Click here to load reader
Click here to load reader
Available online at www.sciencedirect.com
www.elsevier.com/locate/brainres
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8
0006-8993/$ - see frohttp://dx.doi.org/10
nCorrespondenceFax: þ49 761 270 531
E-mail address:
Research Report
Comparative analyses of Purkinje cell gene expressionprofiles reveal shared molecular abnormalities in modelsof different polyglutamine diseases
Bernd Friedricha, Philipp Eulera, Ruhtraut Zieglera, Alexandre Kuhnb,Bernhard G. Landwehrmeyerc, Ruth Luthi-Carterb, Cornelius Weillera,Sabine Hellwiga,d, Birgit Zuckera,n
aDepartment of Neurology, University Hospital Freiburg, GermanybBrain Mind Institute, �Ecole Polytechnique Federale de Lausanne (EPFL), Lausanne, SwitzerlandcDepartment of Neurology, University Hospital, Ulm, GermanydDepartment of Psychiatry and Psychotherapy, University Hospital Freiburg, Germany
a r t i c l e i n f o
Article history:
Accepted 1 August 2012
Polyglutamine (PolyQ) diseases have common features that include progressive selective
neurodegeneration and the formation of protein aggregates. There is growing evidence to
Available online 17 August 2012
Keywords:
Huntington’ s Disease
Spinocerebellar ataxia
Laser capture microdissection
Purkinje cell
Polyglutamine disease
Microarray
nt matter & 2012 Elsevie.1016/j.brainres.2012.08.0
to: Department of Neuro00.birgit.zucker@uniklinik-f
a b s t r a c t
suggest that critical nuclear events lead to transcriptional alterations in PolyQ diseases
such as spinocerebellar ataxia type 7 (SCA7) and Huntington’s disease (HD), conditions
which share a cerebellar degenerative phenotype. Taking advantage of laser capture
microdissection technique, we compared the Purkinje cell (PC) gene expression profiles
of two transgenic polyQ mouse models (HD: R6/2; SCA7: P7E) by microarray analysis that
was validated by real time quantitative PCR. A large number of transcriptional alterations
were detected in the R6/2 transgenic model of HD. Similar decreases in the same mRNAs,
such as phospholipase C, b 3, purkinje cell protein 2 (Pcp2) and aldolase C, were found in
both models. A decrease in aldolase C and phospholipase C, b 3, may lead to an increase in
the vulnerability of PCs to excitotoxic events. Furthermore, downregulation of mRNAs
mediated by the Pcp2-promoter is common in both models. Thus, our data reveal shared
molecular abnormalities in different polyQ disorders.
& 2012 Elsevier B.V. All rights reserved.
1. Introduction
Huntington’s disease (HD) and spinocerebellar ataxia type 7
(SCA7) are polyglutamine (polyQ) disorders, which are caused
by an expansion of CAG-repeats in the coding region. Seven
further diseases belong to this group of neurodegenerative
r B.V. All rights reserved.05
logy, Neurozentrum, Univ
reiburg.de (B. Zucker).
diseases: SCA1, SCA2, SCA3, SCA6 and SCA17, spinobulbar
muscular atrophy and dentatorubro-pallidoluysian atrophy
(Gatchel and Zoghbi, 2005). PolyQ expansions confer toxicity
predominantly through a gain-of-function mechanism
of the ubiquitously expressed proteins (Orr and Zoghbi,
2007).
ersity of Freiburg, Breisacher Strasse 64, 79106 Freiburg, Germany.
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 838
Although the most striking HD pathology is observed in the
striatum and cortex an important pathophysiological role for
the cerebellum in HD has been suggested (Deckel, 1995).
Similarly in SCA7, the main target area besides the retina is
the cerebellum. Accordingly, both HD and SCA7 patients show a
cerebellar phenotype characterized by morphological altera-
tions, neuronal intranuclear inclusions and atrophy, with selec-
tive loss of Purkinje cells (PCs) in advanced disease (Bang et al.,
2004) (Jeste et al., 1984). Loss of (PCs) in HD has also been
reported in several early-onset cases (Byers et al., 1973).
Studying the cerebellum provides several advantages
because of its well-described architecture and physiology. In
particular, diverse electrophysiological properties of parallel
fiber synapses and climbing fiber synapses have been eluci-
dated and subcellular compartments in PCs characterized by
different proteins have been described (Watanabe, 2008;
Knopfel and Grandes, 2002; Nomura et al., 2007). Most
recently, molecular defects have been linked to both mor-
phological and functional alterations that ultimately lead to
SCA (Carlson et al., 2009).
Mutant polyQ proteins can either interact with various
transcription-related proteins, or form a subunit of a tran-
scriptional complex, thus eliciting profound effects on gene
expression (Dunah et al., 2002; Li et al., 2002; Zuccato et al.,
2003; Helmlinger et al., 2004b). We therefore predicted similar
gene expression changes for both disease models.
While previous studies on the medium spiny neurons, the
most affected striatal cell type in HD, revealed specific mRNA
alterations (Zucker et al., 2005; Cha, 2007) the accompanying
cerebellar dysfunction and PC loss might also be caused at
least in part by other pathogenic events. First, the suggested
pathomechanisms for the selective loss of medium spiny
neurons in HD are not applicable to the neurotransmitter
profile of PCs, and even intracellular signal processing differs
between the two cell populations, e.g. mature PCs lack
functional N-methyl-D-aspartate (NMDA)-receptors but
uniquely express the glutamate-uptake-transporter excitatory
amino acid transporter (Eaat4) in a characteristic way
(Slemmer et al., 2005; Wadiche and Jahr, 2005). Second,
complex interactions between PCs and surrounding
Bergman-Glia (BG) – especially at parallel fiber and climbing
fiber synapses – seem to be more important in preventing
glutamate-mediated excitotoxic PC death than previously
thought (Custer et al., 2006; Dehnes et al., 1998; Yamashita
et al., 2006; Bellamy, 2006). Thus, the aim of our study was to
compare different polyglutamine disorders in the same ana-
tomical context, in order to elucidate common pathological
alterations that might point to shared pathomechanisms.
For the present study we used one of the most extensively
characterized animal models for HD: the R6/2 mouse line
developed by Mangiarini et al. (1996). R6/2 mice express the
N-terminal portion of human huntingtin, which comprises
�150 CAG repeats and is driven by the human huntingtin
promoter. This line was compared with a transgenic SCA7
model, namely the P7E line (Yvert et al., 2000) expressing
human ATAXIN 7 (ATXN7) comprising 90 CAG repeats and
driven by the Purkinje cell specific Pcp2-promoter. Both
mouse lines exhibit nuclear inclusions in PCs at the age of
12 weeks (R6/2) (Davies et al., 1997) and 16 weeks (P7E) (Yvert
et al., 2000).
2. Results
2.1. Enrichment of Purkinje cells by laser capturemicrodissection (LCM) of cerebellar samples
In preparation for microarray analysis of the laser-dissected
PC samples, we first tested the extent of neuronal enrich-
ment of cerebellar samples from wild-type (WT) animals. We
used Q-PCR to compare mRNA expression of myelin basic
protein (Mbp) as an oligodendroglial marker, glial fibrillary
acidic protein (Gfap) as an astroglial marker and parvalbumin
(Pvalb) as a marker for PCs and compared expression of these
mRNAs in whole cerebellar homogenates (comprising all cell
types) versus LCM-PC samples. LCM-PC samples showed a
significant enrichment of Pvalb by up to 6-fold when com-
pared to Pvalb expression in homogenates. This is illustrated
by a glia marker/Pvalb quotient in homogenate and LCM
material (Fig. 1). Glial contamination could be reduced to 18%
for Mbp and 31% for Gfap in LCM samples.
To identify any shared pathological changes within the
same anatomical context in the two polyglutamine disorder
models, we then performed a parallel genome-wide screen
on Affymetrix microarrays using PC samples from the P7E
and R6/2 models.
2.2. Gene expression changes in P7E and R6/2 mice
To date, DNA microarrays have not been applied to cerebellar
tissue from P7E animals to screen for mRNA alterations in
PCs expressing mutant ATXN7. Indeed, these mice reveal
neuropathological changes with nuclear inclusions in PCs at
15 weeks-of-age (Yvert et al., 2000). On the other hand, R6/2
mice have been shown to exhibit a large number of gene
expression changes in homogenates of the cerebellum at 12
weeks-of-age (Luthi-Carter et al., 2002a).
4173 (of 45037) array probesets indicated differential mRNA
expression between PCs from R6/2 versus WT animals, using
a cutoff False Discovery Rate (FDR) of po0.05 (see Methods).
Of the largest fold changes (1.75-fold or higher), 153 probesets
indicated a reduction in expression, while 39 probesets
detected increased mRNA levels.
Selected mRNAs showing differential expression in PCs are
presented in Table 1 (also see Supplementary Data Table 1 for
complete lists). RNAs from LCM PCs showing the largest
changes in magnitude in transgenic versus WT mice are
shown. Probesets for ESTs and genes without annotation
have been omitted from the table. In cases where multiple
probesets represent the same mRNA, the probeset reporting
the largest change in magnitude is shown.
Microarray analysis did not reveal any changes in P7E mice
according to the cutoff of po0.05. Relaxing the cutoff FDR for
the P7E model to 0.2 reveals a concordance for both models
(R6/2 and P7E) of 9/13 genes (i.e. 69%). A cutoff FDR of 0.25
corresponds to 55 genes significantly changed in P7E Tg
versus WT mice. The number of concordant genes is 36/55
genes (i.e. 65%) (Supplementary Data Table 2). A cut off FDR of
0.3 leads to significant alterations in 137 genes, where 83/137
are concordant (i.e. 61%). With further relaxation of the cutoff
Fig. 1 – Neuronal enrichment of LCM samples. Comparison of the glial marker (Mbp, Gfap)/neuronal marker (Pvalb) ratio
between WT cerebellar homogenates and WT LCM samples, as determined by Q-PCR. LCM Purkinje cell samples showed up
to 6-times more neuronal enrichment compared to cerebellar homogenates, with MBP-positive and GFAP-positive glial
contamination reduced to 18% and 31%, respectively in LCM samples. Gray bar: WT homogenate, white bar: WT LCM. Each
bar represents the mean value þ/� SEM. �po0.05; ��po0.01.
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 39
FDR, the fraction concordance eventually reaches 50%, which
corresponds to the percentage expected by chance.
To determine whether alterations might occur in P7E mice
that are below the detection threshold of microarray, poten-
tially due to their low abundance within PCs in comparison to
other genes, we applied a more sensitive method, namely
real time quantitative PCR (Q-PCR). We selected mRNAs with
a p-value just above p¼0.05 that had been described to be
enriched in PCs, usually by in-situ-hybridization, compared
to other neuronal cell types and that presented with a
relatively high fold change in the P7E versus R6/2 model
comparison. Surprisingly, we discovered distinct genes that
were significantly altered in both models.
First, we focused on robust PC genes which had previously
been found to be downregulated in R6/2 cerebellar homo-
genate: Two Ca2þ binding proteins show abundant expression
in PCs: the low-onset calcium buffer parvalbumin (Pvalb) and
the fast buffer calbindin-28k (Calb1) (Hartmann and
Konnerth, 2005), both of which were downregulated in
the R6/2 model (Table 1). Furthermore, we found normally
highly-abundant PC genes to be reduced in our samples,
such as the inositol 1,4,5-triphosphate receptor 1 (Itpr1),
which releases Ca2þ from intracellular stores (Iino, 2006),
and the Purkinje cell protein 4 (Pcp4), a calmodulin-binding
protein (Kleerekoper and Putkey, 2009). The glutamate recep-
tor d 2 (Grid2), also downregulated in the R6/2 PCs, is
selectively targeted to the spines of the distal PC dendrites
in the adult cerebellum and is presumed to be involved in the
formation and stabilization of synapses, without a known
channel function (Cesa et al., 2003). Protein kinase C, g (Prkcc)
and protein kinase C, d (Prkcd), highly expressed in PCs
(Barmack et al., 2000), were both downregulated on the mRNA
level. Since PKC depends on phospholipase C, b 3 (Plcb3)
activity, we also screened for the latter and subsequently found
a significant decrease in PCs from both polyglutamine disease
models (Metzger and Kapfhammer, 2003). The PC-specific
excitatory amino acid transporter 4 (Eaat4), which is located
at high densities in the membranes of postsynaptic spines
surrounding the cleft and responsible for the majority of PC
glutamate uptake (Wadiche and Jahr, 2005), was also
downregulated.
Our data generated from the R6/2 model corroborate pre-
vious reports of alterations in cerebellar homogenates
(Table 1). This was to be expected, given that some of the
examined mRNAs are highly (Itpr1) or exclusively (Eaat4,
Grid2) expressed in PCs.
We next concentrated on Q-PCR-validation of mRNAs
whose microarray data revealed high x-fold changes in both
mouse models. Aldolase C (Aldoc), an enzyme critical for
glycolysis, is expressed in PCs and distributed in complex
longitudinal stripe-shaped compartments in the cerebellar
cortex (Sugihara and Quy, 2007). Phospholipase C, b 3 (Plcb3),
which produces inositol 1,4,5-trisphosphate and 1,2-diacyl-
glycerol, is one of the major phospholipase isoforms
expressed in PCs and is distributed in both somatodendritic
and axonal compartments (Nomura et al., 2007). Plcb3 is also
expressed in parasagittal stripes that broadly correspond to
Aldoc positive PCs (Sarna et al., 2006). Pcp2 is specifically
expressed in PCs and retinal bipolar cells (Mohn et al., 1997).
One downstream effector of Pcp2-modulated Gi/o signaling is
likely to be a P-type Ca2þ channel, which is the primary
voltage-dependent Ca2þ channel expressed in PCs (Kinoshita-
Kawada et al., 2004). Expression of all three genes (Aldoc,
Plcb3, Pcp2) was reduced in both the R6/2 and P7E models
(Table 1).
There is no known function for the gene represented by
Riken clone 3110001A13 (Fam107b), which shows a marked
reduction in SCA1 and SCA7 mouse models (Gatchel et al.,
2008). Q-PCR of laser-dissected samples revealed significant
downregulation of Fam107b mRNA in both R6/2 and P7E mice.
Validation of further genes confirmed significant changes
only for the HD mouse model: Diacylglycerol lipase, a (Dagla);
Table 1 – Cerebellar gene expression in mouse models of different polyglutamine diseases.
SCA7 (P7E, 90Q) SCA7 SCA3 SCA1 HD (R 6/2, �150Q) DRPLA
LCM LCM LCM Hom
Array qPCR Array qPCR Reported earlier
Parvalbumin Pvalb n.s. n.s. ka n.s. 0.47n kb,c kb
Calbindin 1 Calb1 n.s. n.s. ka,d n.s. 0.54nn kc
Inositol 1,4,5-tris-phosphate receptor 1 Itpr1 n.s. n.s. kf ka,d,e,g 0.47n 0.31nn kc
Purkinje cell protein 4 Pcp4 n.s. n.s. kg ka,g n.s. 0.31nn kc
Neuronal pentraxin 1 Nptx1 n.s. n.s. kg ka,g 0.35nn 0.27n kb,c kb
Glutamate receptor, ionotropic, d 2 Grid2 n.s. n.s. n.s. 0.47nn kc
Protein kinase C, g Prkcc n.s. n.s. ka n.s. 0.64n kb,c kb
Protein kinase C, d Prkcd n.s. n.s. kg n.s. 0.04nnn kb,c kb
Solute carrier family 1 (high affinity aspartate/ glutamate
transporter) member 6 (also: excitatory amino acid transporter 4)
Slc1a6/ Eaat4 n.s. n.s. ka,e n.s. 0.54nnnnn kc
Aldolase C Aldoc n.s. 0.43nn n.s. 0.50n kb
Phospholipase C, b 3 Plcb3 n.s. 0.57nn kd,g 0.25nnn 0.04n
Purkinje cell protein 2 (L7) Pcp2 n.s. 0.54nnn ka n.s. 0.31nnn
Family with sequence similarity 107, member B Fam107b n.s. 0.56n kg kg 0.18nnn 0.11nnn
Diacylglycerol lipase, a Dagla n.s. n.s. 0.39n 0.11nn
Regulator of G-protein signaling 8 Rgs8 n.s. n.s. kg kg 0.37n 0.39nn
Phosphodiesterase 9A Pde9a n.s. n.s. kg kg 0.39n 0.43nnn
Fatty acid binding protein 7, brain Fabp7 n.s. 219n n.s. n.s. mb
Comparison of mRNA changes in laser-dissected Purkinje Cells of R6/2 transgenics versus controls and of P7E transgenics versus controls, with further comparison to data generated from models for
SCA1, SCA3, SCA7 and DRPLA. Selected mRNAs were validated by Q-PCR showing the largest changes in magnitude in transgenic versus WT mice.a Serra et al. (2006).b Luthi-Carter et al. (2002b).c Luthi-Carter et al. (2002a).d Crespo-Barreto et al. (2010).e Lin et al. (2000).f Chou et al. (2008).g Gatchel et al. (2008).n po0.05.nn po0.01.nnn po0.001.
br
ai
nr
es
ea
rc
h1
48
1(
20
12
)3
7–
48
40
Fig. 2 – Dramatic downregulation of mutant ATXN7 transgene levels in P7E mice, and Pcp2 mRNA levels in SCA7 and HD mice.
(A) Realtime Q-PCR analysis of mutant ATXN7 expression levels in homogenized cerebella of P7E mice compared to control
at 6 weeks-, 15 weeks- and 2 years-of-age. Primers specific to recombinant human SCA7 were used and normalized to Actb.
Mutant SCA7 mRNA levels are quantified as the ratio of the levels measured in 6-week-old P7E mice. A downregulation of
mutant SCA7 transgene mRNA was detected at 15 weeks-of-age. Each bar represents the mean value þ/� SEM. (B) Expression
level of Pcp2 in laser-dissected PCs of P7E and R6/2 mice versus control mice. Q-PCR shows a significant, progressive loss of
Pcp2 mRNA in P7E mice at 6 weeks-, 15 weeks- and 2 years-of-age. A similar downregulation was detected in 12-week-old
R6/2 mice in which expression of Pcp2 was not driven by the Pcp2-promoter. Pcp2 levels are presented as percentage of the
mean value þ/� SEM of control WT mice. �po0.05; ��po0.01; ���po0.001.
Fig. 3 – Density of calbindin- and Pcp2-positive PCs in P7E mice. Immunostaining for calbindin (A, B) and Pcp2 (D, E) on
sagittal brain sections and subsequent quantification revealed a highly significant reduced number of labeled Purkinje cells
per 100 lm in P7E mutants in comparison to P7N control animals (C, F). Data are expressed as mean7SEM. (po0.001). Scale
bar: A, B, D, E 100 lm.
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 41
cGMP-specific cyclic nucleotide phosphodiesterase 9A
(Pde9a), whose mRNA was found at highest concentrations
in the PC layer (Andreeva et al., 2001); and the Regulator of G
protein signaling 8 (Rgs8) that is enriched in PCs (Saitoh et al.,
2003).
Further, microarray analysis showed a pronounced upre-
gulation of brain fatty acid-binding protein (Fabp7) for P7E
mice, which was confirmed via Q-PCR. Fatty acid-binding
proteins may play a role in neuronal degeneration and repair,
and have widely been implicated in cell growth and differ-
entiation (Gerstner et al., 2008).
To analyze gene expression at the translational level, we
used immunohistochemistry to measure the density of Calb1-
positive Purkinje neurons in adult P7E mice (n¼3 animals per
genotype). Immunofluorescence staining revealed a loss of
Calb1-positive perikarya. We found that P7E mutant mice
exhibited a decrease in Calb1-positive Purkinje neurons per
length by �25% compared to P7N control animals (Fig. 3A, B,
and C). A similar effect was observed in PCs subjected to the
R6/2 model (Fig. 4A, B, and C).
2.3. Evidence for specific gene dysregulation mediated bythe Pcp2-promoter
Since mutant SCA7 transgene expression is controlled by the
Pcp2-promoter in the P7E mouse model and Pcp2 was found
to be decreased in the laser-dissected PCs (Table 1), we
hypothesized that human ATXN7 transgene expression
would also be affected. Analysis of ATXN7 levels at 6
weeks-, 15 weeks- and 2 years-of-age revealed the progres-
sive downregulation of mutant ATXN7, with more than a
30-fold reduction by 2 years-of-age (Fig. 2A).
Fig. 4 – Density of calbindin-positive PCs in R6/2 mice. Immunostaining for calbindin (A, B) on sagittal brain sections.
Quantitative analysis showed a significant reduction in PC number per 100 lm in R6/2 mice versus controls (C). Mean values
þ/� SEM are presented po 0.05. Scale bar: A, B 200 lm.
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 842
In 6-week-old P7E mice Pcp2 Q-PCR already showed a
significant loss of up to two-fold (Fig. 2B). Time course
analysis revealed that this downregulation was progressive,
leading to a 7-fold reduction after 2 years. Intriguingly, a
decrease in Pcp2 mRNA expression could also be detected in
12-week-old R6/2 mice, although transgene expression of
mutant human huntingtin is not driven by the Pcp2-promoter.
Density measurements of immunopositive cells confirmed
a reduction in Pcp2 at the protein level, whereby Pcp2-
positive PCs were �50% less frequent in P7E mutants com-
pared to P7N animals (Fig. 3D, E, and F).
Together, these results indicate that polyQ expansions
repress Pcp2-promoter activity because both endogenous
Pcp2 (in the R6/2 and P7E model) and Pcp2 promoter-driven
ATXN7 expression are affected. These changes in gene
expression are induced by two unrelated polyQ proteins
and are therefore not specific to the mutant ATXN7.
3. Discussion
This is the first LCM study comparing PC mRNA expression in
mouse models of two different CAG triplet repeat diseases.
Our data reveal novel changes in gene expression in the
cerebellum and provide further evidence for shared mechan-
isms in the etiology of the two polyglutamine diseases.
3.1. Consistency of methods and results
A previous study on whole cerebellar homogenates from R6/2
mice (Luthi-Carter et al., 2002a) revealed a downregulation of
PC-specific genes such as Grid2 and Eaat4 (Wadiche and Jahr,
2005). As expected, these genes were also found to be down-
regulated in R6/2 LCM samples, which mainly contain neu-
ronal mRNA. Furthermore, a number of the cerebellar genes
previously-reported to undergo gene dysregulation, such as
Pvalb, Calb1, Itpr1, Pcp4, Prkcd and Prkcc, could be linked
strongly to the PC environment (Luthi-Carter et al., 2002a,
Luthi-Carter et al., 2002b). Thus, our results in R6/2 LCM
material are in good agreement with previous reports.
Moreover, our findings reveal novel alterations in gene
expression, not previously detected in cerebellar homoge-
nates, i.e. a decrease in Aldoc, Plcb3 and Pcp2 in both PolyQ
disorder models. Only low levels of Aldoc and Plcb3 were
detected in PC-perikarya-enriched LCM samples because these
genes are cytoarchitectonically grouped in stripes within the
PC layer. Therefore they may not have been in every PC that
was harvested. This can explain the low expression level and
why those alterations were not detected as significantly
changed in the arrays but only by Q-PCR. Thus our study
was able to unmask otherwise hidden changes in gene
expression by the use of the highly-sensitive Q-PCR method.
We ensured the collection of representative samples by
harvesting PCs from sections across the entire cerebellar
hemisphere. Further evidence for the representative collec-
tion of PCs in this study is provided by the observation that
mRNAs known to be equally distributed in adult mouse
cerebellum (Fabp7, Pcp2, Fam107b) also underwent dysregu-
lation, while concordantly higher Phospholipase C, b 4 (Plcb4)
levels that might have resulted from Plcb4 and Plcb3 being
complementarily expressed in PCs were absent.
3.2. Region-specific alterations in transcription
Some of the detected changes in R6/2 cerebellar PCs overlap
with the changes observed in R6/2 striatum (Pcp4, Itpr1,
Calb1). Our data detected affected genes that were not pre-
viously reported to be altered: Aldoc, Plcß3 and Pcp2. Earlier
studies comparing R6/2 striatal and cerebellar homogenates
suggested that only a small cohort of dysregulated genes was
simultaneously altered in both regions (Luthi-Carter et al.,
2002a). Moreover, our LCM data pertain to genes expressed
exclusively in the cerebellum (i.e. PC-specific Eaat4, Grid2 and
Pcp2). Our data could also be the result of differentially-
expressed genes in neuronal subpopulations, as demon-
strated by previous LCM studies (Zucker et al., 2005, 2010).
Review of the literature reveals that the mRNAs downregulated
in our study have also been reported to be altered in cerebellar
tissue from other polyglutamine disease mouse models (see
Table 1). However, the real overlap may even be higher, as full
data sets are not always presented. Most of the dysregulated
mRNAs in our study were also downregulated in further polyQ
models, either in another SCA7 model (Gatchel et al., 2008), or in
SCA1 (Lin et al., 2000; Crespo-Barreto et al., 2010), or in SCA 3
(Chou et al., 2008) or in DRPLA (Luthi-Carter et al., 2002b).
The fact that our data are comparable to the results from
other polyQ disease models strengthens the hypothesis that
these particular mRNAs play a role in polyQ pathology.
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 43
3.3. Pcp2-promoter repression as an early event inpolyglutamine disease pathogenesis
One mechanism suggested to explain the region-specific
alterations in transcription is promoter repression. In our
study, we demonstrated early and pronounced downregula-
tion of Pcp2, as well as a progressive and dramatic reduction
in Pcp2-driven human ATXN7 in P7E mice. Further evidence
for involvement of the Pcp2-promoter in polyglutamine
mediated pathogenesis is provided by the observation of
significant downregulation of Pcp2 in R6/2 mice. The trans-
gene (a portion of the human HD gene) is driven by human
promoter elements (Mangiarini et al., 1996), rather than by
mouse Pcp2-promoter elements. This points to a shared
pathogenic event caused by two different polyQ proteins in
the same anatomical context.
Of the nine polyQ diseases, seven are associated with
nuclear inclusions, for which there is evidence for a role in
transcription regulation (Garden and La Spada, 2008). Neuro-
nal inclusions are assumed to sequester transcription factors
(Cha, 2007). Both models in our study are known to have
aggregates in PCs at the ages at which they were used for our
experiments.
Both Atxn7 and htt have been shown to regulate transcrip-
tion (Nucifora Jr. et al., 2001; Dunah et al., 2002; Helmlinger
et al., 2004b), where alterations in gene transcription were
reported to be an early event in disease pathogenesis (Luthi-
Carter et al., 2000). Thus, our results of both polyQ models
confirm transcriptional dysregulation.
The retina is another tissue that characteristically shows
severe affection in SCA7. Transcriptional alterations to
photoreceptor-specific genes in different SCA7 models
revealed that the molecular pathways underlying rod dys-
function are identical (La Spada et al., 2001; Yoo et al., 2003). In
particular, one study investigated the retina in both R6/2 and
R7E mice (Helmlinger et al., 2004a). Like the P7E model, R7E
animals carry full-length human ATXN7 comprising about 90
CAG-repeats, which is expressed under rhodopsin (Rho) pro-
moter control (Yvert et al., 2000). Helmlinger et al. described a
near complete loss of transgene expression and a progressive
downregulation of Rho mRNA in R7E mice. Our observations
revealed similar dynamics, with a progressive downregulation
of Pcp2 (equivalent to Rho) and ultimately a subtotal loss of
transgene expression. The observed repression in PCs occurs
later than in rods. This time-course difference between P7E
and R7E correlates with the different onset of pathological
changes and clinical features in these two models (Yvert et al.,
2000). In addition, Helmlinger et al. reported a significant
downregulation of Rho in the retina of 10-week-old R6/2
animals, which is comparable to Pcp2 downregulation in
PCs of 12-week-old R6/2 animals (Fig. 2). These parallel
changes, even in a mouse model of another polyglutamine
disease that is not driven via the Pcp2-promoter, indicate that
promoter repression is not just an artifact or a coincidence.
A model-specific explanation for ATXN7 transgene down-
regulation is a possible lack of repressor and enhancer
elements influencing the Pcp2-promoter of the P7E model
(Oberdick et al., 1993).
Sense and antisense transcripts from the repeat region
may cause toxicity: One transcript acts through an RNA
gain-of-function pathway and the other may yield a toxic
poly-amino acid tract-containing protein. Expression of
mutant transcripts may further cause the formation of CAG
repeat foci which, in turn, trigger aberrant splicing (La Spada
and Taylor, 2010; Krzyzosiak et al., 2012).
For ATXN7 (Sopher et al., 2011) and huntingtin (Chung
et al., 2011), the existence of antisense RNA transcripts can
cause promoter repression. Recently, an epigenetic process at
triplet-repeat binding sites for CTCF was discovered, whereby
a non-coding antisense RNA transcript governs ATXN7 gene
expression by activating an ATXN7 alternative promoter.
Convergent transcription in cis leads to the repression of
the promoter (Sopher et al., 2011).
The progressive downregulation of the ATXN7 transgene
(Fig. 2) may reflect the loss of de-repression through the
sequestration of transcription factors into growing aggre-
gates. Initially, ATXN7 may be overexpressed because of cis-
effects of the expanded CAG repeat (Sopher et al., 2011). This
overexpression will then be mitigated throughout the life-
span as factors necessary for Pcp2 promoter-dependent
transcription are sequestered into aggregates. Aggregates
have been observed in the P7E model at 15 weeks, a time
point at which downregulation of ATXN7 occurs. Binding of
transcription factors may also cause downregulation of the
endogenous gene, while short CAG repeat RNAs may alter
expression levels through silencing of repeat-containing
mRNAs (Rudnicki et al., 2012).
Characteristic transcriptional alterations in PCs may also
occur in a more global manner. In accordance with another
SCA1 study that used a subtraction strategy (Serra et al.,
2004), our SCA7 Q-PCR validation approach uncovered the
downregulation of mRNAs that are mediated via Retinoic acid
receptor-related Orphan Receptor a (Rora). Rora-dependent
genes include Pcp2, Itpr1 and Eaat4 (Gold et al., 2003) and
indeed, all of these genes were downregulated in R6/2 LCM
material. Similarly, in P7E mice Pcp2 was repressed in laser-
dissected PCs and Itpr1 was downregulated in whole cere-
bellar homogenates. Such a downregulation is reminiscent of
the staggerer mouse that carries a deletion of Rora (Hamilton
et al., 1996) further suggesting a link between this gene and
cerebellar dysfunction and clinical ataxia. An involvement of
Rora in SCA7 pathogenesis also emerges from the fact that
expanded ataxin-7 represses Rora activity (Strom et al., 2005).
3.4. Reduced mRNA levels suggest an increased potentialfor excitotoxic events
Our study has revealed the downregulation of distinct PC
mRNAs in mouse models of two different polyglutamine
diseases. Among these are Plcb3, Aldoc and Eaat4 (see
Table 1). Eaat4 is normally highly enriched in the membranes
of postsynaptic spines surrounding the cleft and is respon-
sible for the vast majority of glutamate uptake by PCs
(Wadiche and Jahr, 2005). In R6/2 mice, however, Eaat4 mRNA
was significantly reduced. Interestingly, dark cell degenera-
tion in PCs was observed in SCA7 mice expressing polyQ
in Bergmann Glia (BG) and led to the downregulation of the
BG-specific glutamate transporter GLAST (Custer et al., 2006).
GLAST has been localized to the portions of BG membranes
facing excitatory PC synapses (Slemmer et al., 2005), suggesting
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 844
a functional relationship between Eaat4 and GLAST (Dehnes
et al., 1998). Although GLAST and Eaat4 show different kinetic
properties (Takayasu et al., 2005) the observed effects result-
ing from GLAST deficiency may also apply to a lack of Eaat4.
This has to be considered even more, as Eaat4 also serves as
glutamate-gated chloride-channel causing hyperpolarization
(Welsh et al., 2002). Furthermore, glutamate uptake capacity
in PCs appears to be essential, since astrocytes not only clear
the synaptic cleft but can also release glutamate (Slemmer
et al., 2005). Higher glutamate levels in the synaptic cleft
could result from reduced uptake caused by a lack of
essential glutamate transporters.
The glycolytic enzyme Aldoc is expressed in parasagittal
patterns similar to those of Eaat4 and both are necessary for
PCs to survive pathologically-intense synaptic input (Welsh
et al., 2002). Cortical cerebellar ischemia leads to the rela-
tively higher survival of Aldoc-positive PCs, while transfec-
tion with Aldoc siRNA leads to PC death in murine cerebellar
cultures; this effect was exacerbated after treatment with
amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)
(Slemmer et al., 2007). A reduced level of Aldoc impairs
anaerobic metabolism, which could be critical as oxidative
phosphorylation may be affected in polyglutamine diseases,
especially HD (Orr and Zoghbi, 2007). Another protective
mechanism arising from Aldoc is the possible generation of
fructose 1,6-bisphosphate (1,6-FBP) (Slemmer et al., 2007). 1,6-
FBP has a proven neuroprotective effect after excitotoxic
insults but depends on both glycolysis and phospholipase C
(Fahlman et al., 2002). Recently, a marked downregulation in
Aldoc was shown in the sticky mouse – a model with
affection of PCs and a cerebellar phenotype – which is in
good agreement with our work (Sarna and Hawkes, 2011).
Thus, a significant downregulation of Plcb3, one of the
major isoforms in PCs, and Aldoc in both mouse models may
well explain PC degeneration through a lack of neuroprotec-
tion after excitotoxic events.
In summary, this comparative study of SCA7 and HD mouse
models reveals shared molecular abnormalities in PCs. By the
use of LCM we could link previously-reported changes of
mRNA expression to PC genes and we were able to detect
alterations that have not yet been reported. Furthermore, our
data on Pcp2-promoter regulated genes gives rise to the
hypothesis of promoter repression. In the light of excitotoxic
events, our data point to novel, potential therapeutic targets
that may be common to both diseases.
4. Experimental procedure
4.1. Animals
P7E mice were obtained from the Institut de Genetique et de
Biologie Moleculaire et Cellulaire, CNRS/INSERM/ULP, Illkirch,
France. Female P7E transgenic mice carrying the mutant
human ATXN7 transgene [PolyQ90] (Yvert et al., 2000) and
WT littermates were sacrificed at 6 weeks-, 15 weeks- and 2
years-of-age. Female R6/2 mice and WT littermates were
purchased from Jackson Laboratories (Bar Harbor, ME, USA)
and sacrificed at 12 weeks-of-age. The CAG repeat length of
the R6/2 mice used for our studies was approximately 150.
The cerebella used for LCM and homogenate studies (n¼4 per
group of R6/2 mice, n¼3 per group of P7E mice) were snap
frozen and stored at �80 1C.
4.2. Mouse RNA samples and LCM
Eight mm parasagittal sections of cerebellum were cut on a
cryostat (2800 Frigocut E, Reichert-Jung, Germany) and thaw
mounted onto uncoated glass slides (Gold Seals RITE-ON micro
slides). Sections were stained with methylene blue using a
previously described protocol (Zucker et al., 2005). Purkinje cells
were dissected using the PixCell II LCM instrument (Arcturus,
Mountain View, CA, USA) and collected onto CapSureTM HS caps
covered with a thermoplastic film. The harvested cells were
solubilized from the film in extraction buffer (Arcturus Pico
PureTM RNA isolation kit) for 30 min at 42 1C and stored at
�80 1C. Solubilized laser-dissected neurons underwent RNA
extraction according to the Pico PureTM RNA isolation kit
instructions (Arcturus), which included a DNAse treatment step
(Qiagen, Valencia, CA, USA). Whole cerebellum samples were
homogenized and RNA was extracted using TRI reagent (Sigma-
Aldrich, Steinheim, Germany) followed by RNeasy column clean
up (Qiagen) according to the manufacturer’s protocols. RNA
from both laser-dissected and homogenized samples was pre-
cipitated in order to achieve volume reduction.
4.3. Microarray sample processing
RNA from 2400 laser-dissected PCs per sample (n¼4 for 12-week-
old R6/2 mice and n¼3 for 15-week-old P7E mice) was used to
prepare biotinylated fragmented cRNA with products from Affy-
metrix and according to the GeneChips Eukaryotic Small Sample
Target Labeling Protocol. Mouse Genome 430 2.0 GeneChips
Arrays (Affymetrix) were hybridized for 16 h, then washed,
stained, and scanned using an Affymetrix Fluidics Station and
Scanner (Brain Mind Institute, Array Facility, �Ecole Polytechnique
Federale de Lausanne (EPFL), Lausanne, Switzerland).
4.4. Microarray analysis
Selected array measures were reported from Affymetrix GCOS
software; microarray data analyses were performed using R and
Bioconductor packages (http://www.bioconductor.org). To com
pare gene expression in PCs from P7E transgenic versus WT and
R6/2 versus WT animals, we normalized 14 microarrays
together and quantified gene expression using a robust
multi-array analysis implemented in the R package affy
(Bolstad et al., 2003; Irizarry et al., 2003; Gautier et al., 2004).
We identified genes differentially expressed in R6/2 LCM com
pared to WT LCM by computing empirical Bayes t-statistics
with the R package limma (Smyth, 2004). P values were
corrected for multiple testing using the False Discovery Rate
(FDR) method (cutoff FDR po0.05) (Benjamini, 1995). Microarray
annotation was performed using the R package annotation
tools (Kuhn et al., 2008) and Affymetrix annotation data.
4.5. Q-PCR assays
Reverse transcription of RNA derived from PCs was con-
ducted with a SuperScriptTM First Strand Synthesis System
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 45
for reverse transcription-PCR (Invitrogen, Carlsbad, CA USA)
using random hexamer primers according to the manufac-
turer’s instructions. Q-PCR assays with 50 cycles were per-
formed with a Bio-Rad iCycler using SYBR-Green PCR Master
Mix (Applied Biosystems, Foster City, CA, USA) as previously
described (Zucker et al., 2005). Each cDNA sample, equivalent
to the amount of RNA extracted from 25 laser-dissected
neurons, was run in triplicate for the target gene and the
normalizing gene in the same 96-well plate. Amplicon speci-
ficity was monitored by the melt curve analysis at the end of
the run, a gel electrophoresis and DNA sequencing. Mouse
primer sequences were as follows:
Pvalb (NM_013645) AAGTTCTTCCAGATGGTGGGC, TCCT-
CCTCAATGAAGCCACTTT;
Calb1 (NM_009788) GTTGGCTCACGTCTTACCCA, GAAGCC-
GCTGTGGTCAGTAT;
Pcp4 (NM_008791) GTCAGGCCAACATGAGTGAGAG, TGA-
ATGGCCACAGCTGCA;
Nptx1 (NM_008730) TGTGTAAGGGACCAGGAGGTT, ACCCC-
TATGTTAGCCAGAGTGAC;
Grid2 (NM_008167) CTGGCGACCGCTGATTCTAT, TGGTTG-
AGGTCACCAACTGCT;
Prkcc (NM_011102) GATTGGGATAGGACATCCCGA, AATATT-
CGCCCTCCTCCTGG;
Prkcd (NM_011103) GAACTCTACCGGGCTACGTTT, GTCTA-
GCATCACATTGTCCAGC;
Eaat4 (NM_009200) ACAACAAGGCGACAGGGC, TGCCGAT-
GAAAACTGCAATG;
Aldoc (NM_009657) GATGGGCTCTTGGAACGCT, GCGTGC-
GATCACTGATTTTT;
Plcb3 (NM_008874) TGCCTGCCCTGCTTATCTACA, TAGGC-
TTACGTGCTTGATGGG;
Pcp2 (NM_008790) GGATTCTTAGTACTGTCCCCCAA, TGAA-
CCTGCCAGGGAAATG;
Fam107b (NM_025626) CGGATTCTTGGTCCTATCAGC, GTC-
ACTGAGCCAATCTTCAAGG;
Dagla (NM_198114) CATTGAGGAAGACAACTGTTGTG, GGA-
GTTTCATAGACCGCATCG;
Rgs8 (NM_026380) TGTTGCTTTCCCTGTCTCTCC, CCCAT-
TCTAAGAAGGTATGTCCA;
Pde9a (NM_008804) GACATTAAAAAGATGCGGGAGG, CGT-
CGAGGTGTCAACTTCTTGTT;
Fabp7 (NM_021272) AAGTGGTGATCCGGACACAA, CCATCC-
AACCGAACCACAG and were designed using ABI software
(primer express, ABI, USA). Actin b (Actb), Gfap, Mbp, Itpr1
primer sequences as described previously (Zucker et al., 2005).
4.6. Q-PCR data analysis
Expression of the mRNA of interest in each sample was
calculated for Q-PCR by normalization of Ct values to the
reference RNA (Actb) using the equation:
V¼ 1þ Ereferenceð ÞðCtreference
Þ= 1þ Etarget
� �ðCttarget Þ
in order to correct for potential differences in PCR amplifica-
tion efficiencies (Ferrante et al., 2003; Zucker et al., 2005). V is
the relative value of target gene normalized to reference
(Actb), E is the PCR amplification efficiency, Ct is the threshold
crossing cycle number. Differences between genotypes for
Purkinje cells were assessed using an unpaired, two-tailed
Student’s t-test.
4.7. Immunohistochemistry
Adult P7E/N mice (n¼3 for each genotype, aged 15 weeks) and
R6/2 mice/WT littermates (n¼3 for each genotype, aged 12
weeks) were deeply anesthetized with sodium pentobarbital
(Narcoren, Merial, Hallberg, Germany; 300 mg/kg body
weight) and fixed by transcardial perfusion as described
previously (Deller et al., 2000). Dehydrated, PFA-fixed brains
were embedded in paraffin wax and sectioned at 7 mm.
Immunohistochemistry for Calb1 and Pcp2 was performed
on sagittal paraffin sections as described previously (Batlle
et al., 2002). Briefly, after rehydration, sections were preincu-
bated for 60 min in blocking solution (4% horse serum
containing 0.1% Tween 20 in 1x phosphate buffered saline
(PBST)) at room temperature. Subsequently, sections were
incubated with the primary antibodies in 0.4% HS in 1x PBST
overnight at 4 1C. The following antibodies were used: rabbit-
anti-calbindin (1:1000; CB38; Swant, Bellinzona, Switzerland)
and rabbit-anti Pcp2 (1:100; ABIN390329; antibodies-online
GmbH, Aachen, Germany). After washing three times for
10 min each in 1x PBST sections were incubated in secondary
fluorochrome-conjugated antibodies (1:300; Alexa-Fluor ser-
ies, Invitrogen, Karlsruhe, Germany) for 2 h at room tempera-
ture. After rinsing in 1x PBS (three times for 10 min each),
sections were mounted on Superfrost glass slides and cover-
slipped with fluorescent mounting medium (DAKO, Glostrup,
Denmark)71 mg/ml 40, 6-Diamidin-2-phenylindol (DAPI).
4.8. Data analysis and statistics
Images were captured using an Olympus BX61 microscope
(Olympus, Europa Holding GmbH, Hamburg, Germany).
Quantification was conducted using ImageJ 1.40 analysis
software (National Institutes of Health) by a trained techni-
cian who was blinded to the genotype information. For each
section (n¼3/animal/genotype), three cerebellar folia located
most central in the slide were selected for counting. Within
each of these folia, two smaller subregions consisting of the
most distal peak (gyrus) and the most distal trough (sulcus)
were chosen. For the analysis of Purkinje cell density, the
following parameters were obtained in six subregions per
animal: number of Purkinje cells with visible calbindin- or
Pcp2-positive nuclei per length of the PC layer.
Statistical analysis was performed by using the non-
parametric Mann–Whitney-U-test. Significance was assigned
for all tests at po0.05.
Acknowledgments
The authors thank Dr. Katrin Lindenberg for valuable discus-
sions, Prof. Didier Devys for advice and providing the primer
sequences of ATXN7, Prof. Carola Haas for providing the
microscope and Jutta Peschke for excellent technical assis-
tance and Dr. Sandy Dieni for her help in finally editing the
manuscript. This work was supported by the European Union
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 846
(EU Grant no. 223524 to C.W.) and the German Research
Foundation (No. DFG ZU 125/1-1 to B.Z.).
Appendix A. Supporting information
Supplementary data associated with this article can be found
in the online version at http://dx.doi.org/10.1016/j.brainres.
2012.08.005.
r e f e r e n c e s
Andreeva, S.G., Dikkes, P., Epstein, P.M., Rosenberg, P.A., 2001.Expression of cGMP-specific phosphodiesterase 9A mRNA inthe rat brain. J. Neurosci. 21, 9068–9076.
Bang, O.Y., Lee, P.H., Kim, S.Y., Kim, H.J., Huh, K., 2004. Pontineatrophy precedes cerebellar degeneration in spinocerebellarataxia 7: MRI-based volumetric analysis. J. Neurol. Neurosurg.Psychiatry 75, 1452–1456.
Barmack, N.H., Qian, Z., Yoshimura, J., 2000. Regional and cellulardistribution of protein kinase C in rat cerebellar Purkinje cells.J. Comp. Neurol. 427, 235–254.
Batlle, E., Henderson, J.T., Beghtel, H., van den Born, M.M.,Sancho, E., Huls, G., Meeldijk, J., Robertson, J., van de Weter-ing, M., Pawson, T., Clevers, H., 2002. Beta-catenin and TCFmediate cell positioning in the intestinal epithelium by con-trolling the expression of EphB/ephrinB. Cell 111, 251–263.
Bellamy, T.C., 2006. Interactions between Purkinje neurones andBergmann glia. Cerebellum 5, 116–126.
Benjamini, H., 1995. Controlling the false discovery rate: apractical and powerful approach to multiple testing. J. R. Stat.Soc. Ser. B 57, 289–300.
Bolstad, B.M., Irizarry, R.A., Astrand, M., Speed, T.P., 2003.A comparison of normalization methods for high densityoligonucleotide array data based on variance and bias. Bioin-formatics 19, 185–193.
Byers, R.K., Gilles, F.H., Fung, C., 1973. Huntington’s disease inchildren. Neuropathologic study of four cases. Neurology 23,561–569.
Carlson, K.M., Andresen, J.M., Orr, H.T., 2009. Emerging patho-genic pathways in the spinocerebellar ataxias. Curr. Opin.Genet. Dev. 19, 247–253.
Cesa, R., Morando, L., Strata, P., 2003. Glutamate receptor delta2subunit in activity-dependent heterologous synaptic competi-tion. J. Neurosci. 23, 2363–2370.
Cha, J.H., 2007. Transcriptional signatures in Huntington’s dis-ease. Prog. Neurobiol. 83, 228–248.
Chou, A.H., Yeh, T.H., Ouyang, P., Chen, Y.L., Chen, S.Y., Wang, H.L.,2008. Polyglutamine-expanded ataxin-3 causes cerebellardysfunction of SCA3 transgenic mice by inducing transcriptionaldysregulation. Neurobiol. Dis. 31, 89–101.
Chung, D.W., Rudnicki, D.D., Yu, L., Margolis, R.L., 2011. A naturalantisense transcript at the Huntington’s disease repeat locusregulates HTT expression. Hum. Mol. Genet. 20, 3467–3477.
Crespo-Barreto, J., Fryer, J.D., Shaw, C.A., Orr, H.T., Zoghbi, H.Y.,2010. Partial loss of ataxin-1 function contributes to transcrip-tional dysregulation in spinocerebellar ataxia type 1 patho-genesis. PLoS Genet. 6, e1001021.
Custer, S.K., Garden, G.A., Gill, N., Rueb, U., Libby, R.T., Schultz, C.,Guyenet, S.J., Deller, T., Westrum, L.E., Sopher, B.L., La Spada, A.R.,2006. Bergmann glia expression of polyglutamine-expandedataxin-7 produces neurodegeneration by impairing glutamatetransport. Nat. Neurosci. 9, 1302–1311.
Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H.,Ross, C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L., Bates, G.P.,
1997. Formation of neuronal intranuclear inclusions underliesthe neurological dysfunction in mice transgenic for the HDmutation. Cell 90, 537–548.
Deckel, A.W., 1995. Is Huntington’s disease of cerebellar/brain-stem origin?. Lancet 345, 263–264.
Dehnes, Y., Chaudhry, F.A., Ullensvang, K., Lehre, K.P., Storm-Mathisen, J., Danbolt, N.C., 1998. The glutamate transporterEAAT4 in rat cerebellar Purkinje cells: a glutamate-gatedchloride channel concentrated near the synapse in parts ofthe dendritic membrane facing astroglia. J. Neurosci. 18,3606–3619.
Deller, T., Merten, T., Roth, S.U., Mundel, P., Frotscher, M., 2000.Actin-associated protein synaptopodin in the rat hippocampalformation: localization in the spine neck and close associationwith the spine apparatus of principal neurons. J. Comp.Neurol. 418, 164–181.
Dunah, A.W., Jeong, H., Griffin, A., Kim, Y.M., Standaert, D.G.,Hersch, S.M., Mouradian, M.M., Young, A.B., Tanese, N.,Krainc, D., 2002. Sp1 and TAFII130 transcriptional activitydisrupted in early Huntington’s disease. Science 296,2238–2243.
Fahlman, C.S., Bickler, P.E., Sullivan, B., Gregory, G.A., 2002.Activation of the neuroprotective ERK signaling pathway byfructose-1,6-bisphosphate during hypoxia involves intracellu-lar Ca2þ and phospholipase C. Brain Res. 958, 43–51.
Ferrante, R.J., Kubilus, J.K., Lee, J., Ryu, H., Beesen, A., Zucker, B.,Smith, K., Kowall, N.W., Ratan, R.R., Luthi-Carter, R., Hersch, S.M.,2003. Histone deacetylase inhibition by sodium butyratechemotherapy ameliorates the neurodegenerative phenotype inHuntington’s disease mice. J. Neurosci. 23, 9418–9427.
Garden, G.A., La Spada, A.R., 2008. Molecular pathogenesis andcellular pathology of spinocerebellar ataxia type 7 neurode-generation. Cerebellum 7, 138–149.
Gatchel, J.R., Watase, K., Thaller, C., Carson, J.P., Jafar-Nejad, P.,Shaw, C., Zu, T., Orr, H.T., Zoghbi, H.Y., 2008. The insulin-likegrowth factor pathway is altered in spinocerebellar ataxiatype 1 and type 7. Proc. Nat. Acad. Sci. USA 105, 1291–1296.
Gatchel, J.R., Zoghbi, H.Y., 2005. Diseases of unstable repeatexpansion: mechanisms and common principles. Nat. Rev.Genet. 6, 743–755.
Gautier, L., Cope, L., Bolstad, B.M., Irizarry, R.A., 2004.affy—analysis of Affymetrix GeneChip data at the probe level.Bioinformatics 20, 307–315.
Gerstner, J.R., Bremer, Q.Z., Vander Heyden, W.M., Lavaute, T.M.,Yin, J.C., Landry, C.F., 2008. Brain fatty acid binding protein(Fabp7) is diurnally regulated in astrocytes and hippocampalgranule cell precursors in adult rodent brain. PLoS One 3, e1631.
Gold, D.A., Baek, S.H., Schork, N.J., Rose, D.W., Larsen, D.D.,Sachs, B.D., Rosenfeld, M.G., Hamilton, B.A., 2003. RORalphacoordinates reciprocal signaling in cerebellar developmentthrough sonic hedgehog and calcium-dependent pathways.Neuron 40, 1119–1131.
Hamilton, B.A., Frankel, W.N., Kerrebrock, A.W., Hawkins, T.L.,FitzHugh, W., Kusumi, K., Russell, L.B., Mueller, K.L., vanBerkel, V., Birren, B.W., Kruglyak, L., Lander, E.S., 1996. Dis-ruption of the nuclear hormone receptor RORalpha in stag-gerer mice. Nature 379, 736–739.
Hartmann, J., Konnerth, A., 2005. Determinants of postsynapticCa2þ signaling in Purkinje neurons. Cell Calcium 37, 459–466.
Helmlinger, D., Abou-Sleymane, G., Yvert, G., Rousseau, S., Weber,C., Trottier, Y., Mandel, J.L., Devys, D., 2004a. Disease progres-sion despite early loss of polyglutamine protein expression inSCA7 mouse model. J. Neurosci. 24, 1881–1887.
Helmlinger, D., Hardy, S., Sasorith, S., Klein, F., Robert, F., Weber, C.,Miguet, L., Potier, N., Van-Dorsselaer, A., Wurtz, J.M., Mandel,J.L., Tora, L., Devys, D., 2004b. Ataxin-7 is a subunit of GCN5histone acetyltransferase-containing complexes. Hum. Mol.Genet. 13, 1257–1265.
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 8 47
Iino, M., 2006. Ca2þ-dependent inositol 1,4,5-trisphosphate andnitric oxide signaling in cerebellar neurons. J. Pharmacol. Sci.100, 538–544.
Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B., Speed, T.P.,2003. Summaries of Affymetrix GeneChip probe level data. Nucl.Acids Res. 31, e15.
Jeste, D.V., Barban, L., Parisi, J., 1984. Reduced Purkinje cell densityin Huntington’s disease. Exp. Neurol. 85, 78–86.
Kinoshita-Kawada, M., Oberdick, J., Xi Zhu, M., 2004. A Purkinjecell specific GoLoco domain protein, L7/Pcp-2, modulatesreceptor-mediated inhibition of Cav2.1 Ca2þ channels in adose-dependent manner. Mol. Brain Res. 132, 73–86.
Kleerekoper, Q.K., Putkey, J.A., 2009. PEP-19, an intrinsicallydisordered regulator of calmodulin signaling. J. Biol. Chem.284, 7455–7464.
Knopfel, T., Grandes, P., 2002. Metabotropic glutamate receptorsin the cerebellum with a focus on their function in Purkinjecells. Cerebellum 1, 19–26.
Krzyzosiak, W.J., Sobczak, K., Wojciechowska, M., Fiszer, A.,Mykowska, A., Kozlowski, P., 2012. Triplet repeat RNA struc-ture and its role as pathogenic agent and therapeutic target.Nucl. Acids Res. 40, 11–26.
Kuhn, A., Luthi-Carter, R., Delorenzi, M., 2008. Cross-species andcross-platform gene expression studies with thebioconductor-compliant R package ‘annotationTools’. BMCBioinformatics 9, 26.
La Spada, A.R., Fu, Y.H., Sopher, B.L., Libby, R.T., Wang, X., Li, L.Y.,Einum, D.D., Huang, J., Possin, D.E., Smith, A.C., Martinez, R.A.,Koszdin, K.L., Treuting, P.M., Ware, C.B., Hurley, J.B., Ptacek, L.J.,Chen, S., 2001. Polyglutamine-expanded ataxin-7 antagonizesCRX function and induces cone-rod dystrophy in a mouse modelof SCA7. Neuron 31, 913–927.
La Spada, A.R., Taylor, J.P., 2010. Repeat expansion disease:progress and puzzles in disease pathogenesis. Nat. Rev. Genet.11, 247–258.
Li, S.H., Cheng, A.L., Zhou, H., Lam, S., Rao, M., Li, H., Li, X.J., 2002.Interaction of Huntington disease protein with transcriptionalactivator Sp1. Mol. Cell. Biol. 22, 1277–1287.
Lin, X., Antalffy, B., Kang, D., Orr, H.T., Zoghbi, H.Y., 2000.Polyglutamine expansion down-regulates specific neuronalgenes before pathologic changes in SCA1. Nat. Neurosci. 3,157–163.
Luthi-Carter, R., Hanson, S.A., Strand, A.D., Bergstrom, D.A.,Chun, W., Peters, N.L., Woods, A.M., Chan, E.Y., Kooperberg, C.,Krainc, D., Young, A.B., Tapscott, S.J., Olson, J.M., 2002a.Dysregulation of gene expression in the R6/2 model of poly-glutamine disease: parallel changes in muscle and brain. Hum.Mol. Genet. 11, 1911–1926.
Luthi-Carter, R., Strand, A., Peters, N.L., Solano, S.M., Hollings-worth, Z.R., Menon, A.S., Frey, A.S., Spektor, B.S., Penney, E.B.,Schilling, G., Ross, C.A., Borchelt, D.R., Tapscott, S.J., Young, A.B.,Cha, J.H., Olson, J.M., 2000. Decreased expression of striatalsignaling genes in a mouse model of Huntington’s disease.Hum. Mol. Genet. 9, 1259–1271.
Luthi-Carter, R., Strand, A.D., Hanson, S.A., Kooperberg, C., Schil-ling, G., La Spada, A.R., Merry, D.E., Young, A.B., Ross, C.A.,Borchelt, D.R., Olson, J.M., 2002b. Polyglutamine and transcrip-tion: gene expression changes shared by DRPLA and Hunting-ton’s disease mouse models reveal context-independenteffects. Hum. Mol. Genet. 11, 1927–1937.
Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A.,Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H.,Davies, S.W., Bates, G.P., 1996. Exon 1 of the HD gene with anexpanded CAG repeat is sufficient to cause a progressiveneurological phenotype in transgenic mice. Cell 87, 493–506.
Metzger, F., Kapfhammer, J.P., 2003. Protein kinase C: its role inactivity-dependent Purkinje cell dendritic development andplasticity. Cerebellum 2, 206–214.
Mohn, A.R., Feddersen, R.M., Nguyen, M.S., Koller, B.H., 1997.
Phenotypic analysis of mice lacking the highly abundant
Purkinje cell- and bipolar neuron-specific PCP2 protein. Mol.
Cell. Neurosci. 9, 63–76.Nomura, S., Fukaya, M., Tsujioka, T., Wu, D., Watanabe, M., 2007.
Phospholipase Cbeta3 is distributed in both somatodendritic
and axonal compartments and localized around perisynapse
and smooth endoplasmic reticulum in mouse Purkinje cell
subsets. Eur. J. Neurosci. 25, 659–672.Nucifora Jr., F.C., Sasaki, M., Peters, M.F., Huang, H., Cooper, J.K.,
Yamada, M., Takahashi, H., Tsuji, S., Troncoso, J., Dawson, V.L.,
Dawson, T.M., Ross, C.A., 2001. Interference by huntingtin and
atrophin-1 with cbp-mediated transcription leading to cellular
toxicity. Science 291, 2423–2428.Oberdick, J., Schilling, K., Smeyne, R.J., Corbin, J.G., Bocchiaro, C.,
Morgan, J.I., 1993. Control of segment-like patterns of gene
expression in the mouse cerebellum. Neuron 10, 1007–1018.Orr, H.T., Zoghbi, H.Y., 2007. Trinucleotide repeat disorders. Annu.
Rev. Neurosci. 30, 575–621.Rudnicki, D.D., Margolis, R.L., Pearson, C.E., Krzyzosiak, W.J., 2012.
Diced triplets expose neurons to RISC. PLoS Genet. 8,
e1002545.Saitoh, O., Masuho, I., Itoh, M., Abe, H., Komori, K., Odagiri, M.,
2003. Distribution of regulator of G protein signaling 8 (RGS8)
protein in the cerebellum. Cerebellum 2, 154–160.Sarna, J.R., Hawkes, R., 2011. Patterned Purkinje cell loss in the
ataxic sticky mouse. Eur. J. Neurosci. 34, 79–86.Sarna, J.R., Marzban, H., Watanabe, M., Hawkes, R., 2006. Com-
plementary stripes of phospholipase Cbeta3 and Cbeta4
expression by Purkinje cell subsets in the mouse cerebellum.
J. Comp. Neurol. 496, 303–313.Serra, H.G., Byam, C.E., Lande, J.D., Tousey, S.K., Zoghbi, H.Y., Orr, H.T.,
2004. Gene profiling links SCA1 pathophysiology to glutamate
signaling in Purkinje cells of transgenic mice. Hum. Mol. Genet.
13, 2535–2543.RORalpha-mediated Purkinje cell development determines dis-
ease severity in adult SCA1 mice. 2006.Serra, H.G., Duvick, L.,
Zu T., Carlson K., Stevens S., Jorgensen N., Lysholm A, Burright
E, Zoghbi HY, Clark HB, Andresen JM, Orr HT.Cell;127(4):697-
708.Slemmer, J.E., De Zeeuw, C.I., Weber, J.T., 2005. Don’t get too
excited: mechanisms of glutamate-mediated Purkinje cell
death. Prog. Brain Res. 148, 367–390.Slemmer, J.E., Haasdijk, E.D., Engel, D.C., Plesnila, N., Weber, J.T.,
2007. Aldolase C-positive cerebellar Purkinje cells are resistant
to delayed death after cerebral trauma and AMPA-mediated
excitotoxicity. Eur. J. Neurosci. 26, 649–656.Smyth, G.K., 2004. Linear models and empirical bayes methods
for assessing differential expression in microarray experi-
ments. Stat. Appl. Genet. Mol. Biol. 3, 1–29.Sopher, B.L., Ladd, P.D., Pineda, V.V., Libby, R.T., Sunkin, S.M.,
Hurley, J.B., Thienes, C.P., Gaasterland, T., Filippova, G.N., La
Spada, A.R., 2011. CTCF regulates ataxin-7 expression through
promotion of a convergently transcribed, antisense noncoding
RNA. Neuron 70, 1071–1084.Strom, A.L., Forsgren, L., Holmberg, M., 2005. A role for both wild-
type and expanded ataxin-7 in transcriptional regulation.
Neurobiol. Dis. 20, 646–655.Sugihara, I., Quy, P.N., 2007. Identification of aldolase C compart-
ments in the mouse cerebellar cortex by olivocerebellar
labeling. J. Comp. Neurol. 500, 1076–1092.Takayasu, Y., Iino, M., Kakegawa, W., Maeno, H., Watase, K.,
Wada, K., Yanagihara, D., Miyazaki, T., Komine, O., Watanabe,
M., Tanaka, K., Ozawa, S., 2005. Differential roles of glial and
neuronal glutamate transporters in Purkinje cell synapses. J.
Neurosci. 25, 8788–8793.
b r a i n r e s e a r c h 1 4 8 1 ( 2 0 1 2 ) 3 7 – 4 848
Wadiche, J.I., Jahr, C.E., 2005. Patterned expression of Purkinje cellglutamate transporters controls synaptic plasticity. Nat. Neu-rosci. 8, 1329–1334.
Watanabe, M., 2008. Molecular mechanisms governing competi-tive synaptic wiring in cerebellar Purkinje cells. Tohoku J. Exp.Med. 214, 175–190.
Welsh, J.P., Yuen, G., Placantonakis, D.G., Vu, T.Q., Haiss, F.,O’Hearn, E., Molliver, M.E., Aicher, S.A., 2002. Why do Purkinjecells die so easily after global brain ischemia? Aldolase C,EAAT4, and the cerebellar contribution to posthypoxic myo-clonus. Adv. Neurol. 89, 331–359.
Yamashita, A., Makita, K., Kuroiwa, T., Tanaka, K., 2006. Gluta-mate transporters GLAST and EAAT4 regulate postischemicPurkinje cell death: an in vivo study using a cardiac arrestmodel in mice lacking GLAST or EAAT4. Neurosci. Res. 55,264–270.
Yoo, S.Y., Pennesi, M.E., Weeber, E.J., Xu, B., Atkinson, R., Chen, S.,Armstrong, D.L., Wu, S.M., Sweatt, J.D., Zoghbi, H.Y., 2003.SCA7 knockin mice model human SCA7 and reveal gradualaccumulation of mutant ataxin-7 in neurons and abnormal-ities in short-term plasticity. Neuron 37, 383–401.
Yvert, G., Lindenberg, K.S., Picaud, S., Landwehrmeyer, G.B.,Sahel, J.A., Mandel, J.L., 2000. Expanded polyglutaminesinduce neurodegeneration and trans-neuronal alterations incerebellum and retina of SCA7 transgenic mice. Hum. Mol.Genet. 9, 2491–2506.
Zuccato, C., Tartari, M., Crotti, A., Goffredo, D., Valenza, M., Conti,L., Cataudella, T., Leavitt, B.R., Hayden, M.R., Timmusk, T.,Rigamonti, D., Cattaneo, E., 2003. Huntingtin interacts withREST/NRSF to modulate the transcription of NRSE-controlledneuronal genes. Nat. Genet. 35, 76–83.
Zucker, B., Kama, J.A., Kuhn, A., Thu, D., Orlando, L.R., Dunah,A.W., Gokce, O., Taylor, D.M., Lambeck, J., Friedrich, B., Linden-berg, K.S., Faull, R.L., Weiller, C., Young, A.B., Luthi-Carter, R.,2010. Decreased Lin7b expression in layer 5 pyramidal neuronsmay contribute to impaired corticostriatal connectivity inhuntington disease. J. Neuropathol. Exp. Neurol. 69, 880–895.
Zucker, B., Luthi-Carter, R., Kama, J.A., Dunah, A.W., Stern, E.A., Fox,J.H., Standaert, D.G., Young, A.B., Augood, S.J., 2005. Transcriptionaldysregulation in striatal projection- and interneurons in a mousemodel of Huntington’s disease: neuronal selectivity and potentialneuroprotective role of HAP1. Hum. Mol. Genet. 14, 179–189.