Construction of a Microsatellite-Enriched Genomic Library of Physalis philadelphica
Maria Chacon
March 19 2003
Purpose
Present progress on building a Physalis philadelphica genomic library with a high proportion of inserts containing microsatellite repeats. The protocol used was modified from the one developed at the Natural History Museum of the Smithsonian Institution
Outline
1. Microsatellite definition and mutation process
2. Application of microsatellite markers
3. Advantages of microsatellites
4. Drawbacks of microsatellites
5. Protocol
6. Results
7. Conclusions and future work
Classification:
Mono (A)11: AAAAAAAAAAADi (AT)8: ATATATATATATATATTri (ATC)7: ATCATCATCATCATCATCATCTetra (CTAG)6 CTAGCTAGCTAGCTAGCTAGCTAG
Imperfect microsatellite GTGTGTGTATGTGTGTInterrupted microsatellite GTGTGTGTCCCGTGTGTGTCompound microsatellite GTGTGTGTCTCTCTCTCTCT
1. Microsatellite definition and mutation process
Also known as simple sequence repeats (SSR) or short tandem repeat (STR). These terms are used to describe tandem repeats of short sequence motifs from mono to penta-nucleotides.
Genomic distribution of microsatellites
They are abundant in the eukaryotic genome and are distributed throughout the genome
The genomic frequency of microsatellites is inversely related to their repeat number, the higher number of repeats the less frequent
Microsatellites not based on a unit of three are rare within coding sequences as these can give rise to frameshift if they mutate
A microstellite mutation model
Microsatellite are exposed to a mutational process called DNA (replication) slippage: this causes length instability of tandem repeats and generates polymorphisms
(after Schlotterer and Harr, 2001)
2. Applications of microsatellite markers
I. Population genetic studies of natural populations: Hybridization, population history and phylogeography, divergence among populations, inbreeding, conservation genetics
II. Behavioral ecology: male mating success determined by paternity testing, social organization of populations (identification of relatedness) and multiple paternity
III. Genetic mapping: Microsatellites are distributed more or less evenly throughout the genome which makes them appropriate markers for mapping
Several hundreds of microsatellites are present in eukaryotic genomes and each locus is subjected to DNA slippage they are therefore a huge reservoir for polymorphic genetic markers
3. Advantages of microsatellites
• They probably exist in most of the species
• They are codominant markers
• They occur throughout most species’ genomes
• They can be isolated through the construction of a genomic library enriched for microsatellites or by the use of primers originally design for related species
• High heterozygosity level and high mutation rate
• Once isolated, microsatellites are amplified by PCR. Multiplex amplification of up to five loci is possible in a single PCR reaction which makes the scoring of multiple genotypes faster and cheaper
4. Drawbacks of microsatellites
I. Some organisms are very difficult to obtain microsatellite from: Some plants, invertebrates such as Lepidopterans and birds
II. Problems associated with PCR: A. non-amplification of certain alleles due to substitutions, insertions or deletions within the priming sites generating “null alleles”B. Taq polymerase may generate slippage products or add an extra dNTP which cause single base shifts making typing difficult
III. Problems associated with size or length homology: alleles may converge on the same size via different types of events in or surrounding the repeat array. This has limited their use in resolving evolutionary relationships
Size or length homoplasy
I. Addition or deletion of another type of repeat unit within the arrayII. Nonrepeated sequences or a partial repeat within the arrayIII. Changes in the sequence flanking the array
Five SSR markers in Poplar. Tree Genetic Engineering Research CooperativeSix bovine SSR markers. Kovar et al. LI-COR environmenral products
5. Protocol
I. Digestion of genomic DNA
II. Ligation of adapters
III. Enrichment steps with biotin-labeled SSR probes
IV. Removal of adapters
V. Cloning of enriched fragments
VI. PCR amplification of inserts
VII. Sequencing of inserts and design of primers
I. Digestion of genomic DNA
Genomic DNA is fragmented by digestion with restrictionEndonucleases. These are enzymes that cut the DNA atspecific recognition sequences
DNA was extracted from young leaves of Physalis philadelphicaand restricted with BamHI
5’-GTTCGATTGCGGATCCTCCTATTAGGATCCCGATCTGA-3’
3’-CAAGCTAACGCCTAGGAGGATAATCCTAGGGCTAGACT-5’
GTTCGATTGCGCAAGCTAACGCCTAG
GATCCTCCTATTAG GAGGATAATCCTAG
GATCCCGATCTGA GGCTAGACT
overhang overhang
overhang overhang
II. Ligation of adapters
Adapters are short DNA fragments of known sequence that may or not contain at the 3’ end an overhang for a specific restriction enzyme.
Adapters are linked to both ends of each fragment generated by restriction digestion
Adapters help manipulate the digested fragments of unknown sequence
GATCCTCCTATTAG GAGGATAATCCTAG
5’-GCGGTACCCGGGAAGCTTGG3’- CGCCATGGGCCCTTCGAACCCTAG
GATCCCAAGCTTCCCGGGTACCGC-3’ GGTTCGAAGGGCCCATGGCG-5
BamHI recognition sequences are restored at both ends of restriction fragments
III. Enrichment steps with biotin-labeled SSR probes
mag
net
Straptividine beads
Adapter-ligated fragments are hybridized with biotin-labeled SSR probes
Fragments that do not hybridize with probes are washed away by attaching biotin to straptividine beads and a magnet
The purpose of this step is to select the fragments containing microsatellite sequences
Biotin-labeled SSR probes
(AAC)10, (AAG)10, (AAT)10, (ACT)10, (AGT)10
(ATG)10, (ATC)10, (TTC)10, (TTA)10, (TTG)10
IV. Removal of adapters
Adapters are removed by digesting with BamHI enzyme.The BamHI overhangs are restored at both ends of the fragments. These overhangs are going to complement overhangs of the vector for cloning
GATCCTCCAACAACAACAACAACTATTAG GAGGTTGTTGTTGTTGTTGATAATCCTAG
5’-GCGGTACCCGGGAAGCTTGG3’- CGCCATGGGCCCTTCGAACCCTAG
GATCCCAAGCTTCCCGGGTACCGC-3’ GGTTCGAAGGGCCCATGGCG-5
V. Cloning of insert DNA
Linear vectorBamHI restriction
Ligation of insert
Circular vector
pBluescript vector
Ampicillin lacZ’
MCS
Transformation
Transformation of XL1-blue strain of E. Coli
E. coli+plasmid without insert+f’ episome
E. coli+plasmid with insert+f’episome
Growing in selective medium
Ampicillin + Tetracycline + IPTG + X-GAL
E. coli+plasmid without insert, no f’ episome
lacZ
lacZgene
Ampr
pBluescript vector carries a partial copy of the lacZ gene and F’ episome also carries a defective lacZ gene which complement each other to produce an active B-galactosidase gene
The active gene gives a blue color. The inactive gene gives a white color
Tetr
lacZ
Ampr
Tetr
lacZ
Ampr
White-blue color selection
FunctionallacZ gene
lac repressor
expression X-Gal degradesrepression inhibited by IPTG
lacZ
Ampr
lacZgeneAmpr
Non-functionallacZ gene
Non-expression X-Gal does not degrade
VI. PCR amplification of inserts
T7 primer T3 primer
VII. Sequencing of inserts
Partial sequence of an insert enriched with (TTG)10
6. Results
I. Enrichment was succesful for all microsatellite probes except for (ATG)10 and (TTC)10
II. Several clones with insert were obtained for the successful enrichment reactions:(TTG)10: 250 clones (AGT)10: 126 clones(TTA)10: 90 clones (AAC)10: 50 clones(ACT)10: 50 clones (AAT)10: 130 clones(AAG)10+(ATC)10: 72 clones
Total: 768 clones
III. Insert size ranged from 300 bp up to 1500 bp. The most common sizes ranged from 300-700 bp
IV. 33 clones: 10 enriched for (TTG)10, 14 for (AGT)10, 5 for (TTA)10 and 3 for (AAC)10 were sent for sequencing. One third did not contain SSR including all those that were enriched for TTA
6. Results
Conclusions and future work
I. Physalis philadelphica contains AT-rich microsatellites as other plant species and this method have proved useful for isolating them
II. Microsatellite sequences can be isolated by doing one or two steps of enrichment without need for further screening such as hybridization of clones with SSR-probes
III. Ninety six clones are going to be sequenced
IV. The aim is to isolate a minimum of 15-20 polymorphic loci