Communication Vol. 268, No. 17, Issue of June 15, pp. 12239-12242, 1993 THE JOURNAL OF BIOLOGICAL CHEMISTRY

0 1993 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

Germin, a Protein Marker of Early Plant Development, Is an Oxalate Oxidase*

(Received for publication, March 29, 1993) Byron G. Lane$$, J im M. Dunwelll, John A. Rag, Mark R. Schmitt/l**, and Andrew C. Cumin&*

From the $Department of Biochemistry, Faculty of Medicine, University of Toronto, Toronto, Ontario M5S lA8, Canada, IZeneca Seeds, Jealott’s Hill Research Station, Bracknell, Berkshire RG12 6EE: United Kingdom, IEnichem America, Inc., Monmouth Junction, New Jersey 08852, and the $$Department of Genetics, University of Leeds, Leeds LS2 9J1: United Kingdom

Germin is a homopentameric glycoprotein, the syn- thesis of which coincides with the onset of growth in germinating wheat embryos. There have been de- tailed studies of germin structure, biosynthesis, ho- mology with other proteins, and of its value as a marker of wheat development. Germin isoforms as- sociated with the apoplast have been speculated to have a role in embryo hydration during maturation and germination. Antigenically related isoforms of germin are present during germination in all of the economically important cereals studied, and the amounts of germin-like proteins and coding elements have been found to undergo conspicuous change when salt-tolerant higher plants are subjected to salt stress. In this report, we describe how circumstantial evidence arising from unrelated studies of barley ox- alate oxidase and its coding elements have led to de- finitive evidence that the germin isoform made dur- ing wheat germination is an oxalate oxidase. Establishment of links between oxalate degradation, cereal germination, and salt tolerance has significant implications for a broad range of studies related to development and adaptation in higher plants. Roles for germin in cell wall biochemistry and tissue re- modeling are discussed, with special emphasis on the generation of hydrogen peroxide during germin- induced oxidation of oxalate.

Germin is a water-soluble, pepsin-resistant homopentameric glycoprotein whose polypeptide structure (monomer molecular mass - 25 kDa; oligomer molecular mass - 125 kDa) has been deduced by cDNA sequencing (Dratewka-Kos et al., 1989). Ger- min isoforms are encoded in chromosomes 4A (-5 copies), 4B (-3 copies), and 4D (-9 copies) of hexaploid wheat, and large parts of two of these genes have been sequenced (Lane et al.,

* This work was supported by Grant MRC-MT-1226 from the Medical Research Council of Canada. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

ted to the GenBankTMIEMBL Data Bank with accession number(s) The nucleotide sequence(s) reported in this paper has been submit-

L15737 8 To whom correspondence and reprint requests should be addressed.

Tel.: 416-978-8677; Fax: 416-978-8548. ** Present address: American Cyanamid, Box 400, Princeton, NJ

08543-0400.

1991). Structural protein coding regions of these germin genes have intriguing similarities to structural protein coding regions of genes for spherulins l a and l b (Bernier et al., 1986, 1987; Lane et al., 1991). Spherulins are elaborated when the ancient slime mold, Physarum polycephalum, is subjected to various forms of environmental stress, and the amounts of some other germin-like proteins and coding elements have also been shown to change when salt-tolerant monocotyledons (barley) (see Hurkman et al. (1991)) and dicotyledons (ice plant) (Michalow- ski and Bohnert, 1992) are subjected to salt stress.

Germin isoforms have been shown to be discrete markers of wheat development, and different isoforms have been found to occur in selective association with cell walls during maturation (pseudogermin) and germination (germin) (Lane et al., 1992). Germin first attracted our attention as a unique marker of the onset of germinative growth when mature wheat embryos were cultured either in vitro (Thompson and Lane, 1980) or in planta (Grzelczak et al . , 19851, and its wall-bound form has recently been found to account for about 40% of the total germin in wheat embryos by 2 days post-imbibition (Lane et al., 1992). Their presence during germination suggests that germin iso- forms have a significant role in the development of all of the major cereals: barley, corn, oat, rice, rye, and wheat (Lane, 1991; Lane et al., 1991, 1992).

Even as these studies of germin were in progress, indepen- dent and seemingly unrelated studies of a possible strategy for transforming plants with barley oxalate oxidase genes, as a defense against oxalate-secreting fungal pathogens, were in progress. A novel procedure for purifying barley oxalate oxi- dase, which degrades oxalate to COz and H 2 0 2 , was developed (Schmitt, 1991) and used to prepare the enzyme. Antibodies against the barley oxalate oxidase monomer were used to screen a barley-root cDNA expression library, from which a barley oxalate oxidase cDNA was isolated and its sequence determined.

Surprisingly, the amino acid sequence encoded in the barley oxalate oxidase cDNA has very strong homology with the amino acid sequences of wheat germins. Further work has shown that the wheat germin made during embryo germination has ox- alate oxidase activity that is as high as any that has been reported for barley oxalate oxidase and that antibodies against the wheat germin monomer and oligomer are equally cross- reactive with the barley oxalate oxidase monomer and oligo- mer. Detailed evidence in support of these claims is summa- rized, and the broad relevance of these unexpected findings to perennial interest in the role of oxalate in the biology of higher plants, and to current interest in the roles of hydrogen peroxide and calcium in higher plant development, is elaborated and evaluated.

EXPERIMENTAL PROCEDURES Materials-Germin was prepared from germinated wheat embryos

as described (Lane et al., 1987). Barley oxalate oxidase was prepared from seedlings as described (Schmitt, 1991) and was purified from com- mercially accessible sources: Sigma (catalog no. 0-4217) and Boeh- ringer Mannheim (catalog no. 567,698) in the same way (Schmitt, 1991). Oxalic acid, succinic acid, hydrogen peroxide, Nfl-dimethyl- aniline, 4-aminoantipyrine, and horseradish peroxidase (Type VI-A, 1100 unitdmg, catalog no. P-6782) were purchased from Sigma.

Assay of Oxalate Oxidase Actiuity-The procedure described by Su- giura et al. (1979) was used for the solution assay of oxalate oxidase activity. The assay was adapted for detection of the enzyme in nitrocel- lulose blots. For this purpose, a 5 X 5-cm section of nitrocellulose filter

12239

12240 Germin Is an Oxalate Oxidase was immersed in a solution made by combining 5 ml of “substrate solution” (2 mM oxalate, 100 mM succinate buffer (pH 3.5)) with 3 ml of “developing solution,” containing 0.25 mg of 4-aminoantipyrine, 40 units of horseradish peroxidase, and 0.6 pl of N,N-dimethylaniline in 100 mM sodium phosphate buffer (pH 5.5). After color development (20 min), the filter was rinsed with water,

Preparation and Sequence Analysis of Barley Oxalate Oxidase cDNA -A cDNA library was prepared by Clontech Laboratories using AgtZZ as a vector for polyadenylated RNA that had been isolated from the roots of 10-day barley seedlings. The mean insert size in the library was -1.8 kilobases, and 1.2 X lo6 plaques were screened by standard tech- niques (Sambrook et al., 1989) using a high titer antiserum that was raised by intramuscular injection of a rabbit with barley oxalate oxidase monomer. The monomer had been recovered by mincing wet gel slices from an SDS-PAGE1 gel with Freund’s adjuvant. Fourteen potentially positive signals were rescreened; the insert from the plaque that gave the strongest signal was amplified by standard polymerase chain reac- tion technology (Erlich, 19891, and its sequence was determined using the T7 kit from Pharmacia LKl3 Biotechnology Inc.

Amino Acid Sequence Analysis and Separation of Proteins by SDS- PAGE-The procedure of Laemmli (1970) was used in conjunction with a Mini-Protean I1 dual slab gel system (Bio-Rad) for SDS-PAGE sepa- ration of proteins. Because the germin (oxalate oxidase) oligomer is stable under the conditions of SDS-PAGE electrophoresis, the recom- mended heating step (Laemmli, 1970), prior to application of samples to gels, was often omitted. Standard procedures, previously described (Lane et al . , 19921, were used to transfer proteins from SDS-PAGE gels to nitrocellulose, for immunodetection of proteins on blots (using con- jugated alkaline phosphatase as a second antibody) and for Edman degradation to determine the N-terminal sequences of proteins.

RESULTS

Circumstantial Evidence Relating Barley Oxalate Oxidase to Wheat Germins-Barley oxalate oxidase was prepared from seedling roots (Schmitt, 19911, and the N-terminal sequence of 18 amino acids, determined by Edman degradation of the pu- rified enzyme, was identical with the corresponding N-terminal sequence in the protein recovered by applying the same puri- fication procedure to a commercially available preparation of barley oxalate oxidase (from Sigma). For further work, a more highly purified commercially available preparation of barley oxalate oxidase (from Boehringer Mannheim) was used. The monomer of barley oxalate oxidase was extracted from SDS- PAGE gel and used to raise a rabbit antiserum. Polyclonal antibodies against oxalate oxidase monomer were used to screen a barley (10-day seedlings) cDNA expression library.

The insert in the strongest “cDNA-positive” was recovered and amplified. The nucleotide sequence of the insert was de- termined, and it was found to encode a sequence that over- lapped the C-terminal 12 amino acids in the N-terminal se- quence determined by direct amino acid sequencing of barley oxalate oxidase, i.e. the insert was presumed to be an almost full-length barley oxalate oxidase cDNA. The barley oxalate oxidase cDNA sequence (shown in Fig. lA) and its encoded protein sequence (shown in Fig. 1B) were compared with se- quences in the data base, and striking homology was found between barley oxalate oxidase and sequences for two wheat germins (Lane et al . , 1991). Over the 201 amino acids in each of the mature proteins, oxalate oxidase only differs from thegf-2.8 germin at 9 positions, and from the gf-3.8 germin isoform at 15 positions, whereas the two germin isoforms differ from each other at 14 positions. A majority of the differences between and among the three sequences involve equivalent amino acids.

Definitive Evidence That Wheat Germin Is an Oxalate Oxi- dase-The methods of Sugiura et al. (1979) were used to assess directly the oxalate oxidase activity of a G-rich preparation of highly purified wheat germin that had been prepared in mass quantity from germinated embryos and was shown to be virtu- ally devoid of contamination by other proteins (Lane et al.,

The abbreviation used is: PAGE, polyacrylamide gel electrophoresis.

A OXOX TCCGACCCAGACCCACTCCAGGACTTCTGCGTCGCGGACCTCGATGGCMGGCGG 55 gf-2.8 A ............. 1 .............. T ..... C ........ C .......... 55 gf-3.8 ... A .... TC .... T .............. T ..... C ................... 55

OXOX TCTCGGTGAACGGGCATACGTGTMGCCCATGTCGGAGGCCGGCUCGACTTCCT 110 ............... ... .............................. ................ ........................ gf-3.8 C.T . . .C . . . . . . . . 110 gf-2.8 .C . .C . . 110

OXOX CTTCTCGTCCAAGCTGACCAGGCCGGCACACGTCCACCCCWCGGCTCGGCC 165 gf-2.8 ............. T. .G .................................. C . . . 165 gf-3.8 ...... T ........ TG ................ A . . . . . . . . . . . . . . . . . C . . T 165

OXOX GTGACGGAGCTCGACGTGGCCGAGTGGCCCGGTACGAACACGCTGGGCGTGTCCA 220 gf-2.8 .................................. . C . . . ....... . T . . ..... 220 gf-3.8 ........ T ... A . . . . . . . . . . . . . . . . T . . . . . . . . . . . A . . . . . T . . . . . . . 220

OXOX TGAACCGTGTGUCTTCGCGCCGGGGGGCACWCCGCCGCACATCCACCCGCG 275 gf-2.8 ....... C ........ T..T..C..A ........... A..A .............. 275 gf-3.8 ................ T..A..A .............. A ................. 275

OXOX TGCAACCGAUTCGGCATGGTGATWGGTGAGCTCCTCGTTGGPATCCTCGGC 330 gf-2.8 .. . C . ............ . C . . ............... T. . .. .G, ....... T , .. 330 gf-3.8 C..C..T ........... C .......................... T ......... 330

OXOX AGCCTTGACTCCGGAAACAAGCTCTACTCCAGGGTGGTGCGTGCCGGAGAGACTT 385

gf-3.8 C . .T..G C..T G. 385 gf-2.8 C . . G.. .G.. C . . . G. 385 ..... ...... ........... ......... ........ ..... ... .......................... ........ OXOX TCGTCATCCCGCGCGGCCTCATGCACTTCCAGTTCAACGTTGGTMGACGGAAGC 440 gf-2.8 . . C ....... A..G .......................... C ........ C..G.. 440 of-3.8 . . C ............. G ....................... C ........... G.. 440

OXOX CTACATGGlTGTGTCCTTCCAGCCAWCCCTGGCATCGTCTTCGTGCCGCTC 495 gf-2.8 . .C. ..... C . .C .................... C . . . . . T ........... C . . . 495 91-3.8 ..C ...... C..C.T .............. G...CA..G ............. A... 495

OXOX AU\CTCTTCGGCTCCGACCCTCCCATCCCCACGCCCGTGCTCACC~GGCTCTCC 550 gf-2.8 ..G ........... .A. . . .G ........ A ..... G.. ............ A .... 550 gf-3.8 . . G ............ A .... G .......... M..G ................... 550 91-2.8 ........... A.G .......................... T .... C ..... T. 603 OXOX GGGTGGAGGCCGGAGTCGTGGAACTTCTCPAGTCCPAGTTCGCCGGTGGGTCT 603

gf-3.8 .......... T..G ................. A ........... T ......... 603

OXOX SDPOPLPDFCVAOLDGKAVSVNGHTCKPMSEAGOOFLFSSKL~GNTSTPNGSA 55

B gf-3.8 .N.H .................... M ................. A ............ 55 gf-2.8 T ........................................ . A , . . . . ....... 55

OXOX VTELOVAEWPGTNTLGVSMNRVOFAPGGTNPPHIHPRATEIGHVH(GELLVGILG 110 gf-2.8 .......................................... I . ........... 110 gf-3.8 ..D.N ..................................... I ............ 110

OXOX SLDSGNKLYSRVVW\GETFVIPRGLMHFQFNVO(TEAmVVSFNSQNPGIVFVPL 165 gl-2.8 ................... L ............... . . S a . . .............. 165 gr-3.8 .................. .L.. .............. .s.. . F. . .. s. sv.. ... 165

OXOX TLFGSDPPIPTPVLTKALRVEAGVVELLKSKFAGGS 201

of-3.8 ..... N .... K ......................... 201 gf-2.8 ..... N ................ R .......... A.F 201

FIG. 1. Nucleotide-coding (A) and amino acid ( B ) sequences of mature barley oxalate oxidase are compared with the corre- sponding sequences of the germin isoforms gf-2.8 and gf3.8 (Lane et aL, 1991). An N-terminal amino acid sequence (18 residues) for the barley oxalate oxidase was determined by direct amino acid sequencing. The amino acid sequence corresponding to the almost full- length cDNA clone begins a t residue 7 and nucleotides encoding the first six amino acids were assigned by reference to the amino acid sequence that was determined by direct amino acid sequencing. In each part of the figure, the sequences are identical, except where a lettered symbol replaces a dot.

1987). There are two principal isoforms of germin in soluble extracts of germinated wheat embryos, both having the same apoprotein; however, one, the G form, contains antennary GlcNAc residues in its covalently bonded glycans, whereas the other, the G’ form, lacks antennary GlcNAc residues in its otherwise identical glycans (Jaikaran et al., 1990). The activity of G-rich germin was reproducibly found to be as high as any activity that has been reported for barley oxalate oxidase. The specific activity of G-rich germin was found to be between 8 and 9 unitdmg of protein, corresponding to the oxalate-dependent release of 8-9 pmol of H202/midmg of G-rich germin.

As shown in Fig. 2A (lane A), a commercial preparation of barley oxalate oxidase (from Boehringer Mannheim), when subjected to SDS-PAGE without preheating, contains a single major protein after Coomassie staining. The major protein band in Fig. 2A (lane A ) co-migrates with the wheat germin oligomer and has a molecular mass of -125 kDa in relation to a series of standard marker proteins (Lane et al., 1987; McCub-

Germin Is an Oxalate Oxidase 12241

A - A B

B A B C D E

C

FIG. 2. Prote ins in SDS-PAGE separations of 12.E gels were stained directly with Coomassie Blue (A and C) or a f t e r elec- troblotting, for oxalate oxidase activity ( B ) . A, the gel was stained with Coomassie Blue to detect protein and illustrates the results ob- tained when a commercially available specimen, containing -1 pg of barley oxalate oxidase, is subjected to electrophoresis without, as in A, or with prior heat treatment (2 min, 100 "C) as recommended by Laem- mli (1970), as in B. E , the electroblot was stained to detect oxalate oxidase activity (see text) and illustrates the results obtained when -1 pg of barley oxalate oxidase (A and B ) , -1 pg of wheat germin (C and D), or -65 pg of proteins in a soluble extract from two wheat embryos (E) (Grzelczak and Lane, 1983, 1984) were applied to the original gel, without (A, C, and E) or with ( B and D) prior heat treatment (2 min, 100 "C) as recommended by Laemmli (1970). C, the gel was stained with Coomassie Blue to detect proteins and illustrates that the small amount of wheat germin oligomer (-80 ng) in a soluble extract of two wheat embryos is not detectable by dye staining, although it is easily detected, and is the only protein detected, if the same extract of two wheat em- bryos is stained for oxalate oxidase activity after electroblotting (panel B, lane E ) .

bin et al., 1987). If preheated before SDS-PAGE, as suggested by Laemmli (1970), the major protein band in the commercial preparation of barley oxalate oxidase, shown in Figure 2A (lane B), co-migrates with the wheat germin monomer and has a molecular mass of -25 kDa in relation to a series of standard marker proteins. Of passing interest, buffers and so-called stabilizers in the commercial barley oxalate oxidase reduce the mass proportion of protein to the level of -1%.

The reagents employed to measure H202 in the solution as- say of oxalate oxidase activity (Sugiura et al., 1979) can be used to detect oxalate-dependent release of H202 in blots of SDS- PAGE gels. Areas of oxalate oxidase activity appear as discrete blue bands on the nitrocellulose filter (similar in color to Coo- massie Blue). As shown for the commercial preparation of bar- ley oxalate oxidase in Fig. 2B (lane A ) , and for pure wheat germin in Fig. 2B (lane C), oxalate oxidase activity is only detected in the region of the oligomer, none being detected in tracks that contain (the respective monomers in the) preheated specimens (Fig. 2B, lanes B and D). Likewise, as shown in Fig. 2B (lane E ) , oxalate oxidase activity in a soluble extract of germinated wheat embryos co-migrates with the germin oligo- mer, none being seen if the same sample is preheated (yielding the germin monomer) before application to the gel (not shown).

If the soluble extract of germinated wheat embryos is not heated before SDS-PAGE, all oxalate oxidase activity is con- fined to the germin oligomer, compatible with the virtual ab- sence of the monomer in barley oxalate oxidase and wheat germin preparations, which are made from soluble extracts of roots and embryos, respectively. The soluble proteins (-65 1.18) applied to the gel from which the blot was made in the case of Fig. 2B (lane E ) derived from the equivalent of two wheat embryos. The position of the germin oligomer (undetectable) in

a corresponding untransferred, but dye-stained (Coomassie Blue) gel is indicated in Fig. 2C.

Comparison of oxalate oxidase staining with dye staining, in Fig. 2 (panel B (lane E) and panel C), illustrates the very great sensitivity and selectivity of the enzymatic detection method, which rivals detection of germin by anti-germin antibodies (Fig. 3). However, as shown in Fig. 3, the heated monomers of barley oxalate oxidase and wheat germin (E-H), which are not detected by the enzymatic staining method, are equally as well detected as are the corresponding oligomers (A-D) when poly- clonal antibodies against wheat germin (Lane et al., 1992) are used as primary antibodies for detecting proteins in gel blots.

DISCUSSION

Oxalates are generally thought of as being inert end products of plant and animal metabolism. Just as urate and urea are seen as well tolerated excretionary end products of nitrogen assimilation in different vertebrate animals, insoluble calcium oxalate is viewed as a well tolerated storage form of Ca2+ in higher plants. In halophytes such as Atriplex (Karimi and Un- gar, 1986) and the pasture grass Setaria sphacelata (Smith, 1972), oxalate is the principal anion responsible for cation bal- ance, but this is the exception, not the rule. Discovery that germin, a developmentally regulated protein in wheat, is an oxalate oxidase, suggests for the first time that oxalate is used in the developmental processes of higher plants.

Discovery of its oxalate oxidase activity instantly suggested several specific ways in which germin might act at the molec- ular level. Linkage of the developmental appearance of wall- bound germin (Lane et al., 1992) to oxalate degradation (present study) suggests that release of H202 and Ca2" are the biochemically important consequences of this germin activity. Both of these small, rapidly diffusible molecules behave as signals or "second messengers" a t low concentrations (Luttrell, 1993; Apostol et al., 1989), and both mediate cross-linking of cell wall polymers at higher concentrations (Cassab and Var- ner, 1988; Showalter, 1993).

A B C D E F G H

FIG. 3. An electroblot m a d e after SDS-PAGE of barley oxalate oxidase and wheat germin. Proteins were detected using an anti- germin serum as a source of primary antibodies and alkaline phos- phatase-conjugated goat-anti-rabbit antibodies as a source of second antibodies (Lane et al., 1992). A, -250 ng of barley oxalate oxidase oligomer; B, -25 ng of barley oxalate oxidase oligomer; C, -25 ng of wheat germin oligomer; D, -250 ng of wheat germin oligomer; E, -250 ng of wheat germin monomer; F , -25 ng of wheat germin monomer; G , -25 ng of barley oxalate oxidase monomer; H , -250 ng of barley oxalate oxidase monomer. Protein estimates are based on the degree of staining by Coomassie Blue when known amounts (by amino acid analysis) of wheat germin monomers and oligomers are stained in SDS-PAGE gels. Specimens in tracks A-D were applied to the gel without preheating, whereas specimens in E-H were preheated before application to SDS- PAGE gels as recommended by Laemmli (1970). The G-rich form of germin was applied to tracks D and E, whereas the G' form, otherwise identical to the G form, except that it lacks antennary GlcNAc residues in its covalently bonded glycans (Jaikaran et al., 1990), was applied to tracks C and F for comparison with barley oxalate oxidase. As expected from earlier work (Schmitt, 1991). this specimen of barley oxalate oxi- dase (from Sigma) consists mainly of the faster migrating G' isoform.

12242 Germin Is an Oxalate Oxidase

Ironically, we once before considered the possibility that ger- min might have enzymic activity (Lane, 1988). This notion was prompted by the finding that, of all proteins with which its amino acid composition was compared, germin was only signif- icantly related (Cornish-Bowden, 1983) to a fungal phytase, amino acid compositions of purified cereal phytases being un- available. Assay of germin for phytase activity2 gave negative results, but their common property of sequestering calcium dictates mutual roles for oxalate and phytate in the calcium homeostasis of higher plants. Although phytate is a well known component of wheat embryos (-4 pg/embryo) (MacMasters e t al., 19781, it is interesting that there has been only one, rela- tively obscure report of their oxalate content (-1 &embryo) (Andrews and Viser, 1951). Calcium seclusion by oxalate and phytate (Luttrell, 1993) has important implications for cellular biochemistry: (i) sequestering of second messengers in the form of Ca2+ and inositol polyphosphates (Lane, 1988) and (ii) se- questering of calcium that can be used for cross-linking carbox- ylated sugars in the pectins and hemicellulosic glucuronogalac- toarabinoxylans of monocotyledons (see Carpita (1988)) and dicotyledons (see Darvill et al. (1980)).

A requirement for H202 in peroxidase reactions needs little elaboration here except perhaps to reiterate what van Huystee and Cairns (1980) have said about peroxidases being a param- eter of metabolic activity during growth alterations. During germination, wheat quickly passes from a state of metabolic arrest to the highest growth rate in its life history (Williams, 1972). This developmental transition from predominantly cell division growth during embryogenesis, to predominantly vege- tative growth during post-germinative growth of the seedling, must involve major adjustments of the apoplast and it is not difficult to visualize an important role for H202: H20z is needed for the key cross-linking reactions of cell wall biochemistry (see Showalter (1993)), including lignification (Halliwell, 1978; Scalbert et al., 1985) and cross-linking of ferulate to glucu- ronogalactoarabinoxylans (Carpita, 1986, 19871, which, in highly substituted form, bind tightly and selectively to germin (Lane et al., 1992) and are known from independent studies (Gibeaut and Carpita, 1991) to be allied with cereal wall ex- pansion.

In considering possible involvements of germin in embryo and seedling development, it is plausible that generation of high concentrations of H202 from oxalate may promote perox- isome-mediated tissue remodeling. For instance, a physiologi- cal role for germin has recently been pursued in the context of a conspicuous parallel between water uptake and germin syn- thesis during the (post)germinative growth of wheat embryos (Lane, 1991). Discovery of an oxalate oxidase activity for ger- min gives an added and important new focus for possibly un- derstanding the accumulation of germin in association with water uptake. Oxalate oxidase activity of germin may promote water uptake by driving peroxisome-mediated tissue remodel- ing (e.g. of the cortex; see Lane et al. (1992)).

Highly significant in the context of all that has been said here, Varner's laboratory has recently communicated (Varner, 1993)3 the results of investigations that suggest a central wall- related role for H202 in plant development, differentiation, vascularization, response to wounding, and possibly, in signal-

B. G. Lane, unpublished observation. P. D. Olson and J. E. Varner, submitted for publication.

ing through the transpiration stream. Varner has noted that generation of H202 in some species is greatly increased if pH is reduced from 7 to 4. It may be significant that the pH optimum of barley oxalate oxidase is 3.5 (Sugiura et al., 1979). If oxalate oxidation generates the H202 used to induce similar changes in graminaceous monocotyledons, germin coding elements may be valuable molecular biological adjuncts for studying any general role of H202 in higher plant development, and any particular role of oxalate in cereal development.

Acknowledgment-We thank Prof. Joseph Varner (Washington Uni- versity, St. Louis, MO) for providing, in manuscript form, the results of the unpublished work on the production of hydrogen peroxide in higher plants.

REFERENCES

Andrews, J. C., and Viser, E. T. (1951) F w d Res. 16, 306-312 Apostol, I., Heinstein, P. F., and Low, P. S. (1989) Plant Physiol. 90, 109-116 Bernier, F., Seligy, V. L., Pallotta, D., and Lemieux, G. (1986) Biochem. Cell Biol.

Bernier, F., Lemieux, G., and Pallotta, D. (1987) Gene (Amst. 59, 265-277 Carpita, N. C. (1986) Plant Physiol. 80,660466 Carpita, N. C. (1987) in Physiology of Cell Expansion During Plant Growth (Cos-

grove, D. J. , and Knievel, D. P., eds) pp. 28-45, The American Society of Plant Physiologists, Rockville, MD

64,337-343

Carpita, N. C. (1988) Curl: Top. Plant Biochem. Physiol. 7, 112-133 Cassab, G. I . , andvarner, J. E. (1988)Annu. Rev. Plant Physiol. Plant Mol. Biol. 39,

Cornish-Bowden, A. (1983) Methods Enzymol. 91, 60-75 Darvill, J. E., McNeil, M., Darvill, A. G., and Albersheim, P. (1980) Plant Physiol.

Dratewka-Kos, E., Rahman, S., Grzelczak, Z. F., Kennedy, T. D., Murray, R. K., and

Erlich, H. A. (1989) PCR Technology: Principles and Applications for DNA Ampli-

Gibeaut, D. M., and Carpita, N. C. (1991) Plant Physiol. 97,551-561 Grzelczak, Z. E, and Lane, B. G. (1983) Can. J. Biochem. Cell Biol. 61,1233-1243

Grzelczak, Z. F., Rahman, S., Kennedy, T. D., and Lane, B. G. (1985) Can. J. Grzelczak, Z. F., and Lane, B. G. (1984) Can. J. Biochem. Cell Biol. 62,1351-1353

Biochem. Cell Biol. 63, 1003-1013 Halliwell, B. (1978) Planta 140,81438 Hurkman, W. J., Tao, C. K., and DuPont, F. M. (1991) Plant Physiol. 97,36&374 Jaikaran,A. S. I., Kennedy, T. D., Dratewka-Kos, E., and Lane, B. G. (1990) J. Biol.

Johnston, F. B., and Stern, H. (1957) Nature 179, 160-161 Karimi, S. H., and Ungar, I . A. (1986) Bot. Gaz. 147,65-70 Laemmli, U. K. (1970) Nature 227,680-685 Lane, B. G . (1988) in The Roots of Modern Biochemistry (von Kleinkauf, H.,

Lane, B. G. (1991) FMEB J. 5,2893-2901 Dohren, H., and Jaenicke, L., eds) pp. 457476, Walter de Gruyter, New York

Lane, B., Grzelczak, Z., Kennedy, T., Hew, C., and Joshi, S. (1987) Biochem. Cell Biol. 65,354362

Lane, B. G., Bernier, F., Dratewka-Kos, E., Shafai, R., Kennedy, T. D., Pyne, C., Munro, J. R., Vaughan, T., Walters, D., and Altomare, F. (1991) J. Biol. Chem.

Lane, B. G., Cuming, A. C., Fregeau, J., Carpita, N. C., Hurkman, W. J., Bernier, 266, 10461-10469

Luttrell, B. M. (1993) J. Biol. Chem. 268, 1521-1524 F., Dratewka-Kos, E., and Kennedy, T. D. (1992) Eul: J. Biochem. 209,961-969

MacMasters, M. M., Hinton, J . J. C., and Bradbury, D. (1978) in Wheat Chemistry and Technology (Pomeranz, Y., ed) pp. 51-113, American Association of Cereal

321-353

66, 1135-1139

Lane, B. G. (1989) J. Biol. Chem. 264,4896-4900

fication, Stockton Press, New York

Chem. 265, 12503-12512

Chemists Inc, St. Paul, MN ~~

McCubbin, W. C., Kay, C. M., Kennedy, T. D., and Lane, B. G. (1987) Biochem. Cell

Michalowski, C. B., and Bohnert, H. J. (1992) Plant Physiol. 100, 537-538 Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Lab-

oratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Scalbert, A,, Monties, B., Lallemand, J.-Y., Guittet, E., and Rolando, C. (1985)

Biol. 65, 1039-1048

Schmitt, M. R. (1991) Plant Physiol. (Suppl.) 96, 85 (Abstr. 540) Showalter. A. M. (1993) Plant Cell 5. 9-23

Phytochemistry 24, 1359-1362

Smith, E W . (1972)Aust. J. Agric. Res. 23, 969-980 Sueiura, M., Yamamura, H., Hirano, K., Sasaki, M., Morikawa, M., and Tsuboi, M.

(1979) Chem. Pharm. Bull. 27,2003-2007 Thompson, E. W., and Lane, B. G. (1980) J. Biol. Chem. 255,5965-5970 van Huvstee. R. B.. and Cairns. W. L. (1980) Bot. Rea 46. 429446 Vamer,-J. E.'(1993j J. Cell Biochem. Suppl. 1 7 4 2 Williams, R. F. (1972) in The Shoot Apex and Leaf Growth: A Study in Quantitative

Biology (Williams, R. F, ed) pp. 9-26, Cambridge University Press, Cambridge, United Kingdom