Comparative Analysis of the &Crystallin / Quinone Reductase Gene in Guinea Pig and Mouse Pedro Gonzalez, * Carlos Herndndez-Calzadilla,? P. Vasantha Rao, * Ignacio R. Rodriguez, * J. Samuel Zigler, Jr., * and Teresa Borrds$ *Laboratory of Mechanisms of Ocular Diseases, National Eye Institute, National Institutes of Health; TDepartamento de Bioquimica y Biologia Molecular, Universidad de La Laguna; and SLaboratorios Cusi c-Crystallin is a novel nicotinamide adenine dinucleotide phosphate : quinone reductase, present at enzymatic levels in various tissues of different species, which is highly expressed in the lens of some hystricomorph rodents and camelids. We report here the complementary DNA (cDNA) cloning of c-crystallin from liver libraries in guinea pig ( Cavia porcellus), where I;-crystallin is highly expressed in the lens, and in the laboratory mouse (Mus musculus), where expression in the lens occurs only at enzymatic levels. A 5’ untranslated sequence different from the one previously reported for the guinea pig lens cDNA was found in these clones. We also report the isolation of genomic clones including the complete guinea pig c-crystallin gene and the 5’ region of this gene in mouse. These results show the presence of two promoters in the guinea pig L-crystallin gene, one responsible for expression at enzymatic levels and the other responsible for the high expression in the lens. The guinea pig lens promoter is not present in the mouse gene. This is the first example in which the recruitment of an enzyme as a lens crystallin can be explained by the acquisition of an alternative lens-specific promoter. Introduction Crystallins are water-soluble proteins present in high concentrations in the ocular lens. These include the a-, p- and y-crystallins, which are ubiquitously ex- pressed in all vertebrate lenses, and the taxon-specific crystallins, which have limited phylogenetic distribu- tions. This latter group is also called “enzyme/crystal- lins” because it has been demonstrated that they are, in fact, enzymes which are highly expressed in lens where they presumably serve as structural proteins (crystallins) (for reviews, see de Jong et al. 1989; Piatigorsky and Wistow 1989 ) . Since only one gene is generally respon- sible for the normal expression at enzymatic levels as well as for the expression at high levels in the lens, the recruitment of an enzyme as a lens protein requires the modification of the pattern of gene expression in the lens, without having an important effect on gene expres- sion in other tissues. This process, whereby the product of a single gene has two distinct functions in different tissues, has been called “gene sharing’: ( Wistow and Pia- tigorsky 1987). The mechanism by which such modi- fication of expression occurs has not been fully elucidated for any enzyme/crystallin gene. It is uncertain whether Key words: guinea pig, mouse, alternative promoter, ocular lens, molecular evolution. Address for correspondence and reprints: J. Samuel Zigler, Jr., National Institutes of Health, Building 6, Room 237, Bethesda, Mary- land 20892. Mol. Biol. Evol. 11(2):305-315. 1994. 0 1994 by The University of Chicago. All rights reserved. 0737-4038/94/l 102~0013$02.00 the recruitment of enzymes as lens crystallins represents a selective process in which the expression in the lens of particular proteins confers some selective advantage or whether it is a more neutral process in which the functional or structural properties of the protein are not so critical (de Jong et al. 1989). <-Crystallin is a nicotinamide adenine dinucle- otide phosphate ( NADPH ) : quinone reductase ( Rao et al. 1992) present at enzymatic levels in various nonlenticular tissues of different species (Rao and Zigler 1992b), which is also a lens crystallin in some hystricomorph rodents (Huang et al. 1987) and cam- elids (Garland et al. 199 1)) where it constitutes 6 10% of total protein. As in the case of other enzyme/crys- tallins, the acquisition of a new function occurred without gene duplication (Borras et al. 1990). This protein is particularly interesting because a hereditary nuclear cataract in guinea pigs (Cavia porcellus) is associated with a genomic mutation causing a deletion in c-crystallin (Rodriguez et al. 1992), the only re- ported case of a cataract resulting from a mutation in an enzyme / crystallin. Moreover, the high expression of c-crystallin in the lens occurs in two groups of mammals: hystricomorphs and camelids, which had already diverged before the radiation of mammals <75 Mya (Novacek 1992). This peculiar distribution could be explained either by independent recruitment in each group or by an early recruitment in the evolution of mammals, with subsequent disappearance from the lens in many taxons. 305 Downloaded from https://academic.oup.com/mbe/article/11/2/305/1113047 by guest on 24 February 2022
Transcript
Comparative Analysis of the &Crystallin / Quinone Reductase Gene in Guinea Pig and Mouse
Pedro Gonzalez, * Carlos Herndndez-Calzadilla,? P. Vasantha Rao, * Ignacio R. Rodriguez, * J. Samuel Zigler, Jr., * and Teresa Borrds$ *Laboratory of Mechanisms of Ocular Diseases, National Eye Institute, National Institutes of Health; TDepartamento de Bioquimica y Biologia Molecular, Universidad de La Laguna; and SLaboratorios Cusi
c-Crystallin is a novel nicotinamide adenine dinucleotide phosphate : quinone reductase, present at enzymatic levels in various tissues of different species, which is highly expressed in the lens of some hystricomorph rodents and camelids. We report here the complementary DNA (cDNA) cloning of c-crystallin from liver libraries in guinea pig ( Cavia porcellus), where I;-crystallin is highly expressed in the lens, and in the laboratory mouse (Mus musculus), where expression in the lens occurs only at enzymatic levels. A 5’ untranslated sequence different from the one previously reported for the guinea pig lens cDNA was found in these clones. We also report the isolation of genomic clones including the complete guinea pig c-crystallin gene and the 5’ region of this gene in mouse. These results show the presence of two promoters in the guinea pig L-crystallin gene, one responsible for expression at enzymatic levels and the other responsible for the high expression in the lens. The guinea pig lens promoter is not present in the mouse gene. This is the first example in which the recruitment of an enzyme as a lens crystallin can be explained by the acquisition of an alternative lens-specific promoter.
Introduction
Crystallins are water-soluble proteins present in high concentrations in the ocular lens. These include the a-, p- and y-crystallins, which are ubiquitously ex- pressed in all vertebrate lenses, and the taxon-specific crystallins, which have limited phylogenetic distribu- tions. This latter group is also called “enzyme/crystal- lins” because it has been demonstrated that they are, in fact, enzymes which are highly expressed in lens where they presumably serve as structural proteins (crystallins) (for reviews, see de Jong et al. 1989; Piatigorsky and Wistow 1989 ) . Since only one gene is generally respon- sible for the normal expression at enzymatic levels as well as for the expression at high levels in the lens, the recruitment of an enzyme as a lens protein requires the modification of the pattern of gene expression in the lens, without having an important effect on gene expres- sion in other tissues. This process, whereby the product of a single gene has two distinct functions in different tissues, has been called “gene sharing’: ( Wistow and Pia- tigorsky 1987). The mechanism by which such modi- fication of expression occurs has not been fully elucidated for any enzyme/crystallin gene. It is uncertain whether
Address for correspondence and reprints: J. Samuel Zigler, Jr., National Institutes of Health, Building 6, Room 237, Bethesda, Mary- land 20892.
Mol. Biol. Evol. 11(2):305-315. 1994. 0 1994 by The University of Chicago. All rights reserved. 0737-4038/94/l 102~0013$02.00
the recruitment of enzymes as lens crystallins represents a selective process in which the expression in the lens of particular proteins confers some selective advantage or whether it is a more neutral process in which the functional or structural properties of the protein are not so critical (de Jong et al. 1989).
<-Crystallin is a nicotinamide adenine dinucle- otide phosphate ( NADPH ) : quinone reductase ( Rao et al. 1992) present at enzymatic levels in various nonlenticular tissues of different species (Rao and Zigler 1992b), which is also a lens crystallin in some hystricomorph rodents (Huang et al. 1987) and cam- elids (Garland et al. 199 1)) where it constitutes 6 10% of total protein. As in the case of other enzyme/crys- tallins, the acquisition of a new function occurred without gene duplication (Borras et al. 1990). This protein is particularly interesting because a hereditary nuclear cataract in guinea pigs (Cavia porcellus) is associated with a genomic mutation causing a deletion in c-crystallin (Rodriguez et al. 1992), the only re- ported case of a cataract resulting from a mutation in an enzyme / crystallin. Moreover, the high expression of c-crystallin in the lens occurs in two groups of mammals: hystricomorphs and camelids, which had already diverged before the radiation of mammals <75 Mya (Novacek 1992). This peculiar distribution could be explained either by independent recruitment in each group or by an early recruitment in the evolution of mammals, with subsequent disappearance from the lens in many taxons.
305
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
306 Gonzalez et al.
Lens cDNA Exon 1 Exon 2 Met AAGTCTGAACTCTTGCAGCACAGCTCCTCGCTCCTGCAACTGTTTCTGACACTTACACTGCTTGTGTTTGTATCTGCATCACCATG
FIG. l .-5 ’ Untranslated sequences of the lens cDNA and liver cDNA clones pCH 18 and pPG 103. The sequences corresponding to exon 2 (common to lens and liver cDNA sequences) are underlined, and the first amino acid of the coding region is shown above its respective codon. The position of the antisense oligonucleotide used for the primer extension analysis (see Material and Methods) is indicated with an arrow. The asterisk (* ) denotes the first nucleotide in clone pPG 163.
Here we report the analysis of the structure of the <-crystallin gene in a species exhibiting high expression in the lens (guinea pig) and in a second, related species (laboratory mouse, Mus musculus) with a low level of lens expression. The gene in guinea pig is regulated by two promoters, one of which is responsible for the high expression in the lens. This lens-preferred promoter is not present in the mouse gene. c-Crystallin is the first instance in which the recruitment of an enzyme as a lens crystallin can be attributed to the acquisition by the gene of a second, lens promoter.
Material and Methods Library Screening, Subcloning, and Sequencing
A hgt 10, oligo dT-primed guinea pig adult liver complementary DNA (cDNA) library was obtained from Clontech (GL1007a). The probe used for the screening was the insert of the guinea pig lens c-crystallin cDNA clone pTB 100 (Rodokanaki et al. 1989). A hEMBL3 guinea pig genomic library (Clontech; GL1002d) was screened with the insert of the guinea pig lens cDNA clone pTB 100 and with a fragment, gen- erated by polymerase chain reaction (PCR), corre- sponding to the first 120 nt in the 5 ’ region of pTB 100 insert.
The mouse liver cDNA library hgt 11 (~207 1; Pro- mega) was screened with the insert of clone pTB100. Two mouse genomic libraries from Clontech ( ML 103Oj and ML1044j ), constructed in hEMBL3, were screened with a nested PCR fragment corresponding to the first 2 10 nt in the 5’ end of mouse liver cDNA clone pMLR107 (fig. 4).
All the probes were labeled by the random primer method with ( 32P)dCTP. Screenings were performed using nitrocellulose filters ( Schleicher and Schuell ), with hybridizations at 68°C in 6 X saline-sodium citrate (SSC), 0.5% sodium dodecyl sulfate (SDS), 0.5% Den- hardt’s with 100 pg Escherichia coli or salmon-sperm DNA ( Sigma)/ml and washes at 68°C in 2 X SSC, 0.1% SDS.
The positive clones were analyzed by Southern blot analysis as described by Sambrook et al. ( 1989, vol. 2, pp. 9.3 l-9.57 ) . Hybridizations were carried out under the same conditions as for the library screenings. The insert of the guinea pig lens cDNA clone pTB 100 was
used as full-length probe. Fragments corresponding to nucleotides 142-446, 553-690, and 1368-1729 of the insert of clone pTB 100 and to the first 220 nt of clone pCH 18 (fig. 1) were generated by the PCR and used in mapping the guinea pig clones.
The inserts of the positive clones were subcloned in the vector pBluescript II KS+ (Stratagene). The re- combinant plasmids were sequenced with ( 35S)dATP by using the Sequenase II system (USB). Computer analysis was carried out with the GCG package of pro- grams in the NIH Convex unit.
Primer Extension Analysis of Guinea Pig Liver RNA
For the primer extension analysis, one 36-mer syn- thetic oligonucleotide ( 5 ‘-CGCCTCCAGAGCAGG- GATCACAACCTGCTATGGCTC-3’) complementary to the liver cDNA untranslated region was end labeled with ( 32P)ATP and hybridized with 50 kg of total RNA from guinea pig liver previously extracted by the method of Chomczynsky and Sacchi ( 1987). The primer exten- sion was carried out as described by Sambrook et al. ( 1989, vol. 1, pp. 7.79-7.85) using AMV reverse tran- scriptase ( Promega) .
PCRs
In order to amplify fragments of the sizes expected for some introns, we used the buffer described by Ponce and Micol ( 1992). This buffer has been especially for- mulated to get amplifications of products ~6 kb in length. The Taq polymerase and deoxynucleotides were purchased from Perkin-Elmer.
Rapid Amplification of cDNA Ends (RACE)
For the RACE, total RNA from the mouse lens- derived cell line aTN4 was used. The first-strand cDNA synthesis was performed by priming the total RNA with a <-crystallin antisense oligonucleotide ( 5 ‘-CTGATG- GCTCTGTGGAACAG-3 ‘, nucleotides 2 lo- 190 of clone pMLR 107 ) by using MLV reverse transcriptase (Promega). After dA tailing with TdT enzyme from BRL, a run of amplification was performed using a polyT oligo with an EcoRI restriction site ( 5 ‘-GGAC- TCGAATTCGACTGCTTTTTTTTTTTTTTT- TT-3’) and an internal c-crystallin antisense oligonucle- otide ( 5 ‘-AAACTCAAACACTCGAATAG-3 ‘, nucleo-
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
308 Gonzalez et al.
A ATG TGA
B
Liver exon
Lens 2 3 4 5 6 78 9 exon
hPG- 1
hPG-2
UG-7
5 kb I I
FIG. 3.-A, Genomic organization of the guinea pig t;-crystallin gene. Exons are shown as boxes numerated below. The unblackened boxe represent untranslated regions, and the blackened boxes represent translated regions. The location of the start codon (ATG) and stop coda (TGA) are indicated with arrows. B, Extent of the guinea pig genomic clones used for the sequence analysis.
isolated (fig. 3). The sequence corresponding to the 5’ end of the liver cDNA was found in clone 3LPG7 -3 kb upstream of the lens exon. This exon is followed by a consensus donor splicing sequence at the 3’ end, but no evident acceptor splicing sequence is present at the 5’ region. The first translated exon is located - 1 kb down- stream of the lens first exon. The methionine codon is preceded by 13 untranslated nucleotides, and the exon encodes for 36 additional amino acids. This exon is fol- lowed by seven other exons ranging in size from 52 nt (exon 5) to 933 nt (exon 9). The last exon, exon 9,
Table 1 Intron-Exon Junctions of the t;-Crystallin Gene in Guinea Pig
encodes 53 amino acids of the C-terminal region of tb protein as well as the entire 772 bp of the 3’ noncodin: region of the cDNA. All of the exon-intron junction display the minimal consensus sequences GT and AC (Breathnach and Chambon 1981; Mount 1982) at thl 5’ and 3’ boundaries of every intron (table 1) . The exor sequences obtained from the genomic clones were iden tical to the cDNA sequence reported elsewhere (Rodo kanaki et al. 1989), except for one extra A at positior 2 ( 5 ’ untranslated region).
a Minimal consensus splice sequences are underlined.
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
<-Crystallin Gene in Guinea Pig and Mouse 309
contain TATA or CAAT boxes. The main characteristic of this region is its high content of GpC (G+C=6 1% in 472 nt). The upstream region of the lens exon includes TATA box, Sp 1, and some putative regulatory elements present in the promoters of other crystallins, including C/EBP (Johnson et al. 1987), aCE2 (Matsuo and Ya- suda 1992), aCRYBP1 (Nakamura et al. 1990), and a string of T (McDermott et al. 1992). Functional analysis of this region has demonstrated that it contains a very active promoter which is virtually lens specific (Lee et al. 1992; D. C. Lee, P. Gonzalez, and G. J. Wistow, personal communication ) .
Characterization of c-Crystallin cDNA in Mouse
mouse.
As a first step in comparing the regulatory regions of the c-crystallin gene in guinea pig with that of species lacking high expression in the lens, a cDNA library from
All the clones had a long polyA tail in the 3’ end
mouse liver was screened and three independent clones (pMLRlO5, pMLR106, and pMLR107; fig. 4) were ob-
15 nt downstream of the motif AGTAAA which is prob-
tained. The 5 ’ untranslated sequence of clone pMLR 106 extended only 12 nt upstream of the ATG start codon,
ably the functional polyadenylation signal. An additional
and clones pMLR 105 and pMLR107 extended 85 and 99 nt upstream of the start codon, respectively. This
consensus polyadenylation signal ( AATAAA) was lo-
sequence shows similarity with the 5’ untranslated region found in cDNA clones from guinea pig liver (fig. 5 ) . In order to determine whether the 5’ untranslated sequence
cated in the same relative position ( 1479-1484) as in
in mouse lens cells was identical to that found in the liver cDNA clones or whether it was similar to the one
guinea pig (Rodokanaki et al. 1989) and human (Gon-
in guinea pig lens cDNA, a RACE experiment was per- formed with RNA from the mouse lens cell line oTN4. This cell line was selected because the lens-specific pro- moter of guinea pig shows high activity in transfection experiments using these particular cells (D. C. Lee, P. Gonzalez, and G. J. Wistow, personal communication). The results showed no difference between the lens and liver sequences, suggesting that a lens promoter similar to the one in the guinea pig gene was not present in
8.10, respectively. The similarity with the guinea pig se- quence is 80.3% and with the human 80.6%. A detailed comparative analysis of the amino acid sequences of c- crystallins, including the mouse sequence reported here, has recently been published (Jiirnvall et al. 1993).
5 ’ Region of c-Crystallin Gene in Mouse
Two mouse genomic libraries were screened with a probe corresponding to the 5’ region of the cDNA.
counting from the first nucleotide in intron 1, and a
Three independent clones were isolated: AMG 1 included only
truncated LlMdA2 repetitive sequence (Loeb et al.
-300 nt upstream of the first translated exon. Clones hMG75 and hMG78 extended > 10 kb to the
1986) at position 3153-4166. The similarity between
upstream region of the gene. The sequence correspond- ing to the liver untranslated exon was found 8 kb up-
guinea pig and mouse intron sequences from this point
stream of the second exon, and the complete intron was sequenced. If we assume a genetic distance between
to exon 2 is
guinea pig and mouse
-74%, with the exception of a fragment of
~75 Myr (Novacek 1992) and a ratio of 4.6 X 10 -9 substitutions/ nucleotide site/year
235 nt in guinea pig and of 400 nt in mouse, located
(Li et al. 198 1 ), the similarity expected in intron se- quences without a functional role is -65%. It is therefore
480 nt upstream of exon 2. The similarity between the
possible to distinguish sequences which were originally in the gene before the divergence of guinea pig and mouse from those that resulted from recombinatory events after the divergence of the two species. The region upstream of the liver exon showed 67% similarity with that in guinea pig. As in guinea pig, this sequence is GpC rich ( 65.4% in 358 nt ) and lacks TATA or CAAT boxes (fig. 5). Similarity with the guinea pig gene ends just after the splicing donor consensus sequence, and it reap- pears in the region corresponding to the guinea pig lens exon. The complete region responsible for the lens pro- moter activity in guinea pig (D. C. Lee, P. Gonzalez, and G. J. Winstow, personal communication) is absent in the mouse gene (fig. 6). The fragment of 6.5 kb not homologous to the guinea pig intron sequence includes two GT repeats at positions 2875-2935 and 5958-6009,
zalez et al. 1993). The sequence surrounding the putative initiation
ATG ( Met ) codon ( 5 ‘-GTCTCCCATGG-3 ‘) matches the consensus for the translation initiation region of ver- tebrate genes (Kozak 199 1). The termination codon TGA was located at position 1093- 1095. The open reading frame was 990 nt in length and coded for a pro- tein with 330 amino acids, two residues longer than in guinea pig and human. The two new residues are Asp and Lys located at positions 2 16 and 2 17. The calculated molecular mass and isoelectric point are 35,137 D and
two species ends again after the consensus splicing donor sequence of intron 2. A graphic representation of the conserved and nonconserved sequences between the two species, in the 5 ’ region of the gene, is shown in fig- ure 7.
Discussion
The analysis of the guinea pig and mouse <-crys- tallin genes presented here indicates clearly that the dif- ference in the level of expression in the lens in these two
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
be/article/11/2/305/1113047 by guest on 24 February 2022
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
3 14 Gonzalez et al.
MOUSE
Put live pro
Ll Md-A2
ATG
t
GUINEA PIG
Liver exon Lens exon exon 2
I II
FIG. 7.-Comparison between the 5’ region of guinea pig and mouse <-crystallin genes. The regions conserved (similarity -70%) betwee the two species are represented as gray boxes. The sequences specific to the mouse and guinea pig genes are represented as unblackened an blackened boxes, respectively. The mouse Ll MdA2 repetitive element and the GT repeats are also shown. The region labeled as lens promott in the guinea pig gene is based on the functional analysis by D. C. Lee, P. Gonzalez, and G. J. Winstow (personal communication). Th sequences corresponding to the areas indicated as liver exon (I) and guinea pig lens exon (II) correspond to those sequences shown in figs. and 6, respectively.
Since the studies carried out on other enzyme/ crystallins have not always involved the analysis of the 5 ’ untranslated sequences of the cDNA in nonlenticular tissues, it seems possible that the presence of alternative promoters may not be limited to c-crystallin. A recent analysis of two enzymes recruited as lens crystallins (ar- gininosuccinate lyase/ &crystallin and lactate dehydro- genase-B / a-crystallin ) indicated that in those cases there is apparently one promoter responsible for expression in both lens and liver ( Hodin and Wistow 1993 ). More recently, it has been reported that the high expression of lactate dehydrogenase-B /a-crystallin in the lens in duck may be mediated by the presence of a promoter- specific enhancer(s) present in the first intron of the gene. Taken together, these studies suggest that the mechanism of recruitment of enzymes as lens crystallins does not have a single common basis but occurs by dif- ferent means ( Kraft et al. 1993 ) .
In conclusion, the analysis of the c-crystallin gene reported here provides the first example of an enzyme/ crystallin in which the double role as enzyme and lens crystallin can be explained by the acquisition of an ad- ditional lens-specific promoter. This finding raises fur- ther interesting questions about the evolution of the gene. One such question is whether the lens-specific promoter arose via an insertion into the original gene or by a mod- ification of sequences already present in the gene. A sec- ond question concerns whether &crystallin was recruited independently, as a lens protein in two distinct mam- malian groups, hystricomorphs and camelids. Further analysis of the <-crystallin gene in other species, including camelids, is in progress in our laboratory and should help clarify these evolutionary questions.
Acknowledgments
We thank Dr. S. Tumminia for providing tota RNA from aTN4 cells. P.G. was supported in part b a grant from the Ministerio de Education y Cienci, (Spain) : programa sectorial de betas de formation d profesorado y personal investigador en el extranjero.
LITERATURE CITED
BHAT, S. P., and C. N. NAGINENI. 1989. aB subunit of lens specific protein a-crystallin is present in other ocular an non-ocular tissues. Biochem. Biophys. Res. Commun. 158 3 19-325.
BORRAS, T., H. J~RNVALL, A. RODOKANAKI, P. GONZALES I. RODRIGUEZ, and C. HERNANDEZ-CALZADILLA. 199C The transcripts of zeta-crystallin, a lens protein related tl the alcohol dehydrogenase family, are altered in a guinea pig hereditary cataract. Exp. Eye Res. 50:729-735.
BREATHNACH, R., and P. CHAMBON. 198 1. Organization ant expression of eucaryotic split genes coding for protein: Annu. Rev. Biochem. 50:83 l-839.
CHOMCZYNSKI, P., and N. SACCHI. 1987. Single-step methoc of RNA isolation by acid guanidium thiocyanate-phenol chloroform extraction. Anal. Biochem. 162: 156-l 59.
DE JONG, W. W., W. HENDRIKS, J. W. M. MULDERS, and H BLOEMENDAL. 1989. Evolution of the eye lens crystallim the stress connection. Trends Biochem. Sci. 14:365-368.
DUBIN, R. A., E. F. WAWROUSEK, and J. PIATIGORSKY. 1989 Expression of the murine aB-crystallin gene is not restrictec to the lens. Mol. Cell. Biol. 9: 1083- 109 1.
GARLAND, D., P. V. RAO, A. D. CORSO, U. MURA, and J. S ZIGLER, JR. 199 1. c-Crystallin is a major protein in the len of CumelIus dromedarius. Arch. Biochem. Biophys. 285 134-136.
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
I;-Crystallin Gene in Guinea Pig and Mouse 3 15
GOLDSMITH, T. H. 1990. Optimization, constraint, and history in the evolution of the eyes. Q. Rev. Biol. 65:28 l-322.
GONZALEZ, P., P. V. RAO, and J. S. ZIGLER, JR. 1993. Mo- lecular cloning and sequencing of the zeta-crystallin /qui- none reductase cDNA from human liver. Biochem. Bio- phys. Res. Commun. 191:902-907.
HODIN, J., and G. WISTOW. 1993. 5’-RACE PCR of mRNA for three taxon specific crystallins. Biochem. Biophys. Res. Commun. 190:39 l-396.
HUANG, Q. L., P. RUSSELL, S. H. STONE, and J. S. ZIGLER, JR. 1987.l;~Crystallin, a novel lens protein from the guinea pig. Curr. Eye Res. 6~725-732.
IWAKI, A., T. IWAKI, J. E. GOLDMAN, and R. K. H. LIEM. 1990. Multiple mRNAs of rat brain alpha-crystallin B chain result from alternative transcriptional initiation. J. Biol. Chem. 265:22 197-22203.
IWAKI, T., A. KUME-IWAKI, R. K. H. LIEM, and J. E. GOLD- MAN. 1989. aB-crystallin is expressed in non-lenticular tis- sues and accumulates in Alexander’s disease brain. Cell 57: 7 l-78.
JOHNSON, P. F., W. H. LANDSCHULZ, B. J. GRAVES, and S. L. MCKNICHT. 1987. Identification of a rat liver nuclear protein that binds to the enhancer core element of three animal viruses. Genes Dev. 1: 133- 146.
JORNVALL, H., B. PERSSON, G. C. Du Bars, G. C. LAVERS, J. H. CHEN, P. GONZALEZ, P. V. RAO, and J. S. ZIGLER, JR. 1993. I;-Crystallin versus other members of the alcohol dehydrogenase super-family: variability as a functional characteristic. FEBS Lett. 322:240-244.
KOZAK, M. 199 1. Structural features in eucaryotic mRNAs that modulate the initiation of transcription. J. Biol. Chem. 266:19867-19870.
KRAFI-, H. J., W. HENDRIKS, W. W. DE JONG, N. H. LUBSEN, and G. G. SCHOENMAKERS. 1993. Duck lactate dehydro- genase B/epsilon crystallin gene: lens recruitment of a GC promoter. J. Mol. Biol. 229:849-859.
LEE, D. C., P. GONZALEZ, P. V. RAO, J. S. ZIGLER, JR., and G. J. WISTOW. 1992. Carbonyl-metabolizing enzymes and their relatives recruited as structural proteins in the lens. Pp. 159- 168 in H. WEINER, ed. Enzymology and molecular biology of carbonyl metabolism. Plenum, New York.
LI, W. H., T. GOJOBORI, and M. NEI. 198 1. Pseudogenes as a paradigm of neutral evolution. Nature 292:237-239.
LOEB, D. D., R. W. PADGETT, S. C. HARDIES, W. R. SHESHEE, M. B. COMER, M. H. EDGELL, and C. A. HUTCHISON III. 1986. The sequence of a large L 1 Md element reveals a tan- demly repeated 5 ’ end and several features found in retro- transposons. Mol. Cell. Biol. 6: 168- 182.
MCDERMOTT, J. B., C. A. PETERSON, and J. PIATIGORSKY. 1992. Structure and lens expression of the gene encoding chicken beta A3 /A I-crystallin. Gene 117: 193-200.
MATSUO, I., and K. YASUDA. 1992. The cooperative inter- action between two motifs of an enhancer element of the
chicken aA-crystallin gene, c&El and aCE2, confers lens- specific expression. Nucleic Acids Res. 20:370 l-37 12:
MOUNT, S. M. 1982. A catalogue of splice junction sequences. Nucleic Acids Res. 10:459-472.
NAKAMURA, T., D. M. DONOVAN, K. HAMADA, C. M. SAX, B. NORMAN, J. R. FLANAGAN, K. OZATO, H. WESTPHAL, and J. PIATIGORSKY. 1990. Regulation of the mouse aA- crystallin gene: isolation of a cDNA encoding a protein that binds to a cis sequence motif shared with the major histo- compatibility complex class I gene and other genes. Mol. Cell. Biol. 10:3700-3708.
NOVACEK, M. J. 1992. Mammalian phylogeny: shaking the tree. Nature 356: 12 1- 125.
PIATIGORSKY, J., and G. J. WISTOW. 1989. Enzyme/crystal- lins: gene sharing as an evolutionary strategy. Cell 57: 197- 199.
PONCE, M. R., and J. L. MICOL. 1992. PCR amplification of long DNA fragments. Nucleic Acids Res. 20:623.
RAO, C. M., and J. S. ZIGLER, JR. 1992a. Levels of reduced pyridine nucleotides and lens photodamage. Photochem. Photobiol. 56:523-528.
RAO, P. V., M. C. KRISHNA, and J. S. ZIGLER, JR. 1992. Iden- tification and characterization of the enzymatic activity of c- crystallin from guinea pig lens. J. Biol. Chem. 267:96-102.
RAO, P. V., and J. S. ZIGLER, JR. 1992b. Purification and characterization of I;-crystallin /quinone reductase from guinea pig liver. Biochem. Biophys. Acta 1117:3 15-320.
RODOKANAKI, A., R. K. HOLMES, and T. BORR&. 1989. Zeta- crystallin, a novel protein from the guinea pig lens is related to alcohol dehydrogenases. Gene 78:2 15-224.
RODRIGUEZ, I. R., P. GONZALEZ, J. S. ZIGLER, JR., and T. BORRAS. 1992. A guinea-pig hereditary cataract contains a splice site deletion in a crystallin gene. Biochem. Biophys. Acta 1180:44-52.
SAMBROOK, J., E. F. FRITSCH, and T. MANIATIS. 1989. Mo- lecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
SCHIBLER, U., and F. SIERRA. 1987. Alternative promoters in developmental gene expression. Annu. Rev. Genet. 21:237- 257.
WISTOW, G. J., W. M. MULDERS, and W. W. DE JONG. 1987. The enzyme lactate dehydrogenase as a structural protein in avian and crocodilian lenses. Nature 326:622-624.
WISTOW, G. J., and J. PIATIGORSKY. 1987. Recruitment of enzymes as lens structural proteins. Science 236: 1554- 1556.
ZIGLER, J. S., JR., and P. V. RAO. 199 1. Enzyme/crystallins and extremely high pyridine nucleotide levels in the eye lens. FASEB J. 5:223-225.
WESLEY M. BROWN, reviewing editor
Received August 10, 1993
Accepted October 27, 1993
Dow
nloaded from https://academ
ic.oup.com/m
be/article/11/2/305/1113047 by guest on 24 February 2022
