+ All Categories
Home > Documents > Competências Básicas de Investigação Científica e de Publicação

Competências Básicas de Investigação Científica e de Publicação

Date post: 25-Feb-2016
Category:
Upload: dotty
View: 29 times
Download: 0 times
Share this document with a friend
Description:
Competências Básicas de Investigação Científica e de Publicação. Physio l ecture 1: Introduction, Hypotheses and Search. Publishing is an essential research skill. Publishing is an essential research skill. determining likelihood of acceptance. - PowerPoint PPT Presentation
Popular Tags:
72
Competências Básicas de Investigação Científica e de Publicação Physio lecture 1: Introduction, Hypotheses and Search 13/08/2013 Ganesha Associates
Transcript
Page 1: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates

Competências Básicas de Investigação Científica e de Publicação

Physio lecture 1: Introduction, Hypotheses and Search

13/08/2013

Page 2: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates

Publishing is an essential research skill

13/08/2013

Page 3: Competências Básicas  de  Investigação Científica  e de  Publicação

Preparation Journal Selection Writing Submission Peer

ReviewPublication

Success

determining likelihood of acceptance

citation management

navigating a submission system in a

second language

writing an outline

comparing journals

assessing relevance to

research topic

understanding comments

long decision timelines

decision to re-submit, or try a different journal

Publicationethics

writing in English formatting to

guidelines

Publishing is an essential research skill

Page 4: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates

Me…

• BSc Physics 1971, PhD Neuroscience 1976, post doc 1975-1979

• Visiting Professor, UFPe 1978-79• Editor, Publisher, Director at Elsevier Science 1979

– 2005• Pubmed systems expert, NCBI, NIH 2006-2007• STM business analyst, Outsell Inc, 2009-2011• Visiting Professor UFPe, 2006, 2007, 2008, 2012,

2013

13/08/2013

Page 5: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates CC BY 3.0 5

The scientific process involves making models of how things work

• These evolving models are described in the scientific literature

• Sometimes the models are wrong, often they are incomplete

• Scientific progress is driven by the communication and publication of the results of new research, and the reinterpretation of older work

• The tool which makes all of this possible is the hypothesis

9 September 2013

Page 6: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates CC BY 3.0 69 September 2013

Page 7: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates CC BY 3.0 79 September 2013

Page 8: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates CC BY 3.0 89 September 2013

Page 9: Competências Básicas  de  Investigação Científica  e de  Publicação

Experimental and observational types of research

Page 10: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates CC BY 3.0 10

Experimental vs. Observational studies

No modification of experimental variablesUseful to discover trends and associationsCannot directly be used to infer causality

Compare responses different treatmentsDesigned to avoid misleading results

e.g. randomisationCan be used to infer cause and effect9 September 2013

Page 11: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 11

Main learning points

• Student projects fall into three categories– No hypothesis, i.e. observational– Weak hypothesis– Strong hypothesis

• The work will be published in a – National journal– Low impact factor journal– High impact factor journal

• Starting with strong hypothesis improves your chances of getting published in a good journal

Page 12: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates CC BY 3.0 129 September 2013

Page 13: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 13

What is a strong hypothesis ?

• A strong hypothesis is based on a series of premises – things that are already known with some certainty

• Each premise must be supported by references back to the (international) primary literature

• So a strong hypothesis will be backed by references to recent papers in high quality journals

Page 14: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates CC BY 3.0 149 September 2013

Page 15: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 15

Coin-tossing - an example• I wonder how many heads or tails I will get if I toss

this coin 100 times– No model

• The frequency distribution of heads and tails will be approximated by a binomial distribution with n=100 and p=0.5– Simple model, based on symmetry

• A detailed analysis of the dynamics reveals that the probability of a head is 0.51– Complex model, based on asymmetry, aerodynamics, etc

Page 16: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 16

Coin-tossing – impact on CV1. None, or possibly negative

2. R. A. Fisher and others did perform this experiment in the early days of biological statistics, before the advent of computers, as a proof that the binomial distribution tended towards a normal one at high levels of n.

Interestingly they all found that the probability of a head p was usually slightly higher than 0.5, but this difference was ignored.

3. Persi Diacusis, Susan Holmes and Richard Montgomery (Stanford, 2004) publish a paper on the ‘Dynamical bias in the coin toss’ proving that the lack of total symmetry in a coin means that the probability of a head will always be slightly greater than 0.5.

Page 17: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 17

Coin tossing - relevance• I think that there will be an association (+ or -) between mutations

in gene x and susceptibility to disease y– No causal basis for a relationship given

• I predict that mutations in gene x will increase susceptibility to disease y because patients with disease y often have low levels of gene product x.– Built-in control, patients with normal levels of the gene product should not

have the disease.• I predict that chemically non-neutral mutations in gene x will

increase susceptibility to disease y in patients with low levels of gene product x.– Second level of control – neutral mutations should be asymptomatic

Page 18: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 18

Coin-tossing – moral of the story

• With a strong hypothesis, you:– Avoid following leads which go nowhere – false

positives, fail early– Avoid ignoring unexpected observations that are

of high interest – false negatives– May need to do less work !– Will get published in better journals !

Page 19: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 19

Case study: Hummingbird territorial behaviour

Page 20: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 20

Most hummingbird species demonstrate strong territorial behavior

If a bluffing charge attack does not work, the residentmay engage the trespasser in a brief but intense physical battle

So why do hummingbirds defend territories ?

H0: Hummingbirds are randomly distributed in space and time.

Hummingbird territorial behaviour

Page 21: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 21

Hummingbird territorial behaviour

H1

If territory = F(energy), then behavior not species-dependent

If territory = F(mating), then behavior should be species and sex dependent

If…

If…

Page 22: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 22

Territorial behaviour in 1971

• Time, Energy, and Territoriality of the Anna Hummingbird (Calypte anna) Science 173 (1971) 818-821.

• When territory quality decreases defenders may switch to less expensive forms of defense because the energy savings outweigh the loss of resources

• Augmented territorial defense during the breeding season is made possible by increased feeding efficiency due to the availability at this time of very nectar-rich flowers.

• Individuals with large territories are more successful reproductively.

Page 23: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 23

Hummingbird territoriality since• Digestive physiology is a determinant of foraging bout

frequency in hummingbirds. Nature. 1986 Mar 6-12;320(6057):62-3.

• Mitochondrial respiration in hummingbird flight muscles. Proc Natl Acad Sci U S A. 1991 Jun 1;88(11):4870-3.

• Cloning and analysis of the gene encoding hummingbird proinsulin. Gen Comp Endocrinol. 1993 Jul;91(1):25-30.

• Flight and size constraints: hovering performance of large hummingbirds under maximal loading. J Exp Biol. 1997 Nov;200(Pt 21):2757-63.

Page 24: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 24

Hummingbird territoriality since

• Hovering performance of hummingbirds in hyperoxic gas mixtures. J Exp Biol. 2001 Jun;204(Pt 11):2021-7.

• Adipose energy stores, physical work, and the metabolic syndrome: lessons from hummingbirds. Nutr J. 2005 Dec 13;4:36.

• Neural specialization for hovering in hummingbirds: hypertrophy of the pretectal nucleus Lentiformis mesencephali. J Comp Neurol. 2007 Jan 10;500(2):211-21.

• Three-dimensional kinematics of hummingbird flight. J Exp Biol. 2007 Jul;210(Pt 13):2368-82.

Page 25: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 25

Hypothesis lecture learning points

• Good hypotheses build directly onto previous work

• So they need to become technically more sophisticated over time moving from the general to the particular

• A given problem can be associated with a number of very different hypotheses – your experiments should include tests to exclude these alternative explanations

Page 26: Competências Básicas  de  Investigação Científica  e de  Publicação

9 September 2013 Ganesha Associates CC BY 3.0 26

Hypothesis lecture learning points

• Hypotheses can be weak (observational) or strong (mechanism-based)

• For example, a hypothesis which predicts that a tossed coin will end up ‘heads’ 50% of the time is much weaker than one that can predict the exact sequence of ‘heads’ and ‘tails’

• So hypothesis ‘quality’ is important

Page 27: Competências Básicas  de  Investigação Científica  e de  Publicação

Types of scientific output

• Abstracts• Primary journal articles

– peer-reviewed interpretations of original research• Reviews• Book chapters, monographs• Conference proceedings• Lectures, seminars• Sequences, data sets• Patents, other forms of intellectual property• Blogs, tweets…

14 May 2013 Ganesha Associates 27

Page 28: Competências Básicas  de  Investigação Científica  e de  Publicação

Some sources of scientific content• Google• PubMed/Medline (NLM)• Scopus (Elsevier)• Web of Science (Thomson Reuters) • Google Scholar• PubMed Central, PubMed Central Europe• SciELO, Biblioteca Virtual em Saude• Science Direct, Ovid, SpringerLink, Wiley Online Library,

BiomedCentral, Public Library of Science, SWETSwise…• CAPES Portal de Periódicos

14 May 2013 Ganesha Associates 28

Page 29: Competências Básicas  de  Investigação Científica  e de  Publicação

Each source is different

• Free– Google, Google Scholar, Pubmed Central

• Subscription– Scopus, ScienceDirect

• Abstracts and citations only– PubMed, Web of Science

• Full text, single publisher– SpringerLink

• Full text, many publishers– Pubmed Central, SwetsWise Online Content

Page 30: Competências Básicas  de  Investigação Científica  e de  Publicação

Classify sources of content

Abstract only

Full text

Free access Subscription

Page 31: Competências Básicas  de  Investigação Científica  e de  Publicação

14 May 2013 Ganesha Associates 31

You can get access if…

• The journal is subscribed to by CAPES• You have a personal subscription• The journal is of the ‘Open Access’ type

– Note: some journals only make their content ‘Open Access’ after 6 or longer months. Some journals contain a mixture of OA and non-OA articles. See http://europepmc.org/journalList for more info.

• Journals in the ‘red’ categories are available anywhere.• Most journals subscribed to by CAPES will be available from

more than one source.• CAPES journals are only available from computers within the

University network unless you have remote access privileges.

Page 32: Competências Básicas  de  Investigação Científica  e de  Publicação

14 May 2013 Ganesha Associates 32

So which sources should I use ?

• No single source contains all of the articles relevant to your research

• Google has the broadest coverage, but not all of the documents you find will be peer-reviewed articles

• Scopus, WoS and PubMed give you the best balance between quality and quantity, and, in theory, should link to all the content subscribed to by CAPES, plus OA content.

Page 33: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 33

Indexing• The purpose of an index is to optimize speed and performance

in finding relevant documents for a search query.

• Without an index, the search engine would have to scan every document in the corpus, which would require considerable time and computing power.

• For example, while an index of 10,000 documents can be queried within milliseconds, a sequential scan of every word in 10,000 large documents could take hours.

• A common type of index used for document search is the “inverted index”

24 August 2012

Page 34: Competências Básicas  de  Investigação Científica  e de  Publicação

Search: how the result list is ranked

• Date of publication• Relevance– Frequency with which search terms occur in the

document– Proximity of search terms

• Google’s PageRank algorithm uses "link popularity”- a document is ranked higher if there are more links to it

14 May 2013 Ganesha Associates 34

Page 35: Competências Básicas  de  Investigação Científica  e de  Publicação

So…

• Using the same search terms will produce different results in different databases because:– Content different– Preparation of search terms will be different, e.g.

only Pubmed uses MeSH terms– Indexing process, implementation of stemming,

removal of stop words will be different– Ranking algorithms will be different

Page 36: Competências Básicas  de  Investigação Científica  e de  Publicação

The question behind the query

• Search engines think in terms of words, but users think in terms of sentences!– How do you spell Bousfield?– What do we know about BRCA1?– Given these symptoms, what is the most likely

diagnosis?– What are the side effects of aspirin?– Has this chemical structure been synthesized before?

• “Cancer causes X” vs. “Y causes cancer”

Page 37: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 3724 August 2012

What real queries look like - Google

• pharmacogenomics and disorders• bacteria growth casein media effect• waal pseudomonas• TRPM2 PCR mouse• Chitinases in carnivorous plants• glycerophosphoinositol 4-phosphate• Dai N, Gubler C, Hengstler P, Meyenberger C,

Bauerfeind P. Improved capsule endoscopy after bowel preparation. Gastrointest Endosc 2005;61(1) 28-31.

Page 38: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 3824 August 2012

What real queries look like - PubMed

• ATR1 HAL2• Fuzzy[ALL] AND Hanage[AU] AND 2005[DP]• arndt and rhabdomyosarcoma• "Vorster HH"[Author]• (rotavirus infections[majr] OR rotavirus[majr])

AND english[la] AND humans[mh] NOT (editorial[pt] OR letter[pt])

Page 39: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 3924 August 2012

Search terms - summary

• Make sure you understand the search term syntax used by your preferred site, i.e. AND, +, “ ”, etc

• Search engines ‘see’ only certain words, not sentences

• Do not use ‘stop’ words, i.e. a, the, of, before unless they are part of “a text string search”

• Try to think of different ways to search for the same subject

• Look beyond the first page of search results

Page 40: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 4024 August 2012

NCBI full_report

Search results Full TextAbstractPlus

BLAST results

GOOGLE searchGOOGLE search AbstractPlus

Search results Full TextAbstractPlus Full Text

A search session may involve many information types..

Page 41: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 4124 August 2012

...and sources

?

GoogleScopusWeb of Science PubMedScielo

HighWireScienceDirect

Springer Link

National Literature

CAPESPortal

OA: BMCOr PLoS

Other Databases,e.g. NCBI

Page 42: Competências Básicas  de  Investigação Científica  e de  Publicação

Quick tour

Page 43: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 44: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 45: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 46: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 47: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 48: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 49: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 50: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 51: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 52: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 53: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 54: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 55: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 56: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 57: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 58: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 59: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 60: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 61: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 62: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 63: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 64: Competências Básicas  de  Investigação Científica  e de  Publicação
Page 65: Competências Básicas  de  Investigação Científica  e de  Publicação

Break

Page 66: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 66

Other types of database• Some databases contain mainly text, but others contain image, sequence

or structural data

• The technologies required to search and retrieve these different data types are very different.

• There is a growing amount of information in publicly available databases.

• For example, in 2013 the Nucleic Acids Research journal online Molecular Biology Database Collection listed 1512.

• The National Center for Biotechnology Information (NCBI) and the European Bioinformatics Institute(EBI) host some of the most important databases used for biomedical research.

24 August 2012

Page 67: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 67

Linking different data types is a challenge

24 August 2012

Gene ExpressionWarehouse

ProteinDisease

SNP

Enzyme

Pathway

Known Gene

SequenceCluster

Affy Fragment

Sequence

LocusLink

MGD

ExPASySwissProt

PDBOMIM

NCBIdbSNP

ExPASyEnzyme

KEGG

SPAD

UniGene

Genbank

NMR

Metabolite

Page 68: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 68

Databases available at NCBI

24 August 2012

Page 69: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 69

Other ways to search – BLAST, PubChem, UCSC Genome Browser

24 August 2012

>DinoDNA from JURASSIC PARK p. 103 nt 1-1200GAATTCCGGAAGCGAGCAAGAGATAAGTCCTGGCATCAGATACAGTTGGAGATAAGGACGGACGTGTGGCAGCTCCCGCAGAGGATTCACTGGAAGTGCATTACCTATCCCATGGGAGCCATGGAGTTCGTGGCGCTGGGGGGGCCGGATGCGGGCTCCCCCACTCCGTTCCCTGATGAAGCCGGAGCCTTCCTGGGGCTGGGGGGGGGCG

By sequence – BLAST:

By structure – PubChem:

Page 70: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 7024 August 2012

Example of BLAST search results

Page 71: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates 71

PC Compound Record

24 August 2012

Page 72: Competências Básicas  de  Investigação Científica  e de  Publicação

Ganesha Associates

Learning points

13/08/2013

• Google is a good place to start• Learn to use several information resources• Modify your search terms during the

course of a search session• Understand how the results are ranked

and don’t just look on the first page


Recommended