Available online at www.sciencedirect.com

www.elsevier.com/locate/brainres

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8

0006-8993/$ - see frohttp://dx.doi.org/10

nCorrespondenceFax: þ49 761 270 531

E-mail address:

Research Report

Comparative analyses of Purkinje cell gene expressionprofiles reveal shared molecular abnormalities in modelsof different polyglutamine diseases

Bernd Friedricha, Philipp Eulera, Ruhtraut Zieglera, Alexandre Kuhnb,Bernhard G. Landwehrmeyerc, Ruth Luthi-Carterb, Cornelius Weillera,Sabine Hellwiga,d, Birgit Zuckera,n

aDepartment of Neurology, University Hospital Freiburg, GermanybBrain Mind Institute, �Ecole Polytechnique Federale de Lausanne (EPFL), Lausanne, SwitzerlandcDepartment of Neurology, University Hospital, Ulm, GermanydDepartment of Psychiatry and Psychotherapy, University Hospital Freiburg, Germany

a r t i c l e i n f o

Article history:

Accepted 1 August 2012

Polyglutamine (PolyQ) diseases have common features that include progressive selective

neurodegeneration and the formation of protein aggregates. There is growing evidence to

Available online 17 August 2012

Keywords:

Huntington’ s Disease

Spinocerebellar ataxia

Laser capture microdissection

Purkinje cell

Polyglutamine disease

Microarray

nt matter & 2012 Elsevie.1016/j.brainres.2012.08.0

to: Department of Neuro00.birgit.zucker@uniklinik-f

a b s t r a c t

suggest that critical nuclear events lead to transcriptional alterations in PolyQ diseases

such as spinocerebellar ataxia type 7 (SCA7) and Huntington’s disease (HD), conditions

which share a cerebellar degenerative phenotype. Taking advantage of laser capture

microdissection technique, we compared the Purkinje cell (PC) gene expression profiles

of two transgenic polyQ mouse models (HD: R6/2; SCA7: P7E) by microarray analysis that

was validated by real time quantitative PCR. A large number of transcriptional alterations

were detected in the R6/2 transgenic model of HD. Similar decreases in the same mRNAs,

such as phospholipase C, b 3, purkinje cell protein 2 (Pcp2) and aldolase C, were found in

both models. A decrease in aldolase C and phospholipase C, b 3, may lead to an increase in

the vulnerability of PCs to excitotoxic events. Furthermore, downregulation of mRNAs

mediated by the Pcp2-promoter is common in both models. Thus, our data reveal shared

molecular abnormalities in different polyQ disorders.

& 2012 Elsevier B.V. All rights reserved.

1. Introduction

Huntington’s disease (HD) and spinocerebellar ataxia type 7

(SCA7) are polyglutamine (polyQ) disorders, which are caused

by an expansion of CAG-repeats in the coding region. Seven

further diseases belong to this group of neurodegenerative

r B.V. All rights reserved.05

logy, Neurozentrum, Univ

reiburg.de (B. Zucker).

diseases: SCA1, SCA2, SCA3, SCA6 and SCA17, spinobulbar

muscular atrophy and dentatorubro-pallidoluysian atrophy

(Gatchel and Zoghbi, 2005). PolyQ expansions confer toxicity

predominantly through a gain-of-function mechanism

of the ubiquitously expressed proteins (Orr and Zoghbi,

2007).

ersity of Freiburg, Breisacher Strasse 64, 79106 Freiburg, Germany.

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 838

Although the most striking HD pathology is observed in the

striatum and cortex an important pathophysiological role for

the cerebellum in HD has been suggested (Deckel, 1995).

Similarly in SCA7, the main target area besides the retina is

the cerebellum. Accordingly, both HD and SCA7 patients show a

cerebellar phenotype characterized by morphological altera-

tions, neuronal intranuclear inclusions and atrophy, with selec-

tive loss of Purkinje cells (PCs) in advanced disease (Bang et al.,

2004) (Jeste et al., 1984). Loss of (PCs) in HD has also been

reported in several early-onset cases (Byers et al., 1973).

Studying the cerebellum provides several advantages

because of its well-described architecture and physiology. In

particular, diverse electrophysiological properties of parallel

fiber synapses and climbing fiber synapses have been eluci-

dated and subcellular compartments in PCs characterized by

different proteins have been described (Watanabe, 2008;

Knopfel and Grandes, 2002; Nomura et al., 2007). Most

recently, molecular defects have been linked to both mor-

phological and functional alterations that ultimately lead to

SCA (Carlson et al., 2009).

Mutant polyQ proteins can either interact with various

transcription-related proteins, or form a subunit of a tran-

scriptional complex, thus eliciting profound effects on gene

expression (Dunah et al., 2002; Li et al., 2002; Zuccato et al.,

2003; Helmlinger et al., 2004b). We therefore predicted similar

gene expression changes for both disease models.

While previous studies on the medium spiny neurons, the

most affected striatal cell type in HD, revealed specific mRNA

alterations (Zucker et al., 2005; Cha, 2007) the accompanying

cerebellar dysfunction and PC loss might also be caused at

least in part by other pathogenic events. First, the suggested

pathomechanisms for the selective loss of medium spiny

neurons in HD are not applicable to the neurotransmitter

profile of PCs, and even intracellular signal processing differs

between the two cell populations, e.g. mature PCs lack

functional N-methyl-D-aspartate (NMDA)-receptors but

uniquely express the glutamate-uptake-transporter excitatory

amino acid transporter (Eaat4) in a characteristic way

(Slemmer et al., 2005; Wadiche and Jahr, 2005). Second,

complex interactions between PCs and surrounding

Bergman-Glia (BG) – especially at parallel fiber and climbing

fiber synapses – seem to be more important in preventing

glutamate-mediated excitotoxic PC death than previously

thought (Custer et al., 2006; Dehnes et al., 1998; Yamashita

et al., 2006; Bellamy, 2006). Thus, the aim of our study was to

compare different polyglutamine disorders in the same ana-

tomical context, in order to elucidate common pathological

alterations that might point to shared pathomechanisms.

For the present study we used one of the most extensively

characterized animal models for HD: the R6/2 mouse line

developed by Mangiarini et al. (1996). R6/2 mice express the

N-terminal portion of human huntingtin, which comprises

�150 CAG repeats and is driven by the human huntingtin

promoter. This line was compared with a transgenic SCA7

model, namely the P7E line (Yvert et al., 2000) expressing

human ATAXIN 7 (ATXN7) comprising 90 CAG repeats and

driven by the Purkinje cell specific Pcp2-promoter. Both

mouse lines exhibit nuclear inclusions in PCs at the age of

12 weeks (R6/2) (Davies et al., 1997) and 16 weeks (P7E) (Yvert

et al., 2000).

2. Results

2.1. Enrichment of Purkinje cells by laser capturemicrodissection (LCM) of cerebellar samples

In preparation for microarray analysis of the laser-dissected

PC samples, we first tested the extent of neuronal enrich-

ment of cerebellar samples from wild-type (WT) animals. We

used Q-PCR to compare mRNA expression of myelin basic

protein (Mbp) as an oligodendroglial marker, glial fibrillary

acidic protein (Gfap) as an astroglial marker and parvalbumin

(Pvalb) as a marker for PCs and compared expression of these

mRNAs in whole cerebellar homogenates (comprising all cell

types) versus LCM-PC samples. LCM-PC samples showed a

significant enrichment of Pvalb by up to 6-fold when com-

pared to Pvalb expression in homogenates. This is illustrated

by a glia marker/Pvalb quotient in homogenate and LCM

material (Fig. 1). Glial contamination could be reduced to 18%

for Mbp and 31% for Gfap in LCM samples.

To identify any shared pathological changes within the

same anatomical context in the two polyglutamine disorder

models, we then performed a parallel genome-wide screen

on Affymetrix microarrays using PC samples from the P7E

and R6/2 models.

2.2. Gene expression changes in P7E and R6/2 mice

To date, DNA microarrays have not been applied to cerebellar

tissue from P7E animals to screen for mRNA alterations in

PCs expressing mutant ATXN7. Indeed, these mice reveal

neuropathological changes with nuclear inclusions in PCs at

15 weeks-of-age (Yvert et al., 2000). On the other hand, R6/2

mice have been shown to exhibit a large number of gene

expression changes in homogenates of the cerebellum at 12

weeks-of-age (Luthi-Carter et al., 2002a).

4173 (of 45037) array probesets indicated differential mRNA

expression between PCs from R6/2 versus WT animals, using

a cutoff False Discovery Rate (FDR) of po0.05 (see Methods).

Of the largest fold changes (1.75-fold or higher), 153 probesets

indicated a reduction in expression, while 39 probesets

detected increased mRNA levels.

Selected mRNAs showing differential expression in PCs are

presented in Table 1 (also see Supplementary Data Table 1 for

complete lists). RNAs from LCM PCs showing the largest

changes in magnitude in transgenic versus WT mice are

shown. Probesets for ESTs and genes without annotation

have been omitted from the table. In cases where multiple

probesets represent the same mRNA, the probeset reporting

the largest change in magnitude is shown.

Microarray analysis did not reveal any changes in P7E mice

according to the cutoff of po0.05. Relaxing the cutoff FDR for

the P7E model to 0.2 reveals a concordance for both models

(R6/2 and P7E) of 9/13 genes (i.e. 69%). A cutoff FDR of 0.25

corresponds to 55 genes significantly changed in P7E Tg

versus WT mice. The number of concordant genes is 36/55

genes (i.e. 65%) (Supplementary Data Table 2). A cut off FDR of

0.3 leads to significant alterations in 137 genes, where 83/137

are concordant (i.e. 61%). With further relaxation of the cutoff

Fig. 1 – Neuronal enrichment of LCM samples. Comparison of the glial marker (Mbp, Gfap)/neuronal marker (Pvalb) ratio

between WT cerebellar homogenates and WT LCM samples, as determined by Q-PCR. LCM Purkinje cell samples showed up

to 6-times more neuronal enrichment compared to cerebellar homogenates, with MBP-positive and GFAP-positive glial

contamination reduced to 18% and 31%, respectively in LCM samples. Gray bar: WT homogenate, white bar: WT LCM. Each

bar represents the mean value þ/� SEM. �po0.05; ��po0.01.

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 39

FDR, the fraction concordance eventually reaches 50%, which

corresponds to the percentage expected by chance.

To determine whether alterations might occur in P7E mice

that are below the detection threshold of microarray, poten-

tially due to their low abundance within PCs in comparison to

other genes, we applied a more sensitive method, namely

real time quantitative PCR (Q-PCR). We selected mRNAs with

a p-value just above p¼0.05 that had been described to be

enriched in PCs, usually by in-situ-hybridization, compared

to other neuronal cell types and that presented with a

relatively high fold change in the P7E versus R6/2 model

comparison. Surprisingly, we discovered distinct genes that

were significantly altered in both models.

First, we focused on robust PC genes which had previously

been found to be downregulated in R6/2 cerebellar homo-

genate: Two Ca2þ binding proteins show abundant expression

in PCs: the low-onset calcium buffer parvalbumin (Pvalb) and

the fast buffer calbindin-28k (Calb1) (Hartmann and

Konnerth, 2005), both of which were downregulated in

the R6/2 model (Table 1). Furthermore, we found normally

highly-abundant PC genes to be reduced in our samples,

such as the inositol 1,4,5-triphosphate receptor 1 (Itpr1),

which releases Ca2þ from intracellular stores (Iino, 2006),

and the Purkinje cell protein 4 (Pcp4), a calmodulin-binding

protein (Kleerekoper and Putkey, 2009). The glutamate recep-

tor d 2 (Grid2), also downregulated in the R6/2 PCs, is

selectively targeted to the spines of the distal PC dendrites

in the adult cerebellum and is presumed to be involved in the

formation and stabilization of synapses, without a known

channel function (Cesa et al., 2003). Protein kinase C, g (Prkcc)

and protein kinase C, d (Prkcd), highly expressed in PCs

(Barmack et al., 2000), were both downregulated on the mRNA

level. Since PKC depends on phospholipase C, b 3 (Plcb3)

activity, we also screened for the latter and subsequently found

a significant decrease in PCs from both polyglutamine disease

models (Metzger and Kapfhammer, 2003). The PC-specific

excitatory amino acid transporter 4 (Eaat4), which is located

at high densities in the membranes of postsynaptic spines

surrounding the cleft and responsible for the majority of PC

glutamate uptake (Wadiche and Jahr, 2005), was also

downregulated.

Our data generated from the R6/2 model corroborate pre-

vious reports of alterations in cerebellar homogenates

(Table 1). This was to be expected, given that some of the

examined mRNAs are highly (Itpr1) or exclusively (Eaat4,

Grid2) expressed in PCs.

We next concentrated on Q-PCR-validation of mRNAs

whose microarray data revealed high x-fold changes in both

mouse models. Aldolase C (Aldoc), an enzyme critical for

glycolysis, is expressed in PCs and distributed in complex

longitudinal stripe-shaped compartments in the cerebellar

cortex (Sugihara and Quy, 2007). Phospholipase C, b 3 (Plcb3),

which produces inositol 1,4,5-trisphosphate and 1,2-diacyl-

glycerol, is one of the major phospholipase isoforms

expressed in PCs and is distributed in both somatodendritic

and axonal compartments (Nomura et al., 2007). Plcb3 is also

expressed in parasagittal stripes that broadly correspond to

Aldoc positive PCs (Sarna et al., 2006). Pcp2 is specifically

expressed in PCs and retinal bipolar cells (Mohn et al., 1997).

One downstream effector of Pcp2-modulated Gi/o signaling is

likely to be a P-type Ca2þ channel, which is the primary

voltage-dependent Ca2þ channel expressed in PCs (Kinoshita-

Kawada et al., 2004). Expression of all three genes (Aldoc,

Plcb3, Pcp2) was reduced in both the R6/2 and P7E models

(Table 1).

There is no known function for the gene represented by

Riken clone 3110001A13 (Fam107b), which shows a marked

reduction in SCA1 and SCA7 mouse models (Gatchel et al.,

2008). Q-PCR of laser-dissected samples revealed significant

downregulation of Fam107b mRNA in both R6/2 and P7E mice.

Validation of further genes confirmed significant changes

only for the HD mouse model: Diacylglycerol lipase, a (Dagla);

Table 1 – Cerebellar gene expression in mouse models of different polyglutamine diseases.

SCA7 (P7E, 90Q) SCA7 SCA3 SCA1 HD (R 6/2, �150Q) DRPLA

LCM LCM LCM Hom

Array qPCR Array qPCR Reported earlier

Parvalbumin Pvalb n.s. n.s. ka n.s. 0.47n kb,c kb

Calbindin 1 Calb1 n.s. n.s. ka,d n.s. 0.54nn kc

Inositol 1,4,5-tris-phosphate receptor 1 Itpr1 n.s. n.s. kf ka,d,e,g 0.47n 0.31nn kc

Purkinje cell protein 4 Pcp4 n.s. n.s. kg ka,g n.s. 0.31nn kc

Neuronal pentraxin 1 Nptx1 n.s. n.s. kg ka,g 0.35nn 0.27n kb,c kb

Glutamate receptor, ionotropic, d 2 Grid2 n.s. n.s. n.s. 0.47nn kc

Protein kinase C, g Prkcc n.s. n.s. ka n.s. 0.64n kb,c kb

Protein kinase C, d Prkcd n.s. n.s. kg n.s. 0.04nnn kb,c kb

Solute carrier family 1 (high affinity aspartate/ glutamate

transporter) member 6 (also: excitatory amino acid transporter 4)

Slc1a6/ Eaat4 n.s. n.s. ka,e n.s. 0.54nnnnn kc

Aldolase C Aldoc n.s. 0.43nn n.s. 0.50n kb

Phospholipase C, b 3 Plcb3 n.s. 0.57nn kd,g 0.25nnn 0.04n

Purkinje cell protein 2 (L7) Pcp2 n.s. 0.54nnn ka n.s. 0.31nnn

Family with sequence similarity 107, member B Fam107b n.s. 0.56n kg kg 0.18nnn 0.11nnn

Diacylglycerol lipase, a Dagla n.s. n.s. 0.39n 0.11nn

Regulator of G-protein signaling 8 Rgs8 n.s. n.s. kg kg 0.37n 0.39nn

Phosphodiesterase 9A Pde9a n.s. n.s. kg kg 0.39n 0.43nnn

Fatty acid binding protein 7, brain Fabp7 n.s. 219n n.s. n.s. mb

Comparison of mRNA changes in laser-dissected Purkinje Cells of R6/2 transgenics versus controls and of P7E transgenics versus controls, with further comparison to data generated from models for

SCA1, SCA3, SCA7 and DRPLA. Selected mRNAs were validated by Q-PCR showing the largest changes in magnitude in transgenic versus WT mice.a Serra et al. (2006).b Luthi-Carter et al. (2002b).c Luthi-Carter et al. (2002a).d Crespo-Barreto et al. (2010).e Lin et al. (2000).f Chou et al. (2008).g Gatchel et al. (2008).n po0.05.nn po0.01.nnn po0.001.

br

ai

nr

es

ea

rc

h1

48

1(

20

12

)3

7–

48

40

Fig. 2 – Dramatic downregulation of mutant ATXN7 transgene levels in P7E mice, and Pcp2 mRNA levels in SCA7 and HD mice.

(A) Realtime Q-PCR analysis of mutant ATXN7 expression levels in homogenized cerebella of P7E mice compared to control

at 6 weeks-, 15 weeks- and 2 years-of-age. Primers specific to recombinant human SCA7 were used and normalized to Actb.

Mutant SCA7 mRNA levels are quantified as the ratio of the levels measured in 6-week-old P7E mice. A downregulation of

mutant SCA7 transgene mRNA was detected at 15 weeks-of-age. Each bar represents the mean value þ/� SEM. (B) Expression

level of Pcp2 in laser-dissected PCs of P7E and R6/2 mice versus control mice. Q-PCR shows a significant, progressive loss of

Pcp2 mRNA in P7E mice at 6 weeks-, 15 weeks- and 2 years-of-age. A similar downregulation was detected in 12-week-old

R6/2 mice in which expression of Pcp2 was not driven by the Pcp2-promoter. Pcp2 levels are presented as percentage of the

mean value þ/� SEM of control WT mice. �po0.05; ��po0.01; ���po0.001.

Fig. 3 – Density of calbindin- and Pcp2-positive PCs in P7E mice. Immunostaining for calbindin (A, B) and Pcp2 (D, E) on

sagittal brain sections and subsequent quantification revealed a highly significant reduced number of labeled Purkinje cells

per 100 lm in P7E mutants in comparison to P7N control animals (C, F). Data are expressed as mean7SEM. (po0.001). Scale

bar: A, B, D, E 100 lm.

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 41

cGMP-specific cyclic nucleotide phosphodiesterase 9A

(Pde9a), whose mRNA was found at highest concentrations

in the PC layer (Andreeva et al., 2001); and the Regulator of G

protein signaling 8 (Rgs8) that is enriched in PCs (Saitoh et al.,

2003).

Further, microarray analysis showed a pronounced upre-

gulation of brain fatty acid-binding protein (Fabp7) for P7E

mice, which was confirmed via Q-PCR. Fatty acid-binding

proteins may play a role in neuronal degeneration and repair,

and have widely been implicated in cell growth and differ-

entiation (Gerstner et al., 2008).

To analyze gene expression at the translational level, we

used immunohistochemistry to measure the density of Calb1-

positive Purkinje neurons in adult P7E mice (n¼3 animals per

genotype). Immunofluorescence staining revealed a loss of

Calb1-positive perikarya. We found that P7E mutant mice

exhibited a decrease in Calb1-positive Purkinje neurons per

length by �25% compared to P7N control animals (Fig. 3A, B,

and C). A similar effect was observed in PCs subjected to the

R6/2 model (Fig. 4A, B, and C).

2.3. Evidence for specific gene dysregulation mediated bythe Pcp2-promoter

Since mutant SCA7 transgene expression is controlled by the

Pcp2-promoter in the P7E mouse model and Pcp2 was found

to be decreased in the laser-dissected PCs (Table 1), we

hypothesized that human ATXN7 transgene expression

would also be affected. Analysis of ATXN7 levels at 6

weeks-, 15 weeks- and 2 years-of-age revealed the progres-

sive downregulation of mutant ATXN7, with more than a

30-fold reduction by 2 years-of-age (Fig. 2A).

Fig. 4 – Density of calbindin-positive PCs in R6/2 mice. Immunostaining for calbindin (A, B) on sagittal brain sections.

Quantitative analysis showed a significant reduction in PC number per 100 lm in R6/2 mice versus controls (C). Mean values

þ/� SEM are presented po 0.05. Scale bar: A, B 200 lm.

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 842

In 6-week-old P7E mice Pcp2 Q-PCR already showed a

significant loss of up to two-fold (Fig. 2B). Time course

analysis revealed that this downregulation was progressive,

leading to a 7-fold reduction after 2 years. Intriguingly, a

decrease in Pcp2 mRNA expression could also be detected in

12-week-old R6/2 mice, although transgene expression of

mutant human huntingtin is not driven by the Pcp2-promoter.

Density measurements of immunopositive cells confirmed

a reduction in Pcp2 at the protein level, whereby Pcp2-

positive PCs were �50% less frequent in P7E mutants com-

pared to P7N animals (Fig. 3D, E, and F).

Together, these results indicate that polyQ expansions

repress Pcp2-promoter activity because both endogenous

Pcp2 (in the R6/2 and P7E model) and Pcp2 promoter-driven

ATXN7 expression are affected. These changes in gene

expression are induced by two unrelated polyQ proteins

and are therefore not specific to the mutant ATXN7.

3. Discussion

This is the first LCM study comparing PC mRNA expression in

mouse models of two different CAG triplet repeat diseases.

Our data reveal novel changes in gene expression in the

cerebellum and provide further evidence for shared mechan-

isms in the etiology of the two polyglutamine diseases.

3.1. Consistency of methods and results

A previous study on whole cerebellar homogenates from R6/2

mice (Luthi-Carter et al., 2002a) revealed a downregulation of

PC-specific genes such as Grid2 and Eaat4 (Wadiche and Jahr,

2005). As expected, these genes were also found to be down-

regulated in R6/2 LCM samples, which mainly contain neu-

ronal mRNA. Furthermore, a number of the cerebellar genes

previously-reported to undergo gene dysregulation, such as

Pvalb, Calb1, Itpr1, Pcp4, Prkcd and Prkcc, could be linked

strongly to the PC environment (Luthi-Carter et al., 2002a,

Luthi-Carter et al., 2002b). Thus, our results in R6/2 LCM

material are in good agreement with previous reports.

Moreover, our findings reveal novel alterations in gene

expression, not previously detected in cerebellar homoge-

nates, i.e. a decrease in Aldoc, Plcb3 and Pcp2 in both PolyQ

disorder models. Only low levels of Aldoc and Plcb3 were

detected in PC-perikarya-enriched LCM samples because these

genes are cytoarchitectonically grouped in stripes within the

PC layer. Therefore they may not have been in every PC that

was harvested. This can explain the low expression level and

why those alterations were not detected as significantly

changed in the arrays but only by Q-PCR. Thus our study

was able to unmask otherwise hidden changes in gene

expression by the use of the highly-sensitive Q-PCR method.

We ensured the collection of representative samples by

harvesting PCs from sections across the entire cerebellar

hemisphere. Further evidence for the representative collec-

tion of PCs in this study is provided by the observation that

mRNAs known to be equally distributed in adult mouse

cerebellum (Fabp7, Pcp2, Fam107b) also underwent dysregu-

lation, while concordantly higher Phospholipase C, b 4 (Plcb4)

levels that might have resulted from Plcb4 and Plcb3 being

complementarily expressed in PCs were absent.

3.2. Region-specific alterations in transcription

Some of the detected changes in R6/2 cerebellar PCs overlap

with the changes observed in R6/2 striatum (Pcp4, Itpr1,

Calb1). Our data detected affected genes that were not pre-

viously reported to be altered: Aldoc, Plcß3 and Pcp2. Earlier

studies comparing R6/2 striatal and cerebellar homogenates

suggested that only a small cohort of dysregulated genes was

simultaneously altered in both regions (Luthi-Carter et al.,

2002a). Moreover, our LCM data pertain to genes expressed

exclusively in the cerebellum (i.e. PC-specific Eaat4, Grid2 and

Pcp2). Our data could also be the result of differentially-

expressed genes in neuronal subpopulations, as demon-

strated by previous LCM studies (Zucker et al., 2005, 2010).

Review of the literature reveals that the mRNAs downregulated

in our study have also been reported to be altered in cerebellar

tissue from other polyglutamine disease mouse models (see

Table 1). However, the real overlap may even be higher, as full

data sets are not always presented. Most of the dysregulated

mRNAs in our study were also downregulated in further polyQ

models, either in another SCA7 model (Gatchel et al., 2008), or in

SCA1 (Lin et al., 2000; Crespo-Barreto et al., 2010), or in SCA 3

(Chou et al., 2008) or in DRPLA (Luthi-Carter et al., 2002b).

The fact that our data are comparable to the results from

other polyQ disease models strengthens the hypothesis that

these particular mRNAs play a role in polyQ pathology.

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 43

3.3. Pcp2-promoter repression as an early event inpolyglutamine disease pathogenesis

One mechanism suggested to explain the region-specific

alterations in transcription is promoter repression. In our

study, we demonstrated early and pronounced downregula-

tion of Pcp2, as well as a progressive and dramatic reduction

in Pcp2-driven human ATXN7 in P7E mice. Further evidence

for involvement of the Pcp2-promoter in polyglutamine

mediated pathogenesis is provided by the observation of

significant downregulation of Pcp2 in R6/2 mice. The trans-

gene (a portion of the human HD gene) is driven by human

promoter elements (Mangiarini et al., 1996), rather than by

mouse Pcp2-promoter elements. This points to a shared

pathogenic event caused by two different polyQ proteins in

the same anatomical context.

Of the nine polyQ diseases, seven are associated with

nuclear inclusions, for which there is evidence for a role in

transcription regulation (Garden and La Spada, 2008). Neuro-

nal inclusions are assumed to sequester transcription factors

(Cha, 2007). Both models in our study are known to have

aggregates in PCs at the ages at which they were used for our

experiments.

Both Atxn7 and htt have been shown to regulate transcrip-

tion (Nucifora Jr. et al., 2001; Dunah et al., 2002; Helmlinger

et al., 2004b), where alterations in gene transcription were

reported to be an early event in disease pathogenesis (Luthi-

Carter et al., 2000). Thus, our results of both polyQ models

confirm transcriptional dysregulation.

The retina is another tissue that characteristically shows

severe affection in SCA7. Transcriptional alterations to

photoreceptor-specific genes in different SCA7 models

revealed that the molecular pathways underlying rod dys-

function are identical (La Spada et al., 2001; Yoo et al., 2003). In

particular, one study investigated the retina in both R6/2 and

R7E mice (Helmlinger et al., 2004a). Like the P7E model, R7E

animals carry full-length human ATXN7 comprising about 90

CAG-repeats, which is expressed under rhodopsin (Rho) pro-

moter control (Yvert et al., 2000). Helmlinger et al. described a

near complete loss of transgene expression and a progressive

downregulation of Rho mRNA in R7E mice. Our observations

revealed similar dynamics, with a progressive downregulation

of Pcp2 (equivalent to Rho) and ultimately a subtotal loss of

transgene expression. The observed repression in PCs occurs

later than in rods. This time-course difference between P7E

and R7E correlates with the different onset of pathological

changes and clinical features in these two models (Yvert et al.,

2000). In addition, Helmlinger et al. reported a significant

downregulation of Rho in the retina of 10-week-old R6/2

animals, which is comparable to Pcp2 downregulation in

PCs of 12-week-old R6/2 animals (Fig. 2). These parallel

changes, even in a mouse model of another polyglutamine

disease that is not driven via the Pcp2-promoter, indicate that

promoter repression is not just an artifact or a coincidence.

A model-specific explanation for ATXN7 transgene down-

regulation is a possible lack of repressor and enhancer

elements influencing the Pcp2-promoter of the P7E model

(Oberdick et al., 1993).

Sense and antisense transcripts from the repeat region

may cause toxicity: One transcript acts through an RNA

gain-of-function pathway and the other may yield a toxic

poly-amino acid tract-containing protein. Expression of

mutant transcripts may further cause the formation of CAG

repeat foci which, in turn, trigger aberrant splicing (La Spada

and Taylor, 2010; Krzyzosiak et al., 2012).

For ATXN7 (Sopher et al., 2011) and huntingtin (Chung

et al., 2011), the existence of antisense RNA transcripts can

cause promoter repression. Recently, an epigenetic process at

triplet-repeat binding sites for CTCF was discovered, whereby

a non-coding antisense RNA transcript governs ATXN7 gene

expression by activating an ATXN7 alternative promoter.

Convergent transcription in cis leads to the repression of

the promoter (Sopher et al., 2011).

The progressive downregulation of the ATXN7 transgene

(Fig. 2) may reflect the loss of de-repression through the

sequestration of transcription factors into growing aggre-

gates. Initially, ATXN7 may be overexpressed because of cis-

effects of the expanded CAG repeat (Sopher et al., 2011). This

overexpression will then be mitigated throughout the life-

span as factors necessary for Pcp2 promoter-dependent

transcription are sequestered into aggregates. Aggregates

have been observed in the P7E model at 15 weeks, a time

point at which downregulation of ATXN7 occurs. Binding of

transcription factors may also cause downregulation of the

endogenous gene, while short CAG repeat RNAs may alter

expression levels through silencing of repeat-containing

mRNAs (Rudnicki et al., 2012).

Characteristic transcriptional alterations in PCs may also

occur in a more global manner. In accordance with another

SCA1 study that used a subtraction strategy (Serra et al.,

2004), our SCA7 Q-PCR validation approach uncovered the

downregulation of mRNAs that are mediated via Retinoic acid

receptor-related Orphan Receptor a (Rora). Rora-dependent

genes include Pcp2, Itpr1 and Eaat4 (Gold et al., 2003) and

indeed, all of these genes were downregulated in R6/2 LCM

material. Similarly, in P7E mice Pcp2 was repressed in laser-

dissected PCs and Itpr1 was downregulated in whole cere-

bellar homogenates. Such a downregulation is reminiscent of

the staggerer mouse that carries a deletion of Rora (Hamilton

et al., 1996) further suggesting a link between this gene and

cerebellar dysfunction and clinical ataxia. An involvement of

Rora in SCA7 pathogenesis also emerges from the fact that

expanded ataxin-7 represses Rora activity (Strom et al., 2005).

3.4. Reduced mRNA levels suggest an increased potentialfor excitotoxic events

Our study has revealed the downregulation of distinct PC

mRNAs in mouse models of two different polyglutamine

diseases. Among these are Plcb3, Aldoc and Eaat4 (see

Table 1). Eaat4 is normally highly enriched in the membranes

of postsynaptic spines surrounding the cleft and is respon-

sible for the vast majority of glutamate uptake by PCs

(Wadiche and Jahr, 2005). In R6/2 mice, however, Eaat4 mRNA

was significantly reduced. Interestingly, dark cell degenera-

tion in PCs was observed in SCA7 mice expressing polyQ

in Bergmann Glia (BG) and led to the downregulation of the

BG-specific glutamate transporter GLAST (Custer et al., 2006).

GLAST has been localized to the portions of BG membranes

facing excitatory PC synapses (Slemmer et al., 2005), suggesting

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 844

a functional relationship between Eaat4 and GLAST (Dehnes

et al., 1998). Although GLAST and Eaat4 show different kinetic

properties (Takayasu et al., 2005) the observed effects result-

ing from GLAST deficiency may also apply to a lack of Eaat4.

This has to be considered even more, as Eaat4 also serves as

glutamate-gated chloride-channel causing hyperpolarization

(Welsh et al., 2002). Furthermore, glutamate uptake capacity

in PCs appears to be essential, since astrocytes not only clear

the synaptic cleft but can also release glutamate (Slemmer

et al., 2005). Higher glutamate levels in the synaptic cleft

could result from reduced uptake caused by a lack of

essential glutamate transporters.

The glycolytic enzyme Aldoc is expressed in parasagittal

patterns similar to those of Eaat4 and both are necessary for

PCs to survive pathologically-intense synaptic input (Welsh

et al., 2002). Cortical cerebellar ischemia leads to the rela-

tively higher survival of Aldoc-positive PCs, while transfec-

tion with Aldoc siRNA leads to PC death in murine cerebellar

cultures; this effect was exacerbated after treatment with

amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)

(Slemmer et al., 2007). A reduced level of Aldoc impairs

anaerobic metabolism, which could be critical as oxidative

phosphorylation may be affected in polyglutamine diseases,

especially HD (Orr and Zoghbi, 2007). Another protective

mechanism arising from Aldoc is the possible generation of

fructose 1,6-bisphosphate (1,6-FBP) (Slemmer et al., 2007). 1,6-

FBP has a proven neuroprotective effect after excitotoxic

insults but depends on both glycolysis and phospholipase C

(Fahlman et al., 2002). Recently, a marked downregulation in

Aldoc was shown in the sticky mouse – a model with

affection of PCs and a cerebellar phenotype – which is in

good agreement with our work (Sarna and Hawkes, 2011).

Thus, a significant downregulation of Plcb3, one of the

major isoforms in PCs, and Aldoc in both mouse models may

well explain PC degeneration through a lack of neuroprotec-

tion after excitotoxic events.

In summary, this comparative study of SCA7 and HD mouse

models reveals shared molecular abnormalities in PCs. By the

use of LCM we could link previously-reported changes of

mRNA expression to PC genes and we were able to detect

alterations that have not yet been reported. Furthermore, our

data on Pcp2-promoter regulated genes gives rise to the

hypothesis of promoter repression. In the light of excitotoxic

events, our data point to novel, potential therapeutic targets

that may be common to both diseases.

4. Experimental procedure

4.1. Animals

P7E mice were obtained from the Institut de Genetique et de

Biologie Moleculaire et Cellulaire, CNRS/INSERM/ULP, Illkirch,

France. Female P7E transgenic mice carrying the mutant

human ATXN7 transgene [PolyQ90] (Yvert et al., 2000) and

WT littermates were sacrificed at 6 weeks-, 15 weeks- and 2

years-of-age. Female R6/2 mice and WT littermates were

purchased from Jackson Laboratories (Bar Harbor, ME, USA)

and sacrificed at 12 weeks-of-age. The CAG repeat length of

the R6/2 mice used for our studies was approximately 150.

The cerebella used for LCM and homogenate studies (n¼4 per

group of R6/2 mice, n¼3 per group of P7E mice) were snap

frozen and stored at �80 1C.

4.2. Mouse RNA samples and LCM

Eight mm parasagittal sections of cerebellum were cut on a

cryostat (2800 Frigocut E, Reichert-Jung, Germany) and thaw

mounted onto uncoated glass slides (Gold Seals RITE-ON micro

slides). Sections were stained with methylene blue using a

previously described protocol (Zucker et al., 2005). Purkinje cells

were dissected using the PixCell II LCM instrument (Arcturus,

Mountain View, CA, USA) and collected onto CapSureTM HS caps

covered with a thermoplastic film. The harvested cells were

solubilized from the film in extraction buffer (Arcturus Pico

PureTM RNA isolation kit) for 30 min at 42 1C and stored at

�80 1C. Solubilized laser-dissected neurons underwent RNA

extraction according to the Pico PureTM RNA isolation kit

instructions (Arcturus), which included a DNAse treatment step

(Qiagen, Valencia, CA, USA). Whole cerebellum samples were

homogenized and RNA was extracted using TRI reagent (Sigma-

Aldrich, Steinheim, Germany) followed by RNeasy column clean

up (Qiagen) according to the manufacturer’s protocols. RNA

from both laser-dissected and homogenized samples was pre-

cipitated in order to achieve volume reduction.

4.3. Microarray sample processing

RNA from 2400 laser-dissected PCs per sample (n¼4 for 12-week-

old R6/2 mice and n¼3 for 15-week-old P7E mice) was used to

prepare biotinylated fragmented cRNA with products from Affy-

metrix and according to the GeneChips Eukaryotic Small Sample

Target Labeling Protocol. Mouse Genome 430 2.0 GeneChips

Arrays (Affymetrix) were hybridized for 16 h, then washed,

stained, and scanned using an Affymetrix Fluidics Station and

Scanner (Brain Mind Institute, Array Facility, �Ecole Polytechnique

Federale de Lausanne (EPFL), Lausanne, Switzerland).

4.4. Microarray analysis

Selected array measures were reported from Affymetrix GCOS

software; microarray data analyses were performed using R and

Bioconductor packages (http://www.bioconductor.org). To com

pare gene expression in PCs from P7E transgenic versus WT and

R6/2 versus WT animals, we normalized 14 microarrays

together and quantified gene expression using a robust

multi-array analysis implemented in the R package affy

(Bolstad et al., 2003; Irizarry et al., 2003; Gautier et al., 2004).

We identified genes differentially expressed in R6/2 LCM com

pared to WT LCM by computing empirical Bayes t-statistics

with the R package limma (Smyth, 2004). P values were

corrected for multiple testing using the False Discovery Rate

(FDR) method (cutoff FDR po0.05) (Benjamini, 1995). Microarray

annotation was performed using the R package annotation

tools (Kuhn et al., 2008) and Affymetrix annotation data.

4.5. Q-PCR assays

Reverse transcription of RNA derived from PCs was con-

ducted with a SuperScriptTM First Strand Synthesis System

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 45

for reverse transcription-PCR (Invitrogen, Carlsbad, CA USA)

using random hexamer primers according to the manufac-

turer’s instructions. Q-PCR assays with 50 cycles were per-

formed with a Bio-Rad iCycler using SYBR-Green PCR Master

Mix (Applied Biosystems, Foster City, CA, USA) as previously

described (Zucker et al., 2005). Each cDNA sample, equivalent

to the amount of RNA extracted from 25 laser-dissected

neurons, was run in triplicate for the target gene and the

normalizing gene in the same 96-well plate. Amplicon speci-

ficity was monitored by the melt curve analysis at the end of

the run, a gel electrophoresis and DNA sequencing. Mouse

primer sequences were as follows:

Pvalb (NM_013645) AAGTTCTTCCAGATGGTGGGC, TCCT-

CCTCAATGAAGCCACTTT;

Calb1 (NM_009788) GTTGGCTCACGTCTTACCCA, GAAGCC-

GCTGTGGTCAGTAT;

Pcp4 (NM_008791) GTCAGGCCAACATGAGTGAGAG, TGA-

ATGGCCACAGCTGCA;

Nptx1 (NM_008730) TGTGTAAGGGACCAGGAGGTT, ACCCC-

TATGTTAGCCAGAGTGAC;

Grid2 (NM_008167) CTGGCGACCGCTGATTCTAT, TGGTTG-

AGGTCACCAACTGCT;

Prkcc (NM_011102) GATTGGGATAGGACATCCCGA, AATATT-

CGCCCTCCTCCTGG;

Prkcd (NM_011103) GAACTCTACCGGGCTACGTTT, GTCTA-

GCATCACATTGTCCAGC;

Eaat4 (NM_009200) ACAACAAGGCGACAGGGC, TGCCGAT-

GAAAACTGCAATG;

Aldoc (NM_009657) GATGGGCTCTTGGAACGCT, GCGTGC-

GATCACTGATTTTT;

Plcb3 (NM_008874) TGCCTGCCCTGCTTATCTACA, TAGGC-

TTACGTGCTTGATGGG;

Pcp2 (NM_008790) GGATTCTTAGTACTGTCCCCCAA, TGAA-

CCTGCCAGGGAAATG;

Fam107b (NM_025626) CGGATTCTTGGTCCTATCAGC, GTC-

ACTGAGCCAATCTTCAAGG;

Dagla (NM_198114) CATTGAGGAAGACAACTGTTGTG, GGA-

GTTTCATAGACCGCATCG;

Rgs8 (NM_026380) TGTTGCTTTCCCTGTCTCTCC, CCCAT-

TCTAAGAAGGTATGTCCA;

Pde9a (NM_008804) GACATTAAAAAGATGCGGGAGG, CGT-

CGAGGTGTCAACTTCTTGTT;

Fabp7 (NM_021272) AAGTGGTGATCCGGACACAA, CCATCC-

AACCGAACCACAG and were designed using ABI software

(primer express, ABI, USA). Actin b (Actb), Gfap, Mbp, Itpr1

primer sequences as described previously (Zucker et al., 2005).

4.6. Q-PCR data analysis

Expression of the mRNA of interest in each sample was

calculated for Q-PCR by normalization of Ct values to the

reference RNA (Actb) using the equation:

V¼ 1þ Ereferenceð ÞðCtreference

Þ= 1þ Etarget

� �ðCttarget Þ

in order to correct for potential differences in PCR amplifica-

tion efficiencies (Ferrante et al., 2003; Zucker et al., 2005). V is

the relative value of target gene normalized to reference

(Actb), E is the PCR amplification efficiency, Ct is the threshold

crossing cycle number. Differences between genotypes for

Purkinje cells were assessed using an unpaired, two-tailed

Student’s t-test.

4.7. Immunohistochemistry

Adult P7E/N mice (n¼3 for each genotype, aged 15 weeks) and

R6/2 mice/WT littermates (n¼3 for each genotype, aged 12

weeks) were deeply anesthetized with sodium pentobarbital

(Narcoren, Merial, Hallberg, Germany; 300 mg/kg body

weight) and fixed by transcardial perfusion as described

previously (Deller et al., 2000). Dehydrated, PFA-fixed brains

were embedded in paraffin wax and sectioned at 7 mm.

Immunohistochemistry for Calb1 and Pcp2 was performed

on sagittal paraffin sections as described previously (Batlle

et al., 2002). Briefly, after rehydration, sections were preincu-

bated for 60 min in blocking solution (4% horse serum

containing 0.1% Tween 20 in 1x phosphate buffered saline

(PBST)) at room temperature. Subsequently, sections were

incubated with the primary antibodies in 0.4% HS in 1x PBST

overnight at 4 1C. The following antibodies were used: rabbit-

anti-calbindin (1:1000; CB38; Swant, Bellinzona, Switzerland)

and rabbit-anti Pcp2 (1:100; ABIN390329; antibodies-online

GmbH, Aachen, Germany). After washing three times for

10 min each in 1x PBST sections were incubated in secondary

fluorochrome-conjugated antibodies (1:300; Alexa-Fluor ser-

ies, Invitrogen, Karlsruhe, Germany) for 2 h at room tempera-

ture. After rinsing in 1x PBS (three times for 10 min each),

sections were mounted on Superfrost glass slides and cover-

slipped with fluorescent mounting medium (DAKO, Glostrup,

Denmark)71 mg/ml 40, 6-Diamidin-2-phenylindol (DAPI).

4.8. Data analysis and statistics

Images were captured using an Olympus BX61 microscope

(Olympus, Europa Holding GmbH, Hamburg, Germany).

Quantification was conducted using ImageJ 1.40 analysis

software (National Institutes of Health) by a trained techni-

cian who was blinded to the genotype information. For each

section (n¼3/animal/genotype), three cerebellar folia located

most central in the slide were selected for counting. Within

each of these folia, two smaller subregions consisting of the

most distal peak (gyrus) and the most distal trough (sulcus)

were chosen. For the analysis of Purkinje cell density, the

following parameters were obtained in six subregions per

animal: number of Purkinje cells with visible calbindin- or

Pcp2-positive nuclei per length of the PC layer.

Statistical analysis was performed by using the non-

parametric Mann–Whitney-U-test. Significance was assigned

for all tests at po0.05.

Acknowledgments

The authors thank Dr. Katrin Lindenberg for valuable discus-

sions, Prof. Didier Devys for advice and providing the primer

sequences of ATXN7, Prof. Carola Haas for providing the

microscope and Jutta Peschke for excellent technical assis-

tance and Dr. Sandy Dieni for her help in finally editing the

manuscript. This work was supported by the European Union

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 846

(EU Grant no. 223524 to C.W.) and the German Research

Foundation (No. DFG ZU 125/1-1 to B.Z.).

Appendix A. Supporting information

Supplementary data associated with this article can be found

in the online version at http://dx.doi.org/10.1016/j.brainres.

2012.08.005.

r e f e r e n c e s

Andreeva, S.G., Dikkes, P., Epstein, P.M., Rosenberg, P.A., 2001.Expression of cGMP-specific phosphodiesterase 9A mRNA inthe rat brain. J. Neurosci. 21, 9068–9076.

Bang, O.Y., Lee, P.H., Kim, S.Y., Kim, H.J., Huh, K., 2004. Pontineatrophy precedes cerebellar degeneration in spinocerebellarataxia 7: MRI-based volumetric analysis. J. Neurol. Neurosurg.Psychiatry 75, 1452–1456.

Barmack, N.H., Qian, Z., Yoshimura, J., 2000. Regional and cellulardistribution of protein kinase C in rat cerebellar Purkinje cells.J. Comp. Neurol. 427, 235–254.

Batlle, E., Henderson, J.T., Beghtel, H., van den Born, M.M.,Sancho, E., Huls, G., Meeldijk, J., Robertson, J., van de Weter-ing, M., Pawson, T., Clevers, H., 2002. Beta-catenin and TCFmediate cell positioning in the intestinal epithelium by con-trolling the expression of EphB/ephrinB. Cell 111, 251–263.

Bellamy, T.C., 2006. Interactions between Purkinje neurones andBergmann glia. Cerebellum 5, 116–126.

Benjamini, H., 1995. Controlling the false discovery rate: apractical and powerful approach to multiple testing. J. R. Stat.Soc. Ser. B 57, 289–300.

Bolstad, B.M., Irizarry, R.A., Astrand, M., Speed, T.P., 2003.A comparison of normalization methods for high densityoligonucleotide array data based on variance and bias. Bioin-formatics 19, 185–193.

Byers, R.K., Gilles, F.H., Fung, C., 1973. Huntington’s disease inchildren. Neuropathologic study of four cases. Neurology 23,561–569.

Carlson, K.M., Andresen, J.M., Orr, H.T., 2009. Emerging patho-genic pathways in the spinocerebellar ataxias. Curr. Opin.Genet. Dev. 19, 247–253.

Cesa, R., Morando, L., Strata, P., 2003. Glutamate receptor delta2subunit in activity-dependent heterologous synaptic competi-tion. J. Neurosci. 23, 2363–2370.

Cha, J.H., 2007. Transcriptional signatures in Huntington’s dis-ease. Prog. Neurobiol. 83, 228–248.

Chou, A.H., Yeh, T.H., Ouyang, P., Chen, Y.L., Chen, S.Y., Wang, H.L.,2008. Polyglutamine-expanded ataxin-3 causes cerebellardysfunction of SCA3 transgenic mice by inducing transcriptionaldysregulation. Neurobiol. Dis. 31, 89–101.

Chung, D.W., Rudnicki, D.D., Yu, L., Margolis, R.L., 2011. A naturalantisense transcript at the Huntington’s disease repeat locusregulates HTT expression. Hum. Mol. Genet. 20, 3467–3477.

Crespo-Barreto, J., Fryer, J.D., Shaw, C.A., Orr, H.T., Zoghbi, H.Y.,2010. Partial loss of ataxin-1 function contributes to transcrip-tional dysregulation in spinocerebellar ataxia type 1 patho-genesis. PLoS Genet. 6, e1001021.

Custer, S.K., Garden, G.A., Gill, N., Rueb, U., Libby, R.T., Schultz, C.,Guyenet, S.J., Deller, T., Westrum, L.E., Sopher, B.L., La Spada, A.R.,2006. Bergmann glia expression of polyglutamine-expandedataxin-7 produces neurodegeneration by impairing glutamatetransport. Nat. Neurosci. 9, 1302–1311.

Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H.,Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L., Bates, G.P.,

1997. Formation of neuronal intranuclear inclusions underliesthe neurological dysfunction in mice transgenic for the HDmutation. Cell 90, 537–548.

Deckel, A.W., 1995. Is Huntington’s disease of cerebellar/brain-stem origin?. Lancet 345, 263–264.

Dehnes, Y., Chaudhry, F.A., Ullensvang, K., Lehre, K.P., Storm-Mathisen, J., Danbolt, N.C., 1998. The glutamate transporterEAAT4 in rat cerebellar Purkinje cells: a glutamate-gatedchloride channel concentrated near the synapse in parts ofthe dendritic membrane facing astroglia. J. Neurosci. 18,3606–3619.

Deller, T., Merten, T., Roth, S.U., Mundel, P., Frotscher, M., 2000.Actin-associated protein synaptopodin in the rat hippocampalformation: localization in the spine neck and close associationwith the spine apparatus of principal neurons. J. Comp.Neurol. 418, 164–181.

Dunah, A.W., Jeong, H., Griffin, A., Kim, Y.M., Standaert, D.G.,Hersch, S.M., Mouradian, M.M., Young, A.B., Tanese, N.,Krainc, D., 2002. Sp1 and TAFII130 transcriptional activitydisrupted in early Huntington’s disease. Science 296,2238–2243.

Fahlman, C.S., Bickler, P.E., Sullivan, B., Gregory, G.A., 2002.Activation of the neuroprotective ERK signaling pathway byfructose-1,6-bisphosphate during hypoxia involves intracellu-lar Ca2þ and phospholipase C. Brain Res. 958, 43–51.

Ferrante, R.J., Kubilus, J.K., Lee, J., Ryu, H., Beesen, A., Zucker, B.,Smith, K., Kowall, N.W., Ratan, R.R., Luthi-Carter, R., Hersch, S.M.,2003. Histone deacetylase inhibition by sodium butyratechemotherapy ameliorates the neurodegenerative phenotype inHuntington’s disease mice. J. Neurosci. 23, 9418–9427.

Garden, G.A., La Spada, A.R., 2008. Molecular pathogenesis andcellular pathology of spinocerebellar ataxia type 7 neurode-generation. Cerebellum 7, 138–149.

Gatchel, J.R., Watase, K., Thaller, C., Carson, J.P., Jafar-Nejad, P.,Shaw, C., Zu, T., Orr, H.T., Zoghbi, H.Y., 2008. The insulin-likegrowth factor pathway is altered in spinocerebellar ataxiatype 1 and type 7. Proc. Nat. Acad. Sci. USA 105, 1291–1296.

Gatchel, J.R., Zoghbi, H.Y., 2005. Diseases of unstable repeatexpansion: mechanisms and common principles. Nat. Rev.Genet. 6, 743–755.

Gautier, L., Cope, L., Bolstad, B.M., Irizarry, R.A., 2004.affy—analysis of Affymetrix GeneChip data at the probe level.Bioinformatics 20, 307–315.

Gerstner, J.R., Bremer, Q.Z., Vander Heyden, W.M., Lavaute, T.M.,Yin, J.C., Landry, C.F., 2008. Brain fatty acid binding protein(Fabp7) is diurnally regulated in astrocytes and hippocampalgranule cell precursors in adult rodent brain. PLoS One 3, e1631.

Gold, D.A., Baek, S.H., Schork, N.J., Rose, D.W., Larsen, D.D.,Sachs, B.D., Rosenfeld, M.G., Hamilton, B.A., 2003. RORalphacoordinates reciprocal signaling in cerebellar developmentthrough sonic hedgehog and calcium-dependent pathways.Neuron 40, 1119–1131.

Hamilton, B.A., Frankel, W.N., Kerrebrock, A.W., Hawkins, T.L.,FitzHugh, W., Kusumi, K., Russell, L.B., Mueller, K.L., vanBerkel, V., Birren, B.W., Kruglyak, L., Lander, E.S., 1996. Dis-ruption of the nuclear hormone receptor RORalpha in stag-gerer mice. Nature 379, 736–739.

Hartmann, J., Konnerth, A., 2005. Determinants of postsynapticCa2þ signaling in Purkinje neurons. Cell Calcium 37, 459–466.

Helmlinger, D., Abou-Sleymane, G., Yvert, G., Rousseau, S., Weber,C., Trottier, Y., Mandel, J.L., Devys, D., 2004a. Disease progres-sion despite early loss of polyglutamine protein expression inSCA7 mouse model. J. Neurosci. 24, 1881–1887.

Helmlinger, D., Hardy, S., Sasorith, S., Klein, F., Robert, F., Weber, C.,Miguet, L., Potier, N., Van-Dorsselaer, A., Wurtz, J.M., Mandel,J.L., Tora, L., Devys, D., 2004b. Ataxin-7 is a subunit of GCN5histone acetyltransferase-containing complexes. Hum. Mol.Genet. 13, 1257–1265.

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 47

Iino, M., 2006. Ca2þ-dependent inositol 1,4,5-trisphosphate andnitric oxide signaling in cerebellar neurons. J. Pharmacol. Sci.100, 538–544.

Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B., Speed, T.P.,2003. Summaries of Affymetrix GeneChip probe level data. Nucl.Acids Res. 31, e15.

Jeste, D.V., Barban, L., Parisi, J., 1984. Reduced Purkinje cell densityin Huntington’s disease. Exp. Neurol. 85, 78–86.

Kinoshita-Kawada, M., Oberdick, J., Xi Zhu, M., 2004. A Purkinjecell specific GoLoco domain protein, L7/Pcp-2, modulatesreceptor-mediated inhibition of Cav2.1 Ca2þ channels in adose-dependent manner. Mol. Brain Res. 132, 73–86.

Kleerekoper, Q.K., Putkey, J.A., 2009. PEP-19, an intrinsicallydisordered regulator of calmodulin signaling. J. Biol. Chem.284, 7455–7464.

Knopfel, T., Grandes, P., 2002. Metabotropic glutamate receptorsin the cerebellum with a focus on their function in Purkinjecells. Cerebellum 1, 19–26.

Krzyzosiak, W.J., Sobczak, K., Wojciechowska, M., Fiszer, A.,Mykowska, A., Kozlowski, P., 2012. Triplet repeat RNA struc-ture and its role as pathogenic agent and therapeutic target.Nucl. Acids Res. 40, 11–26.

Kuhn, A., Luthi-Carter, R., Delorenzi, M., 2008. Cross-species andcross-platform gene expression studies with thebioconductor-compliant R package ‘annotationTools’. BMCBioinformatics 9, 26.

La Spada, A.R., Fu, Y.H., Sopher, B.L., Libby, R.T., Wang, X., Li, L.Y.,Einum, D.D., Huang, J., Possin, D.E., Smith, A.C., Martinez, R.A.,Koszdin, K.L., Treuting, P.M., Ware, C.B., Hurley, J.B., Ptacek, L.J.,Chen, S., 2001. Polyglutamine-expanded ataxin-7 antagonizesCRX function and induces cone-rod dystrophy in a mouse modelof SCA7. Neuron 31, 913–927.

La Spada, A.R., Taylor, J.P., 2010. Repeat expansion disease:progress and puzzles in disease pathogenesis. Nat. Rev. Genet.11, 247–258.

Li, S.H., Cheng, A.L., Zhou, H., Lam, S., Rao, M., Li, H., Li, X.J., 2002.Interaction of Huntington disease protein with transcriptionalactivator Sp1. Mol. Cell. Biol. 22, 1277–1287.

Lin, X., Antalffy, B., Kang, D., Orr, H.T., Zoghbi, H.Y., 2000.Polyglutamine expansion down-regulates specific neuronalgenes before pathologic changes in SCA1. Nat. Neurosci. 3,157–163.

Luthi-Carter, R., Hanson, S.A., Strand, A.D., Bergstrom, D.A.,Chun, W., Peters, N.L., Woods, A.M., Chan, E.Y., Kooperberg, C.,Krainc, D., Young, A.B., Tapscott, S.J., Olson, J.M., 2002a.Dysregulation of gene expression in the R6/2 model of poly-glutamine disease: parallel changes in muscle and brain. Hum.Mol. Genet. 11, 1911–1926.

Luthi-Carter, R., Strand, A., Peters, N.L., Solano, S.M., Hollings-worth, Z.R., Menon, A.S., Frey, A.S., Spektor, B.S., Penney, E.B.,Schilling, G., Ross, C.A., Borchelt, D.R., Tapscott, S.J., Young, A.B.,Cha, J.H., Olson, J.M., 2000. Decreased expression of striatalsignaling genes in a mouse model of Huntington’s disease.Hum. Mol. Genet. 9, 1259–1271.

Luthi-Carter, R., Strand, A.D., Hanson, S.A., Kooperberg, C., Schil-ling, G., La Spada, A.R., Merry, D.E., Young, A.B., Ross, C.A.,Borchelt, D.R., Olson, J.M., 2002b. Polyglutamine and transcrip-tion: gene expression changes shared by DRPLA and Hunting-ton’s disease mouse models reveal context-independenteffects. Hum. Mol. Genet. 11, 1927–1937.

Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A.,Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H.,Davies, S.W., Bates, G.P., 1996. Exon 1 of the HD gene with anexpanded CAG repeat is sufficient to cause a progressiveneurological phenotype in transgenic mice. Cell 87, 493–506.

Metzger, F., Kapfhammer, J.P., 2003. Protein kinase C: its role inactivity-dependent Purkinje cell dendritic development andplasticity. Cerebellum 2, 206–214.

Mohn, A.R., Feddersen, R.M., Nguyen, M.S., Koller, B.H., 1997.

Phenotypic analysis of mice lacking the highly abundant

Purkinje cell- and bipolar neuron-specific PCP2 protein. Mol.

Cell. Neurosci. 9, 63–76.Nomura, S., Fukaya, M., Tsujioka, T., Wu, D., Watanabe, M., 2007.

Phospholipase Cbeta3 is distributed in both somatodendritic

and axonal compartments and localized around perisynapse

and smooth endoplasmic reticulum in mouse Purkinje cell

subsets. Eur. J. Neurosci. 25, 659–672.Nucifora Jr., F.C., Sasaki, M., Peters, M.F., Huang, H., Cooper, J.K.,

Yamada, M., Takahashi, H., Tsuji, S., Troncoso, J., Dawson, V.L.,

Dawson, T.M., Ross, C.A., 2001. Interference by huntingtin and

atrophin-1 with cbp-mediated transcription leading to cellular

toxicity. Science 291, 2423–2428.Oberdick, J., Schilling, K., Smeyne, R.J., Corbin, J.G., Bocchiaro, C.,

Morgan, J.I., 1993. Control of segment-like patterns of gene

expression in the mouse cerebellum. Neuron 10, 1007–1018.Orr, H.T., Zoghbi, H.Y., 2007. Trinucleotide repeat disorders. Annu.

Rev. Neurosci. 30, 575–621.Rudnicki, D.D., Margolis, R.L., Pearson, C.E., Krzyzosiak, W.J., 2012.

Diced triplets expose neurons to RISC. PLoS Genet. 8,

e1002545.Saitoh, O., Masuho, I., Itoh, M., Abe, H., Komori, K., Odagiri, M.,

2003. Distribution of regulator of G protein signaling 8 (RGS8)

protein in the cerebellum. Cerebellum 2, 154–160.Sarna, J.R., Hawkes, R., 2011. Patterned Purkinje cell loss in the

ataxic sticky mouse. Eur. J. Neurosci. 34, 79–86.Sarna, J.R., Marzban, H., Watanabe, M., Hawkes, R., 2006. Com-

plementary stripes of phospholipase Cbeta3 and Cbeta4

expression by Purkinje cell subsets in the mouse cerebellum.

J. Comp. Neurol. 496, 303–313.Serra, H.G., Byam, C.E., Lande, J.D., Tousey, S.K., Zoghbi, H.Y., Orr, H.T.,

2004. Gene profiling links SCA1 pathophysiology to glutamate

signaling in Purkinje cells of transgenic mice. Hum. Mol. Genet.

13, 2535–2543.RORalpha-mediated Purkinje cell development determines dis-

ease severity in adult SCA1 mice. 2006.Serra, H.G., Duvick, L.,

Zu T., Carlson K., Stevens S., Jorgensen N., Lysholm A, Burright

E, Zoghbi HY, Clark HB, Andresen JM, Orr HT.Cell;127(4):697-

708.Slemmer, J.E., De Zeeuw, C.I., Weber, J.T., 2005. Don’t get too

excited: mechanisms of glutamate-mediated Purkinje cell

death. Prog. Brain Res. 148, 367–390.Slemmer, J.E., Haasdijk, E.D., Engel, D.C., Plesnila, N., Weber, J.T.,

2007. Aldolase C-positive cerebellar Purkinje cells are resistant

to delayed death after cerebral trauma and AMPA-mediated

excitotoxicity. Eur. J. Neurosci. 26, 649–656.Smyth, G.K., 2004. Linear models and empirical bayes methods

for assessing differential expression in microarray experi-

ments. Stat. Appl. Genet. Mol. Biol. 3, 1–29.Sopher, B.L., Ladd, P.D., Pineda, V.V., Libby, R.T., Sunkin, S.M.,

Hurley, J.B., Thienes, C.P., Gaasterland, T., Filippova, G.N., La

Spada, A.R., 2011. CTCF regulates ataxin-7 expression through

promotion of a convergently transcribed, antisense noncoding

RNA. Neuron 70, 1071–1084.Strom, A.L., Forsgren, L., Holmberg, M., 2005. A role for both wild-

type and expanded ataxin-7 in transcriptional regulation.

Neurobiol. Dis. 20, 646–655.Sugihara, I., Quy, P.N., 2007. Identification of aldolase C compart-

ments in the mouse cerebellar cortex by olivocerebellar

labeling. J. Comp. Neurol. 500, 1076–1092.Takayasu, Y., Iino, M., Kakegawa, W., Maeno, H., Watase, K.,

Wada, K., Yanagihara, D., Miyazaki, T., Komine, O., Watanabe,

M., Tanaka, K., Ozawa, S., 2005. Differential roles of glial and

neuronal glutamate transporters in Purkinje cell synapses. J.

Neurosci. 25, 8788–8793.

b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 848

Wadiche, J.I., Jahr, C.E., 2005. Patterned expression of Purkinje cellglutamate transporters controls synaptic plasticity. Nat. Neu-rosci. 8, 1329–1334.

Watanabe, M., 2008. Molecular mechanisms governing competi-tive synaptic wiring in cerebellar Purkinje cells. Tohoku J. Exp.Med. 214, 175–190.

Welsh, J.P., Yuen, G., Placantonakis, D.G., Vu, T.Q., Haiss, F.,O’Hearn, E., Molliver, M.E., Aicher, S.A., 2002. Why do Purkinjecells die so easily after global brain ischemia? Aldolase C,EAAT4, and the cerebellar contribution to posthypoxic myo-clonus. Adv. Neurol. 89, 331–359.

Yamashita, A., Makita, K., Kuroiwa, T., Tanaka, K., 2006. Gluta-mate transporters GLAST and EAAT4 regulate postischemicPurkinje cell death: an in vivo study using a cardiac arrestmodel in mice lacking GLAST or EAAT4. Neurosci. Res. 55,264–270.

Yoo, S.Y., Pennesi, M.E., Weeber, E.J., Xu, B., Atkinson, R., Chen, S.,Armstrong, D.L., Wu, S.M., Sweatt, J.D., Zoghbi, H.Y., 2003.SCA7 knockin mice model human SCA7 and reveal gradualaccumulation of mutant ataxin-7 in neurons and abnormal-ities in short-term plasticity. Neuron 37, 383–401.

Yvert, G., Lindenberg, K.S., Picaud, S., Landwehrmeyer, G.B.,Sahel, J.A., Mandel, J.L., 2000. Expanded polyglutaminesinduce neurodegeneration and trans-neuronal alterations incerebellum and retina of SCA7 transgenic mice. Hum. Mol.Genet. 9, 2491–2506.

Zuccato, C., Tartari, M., Crotti, A., Goffredo, D., Valenza, M., Conti,L., Cataudella, T., Leavitt, B.R., Hayden, M.R., Timmusk, T.,Rigamonti, D., Cattaneo, E., 2003. Huntingtin interacts withREST/NRSF to modulate the transcription of NRSE-controlledneuronal genes. Nat. Genet. 35, 76–83.

Zucker, B., Kama, J.A., Kuhn, A., Thu, D., Orlando, L.R., Dunah,A.W., Gokce, O., Taylor, D.M., Lambeck, J., Friedrich, B., Linden-berg, K.S., Faull, R.L., Weiller, C., Young, A.B., Luthi-Carter, R.,2010. Decreased Lin7b expression in layer 5 pyramidal neuronsmay contribute to impaired corticostriatal connectivity inhuntington disease. J. Neuropathol. Exp. Neurol. 69, 880–895.

Zucker, B., Luthi-Carter, R., Kama, J.A., Dunah, A.W., Stern, E.A., Fox,J.H., Standaert, D.G., Young, A.B., Augood, S.J., 2005. Transcriptionaldysregulation in striatal projection- and interneurons in a mousemodel of Huntington’s disease: neuronal selectivity and potentialneuroprotective role of HAP1. Hum. Mol. Genet. 14, 179–189.