical movement in the vicinity of head office during working hours

• Loyalty with the work

• ToF hall is red zone for smoking

• Politics and irrelevant discussion is not allowed during session.

Hopes & fears of the ToF participants Hopes

• We will get education about facilitation and knowledge in simple

• We will get maximum knowledge about vegetables and other crops

• This will help the life standard of poor farmers

• Will be able to disseminate the gained knowledge to the farmers

• Create self confidence in participants

• Improve the production technology

• Helps in avoiding excessive use of pesticide

• Helps in team building

Fears

• If program will windup in the middle stage then

• Lack of farmers interest may be hinders the objective of the project

• Either farmer will adopt the new technology or not.

• Poor participation creates trouble

• Discussion & meetings may not be on regular basis.

Page 11: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

11

Agro Ecosystem Analysis (AESA) AESA stand for Agro Ecosystem Analysis, which is principally based on critical observations of living

things (biotic factors) and non living things (abiotic factors) of crop environment. The ecosystem

analysis provides a method to integrate the many aspects of the crop ecosystem into one drawing that

can then be discussed and analyzed. On weekly basis said activity was carried out in the field and on

the basis of out come of this activity and than discussion through brainstorming on out come, crop

management decision (CMD) was taken for better crop production. Participants were then able to

recognize different stages of sown crops because of regular observation of field. They realized that

keen observation could solve any kind of problem, Conserve natural enemies.

Facilitation and Communication skills, types of communication, characteristics of good

communicator and problems with good communication were discussed in detail.

Practical work Useful practical work also carried out like germination test (use of gunny bags), soil sampling and its

laboratory test and maize seed treatment etc.

Group discussion During TOF sessions discussions were made according to the issues raised or special topics arranged.

Through brainstorming, participatory approach adopted where close attention and respect were given

to the opinions of the participants. At the end of discussion consolidated crop management decisions

(CMD) were made for better crop production.

Chart Preparation After taken AESA in the filed, charts were prepared accordingly. Chart preparation helped in record

keeping and comparison between presented data and previous data.

Presentation

To improve the presentation skills of the participants, presentation was one of the basic activities of

ToF. It developed the skills accordingly.

Land preparation for tunnel technology Clay loamy and well fertile land was selected for tunnel installation in ToF plot having length and width

i.e. 30 ft and 14 ft respectively. Before sowing and transplanting vegetables, land was well prepared.

Well rotten farm yard manure (FYM) was incorporated at the rate of one trolley or 8 tones / acre. Beds

were prepared having following dimensions;

Bed length = 30 ft,

Each bed width = 2 ft

Each ridge width = 2 ft.

Page 12: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

12

There were total 3 beds in the tunnel, in which crops were sown according to ridges allocated to each

crop i.e. tomato and cucumber occupied 3 ridges each. All ridges were given light, irrigation until

moisture reached at the corners of beds where plants were to be transplanted

Tunnel installation High plastic tunnel structure having length of 30 ft, 14 ft

height and 12 ft width installed as ToF plot in side the CABI

office. Total 3 rows or beds and 6 ridges were prepared in

side the tunnel. Beds were prepared having dimension .i.e.

bed length = 30 ft, bed width = 2 ft while ridge width = 2 ft

Note: In FFS, size of tunnel was large than that of ToF. In

field high tunnel structure was kept like having length of

104 ft, 11 ft height and 30 ft width. There were 12 rows

having following dimensions

Bed length = 30 ft

Each bed width at corner on both sides = 1.5 ft

Each bed width in middle = 2 ft

Each ridge width = 2 ft

Nursery raising Just inside the tunnel area, one bed nursery was raised

having 6 ft length, 3 ft width and 9 inches height including

3 inches of silt layer. After bed preparation, seeds of

Tomato (Sahil verity), was sown at half inch depth in a zig-

zag manner at a distance of 4 inches in both P x P and R

x R. Mulching was than spread over beds after seeds

sowing to avoid weeds. Water was given with shower to

remain the sown seeds on the same line or place.

Avoiding hidden insects especially termites application of

chloropyriphos @ 2-3 ml/lit of water was given to the nursery. Nursery plants were planted according to

given following specifications; Tomato (P x P distance) = 15 inches and cucumber crop was sown

directly in the tunnel at a distance of 9 inches away to each other.

Page 13: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

13

Transfer of nursery in tunnel Before transfer of nursery plants or seedlings to tunnel, heavy irrigation was given to nursery. Nursery

plants were uprooted in such a way that plants roots may not be damaged. After uprooting, roots of

nursery plants were dipped in 2-3 % fungicide solution for half an hour at least.

Temperature and humidity management in the tunnel

During severe and cold weather, management of tunnel acquires more attention because of low

temperature and high humidity, which ultimately provide suitable environment of fungal diseases. Inside

the tunnel, temperature must be kept between 15 and 30 C while humidity percentage must not be

exceeded from 70%. During the month of January, severe cold whether struck the area and hence

maintenance of temperature and humidity according to requirement was unable to manage and in a

result out break of downy mildew and chilling effect occurred. Safe fungicides like Redomil along with

mixture of backing soda, detergent and mustard oil were sprayed for the control of fungal diseases.

Crop management Field observed regularly on weekly basis. What ever needed for crop management, consensus

developed for that in TOF session and interventions made for crop management. Weeding,

fertilizations, control measurement, irrigation application etc were done regularly at need basis

Special topics This activity was linked to the stage of growth of the crop and specific local issues. Main objective was

to build the capacity of ToF participants (Annexure 16). With the help of these topics, participants were

able to understand the crop related issues and faced no difficulties during facilitation skills while sharing

with farmers in the field. Various special topics covered during the course of training are given below;

• Participatory Reflection & Action (PRA) and Participatory Situation Analysis (PSA)

• FFS formation

• AESA and conduction of AESA

• Integrated Pest Management (IPM) and Good Agricultural Practices (GAPs)

• Protocol of quality assurance of FFS

• Agronomic practices

• Bed preparation

• Weeds management

• Nursery establishment

• Tunnel Technology & production

• Effect of pesticides on insect pests and natural enemies

• Disease identification and management

Page 14: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

14

• Insect Identification & Role of Natural Enemies

• Vegetables marketing

• Packaging

• Harvest and post harvest management

• Animal housing (Livestock)

• Feeds & Feeding of animal(livestock)

• Breeds & breeding (livestock)

• Day to day disease management (livestock)

• Livestock marketing

Group Dynamics This activity provides an opportunity to develop and enhance cohesion among the participants as a

learning group. Whether it is done as an unfreezing activity or structured learning exercise, group

dynamics highlight the importance and interdependence of individual group members’ performance in

the process of achieving a common goal. A number of exercises and activities were carried out to

achieve this objective while holding the ToF sessions. The list of the group dynamic exercises

undertaken during the ToF Cycle is given as under:

• Body Language

• Hot hot, Cold cold

• Water bridge

• Observing things

• Hopes & fears

• Name game

• How will be the leader

• Back to back and speak (Communication exercise)

• Nine dots

• Wearing the coat

Insect zoo This activity helped participants to increase their understanding of ecological principles in their agro-

ecosystems. With the help of this, participants were able to understand the interaction of pest &

beneficial organisms. in the execution of the ToF/FFS approach. In this regard, following insects, pest,

natural enemies and disease were observed with active involvement of the participants during the

training.

Page 15: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

15

• Semilooper

• Army worm

• Cutworm

• Jassid

• Aphid

• Coccinelids (lady bird beetle)

• Spiders

Participants collected flying insect pests and natural enemies from the field and kept them with each

other in the cages (having leaves or fruits etc) for observation.

Participatory Trials Following participatory trials were developed during lay out of ToF plot:

• Raised bed verses flat beds.

• Chemical fertilizer vs farm yard manure (FYM).

• R X R and Pl X Pl distance in maize crop

• Different insect pest management trials like for the

control of cutworm in maize crop, Brain BAT,

mechanical control and release of natural enemies

etc were developed

• Use of plants extract like neem plant as pest

control

• Fertilizer + 6 inch Pl X Pl distance

• FYM + 6 inch Pl X Pl distance

• Fertilizer + 8 inch Pl X Pl distance + Flat bed

• Fertilizer + 8 inch Pl X Pl distance + Raised bed

• Fertilizer + 9 inch Pl X Pl distance

• Fertilizer + 6 inch Pl X Pl distance

• Raised beds for nursery establishment

• Establishment of tomato crop from out-shoots cutting

During AESA, it was observed that production wise trial (D) Fertilizer + 8 inch Pl X Pl + Raised bed

showed better result having 13 Kg production followed by (E) Fertilizer + 9 inch Pl X Pl distance having

11 Kg. While other trials (A, B, C) were almost same production i.e. 9 Kg.

Page 16: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

16

Multiply 13 kg with 20 marlas to get production per kanal i.e. 13x20 = 260 Kg than multiply 260 Kg with

8 kanals to get production in acre. i.e.260 x 8 =2080 Kg. To get this production in mond than divide

2080 by 50, we will get production in mond i.e. 2080/50 = 42 mond per acre. This formula has been

followed for all trials and the result is given in figure below.

Insect pest management Field Trials for insect pest management designed during ToF sessions:

• BAT

• Insecticides

• Natural Enemies

• Plants in pest control

• Mechanical Control

1. Wheat Bran BAT Formula:

Wheat bran: 5 kg

Gurh: 1 kg

Water 10 litre

Insecticide 25ml

How to prepare:

Mix all these ingredients well. First solve the gurh through heating or grinding, then place the wheat

bran in a tub or drum. After this, mix insecticide with gurh and pore it on the wheat bran and mix all the

materials well.

How to apply:

Place the bran bat at one meter interval and at late afternoon, because the cutworm comes late at

night.

Result:

0

50

Trial (A)

Trial (B)

Trial C

Trial (D)

Trial (E)

29 29 2942

35M

ond

per A

cre

Trials Specification

Comparison of Production

Page 17: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

17

Data of the first night shows that out of 17 cutworms larvae, 12 were found dead inside or near the

BAT, while the rest of 5 insects were inside the soil and escaped because they spend the night

underneath soil.

Insecticides At initial stage, the infestation of cutworms and Halicoverpa zea were found severe. At that stage the

ToF participants decided to spray chemicals due to severe infestation.

Plants in pest control For armyworm we carried out trials of plants extracts application. The detail of which is given below;

Neem oil Trial Neem oil at the ration of 2% was applied for the control of Armyworm. This trial was carried out on 1/3

part of a kanal in the TOF plot.

Chilli and Neem oil Trail Formula:

3.5 tsp of chilli

250ml of Neem oil

Mix it and left it overnight.

Mix 2 tsp of detergent with it and

Pure the solution in 21 litres of water for spray in the field.

This trial was carried out on 1.3 kanal of the TOF plot.

Garlic Trail Formula: 85gms of Garlic

50ml of Kerosene oil or vegetable oil

Left this solution overnight

Then mix 10 ml soap with it or 0.5 tsp detergent

950ml of water

Shake this mixture and place it in a bottle.

For spray in the field mix one part of the solution with 19 parts of water for spray.

Natural Enemies Trichogramma were released after ten days of the chemicals application for eggs parasitism.

Livestock management

Page 18: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

18

Apart from vegetables and other crops, participants were also educated with livestock knowledge. CABI

SA livestock specialist Dr. Khalid Farooq shared knowledge & experiences with participants.

Thoroughly discussion was made in this regard and number of special topics delivered by specialist.

FFS Activities There were 10 Farmer Field Schools (FFS) associated with FA-TOF while 20 Farmer Field Schools

(FFS) were associated with F-TOF as practicing FFS. So whatever enlisted in that of TOF are the

activities of FFS.

Results and discussions Project played significant role in the agriculture based livelihood of the area. Farmers realized the

importance of the project. The farmer-led season long participatory training gave opportunity to the

farmers for extensive skill and knowledge gain.

Spring maize was introduced first time in the farming system of the command area as a cash crop.

Spring maize variety 6525 at all four dams gave highest yield (124.5 mounds/acre) as compared to

32w86. In this particular trail of spring maize both varieties were treated with same dose of fertilizer. i.e

2 bags of DAP + 2 bags of Potash + 2 bags of Zinc Sulphate (5 Kg each) + 4 bags of Urea. The main

reason is that Spring Maize Varieties have more heat unit requirement per day for vigorous plant

growth and almost maintaining 28000 plants per acre. More over the Variety 6525 has more tolerant to

heat as compared 32w86. This is a very critical factor because after the frost season when temperature

increases rapidly and almost at the time of flowering, if temperature rises beyond the limit of 25 0C, it

directly affects the pollen grains and abortion of ovaries will take place. The end result is poor seed

setting. The variety 6525 has high percentage of adoptability to this particular type of environment of

Potohar region.

Sada Behar Chara was also introduced first time in the cropping system of the command area. The

farmers of the command area become very happy with this versatile fodder which not only increased

the production of milk but also increased the fattening of the animals. It produced more yields in those

Dungi Dam, 25

Jammergal Dam,

89

Dhoke Tahlian Dam, 74

Qibla Bandi

Dam, 75

Farmers trained as practicing FFS in each Dam

Page 19: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

19

days when scarcity of fodder could observe through out the Barani area. Due to its tremendous effect in

re-sprouting replaced the old traditional Sorghum, Bajra and Desi Maize in the command area. This

produced more than double production as compare to local one.

Along with spring maize and sada behar chara, potato crop was also introduced first time in the area to

minimize the old cropping system. Apart from these, different varieties of winter & summer vegetables and autumn maize were also sown and results were very encourging.

Off-season vegetables production under high plastic tunnel technology was relatively new idea for the

farming community of the command area. Tunnel technology offer not only early production of the

crops but also helps farmers to fetch more money from their commodities. This technology needs

proper attention to maintain the desire temperature and humidity otherwise fluctuation in temperature

and humidity can cause serious problems in terms of disease out break and chilling effect. Therefore, it

is very important to maintain the temperature and moisture level according to requirements i.e.

temperature level must be between 15 to 30 0C while humidity should not be exceeded from 70 %. In

situations, when humidity levels are above the desired level then it becomes necessary to have proper

ventilation for keeping the percentage of humidity down while for low temperature, plastic sheet from

tunnel may be removed after 9:30 am from sides when there is full sunny day. It was observed that due

to severe cold, low temperature and high moisture contents inside the tunnel could provide favorable

condition for the out break of fungal diseases (downy mildew, late blight etc). In addition, it was also

noted that low temperature causes chilling effect and due to this, stress condition were recorded on

crops. Less amount of water is required for Irrigation inside the tunnel as compare to open field. It was

proved that during the months of December, January and February, percentage of humidity level is

comparatively high inside the tunnel therefore controlled irrigation is needed at such time and hence

number of irrigation may reduce.

In over all circumstances it was noted that cucumber crop has shown insignificant or poor result in

both production and income wise. This is only as a consequence of downy mildew and fusarial wilt

(Fusarium specie) diseases. Unforgiving out break of downy mildew was observed at the time of harsh

& severe cold weather struck the area. i.e. from last week of the December till February. As a result,

fluctuation in weather in the shape of low temperature & high humidity occurred, which is favorable

condition for the growth of the downy mildew.

Cucumber Management includes proper temperature (between 15 to 30 Co) & moisture condition (must

not exceed from 70 %) inside the tunnel.

As far as tomato is concerned it is comparatively hard crop shown tolerance to some extend in above

situation. Attack of early blight (Alternaria solani) and late blight (Phytophthora infestants) was observed

Page 20: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

20

at early stages of the crop. These diseases were coping with help of controlled irrigation, optimal

temperature & moisture level in side the tunnel and judicious use of fungicides.

Good Agricultural Practices (GAPs) Following were the GAPs being introduced during TOF &

FFS sessions:

• Before bed preparation, soil test was carried out.

Application of well rotten Farm Yard Manure (FYM) to

keep land soft and well fertile. Bed was then prepared

for sowing of desire crops

• First time Introduced spring maize, sada behar chara

as fodder and potato in the area

• Introduced new varieties of autumn maize, summer & winter

vegetables

• Good quality seed purchased from a well reputed company.

Seed treatment and proper seed placing were carried out

• Raised beds were kept in both nurseries as well as in field

• Proper Plant to Plant and Row to Row distance for good

plant health were kept

• Proper ventilation and judicious use of irrigation through out

the winter season for the appropriate maintenance of

temperature and humidity inside the tunnels

• Proper raised bed prepared along with well

drainage system in the tunnels

• Cucumber and tomato crops kept upward instead

of led on ground, threads were used as

supporting materials

• Maximum numbers of plants were sown in limited

area with the help of supporting materials

• Timely removal of off-shoots

• Nursery prepared from off-shoot cuttings of

tomato crop in small polythene bags and used as replacement or open field cropping

Page 21: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

21

• Judicious use of proper fungicides along with local totka i.e. use of mixture of mustard oil

backing soda and detergent at required ratio for the control of fungus

• Used of micro nutrients as foliar spray

• Drenching

• Picking and harvesting with equipments

Cost Benefit Ratio Net income in the tunnel is far better than open field cropping. Average production per plant also had

shown better result. Technology proved that large number of plants can easily be sown in a confined

peace of land.

Economic analysis of tomato production under high plastic tunnel (104ft length x 11ft height x 30 ft

width) technology is as follows. There were total 6 rows in TOF plot while on each row 20 plants were

sown. After harvesting, each row has given approximately 105 Kg production. So 105 x 3.5 = 367.5 Kg

(104 ft length) and 367.5 x 12 rows = 4410 Kg (30 ft width) while average rate of tomato per Kg

recorded as Rs. 27. (Annexure 15)

Results show that there is significant gain from investment in this activity.

Workshops Arrangement and conduction of different workshop was one of the mandatory tasks of CABI South Asia

component of CAD Small Dam Project.

Interactive Workshop for Capacity Building of Agricultural Professionals

There were different short training/workshops topics encompassed in this interactive workshop. Detail

is given below;

Total Production (Kg)

Cost of Production (Rs)

Gross Income (Rs) Net Income (Rs)

Tomato 4410 65600 110250 44650

Total Production

(Kg)

Cost of Production

(Rs)

Gross Income (Rs)

Net Income (Rs)

Thou

sand

Cost Benefit Ratio at TOF Tunnel

Page 22: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

22

• Rural psychology and social issues

• Facilitation, communication and presentation skills

• Enterprise development, quality control in agricultural produce and marketing

• Training for quality assurance and monitoring of FFS processes and activities

Curricula Development Workshop on Tunnel Vegetables A three days workshop on “Curricula Development of

vegetables production in tunnels was organized by CABI

South Asia in June, 2008. The purpose of the workshop

was to develop curricula on vegetable tunnel farming and

to find out solutions for all off season vegetable farming.

The participants were from different educational,

research, extension and development organizations.

Prior to workshop, Participatory Situation Workshop

(PSA) was carried out to chalk out related issues.

Training on Insect collection & preservation A comprehensive training on identification and collection

of insects in proper way was imparted to project staff and

an insect collection kit was provided to them for insect

collection and preservation. Each Insect collection kit

consisted of a set of materials (see annexure. )

Success Stories Most of the farmers expressed positive views about the

achievement of the project (Annexure 17,18,19, 20, 21, 22, 23, 24).

Activities 2008-09 Activities carried out by CABI South Asia component of CAD Small Dam Project, during the 2008-09

are given below;

Review/Feedback Session Target 11

Achieved 8

The purpose of feedback sessions was to liaison project activities among CABI and small dam project

staff to discuss and find solutions for the difficulties faced by farmers while running FFS sessions and

any other agenda which can improve the quality of FFS.

Page 23: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

23

Back stopping of Farmer Field Schools (FFS) Farmers Field Schools (FFS) facilitated by the Agriculture Officer of each dam were visited by Expert

Field Facilitator of CABI South Asia for back stopping of the sessions. Technical know how was shared

with each FFS participant about low & high plastic tunnel activities. Two visits were made per month at

each dam.

Farmers were trained during backstopping of FFS visits practically about nursery establishing for

tomato crop through seeds & off-shoots, transplantation techniques, Pl x Pl and row x row distance,

fertilization, irrigation and disease management.

Trainings & Workshops During this period of the project, CABI South Asia

successfully organized and conducted a series of trainings

and workshops on different topics. The topics selected for

the workshops were according to the need of the project

staff and farmers. Objectives of the Training & Workshops

were:

• To build and enhance the capacity of agriculture

staff and farmers

• To address the weak areas being faced by the staff

and farmers while doing agriculture activities

• To formulate and develop training modules

• To provide forums for different stakeholders in order

to discuss and share their experiences with each

other

Targeted Trainings/Workshops

• Skill Enhancement training on situation handling

• Quality Assurance of FFS Workshop

• Curricula Development Workshop (Wheat & Maize)

Additional Trainings/Workshops

• Training workshop on Sanitary & Phyto-sanitary

• Training on Insect collection & reservation

• Global Plant Health Clinic Training Workshop

• Effective Presentation Skills Workshop

Page 24: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

24

Skill Enhancement training on Situation handling & Quality Assurance of FFS This training/workshop held on 18th January, 2009

Curricula Development Workshop on Wheat & Maize Wheat and maize are major crops of the Potohar area.

Realizing the situation and need of the farmers, CABI-SA responded very timely to support them in this

context, developing comprehensive, all-inclusive and

wide-ranging curricula for wheat & maize crops

(Annexure 14). Before conducting the workshop, ground

work was done in the shape of participatory situation

analysis (PSA) to identify issues of wheat & maize crops.

Training Workshop on Sanitary & Phyto-sanitary The workshop was organized by CABI South Asia on

19th Jan, 2009 for introducing quality standards of

marketing according to WTO agreements to agricultural professionals about international sanitary and

phyto-sanitary standards.

Training’s Objectives were to:

• Enhance understanding about Sanitary and Phyto-Sanitary measures

• Analyze SPS measures affect on the Vegetable production

• Identify the measures to improve the SPS compliance of vegetables in Pakistan

• understand the International Compliances e.g. HACCP, BRC and Global GAP

• Identify the SPS constraints for Pakistan Horticulture Export

• Identify the hurdles for Horticulture Export from Pakistan

Training Workshop on Global Plant Health Clinic This 4 days unique training was organized by CABI South Asia from 21st to 24th April, 2009. The main

objective of the workshop was to find out diagnosing and remedy strategies of the plant diseases.

Inland Tour For capacity building of project staff CABI South Asia arranged inland study to Institute of Horticultural

Sciences, University of Agriculture, Sitara Chemicals Faisalabad, Shadi Farm, Mamokanjan, Sargodha

Citrus orchards, Tarnab Research Farm, Agricultural University Peshawar and farmers of low tunnels at

Akora Khatak.

Objective of the an Inland Tour was to:

Page 25: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

25

• Experience sharing with farmers and different agricultural based institutions

• study and learn more about different agriculture activities with special emphasis on off-season

vegetables production under plastic technology

• Exposure to on-going research & development activities on fruits and vegetables

Special Topics This activity was linked to the stage of growth of the crop and

specific local issues. Main objective was to build the capacity of

TOF/feedback sessions participants. With the help of these

topics, participants were able to understand the crop related

issues and faced no difficulties during facilitation skills while

sharing with farmers in the field. During feedback sessions,

participants suggested for arranging special topic on the following topics;

• Vegetables disease management

• Insect Collection & Preservation

• Livestock & fodder management

Hence, as per their demand, above mentioned topics were

arranged for them during feedback session and resource

persons engaged accordingly.

Group Dynamics This activity provides an opportunity to develop and enhance

cohesion among the participants as a learning group. Whether it is done as an unfreezing activity or

structured learning exercise, group dynamics highlight the importance and interdependence of

individual group members’ performance in the process of achieving a common goal. A number of

exercises and activities were carried out to achieve this objective while holding the feedback sessions.

The list of the group dynamic exercises undertaken during the sessions is given as under:

• 16 dots Game

• Water bridge

• Big fish & small fish

Insect Zoo Conducting of the insect zoo using locally available material play an important role in helping farmers

gain a deeper understanding of insect pests and natural enemies in the area. This knowledge is useful

for them for informed decision making. The field management decisions through ecosystem analysis, of

Page 26: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

26

which insects form a major part, is considered pivotal in the execution of the FFS approach. In this

regard, following insects, pest, natural enemies were observed with active involvement of the

participants during the FFS training.

• Lady bird beetle & aphids

• Lemon butterfly

Good Agricultural Practices (GAPs) During FFS sessions, agriculture officers and farmers were facilitated to use following good agricultural

practices:

• Before bed preparation for all high tunnels and low tunnels at each dam well rotten Farm Yard

Manure (FYM) applied to keep land soft and well fertile

• Good Quality and disease free Seeds of tomato (Sahil variety) and Squashes (Karizma)

purchased from a well reputed company

• Germination test of both varieties was held before sowing in the field to check the %age of

germination. In the result, more than 90 % germination occurred

• Proper plant X plant and line X line distance kept for tomato and squashes. Detail is as under;

o Tomato Crop: Plant X Plant = 1.5ft and Line X Line = 2 ft

o Squash Crop: Plant X Plant = 1.5 ft and Line X Line = 5ft

• At all dams, tomato nursery established on raised beds with suitable Pl X Pl (3 inch) and L X L

(3 inch) distance

• Proper look after held regarding water showering, hardening, and transplantation techniques

• Used proper raised beds along with well drainage system for tomato and squash crops in the

field

• Optimum used of fertilizers

• Judicious use of proper fungicides along with local totka i.e. use of mixture of mustard oil,

backing soda and detergent at required ratio for the control of fungus

• Chemicals Spray avoided at the time of picking and harvesting

• que lure were installed for the control of cucurbitae fruit fly Bactrocera cucurbitae) at Chakwal,

Jehlum, Attock and Gujar Khan

On-Farm Participatory Research Activities

Early production of vegetables under low plastic tunnels started as

on-farm participatory research activity at each dam i.e. Dungi,

Page 27: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

27

Jamergal, Qibla and Dhoke Tahlian dams. The detail is given below;

At each dam, two plots of having one kanal area each were selected for early production of vegetable

(Squash or Tinda) under low plastic tunnel technology. Farmers were facilitated in the areas like bed

preparation, tunnels installation, method of seeds sowing, Pl x

Pl and L x L distance, fertilization, irrigation, weeding, pesticide

application and harvesting technology.

This activity shown better result in terms of production (average

1888 Kg/kanal) and cost benefit ratio i.e. 1: 1.5. Practicing

farmers were satisfied from the result and expressed

willingness to do such farming technology in future.

Installation of Fruit Fly monitoring Traps A number of population and symptoms of fruit fly were

observed on squash crop. Installation of fruit fly traps

containing Cue lure to attract the Bactrocera. Cucurbitae were

installed at each site.

Graphical representations of population dynamics of Bactrocera cucurbitae at various dams. Result

shows that population of Bactrocera cucurbitae started increasing from 1st week of April at Dhoke

Tahlian dam. It reached at peak in 2nd week of May and started decreasing onwards till end of report

period. Its population started in 1st week of April and reached at peak in 3rd & 4th weeks of this month

Population dynamics of Bactrocera cucurbitae at various dam

0

50

100

150

200

250

Apr,09(1)

Apr,09(2)

Apr,09(3)

Apr,09(4)

May,09(1)

May,09(2)

May,09(3)

May,09(4)

Jun,09(1)

Weeks

Adul

ts o

f Ba

ctro

cera

cuc

urbi

tae

Page 28: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

28

in Dungi dam. It decreased up-to the end of report period. Similarly at Jamergal dam population of the

said specie started in 1st week of April while decreased in 2nd week of this month and then began to

boost and reached at peak in 3rd week of May. It decreased downward till the 1st week of June, 09. As

far as Qibla Bandi dam is concerned, it slightly decreased in 2nd week of April and then increased and

reached at peak in last week of May, 2009. It decreased onward to the end of reporting period.

Cost benefit ratio Cost of production of low plastic tunnel technology

S # Expenditure of mini tunnel Rs/kanal Total

2 30 Kg plastic sheet @ Rs.165/Kg = Rs. 4950/= but sheet can be

used for the next season hence this rate squeeze to half

2475 2475

3 240 Bamboo sticks having length of 6 ft @ Rs. 17/stick = Rs. 4080/=

but it can be used for 2 years hence rate should be counted as half

for first season

2040 2040

4 5 Kg Rope @ Rs. 75/Kg 375 375

5 320 Seeds @ Rs 1.8/Seed 576 576

6 Fertilizer (DAP 5 Kg @ 65/Kg + Urea 20 Kg @ 15/Kg + Potash 5 Kg

@ 28/Kg)

765 765

7 Pesticide 700 700

8 Labour Charges 3000 3000

9 Tractor 500 500

10 Irrigation 800 800

11 Miscellaneous 1000 1000

Total cost of production 12,231

Page 29: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

29

Cost of Production

Average Production

Total IncomeNet Income

12231

1888

39887

27656

Average production, average rate, gross income and net income of squash under low plastic tunnel

technology/kanal at each dam

S #

Name of Farmer Dam Production in

Kg/kanal Average Rate/Kg

Total Income Net Income

1 Muhammad Asif Dungi(Gujar

Khan) 2000 22 44,000 31,769

2 Mukhtar Hussain do 1900 21 39,900 27,669

3 Waheed Qiblabandi

(Attock) 1800 20 36,000 23,769

4 Anwar Khan do 2100 22 46,200 33,969

5 Arshad

Mehmood

Jamergal

(Jehlum) 1950 19 37,050 24,819

6 Raja Nasir

Mehmood do 1700 22 37,400 25,169

7 Muhammad

Riasat

Dhoke

Tehlian

(Chakwal)

1850 23 42,550 30,319

8 Samad Khan do 1800 20 36,000 23,769

Average Production & Rate 1888 21 39,887 27,656

Cost Benefit Ratio of early production of vegetables under low plastic tunnel technology

Result shows that there is significant

difference between cost of production

(Rs. 12,231) and total income (Rs.

39,887) and hence average net income

(Total income – Cost of Production) in

above one kanal tunnel is recorded

much better i.e. Rs.27, 656/= while total

average production is 1888 Kg.

Therefore Cost Benefit Ratio =

39887/12231 = 3.26 = 1:3.26

In other words, for every one Rupee

spent as cost of production for low tunnel production, it returned Rs. 3.26

Page 30: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

30

Activities 2009-10 Monthly Meetings For the smooth running of the activities and keep liaison with its partner CAD Small Dam office, CABI

South Asia started monthly meetings with the project staff of the CAD Small Dam Project held on

regularly basis on first Tuesday of every month.

Participants of the Monthly Meetings:

Mr. Sayed Aman Ullah Shah, Project Director CAD Small Dam Project

Dr. Kausar Iqbal Khan, Project Manager, CAD Small Dam Project CABI Component

Mr. Muhammad Zahir shah, Project Officer, CAD Small Dam Project CABI Component

Mr. Rai Muhammad Arshad Khan, Agriculture Officer Qibla Bandi Dam

Mr. Irfan Hafeez, Agriculture Officer Jammergal Dam

Mr. Hafiz Baksh Muhammad, Agriculture Officer Dhoke Tahlian Dam

Mr. Zahid Kiani, Agriculture Officer Dungi Dam

Mr. Sajjad Saeed, Assistant Research Officer, CAD Small Dam Project

Following decisions were made in the first monthly meeting;

• There will be eleven numbers of Farmers Field Schools (FFS) at each dam except Dungi dam

(Gujar Khan) where number of FFS will be seven. All FFSs of each dam will conduct a Joint

FFS session on monthly basis for training purpose.

• Number of farmers at each FFS will be at least five

• Session of each joint FFS would be conducted as per following schedule for four months i.e.

start from 1st November, 2009 till 28th February, 2010.

Dungi Dam: 1st Thursday of every month

Qibla Bandi Dam: 2nd Thursday of every month

Jammergal Dam: 3rd Thursday of every month

Dhoke Tahlian Dam: 4th Thursday of every month

• One member from each FFS will be selected for data collection of his tunnel on weekly basis for

the period of four months start from Nov, 2009 to February, 2010.

• Honoraria Rs. 100/- per week will be paid to the above mentioned FFS member on account of

his services regarding data collection. This fund will be given by CABI-South Asia.

• Amount for refreshment of each joint FFS session will be allocated by CABI SA on actual basis

but not more than Rs. 2500/-

Page 31: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

31

• List of FFS members for Joint FFS session will be provided by concerned Agriculture Officer of

each dam on the 1st session.

• CABI South Asia will organize two trainings events for project staff (Four Agriculture Officer, one

Assistant Research Officer and Four Field Assistants) on the following topics.

• One day training on “Management of agriculture in Command Areas of Small Dams” Islamabad

tentatively in January, 2010.

• Five day training (Theory and exposure visit) on “Rain water harvesting & water conservation

techniques (Adoption of sprinkler & drip irrigation system” in Khushab, Bahawalpur and area

suitable for this activity.

• CABI South Asia will install low tunnel of one kanal area at each dam for community based

research activities.

• List of farmers and site selection for the low tunnel activity will be provided by concerned

Agriculture Officer of each dam not later than 10th Oct, 2009.

• CABI South Asia budget will be re-appropriated accordingly to accommodate additional

activities decided in the meeting held on 1st Oct, 2009.

• This monthly meeting will be held among small dam field staff and CABI staff on first Tuesday of

every month at 10:30 am sharply at Project Director Agriculture of CAD Small dam office.

• Research Officer of CAD small dam project will be responsible for planning and conducting at

least five community based research (CBR) activities per dam.

• Special topics on “tomato nursery raising establishment” and “Integrated Pest Management

(IPM) of vegetables” will be given by Project Officer of CABI South Asia in Joint FFS sessions at

all dams

Event based curricula developed for Joint FFS Session (See below in the summary of Joint FFS

Session).

Joint FFS Session

Joint FFS sessions started from 1st week of Oct, 2009 according

to agreed schedule. First of all organizational structure of Joint

FFS session made at each dam accordingly. (Annexure 26, 27,

28, 29, 30, 31)

Objectives of the Joint FFS sessions

• Formation & Registration for Joint FFS

• Name of Joint FFS

• Venue selection for the Joint FFS session

Page 32: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

32

• Selection of Chairman & Deputy Chairman for Joint FFS

• Formation & name of sub FFS

• Selection of group leaders for each sub FFS

• Selection of members for data collection on weekly basis in their respective tunnels

• Handing over materials required for Joint FFS session like white charts, board & permanent

markers, writing pads, color pencils, scales, etc to concerned Agriculture Officer of each dam.

Event Based Sessions following curricula along with field observation was conducted in the monthly meeting in Joint FFS

session at each dam.

• Introduction & Organizational Structure of Joint FFS

• Objective of Joint FFS

• Organizational Structure of Joint FFS

• Formation of Sub FFS

• Venue selection for the meeting of Joint FFS

• Selection of Chairman & Deputy Chairman for Joint FFS

• Selection of Chairman & Deputy Chairman for Sub FFS

• Selection of logistic support members

• Selection of Farmers for weekly basis data collection/dam

• Who will do what & how? Responsibilities

• Distribution of materials among participants

• Registration & Receipt Form formation

• Process of data collection i.e Agro-ecosystem analysis (AESA)

• Nursery Raising establishment and Transplantation of seedlings methodologies and their pre-

requisites

• Seed source

• seed/variety selection

Page 33: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

33

• seed treatment methods

• Seed screening test to check its viability

• Seed purity

• Germination Test

• Importance of nursery

• Site selection for nursery raising

• Soil Type

• Organic Matter

• Importance of Organic Matter

• Soil health and history of the site

• Soil treatment methods

• Calculation of nursery area for vegetable production

• Calculation of no. of plants in nursery

• Practical demonstration of nursery layout and design

• Ploughing and land leveling

• Nutrient management of nursery land

• Composting

• How to prepare good compost

• Structure of the polythene tunnel for the nursery raising

• Seed bed preparation

• Raised beds and Flat beds

• Drainage and its importance in nursery raising

• Mulching

• Irrigation

• Harding of the seedlings

• Nursery Uprooting/Transplanting

• Selection of Healthy seedlings

• Up rooting methodologies

• Seedling treatment with fungicide

• Tunnel Farming

• Why tunnel farming?

• Selection of vegetable crops for low tunnel, walk-in and high tunnel

Page 34: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

34

• Land preparation for tunnels

• Use of green manure

• Fertilization for tunnel farming

• Pl X Pl and L X L distance

• Weeding

• Irrigation

• Effect of humidity & temperature

• Management inside the tunnel

• Cost benefit ratio. Cost of production for all kind of tunnels

• Net production & income

• Integrated Pest Management (IPM)

• Introduction to IPM

• What is pest?

• Types of pest

• Importance & benefits of IPM

• Principles of IPM

• Control of major insect pests through IPM

• Control of fruit borer, aphids, white fly, cut worm, pumpkin beetle etc by applying IPM strategy

• Control of major diseases through IPM

• Management of downy mildew, powdery mildew, root rot, late blight, early blight, wilting etc by

applying IPM strategy

• Weeds management through IPM strategy

• Marketing of yields produced inside the tunnels Tunnel

• Handling, packing, storage of harvest commodities

• Market Information appraisal

• Establishment of market channels

• 4 Ps of Marketing

• Cost benefit ratio

• Marketing of nursery plants

Page 35: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

35

Grow Healthy Seeds

• Good seed health is the first step for better production. Therefore to enhance productivity and

having good health seeds, following characteristics must be addressed before purchasing &

sowing of seeds.

Seed Source

• Seeds should be certified from reliable source

• Well-matched with the weather of the cultivated area

Selection of Variety

• Use only those varieties which are suitable for the area

• Read carefully seed germination %age, name of variety, company, time of producing and time

of expiration on the seed packet before put in money.

• Purchased seeds should be free from seed born diseases

• They must have capability of resistant

• Seeds must be free from adulteration

• Ensure that germination test held before sowing of purchased seeds.

Seed Treatment

• Seed treatment through hot water

Steps:

• Take distill water and kept it on fire up to 50 C°

• Then put the desired seeds in a cloth and kept that cloth in the water up to 30 minutes.

• Then take the hot water treated seeds and placed them in fresh water for a while.

• Only use dried seeds for sowing

• Seed Treatment through Fungicide Application

• Seeds born diseases can also be controlled with the application of recommended fungicides like

Redomil, Mankozeb and Diathane M-45 etc @ 2-3 gm/Kg seeds.

Botanical Treatment Steps:

• Take garlic and grind it

• Then extract water from the grinded garlic

• Then treat the seeds with the solution of the garlic extracts

• How to know about the alive and dead seeds?

Page 36: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

36

Steps:

• Pour water in an open mouth utensil

• Then put down seeds in the water

• See and wait for a while

• You will find that some seeds are floating in water while others do not and reach to the bottom

• It is obvious that those seeds which reached to the

bottom are alive while those floating in water are dead

• Separate dead seeds from the alive

Seeds Germination Test in %age

• Before sowing of seeds, it is very much important to

test the seeds with regard to germination capability of

seeds. Process of germination is given below;

Steps:

• Take a piece of soaked cloth (jute)

• Placed 100 numbers of seeds in line on soaked cloth

• Then cover seeds with another fold of jute cloth

• Now placed them in a shadow place at room

temperature.

• Showering water at least two time in twenty four hours

• After 4-6 days, germination occurs.

• Now count number of germinated seeds (say 80

numbers of seeds are germinated)

• This means that 80 seeds out of 100 are germinated

and hence %age is 80%

• Almost 80-85 % germination occurs which is required

germination %age rate

Nursery Raising & Establishment

• It is recommended that nursery should be raised & established for those crops/vegetables which

grow slowly during initial stages e.g. tomato, sweet pepper, hot pepper and brinjal etc

Importance of nursery

• Seeds grow fast due to proper environment

• Control use of seeds and hence cost of production minimized

Page 37: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

37

• Management of seedlings of crops/vegetables is easy due to small beds

• Weeding is comparatively easy.

• Plants are more healthy and grow fast after transplantation

• Site selection for nursery raising

• Land should be evenly leveled

• Avoid saline soil

• Well drainage system

• Near to dwell

• Near to transplantation field

• Open place not under the shadows of trees

Soil Type

• Upper surface of the soil mostly up to 6-12 inch must be fertile as plants take nutrients & water

from this limited surface

• Soil must be soft as it helps in smooth growth of the roots

• Loamy soil gives good result

• Selected site for nursery raising should be free from soil born diseases

• Do not miss the soil test

• The remains of previous crops must be buried and destroyed

• How to control soil born diseases?

• In hot season, cover the selected area by plastic sheet up to 7-8 days and then remove the

plastic sheet and finally level the land

• If intensity of soil born diseases is high then apply Formalin for complete annihilation of

diseases and insects. After application of Formalin, cover the land by plastic sheet and left the

cover up to one week

• Remove the remains of the weeds and previous crop

• At least one month prior apply Furadon or Carbofuron @ 6-7 Kg/acre to selected area of the

nursery

Organic Matter

• It is decaying plant or animal materials, most commonly compost, green manure, animal

manure and micro organisms etc

Importance of Organic Matter

• It is an agent to improve soil structure, maintain tilth, and minimize erosion

Page 38: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

38

• Serve as revolving nutrient bank account

• Enhance water absorbing capacity of the soil

• Provides nutrients to beneficial organisms of the soil

• With the help of organic matter, plants become resistant to the attack of diseases

• By use of organic matters, use of chemical fertilizers could be minimized to some extend.

• Ensure safe environment

• Over all soil is in good condition

Land Preparation and sowing methodology for Tomato Nursery Establishment

• Select fertile and loamy soil with good drainage system

• One month prior, level the land and use rotten Farm Yard Manure (FYM)

• Avoid fresh FYM during nursery raising

• At least three days before sowing, apply NPK according to land requirement.

• Now prepare at least 6 inch raised bed having dimension (20ft length and 3ft width)

• Then take silt and pass through mesh

• Now spread the meshed silt over bed and form layer up to 3 inch and then level the surface.

• Now take stick and press it on the surface of bed to draw lines for sowing. Line x Line distance

should be 3 inch

• Bed is ready for sowing

• Just sow tomato seeds with out any pressing on the line at a distance of 3 x 3 inch

• After sowing of seeds, apply mixture of well rotten FYM and silt with the help of mesh thoroughly

on bed

• To protect the seeds from birds and keep optimum moisture level, cover the bed with the help of

dried plant parts (Parali or sooka)

• At first showering, add insecticide (Chloropyriphos @ 3gm/lit) to protect seedlings from termites

and other hidden insects

• Irrigate the nursery at least two times during the 24 hours up to 3-4 days and after that water

should be given on need basis.

• Check regularly the nursery and remove the dried parts of the plants (Parali or sooka) very

carefully if germination occurs even of a single seed

• Stop irrigation after 2-3 weeks of germination for the purpose of Harding of the seedlings. This

will boost the resistant mechanism of the seedlings against unsavory condition like drought etc.

Page 39: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

39

Nursery Uprooting/Transplantation of Seedlings

• Irrigate the nursery just 24 hours before transplantation to ensure easily up-rooting

• Use small spade (kurpa) for up-rooting. Avoid up-rooting through hand, it may cause injury to

the roots of the seedlings

• Always transfer healthy seedlings

• Do not delay transplantation after up-rooting, it may effect negatively on the health of the

seedlings

• Treat and dip properly up-rooted seedlings in a fungicide (Redomil, Mencozeb, Diathane M-45

etc @3 gm/lit) solution for at least 45 minutes

• Irrigate the ridges of the field before transplantation of the seedlings

• Make sure that seedlings are transplanted in that area of the ridges where moisture level

reached

• Stay away the stem and roots of the seedlings from direct contact of the water during

transplantation

Low Tunnel Activity As per activities planned for the fourth year of the project, off-season vegetables production under low

plastic tunnels activity has been completed by CABI South Asia well in time on one kanal area at each

dam. Detail is given below

S #

Dam Crop Variety Host

Farmer Remarks

1 Dungi Squash

(Tinda) Riano

Mukhtar

Hussain

-Tunnels installation completed up to 2nd

week of Dec, 2009 (Well in time)

- 90 % germination occurred

2 Qibla Bandi do Karishma Abdul

Waheed

Tunnels installation completed up to 2nd

week of Dec, 2009 (Well in time)

- 90 % germination occurred

3 Jammergal do Riano +

Karishma Ali Asghar

Tunnels installation completed up to 2nd

week of Dec, 2009 (Well in time)

- 85 % germination occurred

4 Dhoke

Tahlian do

Riano +

Karishma Masuood

Tunnels installation completed up to 2nd

week of Dec, 2009 (Well in time)

- 85 % germination occurred

Page 40: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

40

Cost Benefit Ratio

0

5,000

10,000

15,000

20,000

25,000

QiblaBandidam,

Attock

Dhoktahlian,Ckakwal

DungiDam,

Gujar khan

Jamargaldam,

Jehlam

Total CostProfit per kanal

Cost benefit ratio

Cost benefit ratio of Vegetable production under low tunnels

Dam

Varie

ty

Are

a D

uration

Prod

uctio

n ( K

g)

Ave

rage

pric

e pe

r Kg.

Tota

l Ave

rage

Val

ue

(Rs.

)

Expenditure (Rs.)

Total Cost

Profit per

kanal

Land

pr

epar

atio

n

Irrig

atio

n

Seed

s

Fert

ilize

r

Com

post

, FYM

Fung

icid

es a

nd

Pest

icid

es

Plas

tic &

B

ambo

o st

icks

Tran

spor

tatio

n

Qibla Bandi dam,

Attock Car

ishm

a

! Kan

al

Mar

ch 2

, 201

0 to

Jun

e 10

, 20

10

1,840 20 36,800 500 1,000 450 2,000 300 1,000 500 3,000 13,250 23,550

Dhok tahlian, Ckakwal R

HIN

O

! Kan

al

Mar

ch 2

, 20

10 to

May

24

201

0

1,080 30 32,400 500 800 450 2,000 200 1,000 500 1,200 11,150 21,250

Dungi Dam, Gujar khan R

HIN

O +

C

aris

hma

10 M

arla

ea

ch

Mar

ch 2

, 20

10 to

Jun

e 30

201

0

1,200 28 33,600 600 1,000 450 2,000 400 1,000 500 0 10,450 23,150

Jamargal dam,

Jehlam RH

INO

+

Car

ishm

a

11 M

arla

eac

h Fe

brua

ry 2

1,

2010

to M

ay 2

5,

2010

1,100 30 33,000 800 900 450 2,000 200 1,000 500 0 10,350 22,650

Page 41: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

41

Monitoring of Field activities

Page 42: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

42

Page 43: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

43

Page 44: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

44

Identification of viral disease on Summer squash in small dam command area A survey for disease on cucurbits crops was conducted in Gogar khan and Jhelum small dam sites.

Virus-like symptoms were observed in all fields visited. A severe disease was observed on summer

squash (Curcubita pepo). Both aphids and whiteflies were present in the field. Symptoms of the disease

were found on the vegetative portion but not on the fruit. The disease started with leaf curling, mosaic

and with enations on the upper sides of leaves followed by stunting. In view of the symptoms of the

disease and prevalence of viruses in the area, both begmoviruses and RNA viruses were suspected.

DNA was extracted from leaf samples by the method described by Doyle and Doyle (1990). Each DNA

sample was diluted to a uniform concentration of 1μg. PCR was carried out using universal primers

which have the ability to amplify any begomoviruses. Primers were designed in a highly conserved

region of the C1 ORF (Briddon and Markham, 1995). The primers used in PCR were Begomo1

(CCGTGCTGCTGCCCCCATTGTCCGCGTCAC) and Begomo2

(CTGCCACAACCATGGATTCACGCACAGGG) that were expected to produce a PCR product of about

1.1 kb. Fragments of the expected size were amplified from nine samples out of twelve and products

were cloned in TA cloning vector pTZ57RT (Fermentas). Confirmation of clones was done by EcoRI

and PstI restrictions sites in plasmid vector and a fragment of 1.1 kb was released. Confirmed clones

were sequenced from Macrogen, Korea. Sequence analysis of the cloned product showed the highest

sequence identity (91%) to Tomato leaf curl new Delhi virus (ToLCNDV). ToLCNDV is a cosmopolitan

species that has frequently been identified in cucurbits (Maruthi et al., 2007; Tahir and Haider, 2005;

Guzman et al., 2000; Revill et al., 2003; Morales and Jones, 2004). However, Koch’s postulates for

ToLCNDV causing diseases of cucurbits have not been satisfied. DNA sequence data and to lesser

extent, biological characteristics are the currently accepted criteria for defining species of

geminiviruses. These findings suggest that the DNA virus associated with summer squash is

begomovirus already reported from different cucurbit species. Work for identification of RNA virus

associated with the disease is in progress.

Page 45: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

45

Closing ceremony at each dam

Page 46: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

46

Project Closing Ceremony

Page 47: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

47

CAD Small dams Project Budget Utilization

Sr #

Description of account

Budget Re -

appropriated Budget

Mar-07 to June-07

July-07 to June-08

July-08 to June-09

July-09 to April-10

Unutilized Budget

PKR PKR PKR PKR PKR PKR PKR

1 Total

Establishment Cost 6,214,000 6,334,151 521,118 1,408,603 1,828,881 1,619,000 956,549

1

Senior Project

Manager (6 Month

Every Year)

1,536,000 1486,416 172,155 280,916 432,000 432,000 169,345

2 Expert Field Facilitator 1,500,000 1,569,304 90,000 360,360 449,304 430,560 239,080

3

Insect Bio Control

specialist (4 Month

every year )

1,040,000 1,016,334 80,000 200,000 288,000 264,000 184,334

4 Technical Resource

Person 190,000 210,000 60,000 60,000 58,000 0 32,000

5 Field /Lab. Assistant

(2 Nos) 1,084,000 1,158,340 50,000 275,088 350,736 254,976 227,540

6 Office Clerk/

Computer Operator 495,000 508,000 42,015 131,863 139,156 125,213 69,753

7 Drivers (01only) 369,000 385,757 26,948 100,376 111,685 112,251 34,497

2 Total

Operational Cost 5,505,000 3,935,278 154,558 908,676 1,014,389 1,398,953 458,702

1 Travelling &

Subsistence 900,000 569,583 3,620 120,292 167,926 306,007 -28,262

2

Mobility

Charges/Vehicle

Charges @ Rs 18 per

KM

3,000,000 1,970,928 15,516 468,522 556,500 626,885 303,505

3 Supplies & Materials 550,000 379,690 28,154 71,949 25,006 174,934 79,647

4 Chemicals 325,000 276,780

37,104 93,210 94,074 52,392

5 Communication 180,000 175,104 14,127 46,126 53,629 55,415 4,807

6 Utilities 150,000 177,283 25,821 46,590 52,587 41,927 10,358

7 Contingencies 400,000 385,910 67,320 118,093 65,531 98,711 36,255

Page 48: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

48

Sr # Description of account

Budget Re -

appropriated Budget

Mar-07 to June-07

July-07 to June-08

July-08 to June-09

July-09 to April-10

Unutilized Budget

PKR PKR PKR PKR PKR PKR PKR

3 Total

Training Cost 4,980,000 6,521,371 501,400 3,060,203 1,774,662 926,428 258,678

1 Training

Workshops/Meeting 850,000 2,810,000 0 1,552,229 1,108,420 95,787 53,564

2 Inland study Tours 250,000 250,000 0 100,177 135,316 0 14,507

3

Training of Facilitator

For Master Farmer

(F-TOF)

1,000,000 1,026,482 501,400 524,951 0 0 131

4

Training of Facilitators

for Field Assistants

(FA-TOF)

590,000 415,889 0 413,037 0 0 2,852

5 Farmer Field School

(FFS) activities 2,290,000 2,019,000 0 469,809 530,926 830,641 187,624

4 Total

Capital Items 340,000 248,200 248,200 0 0 0 0

1 Computer With all

accessories 90,000 89,000 89,000 0 0 0 0

2 Microscope 120,000 99,800 99,800 0 0 0 0

3 Steel Cages 30,000 14,400 14,400 0 0 0 0

4 Steel Racks 100,000 45,000 45,000 0 0 0 0

Institutional charges 10% 1,703,900 1,703,900 142,528 537,748 461,793 394,438 167,393

Grand Total 18,742,900 18,742,900 1,567,804 5,915,230 5,079,725 4,338,819 1,841,322

Page 49: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

49

Annexure 1; ToF / FFS schedule for CAD Small Dam Project Day Activity

Monday ToF Session with Master Trainer at Office of CABI SA

Tuesday Farmer Field Schools Sessions at each small dam

Wednesday Farmer Field Schools sessions at each small dam

Thursday Farmer Field Schools sessions at each small dam

Friday Feed Back session at Regional Office CABI SA

Annexure 2; TOF Participants

S # Name of Participants Rank Nature of TOF

Area

1 Muhammad Irfan

Agriculture

Officer

FA-TOF

Jammergal Dam (Jhelum)

2 Muhammad Zahid Kiani Dungi Dam (Rawalpindi)

3 Hafiz Muhammad Baksh Dhoke Tahlian (Chakwal)

4 Rai Muhammad Irshad Qibla Bandi (Attock)

5 Muhammad Sajjad Research

Officer Head Office (Islamabad)

6 Shakeel Asghar

Field Assistant

Dhoke Tahlian

7 Shaigan Waqas Jammergal

8 Ashraf Mehmood Qibla Bandi

9 Tamoor Zafar Dungi

10 Aftab Anwar Dhoke Tahlian

11 Irfan Haider Jammergal

12 Muhammad Ibrahim Qibla Bandi

13 Muhammad Iqbal Dungi

14 Khizar Usmani Dungi

15 Muhammad Afzal Qibla Bandi

16 Saifullah Jammergal

17 Muhammad Faisal Qibla Bandi

18 Khan Afsar

Farmer Qibla Bandi (Attock) 19 Abdil Waheed

20 Ashfaq Ahmad

Page 50: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

50

21 Muhammad Altaf

Farmer F-TOF

Qibla Bandi (Attock) 22 Khalid Mehmood

23 Tariq Mehmood

24 Raja Nasir Mehmood

Jammergal (Jehlum)

25 Muhammad Akram

26 Imtiaz Ali

27 Haji Rehmat

28 Ishtiaq Ahmad

29 Mirza Mukhtiar Ahmad

Dungi (Rawalpindi) 30 Ch. Shabaz

31 Muhammad Nazir

32 Haji Jehangir

33 Mirza Khan

Dhoke Tahlian (Chakwal)

34 Jehangir Ahmad

35 Muhammad Aatif Malik

36 Ameer Sultan

37 Hamid Ashraf

Annexure 3; Command areas under Small Dams S # Name of Dam Command Area/Villages Responsibility

1 Qibla Bandi Dam (Attock) Qibla Bandi, Barazai, Kotkay

and Malik Mala

Mr. Rai Muhammad Irshad

(Agri. Officer)

2 Dungi Dam (Rawalpindi) Dungi, Duhray and Duhama Mr. Muhammad Zahid Kiani

(AO)

3 Dhoke Tahlian Dam (Chakwal) Dhor Tahlian, Jhatla and Kalan

Wali

Mr. Hafiz Muhammad Baksh

(AO)

4 Jammergal Dam (Jehlum)

Vara Gujran, Jammergal,

Dhoke Jumma and Chapri

Rajgan

Mr. Muhammad Irfan (AO)

Page 51: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

51

Annexure 4; Farmer Field School, Dungi Dam, Gujar Khan

S. No

Name Village Acerage (kanals)

Area under cash crop

Owner / tenant

crops and vegetables grown

1 Muhammad Jahangir S/o

Muhammad Sharif Duray 22 12 Owner

Maize,

Wheat,

Summer &

winter

vegetables

2 M. Qasir S/o Abdul Rehman Duray 27 10 Owner

3 Haji Abdul Qudoos S/o

Hakeem Duray 20 20 Owner

4 M. Shahbaz S/o Abdul Sultan Dungi 30 20 Owner

5 M. Rasheed S/o Abdul

Rehman Dungi 40 30 Owner

6 Mamga Khans S/o Mehboob

Alam Dungi 70 8 Owner

7 M. Latief S/o M. Saddique Dungi 10 30 Owner

8 Nizakat Hussain S/o M.

saddique Dungi 40 8 Contractor

9 Fiyaz Ahmad S/o M. Yousif Dungi 15 30 Tenant Wheat,

Summer &

winter

vegetables

10 Mazhir Hussain S/o Barkat

Hussain Dungi 25 10 Owner

11 Mirza M.Mukhtar Ahmed S/o

farzand Ali Dungi 40 20

Owner/Co

ntractor

12 M. safir s/o Bagh Ali Duhamma 15 5 Owner

Wheat,

Summer &

winter

vegetables

13 M. shahzad S/o Adalat

Hussain Duhamma 15 5 Owner

14 M.Akbar S/o Mukar rab Khan Duhamma 10 10 Tenant

15 M. Banaras S/o F. Hussain Dungi 20 18 Owner

16 M. Iqbal S/ o Anwar Hussain Dungi 5 5 Tenant

17 Abdul Ghaffor S/ o Alam Din Dungi 20 20 Owner

18 Ch. Razaaaq S/ o Faiz Alam Dungi 10 10 Owner

19 M. S. Aalam S/ o M. Alam Dungi 5 5 Owner

20 Refaqat Hussain S/o Dungi 5 5 Owner

Page 52: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

52

SowarHussain

21 Shabbir Hussain S/o Fazal

Hussain Duhamma 6 6 Owner

22 Ghulam yaheeya S/o

Munsibdar Duhamma 18 15 Owner

23 M.Fazal S/o Qurban Duhamma 5 5 Owner

24 Safdar Hussain S/o M. Alam Dungi 12 10 Owner

25 Shukat Hussain S/o M.

Saddique Dungi 25 14 owner

Page 53: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

53

Annexure 5; Farmer Field School Varagujran, Jamergl Dam, Jehlum

S. No

Name Village Acerage (kanals)

Area under cash crop

Owner/ Tenant

Number of crop and vegetable grown

1 Fazal Ahmed S/o

Ahmed Khan V. Gujran 40 40 Owner

Maize, Wheat, Summer

& winter vegetables

2 Nasir Hussain S/o

Noor Ahmed V. Gujran 64 64 Owner

Maize, Wheat, Summer

& winter vegetables

3 Rehmat Khan S/o

Hakim Khan V. Gujran 64 64 Owner

Maize, Wheat, Summer

& winter vegetables

4 Ghulam Hussain

S/o Makkhan Khan V. Gujran 48 40 Owner

Maize, Wheat, Summer

& winter vegetables

5 Arshad Mehmood

S/o Hakim Ali V. Gujran 64 64 Owner

Maize, Wheat, Summer

& winter vegetables

6 Muhammad Ikram

S/o M. Akram V. Gujran 64 64 Owner

Maize, Wheat, Summer

& winter vegetables

7 Rehmat Khan S/o

Ghulam Hussain V. Gujran 96 88 Owner

Maize, Wheat, Summer

& winter vegetables

8 Muhammad Iqbal

S/o Sahib Din V. Gujran 40 40 Owner

Maize, Wheat, Summer

& winter vegetables

9 Qasim Abbas S/o

Bhader Khan V. Gujran 80 72 Owner

Wheat, Summer & winter

vegetables

10 Bagh Ali S/o Lal

Khan V. Gujran 40 40 Owner

Wheat, Summer & winter

vegetables

11 Shahid Mehmood

S/o Rehamat Khan V. Gujran 40 40 Owner

Wheat, Summer & winter

vegetables

12 Muhammad Siddiq

S/o Allah Din V. Gujran 48 48 Owner

Wheat, Summer & winter

vegetables

13

Ansar Mehmood

S/o

Rehmat Khan

V. Gujran 40 32 Owner Wheat, Summer & winter

vegetables

14 Nazar Muhammad V. Gujran 40 40 Owner Maize, Wheat,

Page 54: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

54

S/o Fazal Ahmed

15 Ehsan Elahi S/o

Nawab Khan V. Gujran 40 40 Owner Maize, Wheat,

16 Rehmat Khan S/o

Muhammad Iqbal V. Gujran 40 40 Owner

Maize, Wheat, Summer

& winter vegetables

17 Muhammad Sabir

S/o Karam Ali V. Gujran 40 24 Owner

Maize, Wheat, Summer

& winter vegetables

18 Mangta Khan S/o

Bhader Khan V. Gujran 24 24 Owner Maize, Wheat,

19 Muhammad Akram

S/o Tajay Khan V. Gujran 120 104 Owner

Wheat, Summer & winter

vegetables

20 Ghulam Rasool S/o

Bhader Khan V. Gujran 80 80 Owner

Wheat, Summer & winter

vegetables

21 Ghulam Rasool S/o

Muhammad Ramzan V. Gujran 24 24 Owner

Wheat, Summer & winter

vegetables

22 Muhammad Zaman

S/o Khwaj Din V. Gujran 24 24 Owner

Summer & winter

vegetables

23 Muhammad Yaqoob

S/o Ahmed Khan V. Gujran 40 36 Owner

Wheat, Summer & winter

vegetables

24 Rehmat Khan S/o

Muhammad Alim V. Gujran 80 68 Owner

Summer & winter

vegetables

25 Ghulam Hussain

S/o Khushi Muhd. V. Gujran 40 40 Owner Maize, Wheat Fodder

26 Mazhar Iqbal S/o

Muhammad Bashir V. Gujran 40 40 Owner Maize, Wheat, Fodder

Page 55: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

55

Annexure 6; Farmer Field School Jammergal, Jammergal Dam Jehlum

S.

No Name Village

Acreage

(kanals)

Area under

cash crop/

vegetable

Owner/

Tenant

Number of crop and

vegetable grown

1 Muhammad Rafiq

S/o Baag Ali Jammergal 32 24 Owner

Wheat, Fodder

Summer & winter

vegetables

2 Kushi S/o Faqir

Muhammad Jammergal 16 16 Owner

Summer & winter

vegetables

3 Sub.Maj. S/o M.

Azam Jammergal 24 24 Owner

Maize, Wheat,

Summer & winter

vegetables

4 Muhammad Walayat

S/o Feroz Khan Jammergal 16 16

Owner,

Tenant

Wheat, Fodder, Millet

Mung, Mash

5 Muhammad Sharif

S/o Raaj Wali Jammergal 16 16 Owner

Wheat, Fodder, Millet

Mung, Mash

6 Mazhar Hussain S/o

Ghulam Rasool Jammergal 24 24 Owner

Summer & winter

vegetables

7 Sultan Ahmed S/o

Allah Ditta Jammergal 32 24 Owner

Wheat, Fodder, Millet

Mung, Mash

8 Hafiz Tahir S/o

Muhammad Ramzan Jammergal 32 32 Owner

Wheat, Fodder, Millet

Mung, Mash

9 Muhammad Akram

S/o Mehdi Khan Jammergal 24 24 Owner

Wheat, Fodder, Millet

Mung, Mash

10 Muhammad Iqbal S/o

Allah Ditta Jammergal 16 16 Owner

Summer & winter

vegetables

11 Farraq Hussain S/o

Makhan Khan Jammergal 24 24 Owner

Wheat, Fodder, Millet

Mung, Mash

12 Muhammad Rafiq

S/o Godar Khan Jammergal 64 64 Owner

Wheat, Fodder, Millet

Mung, Mash

13 Sub. Sheer Afzal S/o

Afzal Khan Jammergal 32 32 Owner

Wheat, Fodder, Millet

Mung, Mash

Page 56: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

56

14 Abdul Rehman S/o

Nazim Ali Jammergal 40 32 Owner

Wheat, Fodder, Millet

Mung, Mash

15 Khadim Hussain S/o

Fazal Ahmed Jammergal 24 24 Owner

Wheat, Fodder, Millet

Mung, Mash

16 RASIB S/o Ghulam

Rasool Jammergal 16 16

Owner,

Tenant

Wheat, Fodder, Millet

Mung, Mash

17 Abdul Latif S/o

Ghulam Hassan Jammergal 16 16 Owner

Summer & winter

vegetables

18 Abdul Ghaffar S/o

Allah Ditta Jammergal 112 112 Owner

Wheat, Fodder, Millet

Mung, Mash

19 Munawar Hussain

S/o Feroz Khan Jammergal 240 240 Owner

Wheat, Fodder, Millet

Mung, Mash

20 Muhammad Yaqoob

S/o Jevan Khan Jammergal 16 16 Owner

Wheat, Fodder, Millet

Mung, Mash

21 Arshad S/o Fazal

Karim Jammergal 48 48 Owner

Wheat, Fodder, Millet

Mung, Mash

22 Haji Rehmet S/o

Ghulam Ali Jammergal 64 64 Owner

Wheat, Fodder, Millet

Mung, Mash

23 Imtiaz S/o Ghulam

Muhammad Jammergal 48 48 Owner

Wheat, Fodder, Millet

Mung, Mash

24 Abid S/o Rehmet

Khan Jammergal 56 48 Owner

Wheat, Fodder, Millet

Mung, Mash

Page 57: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

57

Annexure 7; Farmer Field School Dhoke Jumma, Jammergal Dam, Jehlum

S. No Name Village Acerage (kanals)

Area under cash crop/ vegetable

Owner/ Tenant

Number of crop and vegetable grown

1

Nasir Mehmood

S/o Ghulam

Mustafa

Dhoke

Jumma 24 24 Owner

Maize, Wheat, Summer

& winter vegetables

2 Rehmet S/o

Karim Buskh

Dhoke

Jumma 96 88 Owner Wheat, Fodder

3 Zahoor Ahmed S/o

Abdul Ghafoor

Dhoke

Jumma 64 64 Owner

Maize, Wheat, Summer

& winter vegetables

4 Muhammad Rasib

S/o Rajib Ali

Dhoke

Jumma 24 24 Owner Wheat, Fodder

5

Mehmood Hussain

S/o

Muzafar Khan

Dhoke

Jumma 40 40 Owner Wheat, Fodder

6 Allah Dad S/o

Nawab Khan

Dhoke

Jumma 32 32 Owner Wheat, Fodder

7 Imtiaz S/o

Niaz Ali

Dhoke

Jumma 40 40 Owner

Maize, Wheat, Summer

& winter vegetables

8

Ghulam Sarwar

S/o

Nawab Khan

Dhoke

Jumma 400 368 Owner

Maize ,Wheat, Summer

& winter vegetables

9

Muhammad

Nawaz S/o

Ameer Alam

Dhoke

Jumma 40 40 Owner

Maize, Wheat, Summer

& winter vegetables

10 Safdar S/o

Abdul Karim

Dhoke

Jumma 24 24 Owner Wheat, Fodder

11 Karam Ali S/o

Pehalwan Khan

Dhoke

Jumma 480 464 Owner Wheat, Fodder

Page 58: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

58

12 Raja Ilyas S/o

Bawar Khan

Dhoke

Jumma 280 280 Owner

Maize, Wheat, Summer

& winter vegetables

13

Imran Khan S/o

Muhammad

Safdar

Dhoke

Jumma 8 8 Owner

Wheat, Fodder, Millet

Mung and Mash

14 Zarayat S/o

Allah Dad

Dhoke

Jumma 16 16 Owner

Wheat, Fodder, Millet

Mung &Mash

15 Ghulam Nabi S/o

Muhammad Alam

Dhoke

Jumma 32 32 Owner

Maize, Wheat, Summer

& winter vegetables

16 Usman Ghani S/o

Rehmat Hussain

Dhoke

Jumma 40 40 Owner

Maize, Wheat, Summer

& winter vegetables

17 Javed Akhtar S/o

Ghulam Rasool

Dhoke

Jumma 24 24 Owner

Wheat, Fodder, Millet

Mung, Mash

18

Muhammad Akram

S/o

Adalat Khan

Dhoke Shadi 32 32 Owner Wheat, Fodder, Millet

Mung,Mash

19

Tariq Mehmood

S/o

Rehmet Khan

Dhoke Shadi 24 24 Owner Wheat, Fodder, Millet

Mung, Mash

20 Iftikhar Ahmed S/o

Arif Dhoke Shadi 16 16 Owner

Wheat, Fodder, Millet

Mung &Mash

21

Muhammad Arif

S/o

Rehmat Khan

Dhoke Shadi 24 24 Owner Wheat, Fodder, Millet

Mung &Mash

22

Tariq Mehmood

S/o

Rehmat Khan

Dhoke Shadi 40 40 Owner Wheat, Fodder, Millet

Mung &Mash

23

Choudary Khan

S/o

Imam Din

Dhoke Shadi 40 40 Owner Maize, Wheat, Summer

& winter vegetables

24 Iftikhar Ahemd S/o

Muhammad Ashraf Dhoke Shadi 16 16 Owner

Wheat, Fodder, Millet

Mung &Mash

25 Muhammad Arif Dhoke Shadi 24 24 Owner Wheat, Fodder, Millet

Page 59: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

59

S/o

Rehmet Khan

Mung,Mash

26

Nusrat Mehmood

S/o

Rehmet Khan

VaraGujran 64 64 Owner Maize, Wheat, Summer

& winter vegetables

27

Muhammad Rafiq

S/o

Feroz Khan

VaraGujran 16 16 Owner Wheat, Fodder, Millet

Mung &Mash

28 Malik Basheer S/o

Malik Nazir DhokeJumma 24 20 Owner

Wheat, Fodder, Millet

Mung &Mash

29 Rasheed S/o

Mehmoob Alam Vara Gujran 64 64 Owner

Maize, Wheat ,Summer

& winter vegetables

30 Tariq S/o

Neik Alam Vara Gujran 32 32 Owner

Maize, Wheat, Summer

& winter vegetables

31 Arshad S/o

Ghulam Rasool Vara Gujran 160 152 Owner

Maize Wheat, Summer

& winter vegetables

Page 60: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

60

Annexure 8; Farmer Field School Qibla Bandi, Qibla Bandi Dam, Attock

S. No

Name Village Acerage (kanals)

Area under cash crop

Owner/ Tenant Number of crop and vegetable grown

1

Muhammad

Ismael S/o

Mehtab Din

Qibla

Bandi 08 08 Owner

Summer & winter

vegetables

2

Muhammad

Ishfaq S/o M.

Ashraf

Qibla

Bandi 10 10 Owner

3

Muhammad

Refan S/o Umar

Khan

Qibla

Bandi 12 11 Owner

4 Sher Rehman S/o

Noor Muhammad

Qibla

Bandi 28 28 Owner

5

Muhammad

Saleem S/o Mian

Dad

Qibla

Bandi 16 16 Owner

6

Muhammad

Sheraz S/o Abdul

Ghafoor

Qibla

Bandi 08 08 Owner

7 Safdar Khan S/o

Abdul jabbar

Qibla

Bandi 16 16 Owner

8

Muhammad

Farman S/o Gul

Zaman

Qibla

Bandi 48 42 Owner

9 Muhammad Nisar

S/o Gulzar

Qibla

Bandi 20 20 Owner

10 Shaukat Ali S/o

Mian Dad

Qibla

Bandi 10 10 Owner

11 Hukam Khan S/o Qibla 10 10 Owner Wheat, Fodder,

Page 61: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

61

Karam Dad Bandi Millet & Mash

12 Khalid Mehmood

S/o Abdul Malik

Qibla

Bandi 5 5 Owner/contractor

13

Muhammad

Anwar S/o Ahmad

Khan

Qibla

Bandi 80 76 Owner +cont.

14 Master Ghaus S/o

Fazal Elahi

Qibla

Bandi 12 12 Owner + Cont

15 Mushtaq Ahmed

S/o M. Asraf

Qibla

Bandi 16 16 Owner

Wheat, Fodder,

Maize, Mung &

Mash

16 Abdul Wahid S/o

Banaras Khan

Qibla

Bandi 50 50 contractor

17 Sadaqat Khan

S/o Makhan Khan

Qibla

Bandi 08 08 Owner

18 Safer Ahmed S/o

Sher Afsar

Qibla

Bandi 52 50 contractor

19

Sher Afsar S/o

Muhammad

Sadiq

Qibla

Bandi 20 20 Owner

20 Rafaqat S/o

Sheikh Farid

Qibla

Bandi 18 15 Owner

21

Muhammad

Maskeen S/o

Main Dad

Qibla

Bandi 16 16 Owner

22 M. Anwar S/o

Ahmad Khan

Qibla

Bandi 16 16 Owner

23 Azmat Khan S/o

Muzaffar Khan

Qibla

Bandi 24 24 Owner

24 Abdul Rasheed

S/o Abdul Aziz

Qibla

Bandi 20 18 Owner + cont.

25 Ayub Khan S/o

Muhammad Azad QiblaBandi 12 12 Owner + Cont

Page 62: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

62

Annexure 9; Farmer Field School Barazai, Qibla Bandi Dam, Attock

S. No

Name Village Acerage (kanals)

Area under cash crop

Owner/ Tenant

Number of crop and vegetable grown

1 Muhammad Arshad

S/o Dilwar Khan Brazai 125 120 Owner

Summer & winter

vegetables

2 M. Sultan S/o

Muhammad Anwar Brazai 30 30 Owner

Summer & winter

vegetables

3 M. Refan S/o

Muhammad Zaman Brazai 10 10 Owner

Maize, Wheat, Summer

& winter vegetables

4 Muhammad Amin S/o

Muhammad Daud Brazai 12 12 Owner

Wheat, Fodder, Millet

& Mash

5 Muhammad Naeem

S/o Abdul Qadir Brazai 24 24 Owner

Wheat, Fodder &

vegetables

6 Muhammad Saleem

S/o Ghulam Mahmood Brazai 16 16 Owner

Summer & winter

vegetables & wheat

7 Mumraiz S/o Fazal

Dad Brazai 30 30 Owner

Wheat, Fodder, Maize

& vegetables

8 Muhammad Taj S/o

Abaid Ullah Brazai 48 42 Owner

Wheat, Fodder, Millet

Mung & Mash

9 Javed S/o Haji

Muhammad Khan Brazai 25 25 Owner Wheat, Fodder & Millet

10 Banaras Khan

S/o Waris Khan Brazai 40 40 Owner

Summer & winter

vegetables

11 Tariq Mehmood S/o

Muhammad Shafi Brazai 24 24 Owner

Summer & winter

vegetables & wheat

12 Abdul Rauf S/o Karim

Dad Brazai 10 10 Owner

Wheat, Fodder & Millet 13

Haji Tariq Khan S/o

Haji Abdul Aziz Brazai 80 80 Owner

14 Aslam Khan S/o Fazal Brazai 20 20 Owner

Page 63: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

63

Dad

15 Muhammad Nawaz

S/o Abdul Khaliq Brazai 16 16 Owner

Wheat, Fodder, Millet &

Mung.

16 Ayub Khan S/o

Dilawar Khan Brazai 20 16 Owner

Wheat, Fodder, Maize

Mung & Mash

17 Muhammad Yamin

S/o Abdul Rahim Brazai 25 25 Owner

Maize, Summer &

winter vegetables

18 Muhammad Irshad

S/o Sohbat Khan Brazai 20 20 Owner Wheat & Fodder

19 M. Rafaqat S/o Fazal-

e-wodood Brazai 12 12 Owner

Wheat, Fodder, Maize

& Mash

20 M. Altaf S/o Abdul

Rauf Brazai 24 24 Owner

Wheat, vegetables &

Rice 21

Sajawal S/o Sami

Ullah Brazai 16 16 Owner

22 Ahsan S/o Sikandar Brazai 30 28 Owner Wheat, Fodder& Millet

23 Shabbir S/o M. Ashraf Brazai 30 30 Owner Wheat, summer &

winter vegetables

24 M. Daud S/o Bahadur Brazai 20 18 Owner Wheat, Millet, Maize,

Mung & Mash

25 M. Ashraf S/o

Shamroze Khan Brazai 12 12 Owner Wheat, Fodder & Maize

Page 64: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

64

Annexure 10; Farmer Field School Malik Mala, Qibla Bandi Dam, Attock

S. No

Name Village Acerage (kanals)

Area under cash crop

Owner/ Tenant

Number of crop and vegetable grown

1 Azmat Khan S/o

Muhammad Nawaz Malik Mala 52 52 Owner

Wheat, Fodder

Summer & winter

vegetables

2 Haider Zaman S/o

Muhammad Sultan Malik Mala 40 40 Owner

Summer & winter

vegetables& wheat

3

Muhammad Zahir

S/o Muhammad

Taha

Malik Mala 10 10 Owner Maize, Wheat, Summer

& winter vegetables

4

Tariq Mehmood

Khan S/o Gohar

Rehman Khan

Malik Mala 54 54 Owner Wheat, Fodder &

Sugar-cane

5 Mushtaq Khan S/o

Fazal Khan Malik Mala 24 24 Owner

Wheat, Fodder, Millet &

Maize

6 Banaras Khan S/o

Dilawar Khan Malik Mala 16 16 Owner

Summer & winter

vegetables

7 Sarder Khan S/o

Ghafoor Khan Kotkay 16 16 Owner

Wheat, Fodder, Millet,

Mash & Maize

8 Haji Yamin s/o Abdul

Ghafoor Kotkay 24 24

Owner

+ Cont

Wheat, Fodder, Millet

Mung & Mash

9 Qasir Khan S/o

Mehdi Zaman Malik Mala 20 20 Owner Wheat, Fodder &Millet

10 Muhammad Shakil

S/o Abdul Wakil Malik Mala 10 10 Owner

Summer & winter

vegetables

11 Farid Khan S/o

Hashim Khan Malik Mala 14 13 Owner

Wheat, Fodder, Millet

& Mash

12 Ansar S/o Imam G. Malik Mala 08 08 Owner Wheat, Fodder & Millet

13 Muhammad Arif S/o Kotkay 48 40 Owner Wheat, Fodder,

Page 65: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

65

Murrsaleen Summer & winter

vegetables

14 Qaiser Mehmood

S/o Yamin Khan Kotkay 12 12

Owner

+ Cont

Wheat, Fodder, Mung

& Mash

15

Khuram Shahzad

S/o Muhammad

Safdar

Kotkay 16 16 Owner Wheat, Fodder, Millet &

Mung.

16 Safdar Khan S/o

Dilawar Khan Kotkay 20 16 Owner

Wheat, Fodder &

vegetables

17 Akram Khan S/o

Ayub Khan Kotkay 25 25 Owner

Maize, Summer &

winter vegetables

18

Adrees

S/oMuhammad

Ishaq

Kotkay 20 20 Owner Wheat, Fodder, Maize,

Mung & Mash

19 Safder Khan S/o

Dilawar Khan Kotkay 12 12 Owner

Wheat, Fodder, Maize

& Mash

20 Sheraz s/o Maskeen Kotkay 18 15 Contrac

tor

Summer & winter

vegetables

21 Banaras Khan S/o

Muhammad Younis Kotkay 16 16 Owner

Wheat, Fodder, Millet

& Maize

22

Dil Nawaz S/o

Muhammad

Maskeen

Kotkay 40 40 Contrac

tor

Summer & winter

vegetables

23 Muhammad Amjad

S/o Fazal Dad Kotkay 16 16 Owner

Wheat, Millet, Maize,

Mung & Mash

24 Aman Khan S/o Sher

ur Rehman Kotkay 20 18 Owner

Wheat, Millet, Maize,

Mung & Mash

25 Bazid Khan S/o Mir

Dad Kotkay 12 12

Owner

+ Cont

Wheat, Fodder &

Maize,

Page 66: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

66

Annexure 11; Farmer Field School Dhoke Tahlian, Dhoke Tahlian Dam, Chakwal

S. No

Name Village Acerage (kanals)

Area under cash crop

Owner/ Tenant

Number of crop and vegetable grown

1 Mirza Khan S/o Arab

Husain

Dhoke

Tahlian 130 70 Owner

Maize, Wheat, Summer

& Winter Vegetables.

2 Raja Gulbarg S/o

Ghazanfer Ali

Dhoke

Tahlian 200 110 Owner Maize, Wheat & Fodder

3 Ch. Fazal Husain

S/o Ghulam Husain

Dhoke

Tahlian 20 20 Owner

Wheat, Summer &

Winter Vegetables.

4 Anser Mehmood S/o

M. Yusaf

Dhoke

Tahlian 75 60

Owner+

Cont

Maize, Wheat, Summer

& Winter Vegetables

5 Tsawer Iqbal S/o

Sohnda Khan

Dhoke

Tahlian 20 20

Owner+

Cont

Maize, Wheat, Summer

& Winter Vegetables

6 Jahangir S/o Fazal

Dad

Dhoke

Tahlian 50 45

Owner+

Cont

Maize, Wheat, Summer

& Winter Vegetables

7 Habib Bakhsh S/o

Allah Bakhsh

Dhoke

Tahlian 75 70 Owner

Fodder, Maize, Wheat,

Summer &, Winter

Vegetables.

8 Nazim Afzal S/o

Bahadar Khan

Dhoke

Tahlian 25 25 Owner

Wheat, Fodder,

Summer & Winter

Vegetables.

9 Sbd. M. Ashraf S/o

Abdullah Khan

Dhoke

Tahlian 12 12 Owner

Wheat, Fodder,

Summer & Winter

Vegetables.

10 Raja M. Asghar S/o

Adalat Khan

Dhoke

Tahlian 80 80 Owner

Wheat, Fodder,

Summer & Winter

Vegetables.

11 Iftikhar Ahmad S/o

Gulab Din

Dhoke

Tahlian 24 20 Owner

Wheat, Fodder,

Summer & Winter

Vegetables.

Page 67: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

67

12 M. Doraiz S/o

Nawab Ali

Dhoke

Tahlian 25 20 Owner

Wheat, Fodder,

Summer & Winter

Vegetables.

13 Muhammad Arif S/o

Murrsaleen Kotkay 48 40 Owner

Wheat, Fodder,

Summer & winter

vegetables

14 Qaiser Mehmood

S/o Yamin Khan Kotkay 12 12

Owner

+ Cont

Wheat, Fodder, Mung

& Mash

15

Khuram Shahzad

S/o Muhammad

Safdar

Kotkay 16 16 Owner Wheat, Fodder, Millet &

Mung.

16 Safdar Khan S/o

Dilawar Khan Kotkay 20 16 Owner

Wheat, Fodder &

vegetables

17 Akram Khan S/o

Ayub Khan Kotkay 25 25 Owner

Maize, Summer &

winter vegetables

18 Adrees S/o

Muhammad Ishaq Kotkay 20 20 Owner

Wheat, Fodder, Maize,

Mung & Mash

19 Safder Khan S/o

Dilawar Khan Kotkay 12 12 Owner

Wheat, Fodder, Maize

& Mash

20 Sheraz s/o Maskeen Kotkay 18 15 Contrac

tor

Summer & winter

vegetables

21 Banaras Khan S/o

Muhammad Younis Kotkay 16 16 Owner

Wheat, Fodder, Millet

& Maize

22

Dil Nawaz S/o

Muhammad

Maskeen

Kotkay 40 40 Contrac

tor

Summer & winter

vegetables

23 Muhammad Amjad

S/o Fazal Dad Kotkay 16 16 Owner

Wheat, Millet, Maize,

Mung & Mash

24 Aman Khan S/o Sher

ur Rehman Kotkay 20 18 Owner

Wheat, Millet, Maize,

Mung & Mash

Page 68: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

68

Annexure 12; Farmer Field School Kalan Wali, Dhoke Tahlian Dam, Chakwal

S. No Name Village Acerage (kanals)

Area under cash crop

Owner/ Tenant

Number of crop and vegetable grown

1 Imtiaz Husain

S/o Khuda Dad Kalan Wali 12 12 Owner

Wheat, Fodder Summer

& winter vegetables

2 Mehboob Saqlain

S/o Sohnda Khan Kalan Wali 44 40 Owner

Wheat, Summer &

winter vegetables

3 Arab Husain S/o

Pasand Khan Kalan Wali 13 13 Owner

Wheat, Summer &

winter vegetables

4 Mazhar Husain S/o

Ghulam Husain Kalan Wali 05 05 Owner

Wheat, Fodder, Millet &

Mash

5

Muhammad Ashraf

S/o Ghulam

Muhamad

Kalan Wali 24 24 Owner Wheat, Fodder & Maize

6 Haji M. Azad S/o

Jahan Khan Kalan Wali 12 12 Owner

Summer & winter

vegetables.

7 Haji M. Jawaid S/o

Ashiq Husain Kalan Wali 06 06 Owner

Summer & winter

vegetables.

8 Abid Husain S/o

Muhammad Anayt Kalan Wali 20 16 Owner Wheat, Fodder & Millet

9

Maqbool Husain

S/o Ghulam

Muhamad

Kalan Wali 05 05 Owner Wheat, Fodder & Millet

10 Waseem Ilyas S/o

Sohnda Khan Kalan Wali 20 20 Owner

Maize, Summer & winter

vegetables

11 Imran Asif S/o

Munshi Khan Kalan Wali 07 07 Owner

Wheat, Fodder, Millet &

Maize

12

Muhamad Asghar

S/o Muhammad

Afsar

Kalan Wali 26 24 Owner Wheat, Fodder, Millet

&Maize

Page 69: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

69

13 Haji Gulistan S/o

Hazer Muhammad Kalan Wali 45 40 Owner

Wheat, Fodder, Maize,

Summer & winter

vegetables

14

Muhammad Aslam

S/o Hazer

Muhammad

Kalan Wali 11 11 Owner Summer & winter

vegetables

15 Ghulam Abbas S/o

Shahra Khan Kalan Wali 10 10 Owner

Summer & winter

vegetables

16 Zahoor Ahmad S/o

Noor Khan Kalan Wali 30 25 Owner Wheat, Fodder & Maize

17 Samar Iqbal S/o

Pahnda Khan

Kalan Wali 10 10 Owner

Maize, Summer & winter

vegetables

18 Muhammad Afsar

S/o Shian Khan Kalan Wali 06 06 Owner

Wheat, Fodder, Maize

& Mash

19 Imdad Husain S/o

Khuda Dad

Kalan Wali 09 09 Owner

Wheat, Fodder, Maize &

Mung

20 Muhammad Zarayt

S/o Khuda Dad Kalan Wali 04 04 Owner

Summer & winter

vegetables

21

Mushtaq Husain

S/o Muhammad

Nawaz

Kalan Wali 05 05 Owner Summer & winter

vegetables

22

Musarrat Abbas

S/o Muhammad

Nawaz

Kalan Wali 16 16 Owner Summer & winter

vegetables

23

Mulazim Husain

S/o Muhammad

Sadiq

Kalan Wali 02 02 Owner Summer & winter

vegetables

24 Mirza M. Aslam S/o

Dhuman Khan Kalan Wali 04 04 Owner

Summer & winter

vegetables

25 Adeel Akhtar S/o

Muhammad Afsar Kalan Wali 05 05 Owner

Summer & winter

vegetables

Page 70: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

70

Annexure 13; Farmer Field School Jhattla, Dhoke Tahlian Dam, Chakwal

S. No

Name Village Acerage (kanals)

Area under cash crop

Owner/ Tenant

Number of crop and vegetable grown

1 Fazal Muhammad

S/o Sultan Khan Jhattla 32 26 Owner

Wheat, Fodder Summer &

winter vegetables

2 M. Anayt S/o

Sultan Khan Jhattla 16 16 Owner

Summer & winter

vegetables

3 Muhammad Aslam

S/o Sattar Ali Jhattla 10 10 Owner

Maize, Wheat, Summer &

winter vegetables

4 Muhammad Abbas

S/o Fazal Elahi

Dhoke

Dadu 30 28 Owner

Wheat, Fodder, Millet &

Mash

5 Abid Husain S/o

Muhammad Ashraf

Dhoke

Dadu 24 24 Owner

Wheat, Fodder, Millet &

Maize

6 Hasan Akhtar S/o

Dost Muhammad

Jhattla 16 16 Owner

Summer & winter

vegetables

7 Muhammad Nawaz

S/o Ata Muhammad

Jhattla 16 16 Owner

Wheat, Fodder, Millet,

Mash & Maize

8 Toraiz S/o Karam

Elahi

Jhattla 48 42

Owner

+ Cont

Wheat, Fodder, Millet

Mung & Mash

9 Haroon Rasheed S/o

Mawaz Khan

Jhattla 25 25 Owner Wheat, Fodder & Millet

10 Khuda Dad S/o

Hazer Muhamad

Jhattla 10 10 Owner

Summer & winter

vegetables

11 Muhammad Ashraf

S/o Maula Bakhsh

Jhattla 14 13 Owner

Wheat, Fodder, Millet &

Mash

12 Haji Afsar Khan S/o

Lal Khan

Jhattla 4.5 4.5 Owner Wheat, Fodder & Millet

13 Tanweer Ahmad S/o

Muhamad Afsar

Jhattla 48 40 Owner

Wheat, Fodder, Summer

& winter vegetables

14 Naveed Ahmad S/o

Ahmad Khan

Jhattla 56 50

Owner

+ Cont

Wheat, Fodder, Mung &

Mash

Page 71: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

71

15 Saleem Akhtar S/o

Nazar Muhamad

Jhattla 16 16 Owner

Wheat, Fodder, Millet &

Mung.

16 Malik M. Asghar S/o

Muhamad Bakhsh

Jhattla 20 16 Owner

Wheat, Fodder, Maize

Mung &Mash

17 Hamid Ashraf S/o M.

Ashraf

Jhattla 25 25 Owner

Maize, Summer & winter

vegetables

18

Capt. Hazer

S/o Muhamad

Bakhsh

Jhattla 20 20 Owner

Wheat, Fodder, Maize,

Mung & Mash

19 Muhamad Shehzad

S/o Haq Nawaz

Jhattla 12 12 Owner

Wheat, Fodder, Maize &

Mash

20

Malik Ashiq Husain

S/o Muhamad

Husain

Jhattla 18 15 Owner Wheat, Fodder & Maize,

21 Muhammad Aazad

S/o Hazer Muhamad

Jhattla 16 16 Owner

Wheat, Fodder, Millet &

Maize

22 Malik M. Aslam S/o

Chaudhry Khan

Dhoke

Dadu

100 84 Owner Wheat, Fodder, Millet,

Maize, Mung & Mash

23 Sakhi Muhammad

S/o Sultan Khan

Jhattla 16 16 Owner

Wheat, Millet, Maize,

Mung & Mash

24

Muhammad Ajayb

S/o Muhammad

Zaman

Jhattla 20 18 Owner

Wheat, Millet, Maize,

Mung &Mash

25 Qamar Abbas S/o

Feroz Khan Jhattla 12 12

Owner

+ Cont Wheat, Fodder &Maize,

Page 72: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

72

Annexure 14; Varietals comparison of Spring Maize

Annexure 15; Cost of production of high plastic tunnel Items or Inputs Tomato at (104 ft x 11ft x 30 ft)

Annual Expenditure of tunnel structure (if tunnel life consider as 15

years)

12,000

Plastic Sheet & ropes 17,000

Farm Yard & Green Manures 2400

Bed Preparation 600

Seeds 3000

Fertilizers 4000

Micro nutrients 700

Pesticides 1,200

Mini tunnel for nursery 3,000

Irrigation 700

Labor 17,000

Miscellaneous 4,000

Total 65,600

Sr No

Name of Dam

Area (acre)

Row to Row Distance

Plant to Plant Distance

Varieties of Spring Maize

Variety

Yield Mounds/ Acre

Yield Mounds/ Acre

Variety

Yield Mounds/ Acre

Yield Mounds/ Acre

1 Dungi ½ 21/2′ 8″ 6525 116

124.5

32w8

6 101

103

2 Jammer

gal ½ 21/2′ 8″ 6525 124

32w8

6 116

3 Qibla

Bandi ½ 21/2′ 8″ 6525 131

32w8

6 103

4 Dhoke

Tahlian ½ 21/2′ 8″ 6525 127

32w8

6 92

5 Total 498 412

Page 73: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

73

Annexure 16; Resource persons visited to TOF

No. Name, Designation & Organization

Topic Number of Visits

Remarks

1

Dr. Arif Mehmood,

Assistant Director (Tech),

DIU Rawalpindi

Tunnel technology &

production and

Installation &

Structure

1 Detail information about

tunnel shared

2

Dr. Kauser Niazi, Quality

Assurance Specialist,

CABI SA

Quality Assurance of

FFS 2

Protocol of quality assurance

discussed in detail regarding

FFS

3

Dr. Farooq Nasir Higher

Scientific Officer, CABI,

SA

Classification of

Insects, Morphology,

Preservation and life

cycle

3 Insect identification & and role

of natural enemies discussed.

4

Mr. Shakeel, Senior

Scientific Officer, CABI

SA

Composting 2

Discussion & knowledge

sharing on making of

compost.

5 Mr. Muhammad Zahir

Shah

Nursery

establishment and

transplantation

4 Practical work done

6

Mr. Abdul Rehman, Insect

Biological Control

Specialist, CABI SA

AESA and IPM 4 Practical work done

7 Dr. Khalid Farooq, Live

stock Specialist, CABI SA

Animal housing, feeds

& feeding, breeds &

breeding, day to day

disease management

and livestock

marketing

3 Experience shared and detail

discussion held

Page 74: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

74

Annexure 17; Success Story 1

Page 75: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

75

Annexure 18; Success Story 2

Page 76: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

76

Annexure 19; Success Story 3

Page 77: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

77

Page 78: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

78

Annexure 20; Success Story 4

Page 79: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

79

Page 80: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

80

Annexure 21; Success Story 5

Page 81: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

81

Annexure 22; Success Story 6

Page 82: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

82

Annexure 23; Success Story 7

Page 83: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

83

Annexure 24; Success Story 8

Page 84: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

84

Annexure 25; Insect collection kit Sr. No Items Quantity

2 Stretching Board 2

3 Aspirator 1

4 Killing Jar 1

5 Ethyl acetate 250ml

6 Forceps 2

7 Knife small 1

8 Small paint brush 1

9 Fine brushes ( No 2,4,6 local); Sable Hair Brush (1) 1

10 Plastic vials with sieve(large, Small) 20

11 Glass vials with alcohol 75 % 10

12 Hand lens small (10x) 1

13 Open tubes 20

14 Sieve 1

15 Insect pins(Small, Medium, Large) 100

16 Small plastic Jar 12

17 Note book 1

18 Rubber band 250 gms

19 Pencil 1 Pack

20 Rubber 1

21 Sharpener 1

23 Scissor small and fine 1

24 Collecting Net(Large, Small) 2

25 Capsules 1 Pack

26 Tissue role 1 Pack

27 Alcohol (95 %) 250ml

28 Disposable Plastic Gloves 1 Pack

29 Mask 1 Pack

30 Bottle 2

31 Petri Dish Plastic (Small, Large, with mesh) 10

Page 85: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

85

Annexure 26; Farmers Field Schools visited for back stopping during 2008-09 No. of FFS Visited

FFS Visited Target Achieved

80 74

Chakri, Dhoke Juma, Imtiaz Ali (Dhoke Juma, Ikram (Wala Gujra), Molvi

Rehmat (Wala Gujra), Jhatla (Hamid Ashraf), Dhoke Gulmahi (Amir Sultan),

Dhoke Tahlian (Mirza Khan), Dhoke Tahlian (Jehangir Ahmad), Jang Saida

(M. Abas Shah), Dungi (Ch.Shabaz), Dungi (Muhammad Nazir), Dungi

(Nazakat Hussain), Qibla Bandi (Waheed Khan), Qibla Bandi (Asfaq),

Barazai (Khalid Mehmood), Barazai (Tariq Mehmood), Ghourghushti

(Anwar Khan), and Kotkay (Haji M. Yamin)

Annexure 27; Organizational structure of Joint FFS session at each dam, 2000-10

S # Dam Name of Joint

FFS Chairman

Deputy Chairman

Total Number of

Participants

Total Sub FFS

1 Dungi Potohar Kissan

School

Mr. Ghulam

Safdar

Mehraban

Khan 36 7

2 Qibla Bandi Mushtarka FFS Haider Zaman Aurangzeb 55 11

3 Jammergal Makki Madni Nusrat Mehmood

Bhatti

Haji Rehmat

Khan 55 11

4 Dhoke

Tahlian FFS Mirza khan Hamid Ashraf 55 11

Annexure 28; Total Sub FFS at Dungi Dam, 2000-10 S # Sub FFS Group Leader Group Member

1 FFS Number (1) Mirza Muhktar M. Shahid, M. Zamir, M. Waqar and Ch. Safdar

2 FFS Number (2) Muhammad Nazakat Ghafoor, M. Shaukat, Mazhar Hussain and Shabir

3 FFS Number (3) Muhammad Nazeer M. Aslam, M. Kamran, M. Sharif and M. Latif

4 FFS Number (4) Ch. Manga Khan M. Fazal, M.Iftikhar, M. amen and Abdul Hameed

5 FFS Number (5) Mehraban Khan M. Ramzan, M. Ikram, M. Abbas and M. Akram

6 FFS Number (6) Mukhtar Hussain M. Zahid, M. Asif, Pervaiz Hussain and M. Mushtaq

7 FFS Number (7) M. Jahangir Qaisar Rehman, M. Afzal, M. Saddiq and M.

Shafique

Page 86: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

86

Annexure 29; Total Sub FFS at Qibla Bandi Dam, 2000-10 S # Sub FFS Group Leader Group Member

1 FFS Number (1) Sultan Afsar Bazid Khan, Farid Khan, Muhammad Yamin and

Auragzeb Khan

2 FFS Number (2) Muhammad Banaras Muhammad Anwar, Muhammad Rafiq, Ahmad

Hussain and Muhammad Asif

3 FFS Number (3) Sher Afsar Muhammad Mushtaq, Abdul Waheed (Low

Tunnel), Rafaqat and M. Akram

4 FFS Number (4) Muhammad Sultan Muhammad Abid, Ahmad Zai, Haider Zaman and

Mehmood

5 FFS Number (5) Khalid Mehmood Muhammad Riaz, Muhammad Shafique,

Muhammad Azam and M. Iqbal

6 FFS Number (6) Qaisar Mehmood Khuram Shezad, Arshad Mehmood, M. Arif and

Muhammad Zaman

7 FFS Number (7) Muhammad Waqas Safeer Ahmad, Muhammad Asif, Naseer Ahmad

and Hukam Khan

8 FFS Number (8) Muhammad Razaq Muhammad Asif, Muhammad Shoukat, M. Tahir

and Muhammad Imran

9 FFS Number (9) Muhammad Altaf Abdur Rauf, Muhammad Naeem, Nisar Ahmad and

Ali Asghar

10 FFS Number (10) Noor Zaman Lattif Mushtaq, Ehsan Elahi, Muhammad Nawaz

and Muhammad Ramazan

11 FFS Number (11) Muhammad Anwar Yasir Hussain, Atif Mehmood, Manzoor Hussain

and Muhammad Sulaiman

Page 87: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

87

Annexure 30; Total Sub FFS at Jammergal Dam, 2000-10 S # Sub FFS Group Leader Group Member

1 FFS Number (1) Sobaidar Fazal

Ahmad

Muhammad Yaqub, Qadar Dan, Muhammad anar and

Mangtha Khan

2 FFS Number (2) Raja Nasir

Mehmood

Muhammad Bilal, Sikandar Hayat, Sher Bahadar and

Ehsan Elahi

3 FFS Number (3) Ansar Mehmood Muhammad Akram, Arshad, Yasir Mehmood and

Sagheer Abbas

4 FFS Number (4) Imtiaz Ali Raja Amir, Hasnat Ahmad, Javed Akhtar and Younas

Yasir

5 FFS Number (5) Shaukat Mehmood Ghulam Rasool, Ghulam Hussain, Khalid Mehmood

and Liakat

6 FFS Number (6) Abid Hussain Afzaal Mehandi, Jehangir Ahmad, Qamar Zaman and

Muthali Khan

7 FFS Number (7) Nasir Hussain Lattif Mushtaq, Ehsan Elahi, Muhammad Nawaz and

Muhammad Ramazan

8 FFS Number (8) Naveed Hussain Yasir Hussain, Atif Mehmood, Manzoor Hussain and

Muhammad Sulaiman

9 FFS Number (9) Nusrat Mehmood Sobaidar M. Sadiq, Muhammad Rasheed, Tariq

Mehmood and Jamroz Khan

10 FFS Number (10) Haji Rehmat Khan Rajwali, Muhammad Aslam, Rehmat Khan and Talib

Hussain

11 FFS Number (11) Ali Asghar Sayed Qurban Shah, Tasaduq Hussain, Tamraz

Shezad and M. Nawaz

Page 88: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

88

Annexure 31; Total Sub FFS at Dhoke Tahlian Dam, 2000-10 S #

Sub FFS Group Leader Group Member

1 FFS Number (1) Mirza khan Riasat Hussain. Sajid Hussain, Azam

Abbas, Safdar Mehmood

2 FFS Number (2) Amir Sultan s/o M. Noor Mukhtar Hussain, Rizwan Ahmad,

Sajid Hussain, Asif mehmood

3 FFS Number (3) Jahangir Ahmad Mubashar Lal Khan, Khuda Baksh,

Habib Bakhsh, Waheed Ahmad

4 FFS Number (4) Raja Hamid Ashraf Raja Gulburg, Raja Ashraf, Tasawar,

Ghulam Abbas

5 FFS Number (5) Shahzad Afzal Javaid Ahmad, Nazeer Ahmad, Sajad

Ahmad, Shah Saqlain

6 FFS Number (6) Amir Sultan s/o M. Khan M. Duraiz, Tanveer Ahmad, Abass,

Liaqat hussain

7 FFS Number (7) Habib Sultan Haji Ahmad, Naqeeb Sultan, Sabir

Shah, Rafaqat

8 FFS Number (8) Ahmad Shah Iftikhar Shah, Qurban Shah, Ali

Hassan, Nazim Shah

9 FFS Number (9) Samad Khan M. Hasnain, M. Zarat, M. Iqbal, Akhtar

mehmood

10 FFS Number (10) M. Asghar Raja Faisal, Raja mussadiq, Mazhar

Iqbal, Nazim Afzal

11 FFS Number (11) M. Masood Ghulam Muhammad, Tasawar

Hussain, Ikram, Abid Naseer

Page 89: Command Area Development of Small Dams - …...1KNOWLEDGE FOR LIFE CABI South Asia June, 2010 Command Area Development of Small Dams CABI Ref.: FR/CABI-PK/DR10004/2022 Opposite 1-A,

contact CABI

europe

CABI Head Office

Nosworthy Way, Wallingford, Oxfordshire, OX10 8DE, UK

T: +44 (0) 1491 832111, E: [email protected] CABI Europe - UK

Bakeham Lane, Egham, Surrey, TW20 9TY, UK

T: +44 (0) 1491 829080 CABI Europe - Switzerland

Rue des Grillons 1, CH-2800 Del mont, Switzerland

T: +41 (0) 32 4214870 asia

CABI South Asia

Opposite 1-A, Data Gunj Baksh Road, Satellite Town, PO Box 8, Rawalpindi-Pakistan

T: +92 (0) 51 9290132 CABI Southeast and East Asia

PO Box 210, 43400 UPM Serdang, Selangor, Malaysia

T: +60 (0) 3 89432921 CABI South Asia - India

2nd Floor, CG Block, NASC Complex, DP Shastri Marg, Opp. Todapur Village, PUSA,

New Delhi - 110012, India

T: +91 (0) 11 25841906 CABI Southeast and East Asia - China

C/o CAAS-CABI Project Office

C/o Internal Post Box 56, Chinese Academy of Agricultural Sciences,

12 Zhongguancun Nandajie, Beijing 100081, China

T: +86 (0) 10 62112118 africa

CABI Africa

ICRAF Complex, United Nations Avenue, Gigiri, PO Box 633-00621, Nairobi, Kenya

T: +254 (0) 20 7224450/62 americas

CABI Caribbean & Latin America

Gordon Street, Curepe, Trinidad and Tobago

T: +1 868 6457628 CABI North America

875 Massachusetts Avenue, 7th Floor, Cambridge, MA 02139, USA

T: +1 617 3954051


Recommended