Controlling the Emergence of Hematopoietic Progenitor Cells from Pluripotent Stem Cells
by
Kelly Anne Purpura
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Chemical Engineering and Applied Chemistry Collaborative Program: Institute of Biomaterials and Biomedical Engineering
University of Toronto
© Copyright by Kelly A. Purpura 2010
ii
Controlling the Emergence of Hematopoietic Progenitor Cells from Pluripotent Stem Cells
Kelly Anne Purpura
Doctor of Philosophy
Department of Chemical Engineering and Applied Chemistry Collaborative Program: Institute of Biomaterials and Biomedical Engineering
University of Toronto
2010
Abstract
Embryogenesis occurs within a complex and dynamic cellular environment that influences cell
fate decisions. Pluripotent stem cells (PSCs) are a valuable tool for research into disease models
as well as a resource for cell therapy due to their capacity to self-renew and differentiate into all
cell types. Mimicking aspects of the embryonic microenvironment in vitro impacts the resultant
functional cells. The aim of this work was to develop a controlled and scaleable process for the
generation of hematopoietic progenitor cells (HPCs) from embryonic stem cells (ESCs). We
demonstrated with bioreactor-grown embryoid bodies (EBs) that increased HPC generation can
be elicited by decreasing the oxygen tension by a mechanism where vascular endothelial growth
factor receptor 2 (VEGFR2) activation is controlled through competition with the ligand decoy
VEGFR1. This is important as it demonstrates the inherent responsiveness of the developing
hematopoietic system to external forces and influences. We also established a serum-free system
iii
that facilitates directed differentiation, determining 5 ng/ml bone morphogenetic protein-4
(BMP4) with 50 ng/ml thrombopoietin (TPO) could generate 292 ± 42 colony forming cells
(CFC)/5 x 104 cells with early VEGF treatment (25 ng/ml, day 0-5). We also controlled
aggregate size influencing relative endogenous and exogenous growth factor signaling and
modulating mesodermal differentiation; CFC output was optimal when initialized with 100 cell
aggregates. For the first time, we demonstrated efficacy of local growth factor delivery by
producing HPCs with gelatin microparticles (MP). Overall, these design components generate
HPCs in a controlled and reproducible manner using a serum-free bioprocess that couples size
controlled aggregates containing gelatin MPs for localized growth factor release of BMP4 and
TPO with hypoxia to induce endogenous VEGF production. These strategies provide a tunable
platform for developing cell therapies and high density growth, within a bioreactor system, can
be facilitated by hydrogel encapsulation of the aggregates.
iv
Acknowledgments This body of work did not spring forth in isolation, and I would like to thank all the members of
the Zandstra and collaborating labs for providing aid in the form of discussions, reagents,
protocols, expertise, and help – it was highly appreciated. I would also like to thank my friends
and family for their support, as well as the following funding sources: NSERC, OGS, OGSST,
and SCN. A special thank you goes out to everyone who reminded me one way or another of the
Nike slogan, and got me out of bed in the morning. I also wish to thank my committee members,
Andras Nagy, Molly Shoichet, and William Stanford for their guidance and encouragement.
Lastly, I wish to thank my supervisor, Peter Zandstra for the opportunity and guidance that
brought this work to completion – for painting the big picture, seeing the good in my data, and
for boosting my morale when necessary.
v
Table of Contents Acknowledgments.......................................................................................................................... iv
Table of Contents............................................................................................................................ v
List of Tables ................................................................................................................................. ix
List of Figures ................................................................................................................................. x
List of Supplementary Figures...................................................................................................... xii
List of Appendices ....................................................................................................................... xiii
Abbreviations............................................................................................................................... xiv
Chapter 1 ....................................................................................................................................... 1
Introduction..................................................................................................................................... 1
1.0 Motivation: Regenerative Medicine and the Potential of Pluripotent Stem Cells (PSCs) ...... 2
1.1 Hypothesis ............................................................................................................................... 4
1.2 Specific Objectives.................................................................................................................. 4
1.3 Introductory Remarks.............................................................................................................. 5
1.4 Early Mammalian Development.............................................................................................. 7
1.4.1 Embryonic Patterning ................................................................................................... 7
1.4.2 Gastrulation: Primitive Streak Formation and Cell Migration ..................................... 8
1.4.3 Origins of Hematopoiesis: Primitive and Definitive Progenitors ............................... 10
1.4.4 Defining the Adult Hematopoietic Stem Cell (HSC) ................................................. 12
1.4.5 Oxygen Transport to the Embryo ............................................................................... 13
1.5 In vitro Model of Development............................................................................................. 15
1.5.1 Mouse Embryonic Stem Cell Isolation and Maintenance........................................... 15
1.5.2 Embryoid Body (EB) Differentiation ......................................................................... 16
1.5.3 Parallels between mouse and human ESCs ................................................................ 17
1.6 Uncovering the Hematopoietic Phenotype............................................................................ 20
1.7 Influencing the Maturation or Maintenance of HSCs ........................................................... 23
1.7.1 Growth Factors (GFs) and Soluble Receptors ............................................................ 23
Nodal ............................................................................................................................... 23
Bone Morphogenetic Proteins ......................................................................................... 24
Vascular Endothelial Growth Factor (VEGF)................................................................. 25
Soluble VEGFR1 (sVEGFR1) ........................................................................................ 26
Thrombopoietin (TPO).................................................................................................... 27
1.7.2 Signaling Networks......................................................................................................28
Platelet Derived Growth Factor (PDGF) Receptor Family ............................................. 28
Transforming Growth Factor (TGF)-β Superfamily Signaling....................................... 29
Type I Hematopoietic Growth Factor Receptor (HGFR) Family ................................... 29
1.7.3 Microenvironmental Factors........................................................................................30
Cellular Interactions ........................................................................................................ 30
Cell Scaffolds or Encapsulation ...................................................................................... 31
Local Microparticle Delivery Systems............................................................................ 33
Aggregate Size ................................................................................................................ 34
1.7.4 Macroenvironmental Controls .....................................................................................36
1.8 Moving Towards ESC Generated Long-Term Repopulating HSCs ......................................38
1.9 Thesis Overview.....................................................................................................................42
Chapter 2 ......................................................................................................................................43
Soluble Flt-1 Regulates Flk-1 Activation to Control Hematopoietic and Endothelial Development in an Oxygen Responsive Manner......................................................................43
2.0 Abstract ..................................................................................................................................44
2.1 Introduction ............................................................................................................................45
2.2 Materials and Methods ...........................................................................................................48
2.2.1 Cells .............................................................................................................................48
2.2.2 Encapsulation Process and Bioreactor Culture ............................................................48
2.2.3 Hematopoietic Cell Assays ..........................................................................................48
2.2.4 Enzyme-linked immunosorbent assay (ELISA) ..........................................................49
2.2.5 RT-PCR........................................................................................................................49
2.2.6 Endothelial Cell Assay.................................................................................................50
2.2.7 Transgenic Mice...........................................................................................................50
2.2.8 Immunohistochemistry ................................................................................................50
2.2.9 Immunoprecipitation and Western Blot.......................................................................51
2.2.10 Statistical Analysis.......................................................................................................51
2.3 Results ....................................................................................................................................52
2.3.1 ESC blood and endothelial cell output are correlated with VEGF secretion rates in opposite ways...............................................................................................................52
2.3.2 ESC blood Mutant VEGF receptor ESC lines demonstrate that Flt-1 plays a critical role in oxygen-mediated modulation of HPC..................................................54
2.3.3 Hypoxia influences Flk-1 activation via the secretion of Flt-1 and VEGF .................56
vi
vii
2.3.4 Mimicking the Flt-1 mediated control of ESC fate under normoxic conditions: effects on blood and endothelial cell output ............................................................... 57
2.3.5 Controlling Flk-1 activation of primary E7.5 derived cells alters hematopoietic and endothelial outputs in a manner similar to that observed in EB differentiation... 60
2.3.6 Over-expression of Flt-1-Fc in vivo disrupts vascular and hematopoietic development................................................................................................................ 63
2.4 Discussion ............................................................................................................................. 65
2.5 Acknowledgements ............................................................................................................... 69
2.6 Supplementary Figures.......................................................................................................... 70
Chapter 3 ..................................................................................................................................... 73
Analysis of the Temporal and Concentration-Dependent Effects of BMP-4, VEGF and Tpo on the Development of Embryonic Stem Cell-Derived Mesoderm and Blood Progenitors in a Defined, Serum-Free Media.............................................................................................. 73
3.0 Abstract ................................................................................................................................. 74
3.1 Introduction ........................................................................................................................... 75
3.2 Materials and Methods .......................................................................................................... 77
3.2.1 Maintenance of ESCs.................................................................................................. 77
3.2.2 ESC Differentiation .................................................................................................... 77
3.2.3 Flow Cytometry .......................................................................................................... 78
3.2.4 Embryoid Body (EB) Formation Assay...................................................................... 78
3.2.5 Colony Forming Cell (CFC) Assay ............................................................................ 79
3.2.6 Blast (BL-) CFC Assay............................................................................................... 79
3.2.7 RT-PCR....................................................................................................................... 79
3.2.8 Statistical Analysis...................................................................................................... 80
3.3 Results ................................................................................................................................... 81
3.3.1 ESC maintenance in N2B27 serum-free defined media ............................................. 81
3.3.2 BMP-4 promotes dose-dependent T and VEGFR-2 expression: differentiation towards hematopoietic progenitor cells in N2B27 serum-free defined media ........... 81
3.3.3 Development of serum-free mesodermal enhancing media........................................ 85
3.3.4 Serum-free differentiation of ESC .............................................................................. 87
3.3.5 Effect of cytokines on hematopoietic progenitor cell development ........................... 89
3.4 Discussion ............................................................................................................................. 93
3.5 Acknowledgements ............................................................................................................... 97
Chapter 4 ..................................................................................................................................... 98
Endogenous Control and Local Delivery of Inductive Factors to Guide Serum-Free Blood Development from Mouse Pluripotent Stem Cells .................................................................. 98
viii
4.0 Abstract ................................................................................................................................. 99
4.1 Introduction ......................................................................................................................... 100
4.2 Materials and Methods ........................................................................................................ 103
4.2.1 Cell Culture............................................................................................................... 103
4.2.2 Fluorescent Automated Cell Sorting (FACS) ........................................................... 103
4.2.3 Hematopoietic Cell Assays ....................................................................................... 104
4.2.4 Size Controlled Aggregation..................................................................................... 104
4.2.5 Encapsulation Process............................................................................................... 104
4.2.6 Manufacturing and Loading Gelatin Microparticles................................................. 105
4.2.7 Generating Mixed Aggregates of Microparticles and Cells ..................................... 105
4.2.8 Statistical Analysis.................................................................................................... 105
4.3 Results ................................................................................................................................. 106
4.3.1 Cell populations distinguished by phenotype have distinct hemogenic capacity ..... 106
4.3.2 Embyronic stem cell aggregate size influences subsequent mesodermal phenotype and development ....................................................................................................... 108
4.3.3 Inducing the niche by reducing environmental oxygen............................................ 111
4.3.4 Tuning the microenvironment with localized growth factor release ........................ 113
4.3.5 Integrating microparticle growth factor delivery with low environmental oxygen .. 114
4.4 Discussion ........................................................................................................................... 117
4.5 Acknowledgements ............................................................................................................. 120
4.6 Supplementary Figures........................................................................................................ 121
Chapter 5 ................................................................................................................................... 126
Thesis Summary and Future Directions...................................................................................... 126
5.0 Thesis Summary .................................................................................................................. 127
5.1 Future Directions ................................................................................................................. 132
5.1.1 Philosophy................................................................................................................. 132
5.1.2 Further Insights into ESC-HSC Phenotype and Function......................................... 135
5.1.3 Experimental Strategies ............................................................................................ 139
5.1.4 Transfer of Scaleable Propagation and Differentiation Methods from mESC to a Serum-Free hESC or hiPSC System......................................................................... 143
Appendix A ................................................................................................................................ 147
The Impact of Exogenous Factors .............................................................................................. 147
References .................................................................................................................................. 161
Copyright Acknowledgements.................................................................................................... 200
ix
List of Tables
Chapter 4 Table 1. Primers used for qRT-PCR of the phenotypically sorted cells. ................................... 122
Chapter 5 Table 2. Isoelectric points of various proteins ........................................................................... 130
Appendix A Table 3. Primers used for qRT-PCR: assessing the endoderm potential of d14 plated EBs. .... 154
x
List of Figures Chapter 1 Figure 1.1. Experimental approach to HPC generation from ESCs. ............................................. 6
Figure 1.2. Development of the mouse embryo prior to gastrulation. ........................................... 7
Figure 1.3. Schematic representation of mouse embryonic development. .................................... 9
Figure 1.4. Origins of hematopoiesis and engraftment potential................................................. 12
Figure 1.5. The in vitro EB model. .............................................................................................. 16
Figure 1.6. Parallels between HSC development in the mouse embryo and differentiating ESCs. ....................................................................................................................................................... 22
Figure 1.7. A tuneable microenvironment to facilite EB differentiation. .................................... 42
Chapter 2 Figure 2.1. Hematopoietic progenitor cell (HPC) production, EC development and VEGF secretion is a function of oxygen tension...................................................................................... 53
Figure 2.2. Flt-1 is the major modulator of CFC production and in soluble form (sFlt-1) may impact Flk-1 activation as a result of oxygen concentration. ....................................................... 55
Figure 2.3. Control of Flk-1 activation affects CFC and EC output in a developmental stage-specific manner. ............................................................................................................................ 59
Figure 2.4. Modulation of hematopoietic and endothelial development from primary embryo-derived cells as a function of altering Flk-1 activation and inhibition. ........................................ 62
Figure 2.5. Flt-1-Fc overexpression mimics loss of Flk-1 activation in vivo.............................. 64
Figure 2.6. Schematic of the proposed model.............................................................................. 66
Chapter 3 Figure 3.1. BMP-4 and LIF allow cell expansion and maintain the undifferentiated cell phenotype in N2B27 media. ......................................................................................................... 82
Figure 3.2. Phenotypic expression of developing EBs cultured in N2B27 media supplemented with or without 10 ng/ml BMP-4 or serum control. ..................................................................... 84
Figure 3.3. Removal of B27 and the addition of BME improves the yield of VEGFR-2+ and T-GFP+VEGFR-2+ cells. ................................................................................................................. 86
Figure 3.4. T-GFP and VEGFR-2 expression changes in response to cytokine supplementation of N2BME..................................................................................................................................... 88
Figure 3.5. The cytokine cocktail effects hematopoietic differentiation as measured following eight days of treatment.................................................................................................................. 90
Figure 3.6. Delivery time of VEGF effects hematopoietic CFC output, while early BMP-4 (d0-5) delivery is as effective as continuous treatment (d0-8). ............................................................... 92
xi
Chapter 4 Figure 4.1. Monitoring mesodermal specification. .................................................................... 107
Figure 4.2. Controling initial cell aggregate size influences mesodermal specification............ 110
Figure 4.3. Endogenous growth factors can be induced using hypoxia and exogenous factors can be delivered locally with gelatin microparticles. ........................................................................ 112
Figure 4.4. Combining local growth factor delivery with hypoxic induction of exogenous factors supports mesodermal development............................................................................................. 115
Chapter 5 Figure 5.1. Pluripotent stem cells: unlocking the potential. ..................................................... 134
Figure 5.2. Future methods: gelatin microparticle formation and their incorporation into aggregates. .................................................................................................................................. 141
Appendix A
Figure A.1. The general progression of lineage commitment can be tracked over time. .......... 150
Figure A.2. In response to growth factor cocktail different numbers of initiating cells enhance mesodermal potential. ................................................................................................................. 151
Figure A.3. The cytokine cocktail influences CFC output and endoderm gene induction differently based on the initial aggregate size............................................................................. 152
Figure A.4. Conditioned media can enhance the CFC output of the least inductive conditions...................................................................................................................................................... 155
Figure A.5. Screen of 10 hematopoietic cytokines. ................................................................... 158
Figure A.6. Comparing the hematopoietic progenitors produced with BAW or BVT treatment...................................................................................................................................................... 160
xii
List of Supplementary Figures Chapter 2 Supplementary Figure 1. Gene expression analysis of the expression of VEGF and its receptors during ESC differentiation. ........................................................................................................... 70
Supplementary Figure 2. sFlt-1 in the supernatant.. .................................................................... 71
Supplementary Figure 3. Phosphorylation of Flk-1 in different conditions. ............................... 71
Supplementary Figure 4. Hypoxia or exogenous VEGF treatment positively effect hemangioblasts.............................................................................................................................. 72
Chapter 4 Supplementary Figure 1. Gene expression profile from sorted cell populations....................... 121
Supplementary Figure 2. Kinetic CFC output is dependent on initial aggregate size ............... 123
Supplementary Figure 3. Aggregate encapsulation is an efficient process ............................... 123
Supplementary Figure 4. BMP4 was released from the gelatin MPs and detected within the embryoid bodies.......................................................................................................................... 124
Supplementary Figure 5. Similar mesodermal phenotypes observed with soluble or microparticle growth factor delivery................................................................................................................. 125
xiii
List of Appendices Appendix A
The Impact of Exogenous Factors .............................................................................................. 147
xiv
Abbreviations 7AAD 7-amino-actinomycin D AGM Aorta-gonad-mesonephros A-P Anterior-posterior Alb/ALB Albumin Afp/αFP Alpha-fetoprotein ARNT Arylhydrocarbon receptor nuclear translocator AVE Anterior visceral endoderm BAW 1 ng/ml BMP4, 2 ng/ml Activin A, 3 ng/ml Wnt3a B27 B27 supplement BL Blast BME β-mercaptoethanol BM Bone marrow BMSC Bone marrow stem cells BMP Bone morphogenetic protein BSA Bovine serum albumin BVT 5 ng/ml BMP4, 25 ng/ml VEGF, 50 ng/ml TPO CAM Cell adhesion molecule CD Cluster of differentiation CDM Chemically defined medium CFC Colony forming cell Cdx4 Caudal-type homeobox transcription factor 4 CFU Colony forming unit CM Conditioned media Cps1 Carbamoyl phosphate synthetase I DA Dorsal aorta Dl-, Dll- Delta- , Delta-like- DMEM Dulbecco’s Modified Eagle Medium DMPS Dimethylpolysiloxane Dpc days post coitum E Embryonic day EB Embryoid body EC Endothelial cell ECM Extracellular matrix EGF Epidermal growth factor ELISA Enzyme-linked immunosorbent assay Epi Epiblast Epo Erythropoietin EryD Erythroid (definitive) EryP Erythroid (primitive) ES Embryonic stem E+/-T+/-P+/-F+/- E-cadherin Brachyury PDGFRα Flk1 marker expression Evx1 Even skipped homeotic gene 1 homolog FACS Fluorescence activated cell sorting FBS Fetal bovine serum FGF Fibroblast growth factor
xv
Flk-1 or Flk1 Fetal liver kinase 1 (VEGFF2/KDR) Flt-1 or Flt1 Fms-like tyrosine kinase 1 (VEGFR1) Flt3L Fms-like tyrosine kinase 3 ligand Foxa2 Forkhead box A2 / HNF(Hepatic nuclear factor)3beta Gata2/4/6 GATA binding protein (globin transcription factor) G-CSF Granulocyte colony-stimulating factor GEMM Granulocyte, erythrocyte, macrophage, megakaryocyte GF Growth factor GSK3β glycogen synthase kinase 3β GM Granulocyte macrophage HBSS Hanks buffered saline solution HD Hanging drop hESC Human embryonic stem cell HF HBSS with 2 % v/v FBS HGF Hepatocyte growth factor HGFR Hematopoietic growth factor receptor HIF Hypoxia inducible factor hiPSC Human induced pluripotent stem cell HOX Homeobox (gene); a sequence of 180 nucleotides HPC Hematopoietic progenitor cell HSC Hematopoietic stem cell ICM Inner cell mass Id Inhibitor of differentiation IGF-1 Insulin-like growth factor 1 IL Interleukin IMDM Iscove’s Modified Dulbecco’s Medium INF Interferon iPSC Induced pluripotent stem cell Kd Equilibrium binding constant kDa kilodalton; (1 dalton = 1 atomic mass unit = Mu/NA) Klf2 Krueppel-like factor 2 KLS/KTLS cKit+Lin-Sca1+ / cKit+Thy1.1loLin-/loSca1+ KO-SR Knockout-Serum Replacement Lin- Lineage negative LIF Leukemia inhibitory factor LSC Liquid suspension culture LTC-IC Long-term culture initiating cell LTR Long-term repopulating M Methylcellulose MAPK Mitogen-activated protein kinase M-CSF Macrophage colony stimulating factor ME Myeloid erythroid MEF Murine embryonic fibroblast MEK MAPK/extracellular signal-regulated kinase (ERK) mESC Mouse embryonic stem cell MIP-1γ Macrophage inflammatory protein-1 gamma MP Microparticle MPP Multipotent progenitors
xvi
MS Mass spectrometry MTG Monothioglycerol Myb Myeloblastosis oncogene NGF Nerve/neuronal growth factor NbM Neurobasal medium Nos Nitric oxide synthase NSC Neural stem cell Oct4 Octamer-binding protein 4 P-A Posterior-Anterior P-Sp Para-aortic splanchnopleura PB Peripheral blood PBS Phosphate buffered saline PBX1 Pre-B-cell leukaemia transcription factor 1 P-D Proximal-distal PDGF Platelet-derived growth factor PDGFRα Platelet-derived growth factor receptor α PDMS Polydimethylsiloxane PECAM Platelet-endothelial cell adhesion molecule (CD31) PFA Paraformaldehyde Pld3 Phospholipase D3 PLGA poly(lactide-co-glycolide) PlGF Placenta growth factor PSC Pluripotent stem cell RA Retinoic acid RGD Arginine-glycine-aspartic acid Rhob Ras homolog gene family, member b ROCK Rho-associated kinase inhibitor, Y-27632 RPM Rotations per minute RTK Receptor tyrosine kinase RT-PCR Reverse transcription-polymerase chain reaction Runx1 Runt-related transcription factor/ core binding factor-α (CBFα) SAP SLAM-associated protein Sca-1 Stem cell antigen 1 SCID Severe combined immunodeficiency SCF or SF Stem cell factor or Steel factor SCL/TAL1 Stem cell leukemia/T-cell acute lymphoblastic leukemia 1 SLAM Signaling lymphocyte activation molecule SSC Stirred-suspension culture SSEA Stage specific embryonic antigen STAT/Stat Signal transducers and activators of transcription Sox7/17 SRY (sex determining region Y)-box SP Side population sVEGFR1 Soluble vascular endothelial growth factor receptor 1 (Flt-1) T Brachyury Tat Tyrosine aminotransferase TGF-β Transforming growth factor-beta T-GFP Brachyury-green fluorescent protein Tie2 Tyrosine kinase with immunoglobulin-like and EGF-like domains 2
xvii
Tpo or TPO Thrombopoietin TE Trophectoderm VEGF Vascular endothelial growth factor VEGFR2 Soluble vascular endothelial growth factor receptor 2 (Flk-1) VWF von Willebrand factor W41/W41 cKit deficient mouse strain Wnt Wingless Int YS Yolk sac
Chapter 1
Introduction
1
2
1.0 Motivation: Regenerative Medicine and the Potential of Pluripotent Stem Cells (PSCs)
Hematopoietic stem cells (HSCs) sustain blood production throughout life and are defined
operationally by their capacity to reconstitute a recipient’s entire blood system. Currently, a
variety of malignant and genetic blood diseases are treated by transplanting autologous or
allogeneic HSCs from bone marrow (BM), peripheral blood (PB), or umbilical cord blood
(UCB). However, these sources are often limited by donor availability and UCB typically does
not contain enough HSCs to reconstitute adult hematopoiesis upon transplantation (Barker and
Wagner 2002). Ideally, a host compatible and abundant source of HSCs would be available.
Pluripotent stem cells (PSCs), such as embryonic stem cells (ESCs), have unlimited expansion
and differentiation capabilities, thus production of HSC from this source is an attractive option.
In vivo, a single adult HSC is capable of extensive proliferative expansion and can give rise to all
differentiated blood and immune cell types within the body (Osawa et al. 1996). It has been
estimated that just 104-105 HSCs maintain the human blood system (Gordon and Blackett 1998,
Abkowitz et al. 2002), and that this number is conserved across species. However, at steady-
state these cells are primarily quiescent with a low rate of self-renewal (Jordan and Lemischka
1990, Cheshier et al. 1999, Hock et al. 2004). Clinically, increasing the number of transplanted
cells may reduce post-transplant mortality due to an increase in short-term repopulation by
mature cells (Laughlin et al. 2001, Schoemans et al. 2006). Ex vivo expansion of adult derived
HSC is being explored as a means to increase the transplantable stem cell pool but there is
evidence that the extent of HSC expansion may be limited by telomere shortening (Zimmermann
et al. 2004), a problem that is not evident in ESCs (Amit et al. 2000).
Preimplantation blastocyts have been used to isolate ESCs from many species including mice
(Evans and Kaufman 1981, Martin 1981), nonhuman primates (Thomson et al. 1995) and
humans (Thomson et al. 1998). Mouse ESCs (mESCs) have provided a valuble tool for over 25
years, enhancing our understanding of developmental pathways and mechanisms that regulate
hematopoiesis; remarkable progress has also been made with human ESCs (hESCs). In chimeric
and tetraploid aggregation studies, mESCs demonstrate the capacity to differentiate into adult
HSCs, however, under most circumstances in vitro, ESCs do not produce definitive HSCs but
rather hematopoietic progenitor cells (HPCs). HPCs have a reduced capacity for self-renewal,
3
do not reconstitute recipient mice over the long-term, and may be restricted to a specific blood
lineage. This is not to say that HPCs are of no clinical value. The production of large numbers
of specific lineage progenitors or mature cells, such as erythrocytes, platelets, and natural killer
cells, would be useful for transfusion or immune therapies (Kaufman 2009). Regardless of the
species, the cellular products of embryoid body (EB) differentiation with serum containing
media and without additional growth factors or physicochemical control do not exhibit adequate
qualities or sufficient numbers for use in hematopoietic cell-based therapies. Hence, generation
of a cell population with suitable numbers and exhibiting properties of a transplantable HSC or
transfusable progenitor/mature cell requires an understanding of the mechanisms that control
ESC specification and maturation to competency, as well as the ability to deliver these signals in
a robust and clinically relevant (scalable) manner.
4
1.1 Hypothesis The pluripotent stem cell microenvironment can be manipulated to control endogenous factor
catalyzed mesoderm differentiation and subsequent blood progenitor cell output. Cellular
microenvironments hypothesized to be particularly important for mesoderm specification are
oxygen tension, direct or indirect acting soluble factors (BMP4, VEGF, TPO), and endogenous
factors (manipulated through aggregate size). These factors are expected to act in a dynamic and
interactive manner and their control and optimization should support enhanced mesoderm
specification and blood progenitor cell (colony forming cell, CFC) output.
1.2 Specific Objectives
• To quantitatively investigate the impact of hypoxia on hematopoietic progenitor cell
production and to determine the interaction between oxygen concentration and VEGF,
sVEGFR1, and VEGFR2 mediated induction (Chapter 2);
• To test mesoderm differentiation under serum-free conditions using a combination of
exogenous factors, including BMP4, VEGF, and TPO (Chapter 3);
• To examine phenotypic markers (E-cadherin, Brachyury, PDGFRα, and Flk1) associated
with mesoderm differentiation and to relate these markers to blood progenitor cell (CFC)
output (Chapter 4 and Appendix A);
• To determine the affects of aggregate size and localized microparticle growth factor
delivery on hematopoietic progenitor cell production (Chapter 4 and Appendix A).
5
1.3 Introductory Remarks Hematopoietic development arises from coordinated cell migration and a complex network of
signaling factors. Aspects of this regulation may be preserved in the adult within the HSC niche,
where HSCs communicate with their surrounding environment through cell-cell contact, binding
extracellular matrix (ECM) constituents, and interactions with cell bound or soluble growth
factors. A tuneable environment can catalyze endogenous elements to initiate an appropriate
cascade of irreversible events towards blood development from ESCs, such that production may
be maximized in a scaleable serum-free culture system. Consequently my Ph.D. thesis has
focused on developing methods that manipulate cell fate during ESC differentiation such that
blood development is promoted, while other lineages are inhibited, and that integrate with a
scalable bioreactor culture system (Figure 1.1). Mesoderm commitment and blood development
was examined using the mouse ESC model system as it allows HPC numbers to be determined
retrospectively in the colony forming cell assay (CFC assay). This functional assay was coupled
with phenotypic analysis (Flk1, CD31, CD34, CD41, CD45) and sorting strategies (E-cadherin,
Brachyury, PDGFRα, Flk1) to examine the capacity for blood progenitor development and
differentiation capacity of phenotypically distinct cells. Serum-free improvements and factor
supplementation were also investigated.
The intention of this introductory chapter is to present a focused overview of the terminology
and background upon which my experimental model and design is built. First, an overview of
embryogenesis with an emphasis on mesoderm development will be provided. Many in vivo and
in vitro experiments have been performed to increase our understanding of this natural
phenomenon and the generation of the ESC system is described within this context. While the
characteristics of stem cells were established early on, direct studies of HSCs were delayed by a
lack of markers to unequivocally and prospectively detect their presence. Progress in defining
these characteristic markers, along with factors and signaling pathways that are pertinent to
mesoderm differentiation are provided next. Given this background, the focus then shifts to the
micro- and macro-environmental parameters that can be controlled while engineering strategies
to maximize mesoderm differentiation from PSCs. The specific aims are addressed in Chapters
2-4 with the conclusions of these different studies provided in Chapter 5. The importance of
VEGF signaling during lineage specification and speculation on how we will continue to
6
increase our understanding of cell development and our control over differentiation processes in
the future is also highlighted. Information about mesoderm induction with an alternative set of
growth factors (BMP4, Activin A, and Wingless Int (Wnt) 3a) that may mimic an earlier
embryonic microenvironment, is included in Appendix A.
Hydrogel encapsulation (5)
Hematopoetic progenitor cells
Controlled Bioreactor
Size controlled aggregates (3)
Microparticle growth factor
delivery (4)
Pluripotent
Stem Cells
Serum-free (2)
-Oxygen (1)
-pH
Figure 1.1. Experimental approaches to generate HPCs from ESCs. Methods were developed
to manipulate cell fate during ESC differentiation such that blood development is promoted while other
lineages are inhibited in a scalable serum-free bioreactor culture system. Macroenvironmental control
over oxygen tension during growth (1) is coupled with a serum-free environment (2) and using size
controlled aggregates (3) with microparticle growth factor delivery (4) enhances HPC production. An
individual cellular microenvironment or niche is provided by hydrogel encapsulation (5), in a controlled
bioreactor system.
7
1.4 Early Mammalian Development
1.4.1 Embryonic Patterning
Following fertilization, the mouse embryo changes dramatically in size and shape with embryo
asymmetry first becoming apparent at the blastocyst stage (4.5 days post coitum; dpc). At this
stage, an outer cell layer (trophectoderm; TE) surrounds a cluster of cells, called the inner cell
mass (ICM), that are localized at the embryonic pole and lined by a layer of primitive endoderm
at the interface of the blastocoel cavity (Figure 1.2A). The TE will give rise to portions of the
yolk sac and placenta while the ICM will form the embryo proper (Tam and Behringer 1997, Lu
et al. 2001, Gadue et al. 2005). Although many questions remain about patterning the embryo
and determining the embryonic axis in the mouse, and upon extension, human, it is becoming
clear that reciprocal interactions between the extraembryonic and embryonic lineages are
important. These interactions occur in the form of cell signaling modulated by growth factors
and cell contacts, and are influenced by physiochemical conditions such as oxygen tension.
anterior
dorsal
ventral
posterior
proximal
distal
Blastocyst 3.5 days
Inner cell mass Extraembryonic
ectoderm
Ectoplacental cone
Evx1 Fgf8 nodal
Implanting blastocyst 4.5 days
Epiblast
Primitive endoderm
Egg cylinder stage
5.5-6 days
Trophectoderm
A B
VE-1
Figure 1.2. Development of the mouse embryo prior to gastrulation. The embryo develops in
an orderly process, showing the inner cell mass after 3.5 days, and with an axial tilt starting at 4.5 days
(A). Based on figures published by (Beddington and Robertson 1999). Organization continues through
the egg cylinder stage as the ectoplacental cone and extraembryonic ectoderm polarize to the
proximal/dorsal area for future development into the placenta and chorion, while genes (indicated in
italics) also begin segregating to anterior-posterior positions (B).
8
The orchestrated control systems that direct development are incompletely understood, however,
development is clearly a very dynamic and highly regulated process. Upon blastocyst
implantation, asymmetries are detected as the proximal-distal (P-D) axis emerges in the egg
cylinder stage, with the ectoplacental cone considered the proximal pole and the bottom of the
cup-shaped embryo the distal pole (Tam and Behringer 1997, Lu et al. 2001, Gadue et al. 2005).
The anterior-posterior (A-P) axis of the embryo is positioned by coordinated cell movements that
rotate the pre-existing P-D axis by 90° (Varlet et al. 1997, Lu et al. 2001). A number of genes
have been identified that are expressed in patterns indicative of the A-P axis of the embryo prior
to gastrulation. An endoderm-associated antigen is first detected in the visceral endoderm (VE-
1) on one side of the 5.0 dpc embryo and later localizes to the anterior visceral endoderm (AVE)
(Rosenquist and Martin 1995). Posteriorly-restricted expression patterns include Evx1, Fgf8, and
nodal (Dush and Martin 1992, Crossley and Martin 1995, Varlet et al. 1997) (Figure 1.2B).
1.4.2 Gastrulation: Primitive Streak Formation and Cell Migration
Gastrulation is a pivotal step in the formation of the vertebrate body plan and it is generally
accepted that an organizer or specific cell population ensures that precursor tissues are correctly
placed (Lemaire and Kodjabachian 1996). Developmental fates have been extensively studied
and mapped by collating the geographical distribution of specific progenitors (Tam and
Behringer 1997). Within the mouse at approximately 6.5 days of gestation, epiblast cells
(embryonic ectoderm) begin to migrate forming the primitive streak, a posterior midline
structure, which contains nascent mesoderm (Tam and Behringer 1997) and acts as a specific site
of cell ingression that results in germ layer formation (Mikawa et al. 2004). Three definitive
germ layers arise during gastrulation: endoderm, mesoderm and ectoderm (Figure 1.3A). The
newly formed mesoderm migrates laterally and anteriorly, and is patterned into various
populations with distinct developmental fates, such as skeletal muscle, connective tissues, blood
etc., through a complex and regulated molecular sequence (Kinder et al. 1999, Lacaud et al.
2004). Fate maps hint that these different mesodermal derivates arise from temporal and spatial
patterning along the A-P axis of the primitive streak established in part by signals from the
extraembryonic ectoderm and primitive endoderm (Baron 2005) (see Figure 1.3B).
9
A
Anterior Posterior
Proximal
Distal
Figure 1.3. Schematic representation of mouse embryonic development. 3-dimensional (3D)
representation of the early streak, and corresponding 2D fate map based on figures published by
Deschamps and Gadue (Deschamps et al. 1999, Gadue et al. 2005) (A). Midline from the allantois (a) to
the node (nd) represents the primitive streak (ps), and midline from the node to the anterior end (Ant), the
elongating embryonic axis. Black arrows indicate that cells ingress from the primitive streak into
mesoderm by migrating; eem, extraembryonic mesoderm; lpm, lateral plate mesoderm; pm, paraxial
mesoderm; n, notochord (axial mesoderm); ne, neurectoderm. Signal gradients of bone morphogenetic
protein (BMP4), and Nodal occur from blastocyst to late-streak stages (B). Populations leaving the early
streak (ES) give rise to extraembryonic mesoderm, the midstreak (MS) gives rise to lateral plate
mesoderm of the upper body in addition to cardiac and cranial mesoderm, and the late-streak (LS) gives
rise to paraxial mesoderm and lateral plate mesoderm of the trunk as described by Baron (Baron 2005).
Early-Streak 6.5 dpc
Endoderm Mesoderm Ectoderm
ps
B eemyolk sac, amnion, allantois
lpmpm + lpmtrunk
psnd
Nodal
eemyolk sac, amnion,
ES MS
lpmupper body, cardiac, cranial
pm + lpmtrunk
nd
Nodal BMP4
ndNodal
LS
Streak stage and associated mesoderm(time)
nd
Signaling gradient
B
Ant lpm eemne
pm n a
pm nd
lpm eemne
pm n a
pm nd
10
1.4.3 Origins of Hematopoiesis: Primitive and Definitive Progenitors
Most simply, one can define mesoderm as the middle embryonic germ layer (between ectoderm
and endoderm) from which connective tissue, muscle, bone, and the urogenital and circulatory
systems develop. However, this fails to capture the dynamic and temporal control system that
coordinates these developments. The highly dynamic aspect of embryonic development during
early stages of mesoderm specification and gastrulation explains why a unique site of origin for
the HSC is not clear. It appears that independent and multiple emergent hematopoiesis occurs in
both the intra- and extraembryonic tissues (Dzierzak 2003), as development of the hematopoietic
system is characterized by sequential waves of progenitor formation. The hematopoietic needs
of the embryo are distinct from those of an adult, and these differences relate to oxygen transport
and adaptive immunity (Kyba and Daley 2003). Within the immunologically active placenta, the
early embryo lacks lymphocyte production, with the earliest mode of hematopoiesis specialized
to produce primitive erythrocytes (EryP) expressing hemoglobin isoforms of higher oxygen
affinity than the latter definitive (adult) erythrocytes (EryD) (Bauer et al. 1975, Brotherton et al.
1979). Thus, the first blood cells, primitive nucleated (or embryonic) erythrocytes, are observed
within blood islands of the extraembryonic yolk sac from embryonic day 7.5 (E7.5) during
mouse development (Baron 2003). These transient progenitors are followed by a second wave of
hematopoiesis first detected in the yolk sac, as enucleated erythrocytes, macrophages, and
granulocytes (Palis et al. 2001).
The observation that blood and endothelial cells develop in close proximity in yolk sac (YS)
blood islands led to the hypothesis that they originated from a common precursor (Sabin 1920),
or hemangioblast (Murray 1932). These lineages express many of the same genes, such as
VEGFR-1 and -2, Tie-1 and -2, cKit, CD34, and Scl (Iwama et al. 1993, Yamaguchi et al. 1993,
Kallianpur et al. 1994, Young et al. 1995, Bernex et al. 1996) and deletion of either VEGF
receptor disrupts hematopoietic and endothelial development in the mouse embryo (Fong et al.
1995, Shalaby et al. 1995). The hemangioblast represents the first committed hematopoietic cell
from developing mesoderm, and an increasing number of studies have demonstrated its presence
in BM and its potential contribution to the maintenance and repair of both hematopoietic and
vascular systems during adult life (reviewed by Bailey and Fleming 2003).
11
Using the mouse model, cell transplantation and reconstitution of adult recipients was
demonstrated with intraembryonic cell sources including the para-aortic splanchnopleura (P-Sp)
and the aortic-gonadal-mesonephros (AGM) regions (Godin et al. 1993, Medvinsky et al. 1993,
Medvinsky and Dzierzak 1996, Dzierzak et al. 1997), while fetal recipients demonstrated long-
term repopulation from yolk sac progenitors (Yoder et al. 1997). The mouse placenta has been
identified as another anatomical site containing a large pool of pluripotent HSCs during
midgestation, thus providing a distinct hematopoietic microenvironment (Alvarez-Silva et al.
2003, Ottersbach and Dzierzak 2005). Recently, additional hematopoietic activity has been
reported in the umbilical arteries and allantois (Inman and Downs 2007). The onset of HSC
activity in the placenta parallels that of the AGM. HSCs in the placenta expand from E10.5 to
E13.5 and although it contains 15-fold more HSCs than the AGM, it is not clear whether the
placenta possesses the intrinsic ability to generate and expand HSCs (Gekas et al. 2005).
Irrespective of the originating source, the total HSC number in the embryo increases dramatically
between E11 and E12 (Dzierzak 2003). Hematopoiesis shifts to the fetal liver (FL) by E11.5,
where definitive (or adult) red blood cells and other lineages appear, supplanting primitive
erythrocytes in the circulation (Palis et al. 1999). Interestingly, neonatal repopulating cells
present in the conceptus before mid-E10 can give rise to all hematopoietic lineages but have
lower engraftment levels, possibly due to an inability to home to the bone marrow and may
represent either a distinct cell type or a definitive HSC precursor. Definitive multilineage
hematopoiesis following birth is primarily confined to the bone marrow. Hematopoietic sites
and engraftment potential are summarized in Figure 1.4.
12
0 5 10 15 20 25 30 35Birth
DaysCirculation
Fetal liver
Placenta, umbilical artery, allantois
AGM
Bone Marrow
P-Sp
Yolk sac
Ventral mesoderm
Thymus/spleen}Colonized
by migration
LTR-HSC (quiescent)LTR-HSC (cycling)STR-HSC
EryP
Definitive Hematopoiesis
TBGMPMEP
CLPCMP
STR-HSC
LTR-HSC
0 5 10 15 20 25 30 35Birth
DaysCirculation
Fetal liver
Placenta, umbilical artery, allantois
AGM
Bone Marrow
P-Sp
Yolk sac
Ventral mesoderm
Thymus/spleen}Colonized
by migration
LTR-HSC (quiescent)LTR-HSC (cycling)STR-HSC
EryP
Definitive Hematopoiesis
LTR-HSC (quiescent)LTR-HSC (cycling)STR-HSC
EryP
Definitive Hematopoiesis
TBGMPMEP
CLPCMP
STR-HSC
LTR-HSC
TBGMPMEP
CLPCMP
STR-HSC
LTR-HSC
Figure 1.4. Origins of hematopoiesis and engraftment potential. This schematic outlines
hematopoietic development in the mouse and is based on a figure by Orkin and Zon (Orkin and Zon
2008). Blood cells are first detected in the yolk sac, and then become apparent in the para-aortic
splanchnopleura (P-Sp), aorta-gonadal-mesonephros region (AGM), and placenta. Definitive
hematopoiesis occurs with the colonization of the fetal liver, thymus, spleen, and bone marrow. Long-
term repopulating hematopoietic stem cells (LTR-HSC) can self-renew and rescue primary and secondary
adult myeloablated mice, while short-term repopulating hematopoietic stem cells (STR-HSC) have less
self-renewal capacity. For reference, the HSC becomes restricted to either the common myeloid or
lymphoid progenitor (CMP or CLP), before generating megakaryocyte/erythroid progenitors (MEP),
granulocyte/ macrophage progenitors (GMP), or B or T cells.
1.4.4 Defining the Adult Hematopoietic Stem Cell (HSC)
An established hematopoietic system can be envisioned as a continuum of overlapping functional
compartments. This hierarchy of increasingly differentiated progenitors results from a common
precursor termed the hematopoietic stem cell (HSC). Homeostasis of circulating blood cells is
maintained as HSCs balance the decision to divide, remain quiescent, or undergo apoptosis. The
principal feature of a HSC is that it can reconstitute the blood system of a lethally irradiated
mouse in the long-term repopulation (LTR) assay. This is in contrast to multipotent progenitors
with reduced self-renewal that can sustain the recipient for only a short period of time (4-6 weeks
(Bock 1997)), or intermediate-term HSCs that persist for 6-8 months before becoming extinct
13
(Benveniste et al. 2010). Secondary transplantation of donor HSCs from the first recipient to
another lethally irradiated animal further demonstrates the LTR potential of these cells.
Upon division, one of the key aspects of the HSC is its ability to either self-renew or differentiate
along a specific lineage. In vivo, evidence of both extrinsic biological control of self-renewal
through cytokines, morphogenetic ligands and associated signaling components, and intrinsic
control through homeobox transcription factors have been demonstrated (Lessard et al. 2004).
HSCs from human adult bone marrow are assessed with a surrogate in vitro assay termed the
long-term culture initiating cell (LTC-IC) assay to detect primitive cells with the greatest self-
renewal capacity. Blood progenitors are maintained on stromal cells for five weeks before
replating in a typical myeloid-erythroid colony forming cell (ME-CFC) assay (Sutherland et al.
1989), as all but the most primitive cells would die off. The relative influence of intrinsic or
extrinsic factors on HSC self-renewal remain to be elucidated, yet nearly all HSC assays provide
a retrospective look at HSC potential and rely on the generation of functionally mature cells.
Results of a clonal assay of adult mouse HSC function using single cell transplantation of
phenotypically enriched HSCs (CD34-/locKit+Sca1+Lin-) and reconstitution of secondary
recipients implies that self-renewal is not an unlimited capability and that proliferative and
multilineage differentiation capacity is disjunct (Ema et al. 2005). In addition, in many
transplant studies HSC readout relies on their capacity to home and engraft specialized niches of
the BM microenvironment (Benveniste et al. 2003). It has been proposed that the term definitive
HSC be restricted to the description of a cell whereby through its own characteristic ability it
differentiates and expands in definitive, adult, hematopoietic territories with no requirement for
preliminary maturation in a blastocyst, midgestation embryo, fetus or newborn animal
(Medvinsky and Dzierzak 1999). The development of this stable hematopoietic system reflects
processes of differentiation, as well as temporal and spatial control of migration, homing, self-
renewal/proliferation and survival of HSCs.
1.4.5 Oxygen Transport to the Embryo
Aside from the direct influences of various growth factors, oxygen tension is one aspect of the
microenvironment that may impact embryogenesis. However, it is difficult to measure the
oxygen tension in vivo, such that specific differences pre- and post-implantation are largely
unknown. The developmental competence of mouse oocytes cultured in vitro is significantly
14
improved with low-oxygen conditions (5 % oxygen tension) compared to atmospheric conditions
(20 % O2), suggesting that the cells initially reside in a low-oxygen environment (Eppig and
Wigglesworth 1995). This environmental preference was previously illustrated as pronuclear
mouse embryos developed into blastocysts in 5 % O2 prior to transplantation into 3-day pseudo-
pregnant females with a similar implantation rate and embryo viability upon comparison to in
vivo developed blastocysts (Umaoka et al. 1991). Also, the relative abundance of a set of
developmentally important gene transcripts in bovine morulae and blastocysts were similar to in
vivo derived counterparts at 7 % O2 but not atmospheric conditions, showing that development
was recapitulated under chemically defined conditions (Wrenzycki et al. 2001). It is probable
that this low-oxygen condition is also beneficial post-implantation as readings from the monkey
uterus were consistently low during the menstrual cycle (1.5 % O2), and the rabbit and hamster
levels decreased cyclically from ~8.7 % O2 to 5.3 and 3.5 % O2 respectively at the time of
blastocyst development and implantation (Fischer and Bavister 1993). More recently, human
studies indicate that there is low oxygen tension within the feto-placental unit until the start of
the second trimester with the establishment of maternal circulation to the placenta (Burton and
Jaunaiux 2001). This finding can be extended to the mouse, in which the labyrinth of the
chorioallantoic placenta does not begin development until day 8-9 and reliance on anaerobic
glycolysis to meet metabolic demands has been demonstrated (Clough and Whittingham 1983).
15
1.5 In vitro Model of Development
1.5.1 Mouse Embryonic Stem Cell Isolation and Maintenance
Derived from the inner cell mass of the blastocyst, ESCs are poised to reiterate very early
embryonic events (Evans and Kaufman 1981, Martin 1981). ESCs can be expanded indefinitely
in vitro, and have remarkable developmental potency. The pluripotency of ESCs is evident from
three characteristic features. First, injection of undifferentiated cells into the blastocyst cavity
and implantation of the resultant embryos into pseudo-pregnant mice contributes to all cell types
in the chimeric progeny. Second, subcutaneous injection of ESCs into syngeneic (genetically
identical) mice induces teratomas (tumors consisting of different types of tissue), and third, in
vitro aggregates of ESCs differentiate with regions of embryonically distinct cell types (Kaufman
et al. 1983). The first characteristic, contribution to all three germ layers upon introduction to
the blastocyst, has facilitated the study of genetic mutations in developmental pathways of the
mouse genome.
Stem cell lines derived from the ICM of the blastocyst were first grown on mitotically
inactivated mouse embryonic fibroblasts (MEFs) (Evans and Kaufman 1981, Martin 1981), with
refractile, tightly packed cell colonies becoming apparent after a few days (Robertson 1987).
Clonal lines were obtained by selecting individual pluripotent colonies, disaggregating and
replating them on MEFs in an iterative fashion (Robertson 1987). It was discovered that the
MEFs were secreting a factor that maintained the developmental potential of ESCs in vitro, first
termed differentiation inhibitory activity (Smith and Hooper 1987). This factor, currently
referred to as leukemia inhibitory factor (LIF), is required for feeder-free culture of ESCs on
gelatin; ESC characteristics are maintained and can be phenotypically monitored with the
expression of the transcription factors Oct4 (Nichols et al. 1998, Pesce et al. 1998, Niwa et al.
2000) or Nanog (Chambers et al. 2003, Mitsui et al. 2003), and surface expression of stage
specific embryonic antigen 1 (SSEA1) (Solter and Knowles 1979) and E-cadherin (Sefton et al.
1992, Burdsal et al. 1993).
E-cadherin, a highly expressed glycoprotein on pluripotent cells, mediates intercellular adhesion
as differentiation is induced. E-cadherin-/- ES cells contribute poorly to chimera formation when
injected into blastocysts, and this deficiency in cell adhesion likely affects compaction (Larue et
16
al. 1994), a prerequisite for controlled cell patterning (Larue et al. 1996). It has been known for
some time that E-cadherin expression is downregulated during ESC differentiation (Choi and
Gumbiner 1989, Steinberg and Takeichi 1994). Additionally, E-cadherin may be present on
hematopoietic progenitor cells (Corn et al. 2000) and its maintenance has been associated with
endodermal cell fate (Lim et al. 2009).
1.5.2 Embryoid Body (EB) Differentiation
Upon the removal of LIF an aggregate of ES cells, termed an embryoid body (EB), is capable of
recapitulating the development of all three germ layers: endoderm, mesoderm, and ectoderm
(Doetschman et al. 1985, Keller 1995, Smith 2001), albeit in an unorganized manner
(Figure 1.5). Insights from EB differentiation can impact our understanding of embryonic
development and vice versa. Thus we have an in vitro system to study growth factors, signaling
pathways, cellular interactions and lethal genetic mutations that play a role in vivo, as well as a
putative source for therapeutic cell populations. Common mechanisms of tissue development or
key environmental factors can influence our strategies towards directed differentiation.
Endoderm Mesoderm Ectoderm
ESC LSC-EB
Inner cell mass Primitive endoderm Trophectoderm
Figure 1.5. The in vitro EB model. Cells from the ICM can be expanded in tissue culture and
differentiated in liquid suspension culture (LSC) EBs that produce cells from the three germ layers, but in
a disorganized fashion.
There is some self-organization during EB differentiation, however, as it was noted that a thin
layer of primitive endoderm forms on the aggregate surface (Doetschman et al. 1985, Abe et al.
1996). This layer provides signaling that can effect the interior of the aggregate and progressive
germ layer formation (Chen et al. 1994, Coucouvanis and Martin 1995), as well as producing
collagen IV, an ECM protein that supports hemogenic mesoderm (Nishikawa et al. 1998). The
first report of blood development from the EB system noted areas of erythroid cells surrounded
by endothelial cells similar to the blood islands observed in the yolk sac (Doetschman et al.
17
1985). This initial wave of primitive hematopoiesis was followed with the emergence of
multipotent progenitors, including definitive erythroid and myeloid cells (Keller et al. 1993).
The kinetic pattern of gene expression, hematopoietic lineage development, and cytokine/growth
factor responsiveness of cells from the EB were similar to the embryo; EB day 3-4 corresponds
to approximately E6.5-7.5 (YS development), while day 10-14 corresponds to E12.5-14.5 (early
fetal liver) (Wiles and Keller 1991, Keller et al. 1993, Keller 1995). Comparable to the switch
described in the peripheral blood of mice at about E12, studies of EB development have shown
that the switch from embryonic to fetal/adult globin occurs between day 10 and 12 and is
dependent on increased oxygen concentration (Bichet et al. 1999). Consequently, oxygen
tension is an important parameter for the design of a scaleable culture system to maximize
hematopoietic development.
Kinetic gene expression studies and progenitor cell analysis have demonstrated striking
similarities between the establishment of the hematopoietic system in EBs and the yolk sac
(Keller et al. 1993, Palis et al. 1999). In addition, an in vitro equivalent of the hemangioblast
was identified called the blast-colony forming cell (BL-CFC), a bipotent precursor for
endothelial and hematopoietic lineages (Kennedy et al. 1997, Choi et al. 1998). Characterized by
VEGFR2 (Faloon et al. 2000) and brachyury (Fehling et al. 2003) expression, cells from blast
colonies have the potential to generate smooth muscle cells (Ema et al. 2003, Ema and Rossant
2003) in addition to primitive and definitive hematopoietic and endothelial cells. Thus, this in
vitro assay provides a powerful tool to facilitate the study of mesoderm commitment. The blast
assay was instrumental in illustrating transitional stages of mesoderm, highlighting the
importance of the transcription factor SCL/Tal-1 for hematopoietic commitment (Robertson et al.
2000, Chung et al. 2002, D'Souza et al. 2005), and defining how signaling factors such as BMP4,
VEGF, TGFβ1 and Activin A effect mesoderm commitment and/or differentiation (Park et al.
2004). We used this information to guide decisions on the cytokines to be applied and to assess
their effects on commitment and differentiation.
1.5.3 Parallels between mouse and human ESCs
In general, human embryos show similar hematopoietic cell complexity to developing mouse
embryos (reviewed in Peault 1996, Marshall and Thrasher 2001) despite differences in temporal
gene expression and cell surface markers (Conley et al. 2004). As early as day 19 in gestation
18
and prior to circulation, co-cultures of a bone marrow stromal cell (BMSC) line with human
splanchnopleura resulted in cells with both lymphoid and myeloid potential, whereas BMSC
co-culture with yolk sac cells resulted in cells with only myeloid potential (Tavian et al. 2001).
The onset of circulation occurs in concomitance with cardiac beating, and allows yolk sac
derived blood cells to enter embryonic tissues and colonize the liver (Tavian and Peault 2005).
Additionally, hematopoietic cells can be derived from vascular walls (Oberlin et al. 2002).
Human ESC lines have been derived from the ICM of blastocysts produced by in vitro
fertilization (Thomson et al. 1998); subclones can be produced that retain all properties of the
parental line, including the ability to generate teratomas (Amit et al. 2000). Maintenance of
hESCs is possible in both feeder and feeder-free adherent cell culture systems that typically use
conditioned media; perfusion feeding (Fong et al. 2005) and hypoxia (Ezashi et al. 2005) have
been explored to enhance propagation and reduce hESC differentiation. Microcarrier (Fernandes
et al. 2009, Oh et al. 2009) and suspension cultures (Amit et al. 2010, Olmer et al. 2010, Steiner
et al. 2010) have also been explored with human ESCs, paving the way for large-scale expansion
and differentiation.
In vitro induction of hESC differentiation resulted in cystic EBs with regional expression of cells
from the three embryonic germ layers (Itskovitz-Eldor et al. 2000); these cells can be used to
study sequential gene expression as a model for early human development (Gerecht-Nir et al.
2005). Alternative strategies independent of EB formation have also been used to acquire cells
of a desired lineage (Odorico et al. 2001). For example, hematopoietic CFCs have been
identified from hESC co-cultured on irradiated mouse bone marrow stroma or yolk sac
endothelial cells, with approximately 1-2 % of the population demonstrating the CD34+CD38-
phenotype of early hematopoietic cells (Kaufman et al. 2001). Hematopoietic differentiation of
hESC is also enhanced in co-culture with OP9 cells, with the peak occurring one week earlier
upon comparison to the embryoid body method. Following magnetic selection, the CD34+ cells
produced in this culture system can be further expanded (~4-fold) in serum-free expansion media
with cytokines (Vodyanik et al. 2005).
Analyzing factors for their ability to direct the differentiation of hESCs in embryoid bodies or in
adherent culture indicates that multiple human cell types may be enriched by specific factors.
One screen of eight factors showed that none of the tested factors directed differentiation
exclusively to one cell type, differentiation and/or cell selection could be divided into three
19
categories: growth factors (GFs) that mainly induce mesodermal cells, such as Activin A and
transforming growth factor-beta 1 (TGFβ1); factors that activate ectodermal and mesodermal
markers, for example retinoic acid (RA), BMP4, epidermal and basic fibroblast growth factors
(EGF, bFGF); and factors that allow differentiation into the three embryonic germ layers,
including endoderm, such as nerve and hepatocyte growth factors (NGF, HGF) (Schuldiner et al.
2000). Moreover, the method used to promote differentiation impacts hESC fate decisions and
lineage survival. CD34+, CD45+ and hematopoietic CFCs were routinely derived in serum-free
stromal cell co-culture with SCF, TPO, and Flt3L, whereas the EB system required additional
factors for progenitor support, including VEGF and BMP4 (Tian et al. 2004). In addition to cell
type specificity, interest lies in microenvironmental controls of symmetric or asymmetric cell
divisions during maintenance or differentiation culture of HSC/HPCs (Ema et al. 2000, Punzel et
al. 2003, Zwaka and Thomson 2005).
Multilineage hematopoietic colony forming unit (CFU) potential from human embryonic stem
cells has been shown with two cell lines (H1 and H9) following 15 days of EB differentiation
with a mixture of cytokines including SCF, Flt3L, interleukin (IL)-3, IL-6, granulocyte colony-
stimulating factor (G-CSF) and BMP4 (Chadwick et al. 2003). The addition of VEGF-A165 to
this cytokine mix has been shown to promote erythropoietic differentiation, which can be further
augmented by the addition of erythropoietin (EPO). The increased frequency of
CD34+VEGFR2+ cells within VEGF-A165 treated EBs and their correlation to erythroid colonies
provides evidence that factors are capable of regulating hematopoietic lineage development in
hESCs, as observed with mouse ESCs (Cerdan et al. 2004). Upon comparison to the murine
system, hESCs are less robust during EB formation. To work around the low viability that
results when EBs are initiated from a single cell suspension following enzymatic dissociation
with trypsin, differentiation cultures were started with small aggregates after EDTA/collagenase
and gentle mechanical dissociation (Itskovitz-Eldor et al. 2000, Xu et al. 2001, Chadwick et al.
2003). Small aggregates (3-20 cells) and slow turning lateral vessels were combined to produce
more uniform EBs capable of a 75-fold increase in cell concentration over 28 days (Gerecht-Nir
et al. 2004a). Methods for seeding hESCs as single cells followed the demonstration that the
selective Rho-associated kinase (ROCK) inhibitor Y-27632 reduced dissociation-induced
apoptosis in serum and serum-free cultures (Watanabe et al. 2007). For synchronous
hematopoietic differentiation uniform sized EBs can be generated by centrifuging dissociated
20
cells in 96-well round bottom low attachment plates (Ng et al. 2005) or in microfabricated
square-pyramidal wells for higher-throughput (Ungrin et al. 2008).
1.6 Uncovering the Hematopoietic Phenotype In the context of quantifying, staging, and purifying the hematopoietic cells produced in vitro,
surface marker expression and other detectable properties have been investigated intensively. In
this project, markers have been used to monitor EB differentiation and to select cells of interest
based on fluorescence activated cell sorting (FACS). The phenotype of murine cells with HSC
activity changes through ontogeny with respect to several markers including CD41, CD34, Sca1,
Mac-1, AA4.1, and CD45 (Jordan et al. 1995, Morrison et al. 1995, Ferkowicz et al. 2003,
Mikkola et al. 2003). CD 41 (αIIb), a highly expressed platelet surface integrin protein, is an
early marker of primitive (E7.0) and definitive (E8.25) murine yolk sac hematopoiesis. It
persists as a marker of some stem and progenitor cell populations in the FL and adult marrow,
although competitive repopulating ability is enriched in CD41-/lo cells over CD41dim cells from
these two definitive sources (Ferkowicz et al. 2003). Using the EB system it has been shown
that more than 80 % of all hematopoietic progenitors express the CD41 antigen, and it can serve
as a differentiation marker as CD41- cells can become CD41+ progenitors, but the inverse is not
observed (Mitjavila-Garcia et al. 2002).
Phenotypically, AGM HSCs are lineage negative (CD4, CD8, B220, Gr-1) and positive for HSC
markers (Sca1, CD34, cKit). However, a subset of these cells are also Mac-1 positive, a marker
that is expressed on all fetal liver HSCs at E13 (Morrison et al. 1995, Sanchez et al. 1996). In
contrast, yolk sac cells are Sca1 negative and positive for AA4.1 (Huang and Auerbach 1993).
To further characterize intraembryonic hematopoietic stem cells and to define their site of origin,
multipotent progenitors expressing cKit, AA4.1, CD31 and CD41 but not Flk1 and CD45-/lo were
purified from the AGM of mice, capable of long-term reconstitution of sublethally irradiated
Rag2-/-γc-/- recipients (Bertrand et al. 2005). In addition to marking mature endothelium, CD31
or platelet-endothelial cell adhesion molecule (PECAM), is expressed on HSC from E8.5 to
adulthood. The BM derived CD31+Lin-cKit+Sca1- population represents short-term erythroid
progenitors that confer radioprotection without providing long-term multilineage hematopoietic
reconstitution (Baumann et al. 2004). Another endothelial marker, Endomucin, is also expressed
on CD34-cKit+Sca1+Lin- enriched HSCs and can be coupled with either CD41 or CD45 alone at
21
different developmental stages to enrich for HSCs (Matsubara et al. 2005). Due to the
multiplicity of phenotypes, isolated HSCs often remain a highly heterogeneous population and
many purification methods are possible. Combinations of surface receptors from the signaling
lymphocyte activation molecule (SLAM) family (i.e. CD150, CD244, and CD48) have been
shown to be differentially expressed among functionally distinct progenitors. For example,
LTR-HSCs were highly purified as CD48-CD150+CD244- cells while multipotent progenitors
(MPPs) were CD48-CD150-CD244+ and most restricted progenitors were CD48+CD244+ (Kiel et
al. 2005). Alternatively, LTR-HSCs can be purified using Endoglin+Sca1+Rholow (Chen et al.
2003).
The same phenotypes are not necessarily observed in humans. CD34 is used as a marker for
human HSC enumeration, isolation, and manipulation, comprising approximately 1 % of adult
BM. Enrichment occurs upon CD34+CD38-Lin- selection, as CD38 is expressed on many
differentiated cells, however, this cell population is still heterogeneous, with about 1 in 617
functional HSCs in the BM (Bhatia et al. 1997b). Other studies have identified progenitor cells
following 7-10 days of hESC differentiation that can develop into both endothelial and
hematopoiectic cells that express CD31, Flk1, and VE-cadherin, but not CD45 (termed
CD45negPFV cells) (Wang et al. 2004, Wang et al. 2005b) or that are CD34brightCD31+Flk1+
(Woll et al. 2008). A second cell phenotype develops, CD34lowCD45+, that is associated with
hematopoietic capacity and peaks after 21 days of differentiation (Woll et al. 2008). See Figure
1.6 for a summary of phenotypes, gene expression during lineage progression, and the functional
assays that are associated with the emergence of HSCs in the mouse model. Advances in
defining the HSC phenotype and identity will only aid in our understanding and amplification of
this desired cell product. As a starting point we used CD41 coupled with CD34 to mark
hematopoietic development (Chapter 3) and further investigated mesodermal phenotypes to track
HPC generation (Chapter 4).
22
A
Figure 1.6. Parallels between HSC development in the mouse embryo and differentiating
ESCs. The first cells associated with hematopoiesis are observed in the yolk sac, aorta-gonad-
mesonephros and para-aortic splanchnopleura (YS, AGM, P-Sp) (A). The embryonic day (E) is given
for reference, along with phenotypes associated with the respective cell types. A second wave of
hematopoiesis is then observed in the placenta, AGM, and fetal liver (FL), prior to the detection of HSCs
in the bone marrow (BM) at approximately E10.5. Several phenotypes and the HSC repopulating
potential are listed. In line with embryonic development the gene expression, cell lineages, inductive
factors, and functional assays are outlined for ESCs, with an EB timeline for comparison (B).
Definitive HSC
GENE EXPRESSION
FUNCTIONAL ASSAYS
CELL LINEAGE AND INDUCTIVE CYTOKINES
Brachyury E-cadherin
SSEA4 OCT4
Brachyury SCL VEGFR2 cMpl cKit
cMpl cKit CD34 CD41 CD45
cMpl cKit
CD34 CD41 CD45
Transitional Chimera formation Teratocarcinoma formation
BL-CFC ME-CFC
Mesoderm ES Cells Hemangioblast(Primitive HSC?)
EryD-Myeloid progenitor Activin A
BMP4 bFGF Wnt3A
VEGF TPO
SCF TPO HoxB4
HEMATOPOIESIS IN THE EMBRYO
YS AGM P-Sp
Endothelial cells
Hemangioblast
CD31+CD34+
cKit+CD34+
Flk1+ Definitive HSC
BM
HEMATOPOIESIS FROM EMBRYONIC STEM CELLS
cKit+AA4.1+ CD31+CD41+ Scal+CD34+
Hematopoietic cells FL
Sca1-AA4.1+ Endomucin+ CD41+
AGM Flk1-CD45-/lo CD45+
Placenta
LTR-HSC: CD48-CD150+CD244
CD34-cKit+Sca1+lin-(Endomucin+) CD105+Sca1+Rholow
STR-HSC: CD31+cKit+Sca1-lin-
CD48-CD150-CD244+
E 7.5 - 8.5 - 9.0 ≥ 10.5
B
Long term repopulation of lethally irradiated adult mice *LTC-IC
EB Day 0 3 - 4 5 - 7 >10
23
1.7 Influencing the Maturation or Maintenance of HSCs Although it has been over twenty years since the first blood progenitors were detected in EBs
(Doetschman et al. 1985), there have been few reports of definitive HSCs arising from EB
differentiation according to the definition outlined earlier (i.e. the ability to self-renew and
differentiate within adult hematopoietic territories). As the stage has been set by describing
hematopoietic development and the in vitro correlate, I will now outline some of the significant
growth factors that regulate development of the hematopoietic system and the signaling networks
that are induced. Following this, additional micro- and macro-environmental parameters
important to cell production are established.
Initial strategies for adult HSC amplification focused on hematopoietic cytokines or signaling
molecules to induce proliferation at various developmental stages as these factors are frequently
produced by stromal cells in the BM microenvironment. There is a large body of evidence that
co-culture systems can sustain and enhance HSC growth in vitro (Dexter et al. 1984, Nakano et
al. 1994, Ohneda and Bautch 1997, Jung et al. 2005). In vitro, adult mouse or human HSC can be
stimulated using factors such as IL-3, IL-6, IL-11, SCF, Flt3L and TPO (Bodine et al. 1989,
Bodine et al. 1992, Petzer et al. 1996). Bone morphogenetic proteins (BMPs), transmembrane
forms of the hedgehog family, and fibroblast growth factor (FGF-1) have also shown potential in
the induction of repopulating cells or hematopoietic specification (Faloon et al. 2000, Baron
2001, Chadwick et al. 2003). However, multifactor cytokine studies have not yet identified
conditions that result in more than a four to five fold increase in HSC numbers for either mouse
or human cell sources (Bhatia et al. 1997a, Glimm and Eaves 1999) although powerful
multifactorial design experiments can refine the identification and understanding of optimal
growth factor combinations (Zandstra et al. 1997, Audet et al. 2002).
1.7.1 Growth Factors (GFs) and Soluble Receptors
Nodal
Nodals constitute a group within the transforming growth factor-beta (TGF-β) superfamily that
are involved in setting up the embryonic axes, inducing mesoderm and endoderm, patterning the
nervous system, and determining left-right asymmetry in vertebrates (Schier 2003). Nodals can
act both locally and as morphogens in a concentration-dependent manner (Chen and Schier 2001,
24
Le Good et al. 2005) with signaling either autoregulated (Brennan et al. 2001) or restricted
spatially and temporally by feedback inhibition (Bisgrove et al. 1999, Meno et al. 1999, Feldman
et al. 2002). Nodal signaling activates the canonical TGF-β pathway involving activin receptors
(ActRIIB, Alk4), Smad2 and transcription factors (Goumans and Mummery 2000). During
gastrulation nodal signaling can be modulated by essential co-receptors such as Cripto, an
extracellular membrane-attached EGF-CFC protein (Gritsman et al. 1999). Feedback inhibition
also plays a role, as mutations in members of the Lefty family result in an enlarged primitive
streak (Meno et al. 1999). Nodal signaling can also be inhibited through heterodimerization with
ligands involved in the specification of ventral and posterior mesoderm, BMP4 or BMP7
respectively (Yeo and Whitman 2001). Nevertheless, BMP signaling has been implicated in
inducing nodal coreceptors in both the mouse and chick models (Fujiwara et al. 2002, Piedra and
Ros 2002, Schlange et al. 2002). Thus, a combination of positive and negative autoregulatory
loops determine nodal signaling and it has become apparent that different signaling levels induce
different cell fates, with lower levels inducing brachyury (Schier 2003). Brachyury (also known
as T), the founding member of the T-box gene family, encodes transcription factors in early
development (Kispert and Hermann 1993) and is widely used to track emerging mesoderm. In
all, gradients appear to be important for mesodermal patterning and cell fate (Gurdon and
Bourillot 2001, Whitman 2001, Green 2002).
Bone Morphogenetic Proteins
BMPs are soluble growth factors related to the TGF-β superfamily and activin. The migration of
prospective mesodermal cells through the primitive streak appears to be regulated by the activity
of growth factors such as FGF (Deng et al. 1994) and BMP4 (Winnier et al. 1995). Bone
morphogenetic proteins were originally noted for their capacity to induce ectopic bone
formation, however, multiple relations to the HSC system have been described; they play a
critical role in the formation and patterning of mesoderm in the embryo and in blood island
formation in the YS (Snyder et al. 2004). BMP4 is a potent ventralizing factor and has been
implicated in the commitment of embryonic mesodermal cells to a hematopoietic fate in a
number of systems (Marshall et al. 2000). A role in the maintenance of the HSC system or niche
following initial mesoderm induction has also been indicated by observing polarized expression
of BMP in the human AGM, with the highest levels underlying intra-aortic hematopoietic
clusters (Marshall et al. 2000).
25
Most homozygous mutants lacking BMP4 expression die between 6.5 and 9.5 dpc with a
variable phenotype. The embryos do not proceed beyond the egg cylinder stage, lack the
mesodermal marker T, and show little or no mesodermal differentiation (Winnier et al. 1995).
BMPs have also been shown to induce hematopoietic differentiation from ES cells (Baron 2003,
Chadwick et al. 2003), synergize with VEGF to enhance production of lymphoid, myeloid, and
erythroid cells from EBs (Nakayama et al. 2000), and affect the self-renewal or differentiation
properties of HSCs from human CB (Bhatia et al. 1999). Overall, the coordinated expression of
soluble factors such as BMP4 and nodal appear to be required for patterning and lineage
specification during gastrulation (Figure 1.3B).
Vascular Endothelial Growth Factor (VEGF)
The vascular endothelial growth factor (VEGF) family includes VEGF-A, -B, -C, -D, and -E and
PlGF (placental growth factor) that bind with different specificity to VEGFR-1 (Flt1), -2(Flk1),
or -3 (Flt4) and co-receptors neuropilin-1 and -2 (Takahashi and Shibuya 2005, Ho and Kuo
2007). Alternative splicing of a single gene gives rise to several isoforms differing in their
molecular mass, expression patterns, and biochemical and biological properties (Robinson and
Stringer 2001). VEGF-A, the most abundant isoform exists as a homodimeric glycoprotein of
two identical 23 kDa subunits (Ferrara and Henzel 1989) and corresponds to VEGF165 (i.e. 165
residues beyond the signal sequence). VEGF-A (referred to as VEGF for the remainder of the
thesis) is a potent mitogen associated with endothelial cells and plays a central role in
angiogenesis and vasculogenesis in vivo. Expression is upregulated by hypoxia, activated
oncogenes and a variety of cytokines (for reviews see Neufeld et al. 1999, Robinson and Stringer
2001). Once expressed, VEGF can be freely diffusible or sequestered within the ECM by avidly
binding heparin or heparin-like moieties. The VEGF retained in the ECM may act as a reserve
that may be released to a bioactive form by proteolysis by either plasmin or matrix
metalloproteinases (Houck et al. 1992, Lee et al. 2005), although it has been reported that
plasmin diminishes its mitogenic capacity (Roth et al. 2006).
VEGF is critical for endothelial and hematopoietic development, as demonstrated by knock-out
mice lacking specific components of the VEGF-system. Mice homozygous for mutations that
inactivate either tyrosine kinase receptor VEGFR1 (Flt1) or VEGFR2 (Flk1/KDR) die between
d8.5-9.5 in utero (Fong et al. 1995, Shalaby et al. 1995). As ligands other than VEGF may
26
activate these receptors, it was shown that embryos with functional inactivation of one VEGF
allele (VEGF+/–) die at d11-12 due to malformations in the vascular system (Carmeliet et al.
1996, Ferrara et al. 1996). These defects are more pronounced in embryos homozygous for
VEGF deletion (Ferrara et al. 1996), suggesting a dose-dependent regulation of fetal vascular
development by VEGF. Increased levels of VEGF can also cause vascular defects, including
hypervascularization and enlarged vascular lumens (Drake and Little 1995), reminiscent of the
VEGFR1-/- phenotype. The specific roles of VEGFR1 and –2 in vascular development and
function are incompletely defined.
Soluble VEGFR1 (sVEGFR1)
A soluble truncated form of VEGFR1 capable of binding VEGF as strongly as the full-length
receptor has also been identified (Kendall et al. 1996). The soluble receptor is capable of
inhibiting VEGF activity by sequestering it from signaling receptors or by forming non-signaling
heterodimers with VEGFR2. High levels of sVEGFR1 are secreted in the placenta, becoming
more abundant as gestation progresses (Clark et al. 1998, He et al. 1999); it is cyclically
expressed in the endometrium possibly sensitizing maternal endothelial receptors to angiogenic
stimuli upon embryo implantation (Krussel et al. 2003), and secretion has also been detected
from endothelial cells, monocytes, and malignant hematopoietic cells (Inoue et al. 2000, Barleon
et al. 2001). Overall, the presence of the soluble form of VEGFR1 supports the idea that its main
role is to act as a decoy to finely modulate VEGFR2 signaling through VEGF availability. It has
also been postulated in a paired publication that the balance between membrane-bound and
soluble VEGFR1 plays a role in the delivery of VEGF to the surface of VEGFR2-positive cells,
impacting their ability to accumulate and migrate throughout the embryo, and suggesting that a
minimum signaling threshold is required for viability and development (Hiratsuka et al. 2005a,
Hiratsuka et al. 2005b).
VEGFR1–/– embryos develop highly disorganized blood islands and vascular channels that
contain a high number of angioblast and endothelial cells. The severe disorganization of the
vascular system occurs due to altered differentiation with an increase in endothelial cell fate
determination resulting in a high density of hemangioblasts that cause disorganized vessels
(Fong et al. 1999). Additionally, it has been reported that VEGFR1-/- mutant embryos have
increased endothelial cell division (Kearney et al. 2002) and decreased sprout formation and
27
vascular branching (Kearney et al. 2004). Rescue of the branching defect can be achieved with
soluble VEGFR1 (sVEGFR1), and it is thought that this soluble receptor may modulate spatial
localization of the VEGF signal during blood vessel formation (Kearney et al. 2004). The focus
of Chapter 2 is related to the interrelated roles of VEGF, VEGFR2 and sVEGFR1 in
hematopoietic development.
Thrombopoietin (TPO)
In addition to the VEGF-system, thrombopoietin and its receptor c-Mpl play an important role in
the maintenance and expansion of HSCs (Kobayashi et al. 1996, Ku et al. 1996b, Sitnicka et al.
1996, Yagi et al. 1999, Ema et al. 2000, Huang et al. 2009). In contrast to sVEGFR1, an
antagonist to VEGFR2 signaling, application of soluble TPO receptor did not suppress colony
formation from primitive progenitors, and instead acted in a synergistic manner with steel factor
(SF) or Flt3/Flk2 ligand and the membrane bound receptor (Ku et al. 1996a). Investigation into
the molecular pathway by which TPO-induces HSC self-renewal and expansion with murine and
human cell lines indicate that the transcription factor HoxB4 is a downstream mediator of these
effects (Kirito et al. 2003) and that signaling also induces the nuclear translocation of HoxA9 and
its heterodimeric partner, MEIS1 (Kirito et al. 2004). Additionally, TPO enhances BL-CFC
formation from EBs and acts synergistically with VEGF and SCF (Perlingeiro et al. 2003). TPO
and VEGF synergism on hemangioblast development has similarly been shown with rhesus
monkey ESCs, and TPO also enhances VEGFR2 and c-Mpl expression (Wang et al. 2005d).
Using both a model cell line and purified primitive murine cells (Sca1+cKit+Gr-1-) to investigate
the impact of TPO on the VEGF intracellular autocrine loop (Gerber et al. 2002), it was
demonstrated that VEGF expression was enhanced by increasing HIF-1α protein stability (Kirito
et al. 2005). This illustrates the complexity of the coordinated control network that influences
the maturation and maintenance of HSCs; the combination of BMP4, VEGF, and TPO was
employed in Chapter 3 to enhance hematopoietic output in a serum-free system.
28
1.7.2 Signaling Networks
Platelet Derived Growth Factor (PDGF) Receptor Family
PDGFs and VEGFs share a core motif consisting of eight cysteine residues that are biologically
active as either homodimers or heterodimers (Olofsson et al. 1999). PDGFs bind to two cell
surface receptor tyrosine kinases (RTKs), PDGFRα and -β that dimerize prior to receptor
autophosphorylation and signal propagation (Heldin et al. 1998). The structure of the signaling
receptor unit (-αα, -αβ, or −ββ) depends on the pattern of gene expression within the cell and
bioavailability of the PDGF dimers (AA, AB, BB, CC, or DD). PDGFRα binds all PDGF dimers
except –DD, while PDGFRβ binds –B and –D (Betsholtz et al. 2001). The receptor dimers
contact a number of SH2 domain-containing molecules through intracellular phosphotyrosine
residues that connect to assorted signaling pathways. Involved cytosolic proteins include
phospholipase C-γ (PLC γ), phosphatidylinositol 3' kinase p85 (PI3K), SHP2 phosphatase and
Src family kinases; Ras GTPase-activating protein (Ras-GAP) binds only to PDGFRβ (Heldin et
al. 1998, Fambrough et al. 1999, Rosenkranz and Kazlauskas 1999). The two PDGF receptors
can largely compensate for one another during embryonic development as demonstrated by
intracellular domain replacement experiments, although PDGFRβ does not fully compensate for
PDGFRα with respect to vascular development and function (Klinghoffer et al. 2001). PDGFRα
is expressed on fetal liver stromal cells that are in contact with hematopoietic cells (VEGFR2+)
during development (Yoshida et al. 1998) and by mesenchymal cells in the adult (Orr-Urtreger
and Lonai 1992, Shinbrot et al. 1994). Yoshida et al. also reported that all the hematopoietic
supportive stromal lines in their laboratory were PDGFRα+ (Yoshida et al. 1998), and suggested
that hematopoietic cells may require contact or proximity to PDGFRα expressing cells for
maintenance.
The VEGF family members bind VEGFR-1, -2, or -3 with different specificities; VEGFR1 (Flt1)
binds VEGF-A and –B, VEGFR2 binds VEGF-A, -C, -D, or –E and VEGFR3 (Flt-4) binds
VEGF-C or –D. The VEGFs signal through pathways that are similar to the PDGFs upon RTK
dimerization. Activated pathways include cytosolic proteins such as PLC γ, Src-PI3K,
Ras-Raf-1 generating proliferative, migratory, metabolic or survival responses (Neufeld et al.
1999). VEGFR2 is phosphorylated more efficiently upon ligand binding than VEGFR1
(Waltenberger et al. 1994) and appears to mediate most functional endothelial cell signaling
29
(Zachary and Gliki 2001) as well as the survival of hematopoietic progenitor cells (Larrivee et al.
2003). VEGFR2 is expressed on the surface of hemangioblasts (Choi et al. 1998, Faloon et al.
2000) and VEGFR2–/– embryos fail to produce mature hematopoietic cells as well as endothelial
cells, although normal numbers of hematopoetic progenitors are found 7.5 dpc. VEGFR2 seems
to be involved in the migration, and expansion of hemangioblasts in vivo, but is not essential for
commitment as both hematopoietic and endothelial differentiation from bipotent blast colony
forming cells (BL-CFCs) occurs in vitro (Schuh et al. 1999).
Transforming Growth Factor (TGF)-β Superfamily Signaling
The TGFβ superfamily includes TGFβs, activins, and BMPs that bind a constitutively active
type II serinine/threonine kinase receptor which then assembles a heteromeric complex by
activating a type I receptor/ALK to provide a broad spectrum of regulatory signals (Soderberg et
al. 2009). Specifically, BMP dimers bind to type I (Alk2, Alk3/BMPRIA, Alk6) and type II
(BMPRII) serine/threonine kinase receptor subunits and this complex formation and activation
results in the transmission of intracellular signals through the phosphorylation of receptor-
regulated Smads (R-Smads) (Attisano and Wrana 2002, Derynck and Zhang 2003; reviewed in
de Caestecker 2004). Phosphorylated R-Smads initiate a signaling cascade that requires
interaction with a co-Smad, Smad4, prior to translocation to the nucleus where specific
transcription factor interactions result in targeted gene expression (Piek et al. 1999, Miyazono et
al. 2001, Shi and Massague 2003, Miyazono et al. 2005). Eight members of the Smad family
have been identified; BMP binding phosphorylates Smad1/5/8 and TFGβ or activin binding
phosphorylates Smad2/3 (Miyazawa et al. 2002) after binding type I (Alk4/ActRIB, Alk7) and
type II (ActRIIA, ActRIIB) serine/threonine kinase receptor subunits. Inhibitory Smads (6/7)
modulate signaling through competition with Smad4 to bind activated Smads or by binding the
type I receptor, effectively blocking protein translocation to the nucleus (Hayashi et al. 1997,
Hata et al. 1998).
Type I Hematopoietic Growth Factor Receptor (HGFR) Family
c-Mpl, the product of the myeloproliferative leukemia proto-oncogene, is one of more than 20
molecules that make up the HGFR family that contain one or two characteristic cytokine receptor
motifs (Ihle 1995). Upon binding TPO, receptor homodimerization occurs and a number of
secondary messengers promote cell survival, proliferation, and differentiation (Kaushansky
30
2009). The Jak2 and Tyk2 Janus kinases are activated and involve key downstream signal
transducers and activators of transcription (STATs), with phosphorylation of STAT-1, -3, and -5
(Fishley and Alexander 2004). The Ras signaling pathway is also activated upon stimulation of
cells with TPO. Phosphorylation of Shc, Grb2, Sos, SHIP, Vav and Cbl has been observed, with
increased activity of PI3 kinase, and the mitogen-activated protein kinases (MAPK) (Fishley and
Alexander 2004). To maintain steady-state megakaryocytopoiesis TPO signaling can be blocked
by the phosphatases PTEN, SHP1, and SHIP1, the suppressors of cytokine signaling
(Kaushansky 2009), and by the down-regulation of c-Mpl surface expression in a clathrin-
mediated process (Hitchcock et al. 2008). Mice lacking TPO or its receptor c-Mpl display only
half the wild-type number of progenitor cells for all hematopoietic lineages, although they
produce normal numbers of myeloid and lymphoid cells (Alexander et al. 1996, Carver-Moore et
al. 1996). Mice lacking STAT3 die with hematopoietic failure at mid gestation (Kirito et al.
2002), while STAT5 is though to regulate HSCs (Bradley et al. 2004) and has been shown to
augment the hematopoietic commitment of ESCs (Kyba et al. 2003).
1.7.3 Microenvironmental Factors
Efforts continue to develop novel approaches that mimic many aspects of a particular niche
environment, such as including ECM signals, providing small peptide sequences or bioactive
mimetics, delivering architectural or mechanical cues, providing immobilized or time releasing
growth factors, and by controlling oxygen or co-culture cells. We wished to control
hematopoietic development within an engineered niche with ESCs by integrating local and
exogenous signals.
Cellular Interactions
There is a large body of evidence that a variety of co-culture systems can sustain and enhance
HSC growth in vitro (Dexter et al. 1984, Nakano et al. 1994, Ohneda and Bautch 1997, Jung et
al. 2005). There is some evidence that HSCs co-cultured with endothelial cells, increases HSC
transplantation efficiency (Chute et al. 2004a, Chute et al. 2004b). AGM stromal lines have also
been isolated and shown to support mouse and human HPCs, as the AGM microenvironment
contains all the necessary supportive cells for hematopoiesis (Ohneda et al. 1998, Xu et al. 1998,
Matsuoka et al. 2001, Oostendorp et al. 2002, Takeuchi et al. 2002). The stromal cell line OP9,
derived from the calvaria of a macrophage colony-stimulating factor (M-CSF)-deficient (op/op)
31
mouse supports lymphoid as well as myeloid differentiation from murine or human ES cells in
vitro (Kodama et al. 1994, Nakano et al. 1994, Cho et al. 1999, Vodyanik et al. 2005).
Additionally, it has been shown that such influences are not dependent on cell contact
(Oostendorp et al. 2005). The combination of low dose hematopoietic cytokines (SCF, Flt3L,
VEGF) with human BMSCs during human EB differentiation promoted cell clusters with
hematopoietic potential (8.81 % VEGFR2+, 9.94 % CD34+, 25.7 % CD45+) and is an emerging
method for the generation of hematopoietic cells (Wang et al. 2005a).
Within the bone marrow microenvironment, non-hematopoietic cells including endothelial,
fibroblastic stromal cells and osteoblasts compose an interactive niche that support or promote
HSC expansion through cell-cell contact and/or localized delivery of factors (Calvi et al. 2003,
Zhang et al. 2003). One molecular mechanism that positively effects the HSC population is
Notch-1 signaling upon binding to its ligand, Jagged-1, expressed by BMSCs, endothelial cells,
and osteoblasts. Regulation of the stem cell niche in adult BM involves BMP4 (Snyder et al.
2004) and it has implied function at the interface between osteoblasts and HSCs in the bone
marrow (Calvi et al. 2003, Zhang et al. 2003). Additionally, BMP4 is secreted by pulmonary
microvascular endothelial cells in response to hypoxia (Frank et al. 2005), and in differentiating
ESC cultures hypoxia upregulates the mesodermal markers Brachyury, BMP4, and Flk1
(Ramirez-Bergeron et al. 2004). Together, hypoxia and BMP4 are of interest as part of the
regulatory control network that balances cell fate decisions. A cell-processing approach that
ultimately aims to increase numbers of transplantable HSCs may include co-culture, hypoxia,
and the delivery of soluble proteins.
Cell Scaffolds or Encapsulation
Providing the appropriate culture environment is an important part of the niche engineering
focused on generating target cell types and improving their production efficiencies. The
extracellular matrix can be thought of as a structural framework of secreted macromolecules that
provides mechanical support, integrin-mediated signaling or adhesive interactions, and that may
sequester growth factors for proteolytic release to influence cell behaviour or cell fates (Czyz and
Wobus 2001, Engler et al. 2006). Both integrin and growth factors initiate intracellular signaling
cascades upon binding with cellular receptors that influence gene expression and cell phenotype
32
(Juliano and Haskill 1993). The structure of the ECM is highly dependent on location and tissue
function, but consists primarily of collagens, other proteins, polysaccharides, and water.
A range of materials and properties have been used to study stem cell interactions, fabricated as
porous, fibrous, or hydrogel scaffolds (Nair and Laurencin 2006, Dawson et al. 2008). The scale
of the cellular interactions and intent behind the scaffold types vary. For example, porous
scaffolds provide macroscopic voids for the migration and infiltration of cells, whereas fibrous
scaffolds may be fabricated on a size-scale to control cell alignment by mimicking native ECM,
while water-swollen hydrogels may be fabricated from natural or synthetic materials to allow
cell growth through the material (Burdick and Vunjak-Novakovic 2009). One benefit of
employing natural materials is their ability to provide signaling to encapsulated cells. 3D
collagen gels have been used to provide integrin binding for mesenchymal stem cells (Battista et
al. 2005, Chang et al. 2007) and hyaluronic acid (HA), a polysaccharide, has been used for cell
encapsulation and interacts with receptor CD44 to promote ESC maintenance (Burdick et al.
2005, Gerecht et al. 2007, Ifkovits and Burdick 2007). Alternatively, bioinert hydrogels such as
alginate, which forms through ionic crosslinking, and thermoresponsive agarose contain no
adhesive or native signaling and are resistant to non-specific protein adsorption, preventing cell
agglomeration and allowing the encapsulated cells to be differentiated for a variety of
applications (Dang et al. 2004, Gerecht-Nir et al. 2004b, Dean et al. 2006). Synthetic materials
have also been investigated due to the versatility and adaptability of their physical properties,
although cytotoxicity may limit some applications. Two non-toxic synthetic materials that have
been investigated and modified with tethered groups to alter cellular interactions such as
adhesion peptides or phosphates are poly(ethylene glycol) (PEG) hydrogels (Burdick and Anseth
2002, Nuttelman et al. 2004, Yang et al. 2005) and poly(hydroxyethyl)-methacrylate (HEMA).
With the desire to either provide cells with pertinent physical cues or to guide appropriate
cellular functions, scaffolds have been employed with many cell systems. For example, agarose
covalently coupled to laminin 1 was embedded with NGF lipid microtubules before being used
to bridge peripheral nerve gaps and enhance regeneration (Yu and Bellamkonda 2003); a
poly(lactide-co-glycolide) (PLGA) scaffold was crosslinked to a BMP2-derived peptide to act as
an inductive factor for osteogenesis (Duan et al. 2007); electrospun fibrous rhBMP-2 loaded
PLGA with hydroxyapatite was tested for cell attachment and cytotoxicity (Nie et al. 2008); and
alginate covalently modified with the tripeptide arginine-glycine-aspartic acid (RGD) was used
33
to investigate 3D mesenchymal stem cell properties (Duggal et al. 2009). The affects of various
biomaterials on ESC differentiation have also been examined with either singly seeded cells or
preformed aggregates/EBs (Battista et al. 2005, Flaim et al. 2005, Liu et al. 2006a, Gerecht et al.
2007). EBs differentiated in collagen demonstrated a greater cardiomyocyte phenotype when
mixed with high laminin, while an epithelial/vascular cell fate was enhanced with fibronectin
(Battista et al. 2005), or by incorporating the signaling peptide RGD and VEGF in modified
dextran (Ferreira et al. 2007).
Not only the biochemical components affect stem cell differentiation, differences in the physical
properties such as elasticity, may also impact cell fate decisions. The mechanical stiffness of the
hydrogels may influence cell viability, proliferation, and function as it was shown that soft,
medium and rigid substrates are neurogenic, myogenic and osteogenic respectively (Engler et al.
2006). A more in depth survey of microencapsulation techniques, and criteria for engineering
the stem cell microenvironment can be found in recent reviews (Metallo et al. 2007, Schmidt et
al. 2008, Burdick and Vunjak-Novakovic 2009).
Local Microparticle Delivery Systems
Overall, the application of cytokines and microenvironmental controls to regulate transcription
factors and genes point to a multifaceted approach to facilitate the development of a robust
system capable of generating large numbers of HSC. The mode of cytokine presentation can
impact downstream signaling, and thus, stem and progenitor cell fates. Localized cytokine
presentation may mimic in vivo mechanisms more closely and provide a greater range of cell
fate options than soluble delivery (Peerani and Zandstra 2010). Looking to develop greater
control over aspects of differentiation from within the ESC aggregate itself, growth factor release
from embedded particles is being explored. Access to the interior intercellular environment and
molecular composition becomes progressively restricted, as the cell aggregates coalesce and
proliferate (Sachlos and Auguste 2008). One approach to mimic the natural environment and
release growth factors to control differentiation signals is the use of microparticles; controlled
release has been studied for applications in many areas. For delivery, molecules can be
physically adsorbed or immobilized on a particle surface that could be incorporated into the
aggregate, although large molecule delivery may be limited by the structure of the EB itself and
steric diffusional barriers. We are at the early stages of developing a versatile platform to deliver
34
molecular cues via controlled release approaches (Chapter 4). Localized delivery would also
make scale-up more economical by facilitating expansion processes and yields.
One model system for controlled release is to use biocompatible and biodegradable PLGA
particles loaded with growth factors. The PLGA growth factor loaded microparticles showed an
initial burst followed by a slow or negligible release when agitated in PBS at 37ºC (Ferreira et al.
2008). Upon testing within hESC aggregates, the growth factors (VEGF, bFGF, PlGF) were
largely released over the first 2 days, but small concentrations of the factors (~55-285 fold less
than soluble delivery) resulted in a 2-4 fold upregulation of PECAM-1, a definitive endothelial
cell marker (Ferreira et al. 2008). Retinoic acid has also been delivered from PLGA particles in
mESC aggregates, resulting in cystic spheroids of an epiblast nature (Carpenedo et al. 2009).
Another adapatable microparticle system for controlled factor release is gelatin, a degraded
animal collagen that can be positively or negatively charged and that is also biocompatible and
biodegradable. Since first reported, the production methods of gelatin microparticles have been
evolving and include spray-drying, precipitation and emulsification (Bruschi et al. 2003,
Sivakumar and Rao 2003, Vandervoort and Ludwig 2004). The disadvantage of these methods
is that non-uniform particles with a broad size distribution result. To increase reproducibility of
drug release from a more uniform carrier methodologies have also been described to generate
size controlled spheres with a narrow distribution (Oner and Groves 1993, Huang et al. 2009). In
contrast to the burst release observed with PLGA microparticles, BMP-2 gelatin microparticles
exhibited minimal burst release with linear release kinetics in vitro for over three weeks (Patel et
al. 2008b). Specific growth factor release depends on the affects of growth factor size, charge,
and conformation and VEGF release kinetics were also dependent on the extent of gelatin
crosslinking (Patel et al. 2008a). These studies demonstrate the utility of gelatin microparticles
as delivery vehicles for the controlled release of various growth factors for developing tissue
engineering applications.
Aggregate Size
One hopes to engineer an environment with the right biological environmental cues to direct
cells to differentiate at the right time, into the desired phenotype. The importance of initial EB
size in regulating mesoderm specification and hematopoetic differentiation likely relates to
neighbouring cell interactions and to the balance of endogenous promoters and inhibitors with
35
exogenous factors. Cell growth within microwells provides both a confined 3D structure to
encourage uniform size and shape, but may also have the added benefit of conditioning the
surrounding media layer. Decreasing the inherent heterogeneity of traditional EB cultures will
aid in optimizing a process for guided differentiation (Mohr et al. 2009); uniform 3D aggregates
would generate a consistent population and may synchronize differentiation.
The importance of EB size in regulating differentiation may be related to the diffusion of critical
substrates or various growth factor cues. Other systems have shown that passive diffusion of
oxygen, for example, is limited to 100 μm thick cell layers (Radisic et al. 2004, Radisic et al.
2006). Additionally, spatial gradients of a variety of signaling molecules are essential for normal
embryonic development. For example, BMPs from anterior lateral endoderm promote
cardiogenesis, while Wnt from adjacent neuroectoderm inhibits its development (Sugi and Lough
1994, Mohr et al. 2009). BMPs from the primitive streak promote hemogenic mesoderm and
while Wnt aids this, activin/nodal antagonizes the effect (Gadue et al. 2006). In general, secreted
morphogens such as FGF, Activin, and Wnt are thought to form gradients that help promote
specific cell fates (Kubo et al. 2004, Xu et al. 2005, Singla et al. 2006).
Park et al. used a microfabrication stencil technique to study the effects of 2D aggregate size on
germ layer differentiation over 20 days. Similar differentiation kinetics occurred although
differences in gene profiles, protein expression, and albumin/urea production were apparent
between 100, 300 and 500 μm diameter colonies (Park et al. 2007). The smaller aggregates
showed a propensity toward ectodermal markers whereas larger aggregates showed an increase
in mesodermal and endodermal markers. Micropatterning techniques have also illustrated
differences in self-renewal capacities based on colony size (Peerani et al. 2007). Gene and
protein expression of various ECM molecules have also been examined in size controlled 3D
aggregates that demonstrate different cardiogenic output (Hwang et al. 2009b, Mohr et al. 2009,
Niebruegge et al. 2009). Differences in the WNT signaling family were observed under the
conditions tested; WNT5a was associated with smaller EBs and endothelial cell differentiation
(150 μm) while larger aggregates (450 μm diameter) were associated with WNT11 expression
and higher cardiogenesis (Hwang et al. 2009b). Specific control over 3D aggregates has also
been shown to impact hematopoietic capacity, as a minimum 500 cells/hESC aggregate was
required to maintain hemogenic capacity (Ng et al. 2005). In all, mass transport of exogenous
and endogenous factors and metabolites may differ with aggregate size to affect culture outputs.
36
1.7.4 Macroenvironmental Controls
Stirred-suspension cultures (SSC), within spinner flasks or bioreactors, are well suited to control
many aspects of the cellular environment. Stirring prevents formation of spatial concentration
gradients within the bulk media, thus a point measurement reflects the conditions that all cells
are exposed to. The ability to accurately measure culture conditions, such as oxygen tension or
pH, allows control processes to maintain constant conditions or to change conditions as desired
over time. Stirred-suspension cultures are also a practical means for scale-up, as vessel volume
can be increased providing shear forces or sparging do not deleteriously affect the cells (van der
Pol and Tramper 1998). Despite the advantages of SSCs, initially cell agglomeration was a
problem. Agglomeration can occur in static conditions and cultures exhibiting considerable EB
agglomeration are typically discarded (Robertson 1987). SSCs were successful when cells were
initiated and grown for four days in static culture prior to transferring to stirred-suspension
(Zandstra et al. 2003), and later by encapsulating mESC aggregates on the day cultures were
initiated in agarose (Dang et al. 2004) or alginate (Hwang et al. 2009a) hydrogels. Alternatively,
a process capable of direct EB formation from single cells was developed using a large reactor
with a pitch blade turbine (Schroeder et al. 2005). Following these process advancements mESC
and hESC have been used with various SSC differentiation strategies to generate hematopoietic
progenitors (Dang et al. 2004, Purpura et al. 2008a), cardiomyocytes (Bauwens et al. 2005,
Schroeder et al. 2005, Niebruegge et al. 2009), osteoblasts (Hwang et al. 2009a), and hepatic
lineages (Yin et al. 2007, Lock and Tzanakakis 2009).
In the future, realizing the therapeutic potential of stem stems may be facilitated by both the
scaled-up production of undifferentiated as well as differentiated pluripotent cells. mESCs were
first used in SSCs to demonstrate that pluripotency can be maintained in shear-controlled
aggregates and in microcarrier suspension (Fok and Zandstra 2005, Cormier et al. 2006,
Abranches et al. 2007, zur Nieden et al. 2007); the cells retain the ability to differentiate to cell
types from all germ lineages upon shifting to differentiation conditions (Fok and Zandstra 2005).
However, the use of such cultures may unexpectedly impact the efficiency of static
differentiation methods and require a more complete understanding of the environmental impacts
on cell characteristics as it has been observed that a subpopulation of pluripotent cells can persist
without LIF for over four weeks (Taiani et al. 2009). The development of an array of micro-
bioreactors may also help define operating parameters and factors that impact scale-up (Figallo
37
et al. 2007, Cimetta et al. 2009). Although processing challenges remain and mESC culture
conditions often do not directly translate to human culture conditions (reviewed in Kehoe et al.
2009), most recently, hESC have been maintained in SSC as aggregates (Cameron et al. 2006,
Krawetz et al. 2009) or in microcarrier suspension (Phillips et al. 2008, Fernandes et al. 2009,
Nie et al. 2009, Oh et al. 2009).
38
1.8 Moving Towards ESC Generated Long-Term Repopulating HSCs
One of the earliest reports of ESC-derived LTR-HSC employed a bone marrow stromal line,
RP010, exogenous IL-3 and IL-6, and conditioned media from a fetal liver stromal line, FLS4.1
(Palacios et al. 1995). Cells were sorted as CD44+Lin- (B220-Mac1- JORO75-TER119-) and
repopulated the lymphoid, myeloid, and erythroid lineages of irradiated mice. Following 15-18
weeks, HSCs were transferred and rescued secondary irradiated mouse recipients. As these lines
were not readily available, this study was not reproduced and the stimulatory cues provided by
the stromal line and conditioned media have yet to be determined. Using a similar strategy and
providing ESCs with an inductive stromal layer of OP9 cells that do not secrete macrophage
colony-stimulating (M-CSF) supported both myelopoiesis and lymphopoiesis (Nakano 1995),
although the cells produced were unable to repopulate lethally irradiated mice. Other groups
have had some success by adjusting the type of recipient mouse. For example Percoll-
fractionation of day 11-13 EBs showed limited lymphoid contribution with newborn severe
combined immunodeficiency (SCID) mice (Muller and Dzierzak 1993), and CD45+AA4.1+B220-
day 15 EB cells sustained long-term lymphoid contribution in lymphoid-deficient Rag-1-/- mice
(Potocnik et al. 1997).
Generation of a true HSC remains a significant challenge. Obtaining long-term multilineage
hematopoietic engraftment requires a microenvironment that can provide signals to stimulate the
transition from primitive to definitive hematopoiesis. To date, using various animal models, the
closest approximation has been co-culture of cells with OP9 stromal cells following an initial
period of differentiation and/or induction with Hoxb4 (Kyba et al. 2002, Pilat et al. 2005, Sasaki
et al. 2005, Wang et al. 2005c). EBs may not provide the conditions for later developmental
stages as they lack anatomical structure, do not recapitulate particular cell-cell interactions or
physiologically occurring stimuli, and lack certain cell non-autonomous effects (Lengerke and
Daley 2010). AGM stromal explants have provided some clues as to what factors may be
important to enhance the in vivo repopulating ability of HSCs; three factors presumed to regulate
HSCs include β-NGF, macrophage inflammatory protein (MIP)-1γ and BMP4 (Durand et al.
2007). Interestingly, parallels between neuronal and hematopoietic development have been
suggested and factors traditionally associated with one lineage may in fact regulate the
development of different lineages (Durand et al. 2007).
39
Differences have been noted between fetal and adult HSCs regarding their capacity to rescue
irradiated recipients, with more rapid regeneration occurring with fetal cells than adult. This
change in cycling and regenerative capacity appears to occur between 3-4 weeks after birth
(Bowie et al. 2006, Bowie et al. 2007). Purified fetal HSCs (E14.5 FL; Lin-Sca1+CD45+Mac1+)
were contrasted with adult HSCs (BM of 10 week mice; Lin-Rhodamine123-Hoechst 33342- side
population) in defined growth factor conditions to elucidate mechanisms that force HSCs to
adopt different biological fates (Bowie et al. 2007). Enhanced responsiveness to cKit ligand
(also known as stem cell factor or steel factor) and downstream signaling events appear
responsible for the greater efficiency of self-renewal of fetal HSCs in vivo as fetal W41/W41
HSCs, which have a deficient cKit kinase behave similarly to adult HSCs, show a reduced rate of
amplification upon host transplantation (Bowie et al. 2007).
Moving toward prospective isolation of HSCs with durable self-renewal, phenotypic clarity is
slowly emerging in relation to the functional endpoint: a sustained output for at least 4 months
with donor cells providing a minimum of 1 % of all circulating white blood cells (Purton and
Scadden 2007). Heterogeneity remains in repopulation capacity, in part reflecting the cell cycle,
as only cells in the G1 phase are detectable upon transplant (Cheshier et al. 1999) and in part
reflecting HSC subtypes (Schroeder 2010). The expression of CD45+endothelial protein C
receptor (EPCR)+CD48-CD150+ (termed E-SLAM), on sorted FL or adult BM cells resulted in
43 % long-term rescue when used in single cell primary or secondary intravenous tail vein
injection of irradiated congenic W41/W41 mice; only 7 % long-term rescue resulted from cells
with the same phenotype except CD150-. The capacity of this phenotype was also observed in
vitro, as the average percentage of CFCs in the LTC-IC assay was almost identical to the
frequencies of HSCs with durable self-renewal following transplant (Kent et al. 2009). The
expression of CD150 in the subset of CD45+EPCR+CD48- adult BM cells was used to identify
three elevated transcripts: VWF (von Willebrand factor), Rhob (Ras homolog gene family,
member b), and Pld3 (phospholipase D3) (Kent et al. 2009), which may shed light on
mechanisms that regulate HSC self-renewal in the future.
Another study which evaluated the long-term reconstitution of a subset of HSC with CD150 was
published shortly afterwards (Papathanasiou et al. 2009). cKit+Thy1.1loLin-/loSca1+Flk2- (KTLS)
cells that are additionally CD150+ from either FL or adult BM exhibit the most robust
engraftment; 100 cells were competitively transplanted with 300 000 recipient-type CD45+
40
radioprotective cells. This phenotype was associated with high transcript levels of Gata2 (~48
fold increase compared to whole bone marrow, WBM), and c-mpl/TpoR (~5500 fold). It was
also shown that CD150 can substitute for Thy1.1, as 10 CD45+cKit+Lin-Sca1+CD150+ (KLS)
cells competitively transplanted and rescued lethally irradiated recipients (5 of 9 mice), a rate
comparable to typical KTLS long-term multilineage reconstitution (Papathanasiou et al. 2009).
In another study, CD34-KLS CD150high cells were enriched for HSCs with high self-renewal,
although a fraction of these displayed latent myeloid engraftment in primary recipients with
progressive multilineage reconstitution in secondary recipients (Morita et al. 2010).
An alternative strategy for purifying HSCs from mouse bone marrow relies on the stem cell’s
capacity to efflux Hoechst dye and is designated the side population (SP). A gradient of
functional activity appears along the SP despite similar KLS expression (Goodell et al. 1997) and
evidence now supports the view that the hemaotpoiectic system is maintained by a variety of
HSC subtypes rather than a homogenous clonal population (Sieburg et al. 2006, Dykstra et al.
2007, Wilson et al. 2008). CD150 shows a bimodal distribution within the SP KLS population
(Weksberg et al. 2008) and transplanting the upper- and lower- SP KLS fractions reveals
myeloid- or lymphoid-biased HSCs (Challen et al. 2010). Even though both SP fractions
contained HSCs, the upper fraction was biased towards lymphoid differentiation and the cells
were more proliferative with a shorter lifespan than the myeloid-biased lower fraction. The
lineage bias and cell phenotypes were stable over time and serial transplantion, lineage
differences were magnified in the presence of the other HSC subtype, and the fractions
responded differently to TGFβ1. The implication of a HSC pool with distinct subtypes is that
appropriate HSC subtypes must be selected for clinical applications.
With the advent of the SLAM family surface markers and successful reconstitution when
CD150+ expression is combined with canonical hematopoietic cell-surface markers (KLS), a
survey of phenotypes during mouse development was undertaken for comparison to ESC-HSCs.
A heterogeneous cell population, termed EPOCH, results from EB-formation, and passaging
onto OP9s with ectopic Cdx4 and HoxB4. This population was able to rescue mice from lethal
irradiation, however, millions of EPOCH cells were required, reflecting either a rare
repopulating cell or compromised engraftment capacity (Wang et al. 2005c). To summarize,
E9.5 YS, 10.5 AGM, 12.5 placenta, 14.5 FL, and WBM cells were compared to ESC-HSC
(EPOCH cells) and the following was observed: all cells expressed cKit; CD41 was expressed by
41
progenitors in the YS, AGM, placenta and EPOCH cells; CD34 was expressed from E9.5-E14.5
but not on EPOCH cells; CD45 was expressed on cells from the late AGM stage but variably
expressed on EPOCH cells; CD48 was not expressed in vivo but had variable expression on
EPOCH cells; CD150 was expressed on FL and WBM cells as well as EPOCH cells (McKinney-
Freeman et al. 2009). In all, ESC-HSC appear to have a fairly developmentally immature
phenotype that does not directly correspond to a particular in vivo compartment and may be in
the process of transitioning to a more mature phenotype (CD45+CD150+) (McKinney-Freeman
et al. 2009). If the EPOCH population was sorted prior to transplantation, it may be possible to
determine the frequency of LTR cells, and rescue animals without millions of cells. The ESC-
HSCs that are CD45+EPCR+CD48-CD150+ or CD45+cKit+Lin-Sca1+CD150+ may actually
have capacities that match fetal or adult HSCs, so that progress can then be made to understand
mechanisms that enhance their production.
42
1.9 Thesis Overview ESCs provide a unique and renewable resource for the development of a scalable system to
produce HSCs. Although many hurdles remain in understanding how to integrate the multitude
of signaling cascades that direct stem cell fate, it is envisioned that a small 3D
microenvironmental niche can be engineered to provide such a control platform. A single cell or
cell aggregate would be enveloped such that a combination of cytokines and/or cell-cell contacts
may be provided in a coordinated manner to direct stem cell fate to the desired HSC within the
local microenvironment. A high level of complexity may be introduced into the system through
selected scaffold materials, factor presentation, concentration gradients, and cell arrangement,
thus providing a tuneable system that could be extended to a variety of applications (Figure 1.7).
Figure 1.7. A tuneable microenvironment to facilitate EB differentiation. The cell aggregate
can be grown with one or more growth factors/cytokines delivered by local diffusion from embedded
microparticles (shown here as red/blue). These cells can also be grown in a biocompatible agarose gel,
for high density culture in stirred-suspension or within modified agarose with immobilized factors, or
within heparin sulphate agarose.
Interest in cellular therapies continues to grow as induced pluripotent stem (iPS) cells, with
similar capacities to ESCs regarding self-renewal and differentiation, have been created from
both mouse and human somatic cells by transducing a combination of embryonic genes into the
cells (Takahashi and Yamanaka 2006, Takahashi et al. 2007, Wernig et al. 2007, Yu et al. 2007,
Park et al. 2008, Woltjen et al. 2009). Ultimately, the derivation of therapeutic cells from
differentiating ES/iPS cell culture will depend on our ability to understand the embryonic
developmental processes and to control the differentiation of these pluripotent cells into
transplantable lineage-specific stem cells. No treatment regime has yet provided an EB system
capable of highly uniform differentiation, thus, the focus of this project was to enhance
mesoderm specification and amplify HPC products.
Chapter 2
Soluble Flt-1 Regulates Flk-1 Activation to Control Hematopoietic and Endothelial Development in an Oxygen
Responsive Manner
This chapter has been published in Stem Cells. (2008) Nov;26(11):2832-42. Epub 2008 Sep 4.
Collaborators include Sophia George, Stephen Dang, Kyunghee Choi, Andras Nagy and Peter
Zandstra.
Author Contributions:
Kelly A. Purpura- Conception and design, collection and/or assembly of data, data analysis and
interpretation, manuscript writing, final approval of manuscript; Sophia George- conception and
design, collection and/or assembly of data, manuscript writing; Stephen M. Dang- conception
and design, collection and/or assembly of data, data analysis and interpretation, manuscript
writing; Kyunghee Choi- provision of study material, BL-CFC assay assistance; Andras Nagy-
provision of study material; Peter W. Zandstra- conception and design, data analysis and
interpretation, manuscript writing, final approval of manuscript.
43
44
2.0 Abstract Vascular endothelial growth factor (VEGF) and it receptors (VEGFR) regulate the development
of hemogenic mesoderm. Oxygen concentration-mediated activation of hypoxia-inducible factor
targets such as VEGF may serve as the molecular link between the microenvironment and
mesoderm-derived blood and endothelial cell specification. We used controlled-oxygen
microenvironments to manipulate the generation of hemogenic mesoderm and its derivatives
from embryonic stem cells. Our studies revealed a novel role for soluble VEGFR-1 (sFlt-1) in
modulating hemogenic mesoderm fate between hematopoietic and endothelial cells. Parallel
measurements of VEGF and VEGFRs demonstrated that sFlt-1 regulates Flk-1 activation in both
a developmental-stage and oxygen-dependent manner. Early transient Flk-1 signaling occurred
in hypoxia due to low levels of sFlt-1 and high levels of VEGF, yielding VEGF-dependent
generation of hemogenic mesoderm. Sustained (or delayed) Flk-1 activation preferentially
yielded hemogenic mesoderm-derived endothelial cells. In contrast, delayed (sFlt-1 – mediated)
inhibition of Flk-1 signaling resulted in hemogenic mesoderm-derived blood progenitor cells. Ex
vivo analyses of primary mouse embryo-derived cells, and analysis of transgenic mice secreting
a Flt-1-Fc fusion protein, support a hypothesis whereby microenvironmentally-regulated blood
and endothelial tissue specification, is enabled by the temporally variant control of the levels of
Flk-1 activation.
45
2.1 Introduction Oxygen-mediated signaling is expected to initiate and modulate the development of the major
oxygen transport-related tissues. Adaptive responses to hypoxia (O2 deprivation) are required for
mammalian placentation (Adelman et al. 2000), facilitating O2 and nutrient delivery to the
rapidly growing embryo, and for the normal development and patterning of the cardiovascular
system (Ramirez-Bergeron and Simon 2001). Furthermore, hypoxia stimulates pathways leading
to the proliferation of endothelial cells (Phillips et al. 1995) and hematopoietic progenitors
(Adelman et al. 1999, Ramirez-Bergeron et al. 2004).
As a regulator of oxygen homeostasis, hypoxia-inducible factor (HIF) induces a network of
genes related to angiogenesis, erythropoiesis, and glucose metabolism (Giaccia et al. 2004). It
allows dynamic control of cell survival and function in response to changing environmental
stimuli (Bunn and Poyton 1996). Although the molecular mechanisms are not completely
understood, hypoxia plays a crucial role in establishing hemogenic mesoderm (Pouget et al.
2006), and in the subsequent generation of hematopoietic and endothelial cells. Hypoxic regions
have been identified in the yolk sac mesoderm where HIF-1α and vascular endothelial growth
factor (VEGF) co-localize to induce blood vessel formation (Lee et al. 2001). These
observations point to oxygen-regulated activation of growth factor signaling as an important
component of the hemogenic niche associated with the emerging embryonic blood islands. A
recent review elaborates on oxygen availability during embryonic development (Simon and
Keith 2008).
VEGF is a potent endothelial cell mitogen and has a central role in hematopoiesis,
vasculogenesis and angiogenesis (Carmeliet et al. 1996, Ferrara et al. 1996, Drake and Little
1999). There are two VEGF receptors, VEGFR-2 or Flk-1 (fetal liver kinase-1, also known as
kinase insert domain containing receptor, KDR (Quinn et al. 1993)) which transduces signals,
and VEGFR-1 or Flt-1 (fms-like tyrosine kinase receptor-1 (Shibuya et al. 1990)), which has
been described as a non-signaling ligand trap (Hiratsuka et al. 1998, Hirashima et al. 2003). Flt-
1 has a higher affinity (Kd 10-30 pM (Waltenberger et al. 1994)) for VEGF than its actively
signaling counterpart Flk-1 (Kd 75-760 pM (Quinn et al. 1993, Waltenberger et al. 1994)).
VEGF and its receptors Flt-1 and Flk-1 play a crucial role in generating mature endothelial and
hematopoietic cells. Embryos heterozygous for VEGF die by E10 due to malformations in the
46
vascular and blood system (Carmeliet et al. 1996, Ferrara et al. 1996). These defects are more
pronounced in embryos homozygous for the VEGF deletion (Carmeliet et al. 1996), suggesting a
dose-dependent regulation of fetal vascular development by VEGF.
Homozygous Flk-1 null (Flk-1-/-) embryos fail to form blood islands and vessels (Shalaby et al.
1995). In vivo and in vitro analyses have demonstrated that while the requirement of Flk-1 is
cell-intrinsic for endothelial cells, the failure to generate blood cells may be indirect and
associated with the inability of the early mesodermal cells to migrate to hematopoietic conducive
sites (Shalaby et al. 1997, Hidaka et al. 1999). Recent cell labeling experiments suggest that a
continuum of Flk-1 expression is important in the specification of the hemogenic mesoderm
toward blood or endothelial cells (Ueno and Weissman 2006). Mechanisms to control the
activation of Flk-1 may thus play an important role in the embryonic hematopoietic niche. Flt-1
homozygous null (Flt-1-/-) mice generate both endothelial and hematopoietic cells but die from an
abnormally high number of endothelial cells that fail to form an organized vascular network
(Fong et al. 1995, Fong et al. 1999). In contrast, deleting only the intracellular domain of Flt-1
(by generating Flt-1 tyrosine kinase-deficient mice Flt-1TK-/-) yields apparently normal
development (Hiratsuka et al. 1998). Together these results have led to speculation that the
function of Flt-1 is to act primarily as a VEGF “sink” or signaling modulator (Hiratsuka et al.
2005b).
Considered in combination, the phenotypes of Flt-1-/-, Flt-1TK-/- and Flk-1-/- mice suggest that
VEGF action during embryogenesis depends on the strength and timing of the activation of its
singling receptor(s), a parameter that can be manipulated by changing ligand or receptor
availability. Given that VEGF secretion can be broadly regulated by the microenvironment we
hypothesized that oxygen could act as a developmentally-relevant signal to control the VEGF-
ligand-receptor signaling threshold (VEGF-LIST) (Zandstra et al. 2000). We further speculated
that, due to its action as a non-signaling VEGF “sink”, Flt-1 expression may modify the VEGF-
LIST as a function of oxygen tension. We tested these hypotheses using quantitative analysis of
blood and endothelial development from ES cells and mouse embryos.
We demonstrate for the first time that sFlt-1 is an important mediator of hematopoietic
development in a developmental-stage and oxygen-dependent manner. Early transient Flk-1
signaling occurs in a hypoxic microenvironment due to low levels of sFlt-1 and high levels of
47
VEGF, resulting in the enhanced generation of hemogenic mesoderm and blast-colony forming
cells (BL-CFC). Sustained or delayed Flk-1 activation results in enhanced endothelial cell
output. On the other hand, delayed inhibition of Flk-1 signaling resulted in an increase in blood
progenitors from the hemogenic mesoderm. Our results demonstrate a mechanism whereby
hypoxia, VEGF and its cell surface-bound and soluble receptors (sFlt-1) collaborate to regulate
the development of the hematopoietic and endothelial lineages.
48
2.2 Materials and Methods
2.2.1 Cells
Mouse R1, VEGF-/- (Carmeliet et al. 1996), Flt-1-/- (Fong et al. 1995), and Flk-1-/- (Shalaby et al.
1997) embryonic stem cells (ESC) were maintained in a humidified incubator with 5 % CO2 at
37°C as described previously (Dang et al. 2002). G4 and Flt-1-Fc mutant ESCs were grown on
mitomycin C-treated mouse embryonic fibroblasts (MEFs derived from TgN (DR4)1 Jae
embryos) and maintained as above.
ESCs were differentiated in either stirred-suspension (Dang et al. 2004) or liquid suspension
(Dang et al. 2002). Treatments included 25 ng/ml VEGF (Sigma/R&D Systems) or 5 μg/ml
SU1498 (Flk-1 tyrosine kinase inhibitor; Sigma).
E7.5 embryos were harvested, treated with 25 mg/ml collagenase with 20 % FBS in media for
60-90 minutes at 37°C, and dissociated with a 26G needle before culture on OP9-GFP stromal
cells. Cells were cultured in standard OP9 media (Kitajima et al. 2003), supplemented with
SU1498, VEGF or mrFlt-1-Fc (R&D Systems), for five days prior to CFC and EC assessment.
2.2.2 Encapsulation Process and Bioreactor Culture
Mouse ESC aggregates were formed by generating a single cell suspension at 3 x 105 cells/ml in
ESC media and incubating for one day (Dang et al. 2004). The Cellferm-pro system (DasGip,
Julich, Germany) was used for stirred-suspension culture of encapsulated ESCs under controlled
conditions. Vessels were filled with 125-200 ml of ESC media without LIF and inoculated with
5 x 105 – 1 x 106 encapsulated ESCs. Supernatants were collected and analysed by ELISA.
2.2.3 Hematopoietic Cell Assays
Embryoid bodies (EBs) were dissociated by incubation (2 min, 37oC) in 0.25% trypsin-EDTA
(Sigma). Yolk sacs from E8.5 embryos were digested with collagenase as described
previously(Martin et al. 2004). Individual cells were counted using a hemocytometer and
analyzed by either myeloid-erythroid (ME)-CFC assay or flow cytometry (Dang et al. 2002).
ME-CFC assays were performed as recommended using M3434 media (Stem Cell Technologies)
49
with 20000-100000 test cells plated into 35 mm Greiner dishes. CFCs were scored by
morphology 7 days after plating according to established criteria (Eaves 1992).
Blast-CFC assays were performed with 50000-100000 cells/35 mm Greiner dish and scored by
morphology 4 days after plating (Choi et al. 1998). Following four days in the assay, individual
blast colonies were picked and replated into hemogenic-endothelial cell supportive media (Choi
et al. 1998) and/or total RNA was isolated using the Picopure kit (Ambion).
Cells were prepared for flow cytometry as described (Dang et al. 2002). The cells or isotype
controls were incubated with: 1:100 PE anti-mFlk-1 (Avas 12∝1), FITC anti-mCD34 (RAM34),
PE anti-mCD45 (30-F11), PE rat IgG2a,κ, FITC rat IgG2a,κ, PE rat IgG2b,κ (PharMingen), prior to
addition of 1 μg/ml 7-amino-actinomycin D (7AAD, Molecular Probes) in the final wash. The
cells were analyzed on Coulter Epics XL using Expo 32 ADC 1.1 Software (Beckman Coulter,
Fullerton, CA) or FlowJo (TreeStar, Inc.). Positive staining was defined as fluorescence
emission >99.9 % of the levels obtained by negative control cells from the same starting
population.
2.2.4 Enzyme-linked immunosorbent assay (ELISA)
VEGF and sVEGFR1 concentrations in media supernatants were measured using Quantikine
Immunoassay Kits (R&D Systems, Minneapolis, MN), following manufacturer-provided
protocols. VEGF ELISAs measure the concentration of VEGF in the supernatant. That includes
both free VEGF and VEGF bound to sVEGFR1 (personal communication, R&D Systems).
Similarly, sVEGFR1 ELISAs measured the concentration of both free sVEGFR1 and VEGF-
bound sVEGFR1 (personal communication, R&D Systems).
2.2.5 RT-PCR
Total RNA was prepared using Picopure kit or Trizol reagent (Invitrogen). 0.25 µg (blast
colony) or 1 µg (tissue/ESCs) of RNA was reverse-transcribed using Quantitect (Quiagen).
Primers were obtained from Primer Bank (pga.mgh.harvard.edu/primerbank) ID: β1H1 globin-
6680179a1; Brachyury-6678203a1; CD34-19526792a1; Flk-1-27777648a1; Nanog-31338864a1;
GAPDH-6679937a1; L32-2131294a1; 203-EX9-SS, 206-EX14-AS, and 227-INT13-AS (Huckle
and Roche 2004) were used to detect sFlt-1 and Flt-1.
50
2.2.6 Endothelial Cell Assay
Individual day four EBs grown in serum-containing differentiation medium with or without
treatments (25 ng/ml VEGF or 5 µg/ml SU1498) were plated on 250 μg/ml collagen IV (Sigma)
coated 96-well plates. After 24 hours media was exchanged and the day 5 EBs were treated with
25 ng/ml VEGF or 5 µg/ml SU1498 from days 5-7 as described in the figure legends.
Alternatively day 7 EBs from hypoxic or normoxic bioreactors were plated and grown for 2 days
in differentiation medium. Wells were fixed with 4 % paraformaldehyde (PFA) on day seven
and stained for platelet-endothelial cell adhesion molecule-1 (PECAM, CD31) as described
below. Images were taken on an Olympus SZ2-ILST microscope with a single magnification set
between 0.67-4x (Tokyo, Japan) with an Infinity 1 USB 2.0 camera (Zarbeco, LLC, Randolph,
NJ); positive thresholds were set using ImageJ (http://rsb.info.nih.gov/ij/index.html) and PECAM
positive areas were analyzed quantitatively.
2.2.7 Transgenic Mice
ICR outbred stock mice (Harlan) were used for dissections of E7.5 – E8.5 cell cultures. Flt1-Fc
mice were generated as described by George et al. 2007 (George et al. 2007) and mated with Cre
deletor (Tg (ACTB-Cre)1Nagy) (Nagy 2000). Embryos were genotyped by PCR for Cre with
primers P1: GGTTATTGTGCTGTCTCATCA; P2: ATATCCTGGCAGCGATCGCTA, and Flt-
1-Fc with P1: TGGTTGTAAGCCTTGCATAGTACAGTC; P2:
CTAGCTAGCTTTACCAGGAGAGTGGGAG.
2.2.8 Immunohistochemistry
Embryos were dissected in ice-cold PBS and fixed overnight in 4 % PFA at 4 °C. Wholemount
analysis was performed between E7.5-9.5 with PECAM (Pharmingen, MEC13.3 1:100) and goat
anti-rat Ig-HRP conjugate (Biosource, 1:500), using Tyramide-Cy3 amplification (PerkinElmer
NEL752). Embryos and yolk sacs were visualized using a Leica MZ16FA stereomicroscope
with Qimaging 1300C digital camera. E7.5 derived ECs grown on OP9s or EB derived ECs
grown on collagen IV, were fixed in 4 % PFA for 20 min at room temperature or overnight at
4 °C. Following overnight blocking in 5 % BSA, primary PECAM (Armanian-hamster
MAB1398Z Clone 2H8) was added overnight (Chemicon, 1:100) prior to washing and addition
of the secondary, Cy5 AffiniPure goat anti-Armenian hamster (Jackson ImmunoResearch
51
Laboratories Inc., 1:1000) or goat anti-rat Ig-HRP conjugate (Biosource, 1:500), for 3 hours at
4°C. Hoechst was added for 10 minutes to stain the nuclei of cells stained with Cy5 and imaging
was completed at room temperature with ArrayScan® VTI Version 5.5.1.2-0.63x (Build 268)
automated fluorescent microscope (Cellomics, Pittsburgh, PA). Zeiss objectives were used (10x
NA 0.3 or 20x NA 0.4 Korr) and image analysis was completed using ImageJ (standardized
contrast and threshold set to determine EC area).
2.2.9 Immunoprecipitation and Western Blot
Immunoprecipitation on EB proteins were performed using standard protocols with Protein A
(Sigma) and Flk-1 antibody (Abcam, Ab2349; 1:100). Antibodies used in Western blots were
mouse-phosphorylated tyrosine (gift from Dr. Tony Pawson; 1:5000); rabbit Flk-1 (Abcam;
1:1000) and goat HRP-IgG (anti-mouse or anti-rabbit) (BioRad; 1:10,000).
2.2.10 Statistical Analysis
All data are reported as mean ± s.d. Experiments measuring differences between oxygen
tensions were assessed using paired two-tailed Student's t-test with n ≥ 3, α=0.05 unless noted
otherwise in text.
52
2.3 Results
2.3.1 ESC blood and endothelial cell output are correlated with VEGF secretion rates in opposite ways
Although Flk-1 expression has been associated with commitment to blood (Flk-1 low) or
endothelial (Flk-1 high) cells (Ueno and Weissman 2006), it is not clear if control of the
microenvironment could also influence the level of signaling activation of the receptor, and
consequently the development of endothelial and hematopoietic lineages. As a first step in
testing the hypothesis that endogenous regulation of the ligand-receptor signaling threshold
(LIST) and subsequent hematopoiesis and vasculogenesis could be manipulated by the
microenvironment, we examined the role of hypoxia using a bioreactor system (Figure 2.1 Ai,ii)
to recapitulate the low O2 environment thought to occur during development (Umaoka et al.
1992, Fischer and Bavister 1993). Previous reports indicate that hypoxia (≤ 5% O2) enhances
HPC output in the EB system (Adelman et al. 1999, Ramirez-Bergeron et al. 2004). In our
studies, ESCs were differentiated under a range of oxygen conditions and after seven days, HPC
frequency was measured using the ME-CFC assay (Figure 2.1Bi) and EC development was
quantified using PECAM staining of cell outgrowths (Figure 2.1Ci). Analysis showed that ME-
CFC output peaked at 2-4 % O2 tension (Figure 1Bii); whereas EC development displayed the
opposite trend over this same range (Figure 2.1Cii). ELISA was used to demonstrate that, as has
been suggested (Shweiki et al. 1992, Levy et al. 1995), cell specific VEGF secretion rates are
proportional to oxygen (Figure 2.1D). Together these results suggest that VEGF-mediated
signaling regulates hematopoietic and endothelial cell (EC) development in an opposing manner.
To demonstrate that VEGF is a key player in the hypoxic effects on CFC/EC output we also
show that continuous inhibition of Flk-1 with SU1498 significantly decreases both CFC and EC
in hypoxic conditions. Alternatively, competition for VEGF through the addition of Flt-1-Fc
also decreases CFC in hypoxia relative to the control (Figure 2.1E). We next sought to
specifically implicate VEGF-mediated signaling in the observed differential fate outcomes.
53
54
Figure 2.1. Hematopoietic progenitor cell (HPC) production, EC development and VEGF
secretion is a function of oxygen tension. A bioreactor system (Ai) was used to control (Aii)
oxygen tension at 20 %, 8 %, 4 %, 2 %, and 1 %. EBs were harvested on day seven and HPC frequency
was assessed by the myeloid-erythroid CFC output based on established morphological characteristics
(Dang et al. 2002) (Bi). HPC frequency measured as a function of oxygen tension (Bii). Day 7 EBs were
plated on collagen IV, fixed 2 days later and stained with PECAM. PECAM positive areas were analyzed
quantitatively after a positive image contrast threshold was set. Scale bar = 500 µm (Ci). Day 7 EB-
derived PECAM positive areas were calculated and plotted as a function of bioreactor oxygen tension
(Cii). Bioreactor media supernatants were analyzed by ELISA on day 7 to determine VEGF
concentration. The cell-specific VEGF secretion rate (fg/cell/day) was calculated and three independent
experiments are shown (D). To establish that the VEGF produced in hypoxic conditions was effecting
CFC/EC output, differentiating EBs were grown in the presence of Flk-1 inhibitor SU1498 (5 µg/ml) in
hypoxia/normoxia or with competitive Flt-1-Fc. CFC/EC output was compared to control (E).
2.3.2 ESC blood Mutant VEGF receptor ESC lines demonstrate that Flt-1 plays a critical role in oxygen-mediated modulation of HPC
As a first step in determining the mechanisms responsible for the observed oxygen-mediated
modulation of blood development, we performed experiments using parental or engineered R1
ESC lines with homozygous deletions of VEGF, Flt-1, or Flk-1, and parental or genetically
engineered G4 ESC lines that over-expressed Flt-1-fc (George et al. 2007).
Blood and endothelial development from the VEGF and VEGFR mutant ESCs have not been
investigated as a function of oxygen concentration. We reasoned that this analysis would reveal
novel interactions and synergies between these molecules and microenvironmental control. In
normoxia, VEGF-/- and Flk-1-/- mutants produced similar numbers of CFC, whereas Flt-1-/- ESCs
produced a significantly higher number of CFC, in comparison to wild type control
(Figure 2.2Ai). These results suggest that Flt-1 may restrain CFC output in normoxic cultures.
Under hypoxic conditions wild type control cells significantly increased CFC output
(p = 0.00005), whereas VEGF-/- and Flk-1-/- ESCs exhibited modest increases (Figure 2.2Ai).
Interestingly, Flt-1-/- ESCs were completely defective in the hypoxic enhancement of CFC output
(0.7 fold increase, p= 0.05). This data implicates Flt-1 in enhancing CFC generation under
hypoxic conditions.
55 55
56
Figure 2.2. Flt-1 is the major modulator of CFC production and in soluble form (sFlt-1)
may impact Flk-1 activation as a result of oxygen concentration. The CFC capacity of wild
type R1 cells, and their mutant derivatives VEGF-/-, Flt-1-/-, Flk-1-/- was assessed in hypoxia and normoxia
(Ai). The total cell expansion of the parental or mutant R1 cells was independent of oxygen tension (fold
1.0 ± 0.4). 105 cells were seeded on day seven. The CFC capacity of wild type G4 cells and their
derivative Flt1-Fc mutant was assessed in hypoxia and normoxia (Aii). Cell expansion of both the G4
wild type and its mutant varied between normoxia and hypoxia, thus the total CFC for 1000 input ESC
was reported. 5 x 104 cells were seeded on day seven. Significant differences (p < 0.05) are indicated
between hypoxic and normoxic conditions for each cell line (*), between normoxic WT and mutant CFC
production (&), or between hypoxic WT and mutant CFC production (#). Representative FACS plot
demonstrating the Flk-1 isotype control (shaded), and positive Flk-1 expression in hypoxia (solid line)
and normoxia (dashed line) (Bi). Kinetic Flk-1 expression profile in normoxia and hypoxia as measured
by flow cytometric analysis (Bii). Kinetic VEGF and sFlt-1 concentration profiles (Siepmann and Peppas
2001) under normoxia and hypoxia were determined by ELISA, and the calculated ratio of molecules of
VEGF/sFlt-1 is shown (n ≥ 3) (C).
In a second series of studies we used control G4 cells and a derived mutant line, Flt-1-Fc that
over expresses the protein. There was not a significant difference between the G4 parental line
and Flt-1-Fc in normoxia (p=0.13) but in hypoxia Flt-1-Fc generated significantly more CFC
when compared to both the Flt-1-Fc (p=0.002) or G4 line (p=0.03) (Figure 2.2Aii). In sharp
contrast to the reduced CFC output observed relative to wild type with the VEGF-/-, Flt-1-/- and
Flk-1-/- mutants, the Flt-1-Fc ESCs produced significantly more CFC in hypoxia than G4 wild
type controls. Together this data implicates, for the first time, Flt-1 in the oxygen mediated
regulation of blood progenitor cell development.
2.3.3 Hypoxia influences Flk-1 activation via the secretion of Flt-1 and VEGF
The previous results suggest that oxygen concentration may influence the dynamic interaction
between VEGF and its receptors. Gene expression analysis indicates that VEGF, Flt-1 and Flk-1
expression change with time and that VEGF is affected by oxygen concentration (Supplement
Figure 1). To assess these differences at the protein level, we first measured Flk-1 cell-surface
receptor expression using flow cytometry (Figure 2.2Bi). In normoxia, EB Flk-1 expression was
detected on day three, peaked on day five, and then declined for the remainder of the culture
(Figure 2.2Bii). The profile of Flk-1 expression at 4 % O2 was similar in shape to 20 % O2;
57
however, Flk-1 expression peaked one day earlier. The discrepancies between protein and
mRNA measurements for Flk-1 may result from the translation of the gene, or by differences in
the processing and secretion of the extracellular proteins. This suggests that there is a
developmental window that is sensitive to oxygen concentration, during which Flk-1 signaling
may be important.
In contrast to Flk-1 which was detected on the surface of the cells, we could only find Flt-1 upon
analysis of media supernatants. ELISA revealed the production of a soluble form of Flt-1
(sFlt-1), strongly supporting its role as an inhibitor due to its lack of intracellular signal
transduction capacity. Measured values for the concentrations of sFlt-1 are provided in
Supplementary Figure 2. The dynamic competition for the VEGF produced in hypoxia in
contrast to normoxic conditions is best shown by the ratio of VEGF/sFlt-1 (the ratio of the ligand
and its decoy) (Figure 2.2C). The VEGF dimer binds two molecules of receptor (Keyt et al.
1996); we calculated the concentration of protein as the number of molecules of VEGF or sFlt-1
respectively in the bulk media, and assumed that binding occurred in homodimer form. This
ratio (VEGF/sFlt-1) is initially high in hypoxia; but the ratio drops towards one by day 5. In
contrast, in normoxia the ratio is low until day four; after this time the ratio increases and
approaches one. These results are consistent with our earlier results that suggest blood
development proceeds in a VEGF/Flk-1 independent manner in normoxia and that the increase in
blood development during hypoxia proceeds from high VEGF signaling early during culture.
Thus, sFlt-1 may influence cell fate during ESC differentiation via the temporal and
microenvironment dependent control of ligand (VEGF) availability.
2.3.4 Mimicking the Flt-1 mediated control of ESC fate under normoxic conditions: effects on blood and endothelial cell output
We have proposed that sFlt-1 plays a modulating role in the oxygen-mediated enhancement of
blood progenitor generation (and an inverse effect on endothelial cells). Differences between
VEGF and sFlt-1 concentration profiles in hypoxia suggest that CFC generation is enhanced by
early activation of Flk-1, followed by sFlt-1-mediated competitive inhibition of Flk-1 activation.
To further explore and validate the proposed mechanism, Flk-1 activation was controlled in a
time-dependent manner under normoxic conditions using R1 wild type ESCs. Treatments were
provided to either activate (with VEGF) or inhibit Flk-1 signaling (with SU1498) and both HPC
and EC generation were evaluated. Flk-1 activation and SU1498 inhibition was confirmed by
58
immunoprecipitation with Flk-1 and immunoblotting with a phosphorylated tyrosine kinase
antibody (Supplement Figure 3).
As expected, early VEGF treatment (day 0-5) generated more hemogenic mesoderm compared to
the untreated control; HPC frequency and EC growth was 2.3 ± 0.8 and 2.3 ± 0.6-fold higher
respectively (Figure 2.3A). The observation that blood and endothelial cells develop in close
proximity in yolk sac blood islands support a hypothesis that these cells originate from a
common precursor, the hemangioblast (Sabin 1920). An in vitro equivalent of this precursor can
be measured using the blast-colony-forming cell (BL-CFC) assay (Kennedy et al. 1997, Choi et
al. 1998). We confirmed that hypoxia can enhance BL-CFC output (Ramirez-Bergeron et al.
2004) based on colony morphology (Figure 2.3Bi, ii) and that the addition of VEGF to normoxic
cultures had a similar effect (Supplement Figure 4). BL-CFC identity was confirmed with a gene
expression panel, the majority showing CD34 and the lack of brachyury expression characteristic
of BL-CFC (Kennedy et al. 1997, Choi et al. 1998), and functional CFC and EC assays
(Supplement Figure 4B,C). Kinetic analysis of BL-CFC activity in our cultures showed a peak
at day 4-4.5 of differentiation (data not shown). Together this data suggests that VEGF-mediated
signaling (either direct or mediated by hypoxia) acts to increase the hemogenic mesoderm pool
during the first 4-5 days of differentiation.
Figure 2.3. Control of Flk-1 activation affects CFC and EC output in a developmental
stage-specific manner. Comparison of wild type CFC or EC generation in response to treatment
patterns in normoxia. Treatments were normalized with respect to the unsupplemented control media,
and only continuous SU1498 treatment affected cell proliferation (approx. 0.3-fold Control). Treatments
included continuous SU1498 Flk-1 kinase inhibitor (SU0-7), VEGF supplied for the first five days of
culture (V0-5), continuously (V0-7) or from day 5-7 (V5-7), and VEGF for five days followed by
SU1498 (V0-5 SU5-7) as indicated on the x-axis (A). * Indicates a significant difference between the
treated condition and untreated controls (p < 0.02, n ≥ 3); # indicates a significant difference between the
indicated treatment condition and VEGF d0-5 (p < 0.05, n ≥ 3). A representative blast colony is shown
after four days of growth in the blast assay (Bi). Single cells were plated into blast media at
60000 c/35mm plate from d2.5-4.5 EBs. Scale bar = 100 µm. Cells from day 4 EBs cultured in hypoxia
produced more BL-CFC than in normoxia (Bii). Cells were plated at 100000 c/dish and bars indicate
standard deviation of a representative experiment. Representative EC morphology after fixation and
PECAM staining on day seven of the indicated treatments (C). R1 cells were treated for 7 days as
indicated in each of the headings (Ci-vi) while the Flk-1-/- cell line was used as a negative control in
untreated media (D). Scale bar = 500 µm.
59
60
Striking differences in EC outgrowth morphology were also observed as a function of VEGF
activation or inhibition. Baseline levels of EC development were observed in wild type ESCs
cultured in serum (Figure 2.3Ci), while Flk-1-/- ESCs showed little EC development
(Figure 2.3D), a result also seen when wild type ESCs were treated with SU1498 continuously
(Figure 2.3Cii). Highly branched EC networks arose from VEGF-treated cultures with
continuous VEGF supplementation (Figure 2.3Civ), or from days 5-7 only (Figure 2.3Cv). The
presence of VEGF early in culture (day 0-5), followed by Flk-1 inhibition by SU1498 resulted in
the generation of only compact areas of ECs (Figure 2.3Cvi).
2.3.5 Controlling Flk-1 activation of primary E7.5 derived cells alters hematopoietic and endothelial outputs in a manner similar to that observed in EB differentiation
Thus far our results have been limited to ESC differentiation. Although an interesting and useful
model system, we next sought to determine if the stage dependent control of Flk-1 activation
could elicit similar fate changes in primary cells. We established ex vivo cultures from wild type
E7.5 embryos. This developmental stage corresponds to day 4-5 EBs (Keller 2005), and allowed
us to evaluate fate decisions in response to Flk-1 activation or inhibition. CFC development
from this cell source consisted primarily of monocyte and erythroid colonies (Figure 2.4A). A
dose-dependent enhancement in CFC number per embryonic-derived input cell was obtained
from the loosely-adherent layer of embryonic cells treated with Flk-1 antagonists
(Figure 2.4Bi,ii). In contrast, exogenous VEGF resulted in a significant dose-dependent
suppression of CFC output (Figure 2.4Biii). Strikingly, an opposite effect was seen in the
analysis of EC development where the Flk-1 antagonists (mFlt-1-Fc and SU1498) suppressed EC
output (Figure 2.4Ci,ii), while VEGF enhanced EC output while (Figure 2.4Biii). Visual
inspection showed that VEGF enhanced outgrowth and branching from EC colonies, whereas the
mrFlt-1-Fc and SU1498 treatments repressed this growth (Figure 2.4D). The differences in the
branching morphology of the ECs in response to altered Flk-1 signaling is consistent with earlier
observations of vessel formation in the EB system (Roberts et al. 2004).
61
Figure 2.4. Modulation of hematopoietic and endothelial development from primary
embryo-derived cells as a function of altering Flk-1 activation and inhibition. Cells from
E7.5 embryos were cultured on OP9-GFP feeders for five days. Representative myeloid and erythroid
colonies from E7.5 cultures are shown (A). Cells were treated with mrFlt-1-Fc (Bi), SU1498 (Bii), or
VEGF (Biii) at various concentrations to modulate development in a manner similar to the EB system.
CFC capacity, in comparison to untreated controls, was enhanced by treatment with Flt-1-Fc (0.1, 0.3, 1.0
µg/ml) or SU1498 (0.25, 0.5, 1.25 µg/ml). Conversely, VEGF treatment (10, 25, 40 ng/ml) diminished
CFC capacity. * Indicates a significant difference between treatment and control conditions (p < 0.05),
n ≥ 3. The adherent layers of the cultures were stained for PECAM and imaged using quantitative
immunofluorescence to quantify the EC coverage. Flt-1-Fc (Ci) and SU1498 (Cii) supplementation
decreased EC generation while VEGF (Ciii) treatments enhanced EC formation compared to untreated
controls * Indicates significant differences between treatment and control EC coverage (p < 0.05), n ≥ 3.
Two representative fields illustrating the EC treatment response are shown (D). The EC network was
enhanced with VEGF treatment, and reduced with Flk-1 antagonists, SU1498 and Flt-1-Fc, in comparison
to untreated control cultures Nuclear dye (Hoechst): blue, OP9-GFP cells: green, PECAM-Cy5+ ECs:
red. Scale bar = 100 µm.
62
63
2.3.6 Over-expression of Flt-1-Fc in vivo disrupts vascular and hematopoietic development
We have observed that oxygen modulates the timing and extent of sFlt-1 and Flk-1 expression;
and that the temporal modulation of Flk-1 activation by sFlt-1 can influence blood and
endothelial development in vitro and ex vivo. The in vivo relevance of the proposed model is
supported by the phenotypes of embryos with deficient Flk-1 signaling, such as Flk-1-/-, Vegfa+/-
and Vegfa-/- mice (Shalaby et al. 1995, Carmeliet et al. 1996, Ferrara et al. 1996) and Vegfalo/lo
hypomorphs (Damert et al. 2002). Controlling the oxygen concentration of developing embryos
was not feasible, thus we perturbed the natural balance of factors in our proposed mechanism and
analyzed the effects of expressing the extracellular domain of Flt-1 (Flt-1-Fc (Ferrara et al. 1996,
Gerber et al. 1999, George et al. 2007)) in transgenic mice (Huckle and Roche 2004). We
confirmed the presence of the involved factors in E9.5 wild type and mutant embryos
(Figure 2.5A).
The phenotype of the Flt-1-Fc expressing embryos recapitulated the VEGF-/- phenotype
(Carmeliet et al. 1996), demonstrating a severe reduction of vasculature as observed from
wholemount images (Figure 2.5B) or by PECAM expression in the embryo proper (Figure 2.5C)
and yolk sacs (Figure 2.5D). The reduction of hematopoietic development was quantitatively
demonstrated with a significant difference in ME-CFCs from E8.5 yolk sacs; wild type animals
generated 88.9 ± 11.5 colonies/10000 YS cells while Flt-1-Fc mice generated 2.3 ± 2.4 colonies
(p < 0.0001, Figure 2.5E). This is consistent with the significant reduction in CFC observed in
the VEGF-/- and the SU1498 treated ESC (Figures 2.2 and 2.3). Additionally, sections of the
mutant embryos demonstrated the lack of the dorsal aorta (DA) and absence of hematopoietic
cells (Figure 2.5F). Together, the over-expression of Flt-1-Fc in the early embryo appears to
strongly counteract the effect of endogenously produced VEGF leading to lethality at E9.5.
64
Figure 2.5. Flt-1-Fc overexpression mimics loss of Flk-1 activation in vivo. RT-PCR of
VEGF, Flk-1, sFlt-1, and Flt-1 for E9.5 wild type (WT) and mutant embryos (Mut). Placenta
(Pl) was used as the positive control (A). Wholemount E9.5 embryos of wild type control and
mutant (Flt-1-Fc over-expression) are shown (B). The mutants demonstrate reduced growth and
do not survive to term. PECAM (in red) highlights the absence of a structured developing
vasculature in the embryo proper (C) and the yolk sacs (D) of mutant embryos compared to wild
type littermates. CFC generated from 3 individual yolk sacs are shown (*, P <0.00001) (E).
Histological sections through the embryos depict the reduced caliber of the dorsal aorta in the
caudal aspect in mutant embryos in contrast to wild type littermates (F). Abbreviations: DA-
dorsal aorta. Scale bar = 100 µm.
65
2.4 Discussion Our results reveal dual roles for Flk-1 signaling that manifest at different stages of development
and in response to changing microenvironments. During early embryogenesis, VEGF production
results in Flk-1 activation and signaling that induces expansion of hemangioblasts prior to
embryonic day 7.5 or day five in hypoxic culture of EBs in vitro. Flk-1 activation is not
inhibited at this stage due to the lower expression of sFlt-1 relative to VEGF (summarized in
Figure 2.6). After this time, a larger number of HPCs are generated due to competitive inhibition
of VEGF by sFlt-1 and the resultant decrease in Flk-1 activation. If Flk-1 activation remains
high, a substantial network of endothelial cells is promoted.
sFlt-1 acts as an effective signaling modulator by regulating the availability of free VEGF in the
microenvironment (Hirashima et al. 2003, Roberts et al. 2004), leaving Flk-1 as the primary
signaling receptor for VEGF (Zachary and Gliki 2001, Takahashi and Shibuya 2005). The
development of hemogenic mesoderm and the resulting differentiation into its derivative tissues,
depend on both the level and timing of Flk-1 signaling. This was clearly demonstrated by the
early lethality of Flt-1-Fc over-expressing transgenic embryos by their deficiency in
hematopoiesis and vasculogenesis. We detected increasing levels of sFlt-1 in the media
supernatant during the EB differentiation assay and demonstrated that after day five inhibition of
Flk-1 signaling favoured CFC generation, whereas high levels of signaling enhanced ECs
(Figure 2.3A). Similar responses were seen from E7.5 cells following five days of Flk-1
inhibition or exogenous VEGF treatments on a hematopoietic supportive stroma (Figure 2.4).
Thus, sFlt-1 was an effective VEGF sink and reduced Flk-1 signaling in both the EB and ex vivo
system effectively enhancing HPC outputs. In contrast to the almost complete suppression of
CFCs from mutant E9.5 yolk sacs (Figure 2.5E), differentiating Flt-1-Fc ESCs did not suppress
hematopoietic progenitor cell generation and in fact, enhanced CFCs in hypoxia. Although we
do not fully understand these differences, we can speculate that changes in protein expression
and secretion profiles, ECM capture / diffusion effects and/or cell migration effects will
influence the competitive balance sFlt-1 mediated inhibition and Flk-1 activation. The mutant
embryos have enhanced mRNA expression of VEGF (Figure 2.5A; qRT-PCR data not shown)
and the production of Flt-1-Fc by ESCs may take some time before it is capable of blocking
66
signaling, thus acting more like the VEGF / SU1498 treatments (Figure 2.3A) to boost CFC
output. Further in vivo and in vitro studies are required to understand this apparent disparity.
Figure 2.6. Schematic of the proposed model. As demonstrated, hypoxia increases VEGF
production which positively effects the generation of hemogenic mesoderm. The cell output or
fate is then modulated through the competition of sFlt-1 for VEGF and the resultant effects on
Flk-1 signaling. High signal promotes endothelial cells whereas low signaling promotes
hematopoietic progenitors. The competitive balance is affected by VEGF, and sFlt-1
concentrations as well as Flk-1 expression.
67
Vasculogenesis is described as the de novo formation of blood vessels (Risau et al. 1988),
whereas angiogenesis is typically described as the generation of new vessels from existing
vessels driven by EC proliferation (Folkman and Haudenschild 1980). We and others (Giles et
al. 2005) have noted that VEGF positively affects EC specification from the hemogenic
mesoderm through Flk-1 signaling; under sustained VEGF supplementation cells differentiate
robustly into ECs. We suggest that Flk-1 signaling inhibits generation of blood and stimulates
EC generation from hemogenic mesoderm. The VEGF signaling pathway is also important in
regulating EC proliferation and branching morphogenesis (Zeng et al. 2007). Early restriction of
Flk-1 signaling activity during differentiation formed dense masses of endothelial cells that
underwent minimal branching morphogenesis (Figure 2.3Ci,ii). These dense masses were also
apparent when initially high Flk-1 signaling activity was followed by signaling inhibition
(Figure 2.3Ciii,vi). Additionally, ECs/angioblasts may develop independently from the
hemangioblast (Furuta et al. 2006). We may have observed this phenomenon when low Flk-1
activation was followed by VEGF treatment (day 5-7; Figure 2.3Cv). Cells that developed in a
largely VEGF independent manner (normoxic control) were still capable of differentiating into
branched EC networks.
We propose that the inhibition of Flk-1 signaling in hemangioblasts allows these cells to produce
blood progenitors. This result is consistent with earlier evidence that VEGF–treated Flk-1+
mesoderm generates ECs at the expense of hematopoietic commitment in an avian model
(Eichmann et al. 1997). We demonstrate that hypoxia can control this Flk-1 inhibition in a
sFlt-1-dependent manner. Coupling this with earlier observations that Flt-1 expression level is
differentially regulated both spatially and temporally during development (Fong et al. 1996), we
suggest that in its soluble form Flt-1 regulates induction of hematopoiesis. It has already been
proposed that a continuum of Flk-1 expression underlies blood and endothelial cell specification
(Ueno and Weissman 2006); to this model we overlay microenvironmentally controlled Flk-1
activation to the same (as yet undefined) signaling threshold–mediated transcriptional
mechanisms to specify these cell types. The difference in early (mesoderm initiation) versus late
(mesoderm specification) Flk-1 signaling likely results from differences in the identity of the
Flk-1-expressing cell populations at these developmentally distinct times. The earliest Flk-1+
EB-derived cells have been shown to express Brachyury and form BL-CFC (Fehling et al. 2003),
an expression pattern and capacity that is lost in time both in the EB and embryo (Kennedy et al.
68
1997, Choi et al. 1998). Flk-1+ cells from the emerging hemangioblast population at E7.5, have
the capacity to differentiate into hematopoietic and endothelial cells (Nishikawa et al. 1998). We
have demonstrated that Flk-1 signaling after day five in the EB system or following E7.5 primary
cell explant either inhibited HPC specification or expansion. The later scenario is unlikely as
Flk-1 expression is rapidly lost upon commitment to the hematopoietic lineage (Eichmann et al.
1997, Nishikawa et al. 1998), and Flk-1 activation prior to its loss is necessary for HPC
migration to sites supporting their survival and proliferation (Schuh et al. 1999).
In hypoxic conditions, VEGF was able to bind Flk-1 with minimal inhibition until day five, after
which VEGF was competitively bound by Flk-1 and sFlt-1. This pattern of Flk-1 activation and
inhibition was demonstrated to enhance CFC generation. The localized regulation of these
factors may be important in establishing the hemogenic niche. In fact, this mechanism would
allow for the independent (microenvironmentally-controlled) initiation of hemogenic niches in
different parts of the embryo. Alternative splicing of VEGF gives rise to several isoforms,
differing in their expression patterns, biochemical biological properties (Olsson et al. 2006), and
affinity for extracellular matrix (ECM) (Poltorak et al. 1997, Goerges and Nugent 2004). The
complexity and regulatory scope of this conceptual model must be extended to include other
molecules such as placental growth factor (competes with VEGF to bind Flt-1 and thus promotes
Flk-1 activation (Mac Gabhann and Popel 2004)) and other niche-related local control
mechanisms. VEGF-independent pathways may also be involved in hypoxia enhanced HPC
generation as VEGF-/- and Flk-1-/- ESCs were capable of modest enhancement (Figure 2.2Ai).
Our findings demonstrate that sFlt-1 is a vital modulator of VEGF availability and suggest that
VEGF gradients and temporal regulation of Flk-1 signaling are important to ESC-derived
hematopoiesis. Microenvironmentally regulated (Dai et al. 2007, Levesque et al. 2007, Parmar
et al. 2007) competition for Flk-1 activation may continue to impact and maintain hematopoietic
supportive microenvironments or conversely, avascular areas (Ambati et al. 2006), throughout
life in both normal and pathological conditions (Inoue et al. 2000, Wierzbowska et al. 2003).
69
2.5 Acknowledgements We thank D. van der Kooy for manuscript review, C. Park and M. Lynch-Kattman for advice on
the BL-CFC assay and G.H. Fong for the Flt-1-/- cells. P.W.Z. is a CRC in Stem Cell
Bioengineering and A.N. is a CIHR Senior Scientist. This work was accomplished with support
from NSERC, CIHR, NCIC, and OGSST. The authors have no potential conflict of interest to
disclose.
70
2.6 Supplementary Figures
Supplementary Figure 1. Gene expression analysis of the expression of VEGF and its
receptors during ESC differentiation. Samples were taken at day 3, 5 and 7 from cells cultured in
hypoxic or normoxic bioreactors and qRT-PCR was performed.
71
Supplementary Figure 2. sFlt-1 in the supernatant. Supernatant samples were collected from
hypoxic and normoxic bioreactors for seven days and analyzed for sFlt-1 by ELISA. Five
representative experiments are shown.
Supplementary Figure 3. Phosphorylation of Flk-1 in different conditions. Western blot
analysis showing VEGF (25ng/ml) mediated Flk-1 phosphorylation and SU1498 (5 µg/ml)
specific inhibition of Flk-1 phosphorylation in wild type day five EBs grown in serum. Flk-1-/-
cells with VEGF were used as a negative control. Abbreviations: L-ladder; Co-control (serum);
SU-SU1498; S+V-SU1498+VEGF; V-VEGF.
72
Supplementary Figure 4. Hypoxia or exogenous VEGF treatment positively effect
hemangioblasts. Cells were plated at 100000 c/dish and bars indicate standard deviation of a
representative experiment. VEGF (25 ng/ml) supplementation during EB differentiation stimulates BL-
CFCs in normoxia over control conditions (A). RT-PCR of early developmental markers from individual
blast colonies (labeled 1-4) picked after four days in the blast assay (B). E8.5 cells were used as positive
control and water was the negative control. Representative colony demonstrating hematopoietic and
endothelial morphology (C) four days after re-plating a day 4 blast colony in hemogenic-endothelial cell
supportive media (Ci), in contrast to a picked secondary EB (Cii). Scale bar = 100 µm.
.
Chapter 3
Analysis of the Temporal and Concentration-Dependent Effects of BMP-4, VEGF and Tpo on the Development of
Embryonic Stem Cell-Derived Mesoderm and Blood Progenitors in a Defined, Serum-Free Media
This chapter has been published in Experimental Hematology (2008) Sep;36 (9):1186-98. Epub
2008. Collaborators include Jennifer Morin, and Peter Zandstra.
Author Contributions:
Kelly A. Purpura- Conception and design, collection and/or assembly of data, data analysis and
interpretation, manuscript writing, final approval of manuscript; Jennifer Morin- conception and
design, collection and/or assembly of data, manuscript writing; Peter W. Zandstra- conception
and design, data analysis and interpretation, manuscript writing, final approval of manuscript.
73
74
3.0 Abstract Objective: To develop a robust serum-free (SF) system for the generation of hemogenic
mesoderm and blood progenitors from pluripotent cells.
Methods: ESCs maintained in N2B27 supplemented with leukemia inhibitory factor (LIF) and
bone morphogenetic protein (BMP)-4 were induced to differentiate into Brachyury/T expressing
cells (measured using a GFP reporter) and myeloid-erythroid colony forming cells (ME-CFCs),
by removing LIF, changing the base media formulation, and via the time- and concentration-
dependent addition of other factors.
Results: The presence of 10 ng/ml BMP-4 permitted the emergence of cells expressing T and the
vascular endothelial growth factor receptor (VEGFR)-2, however, less than 5 % of the cells were
double positive on day 4. Adjusting the SF media formulation allowed only 5 ng/ml of BMP-4
to yield 24 ± 4 % T-GFP+VEGFR-2+ cells by day 4. These cells could develop into ME-CFC,
producing 4.4 ± 0.8 CFC per 1000 cells at day 8. We also examined the timing and
concentration sensitivity of BMP-4, VEGF and thrombopoietin (Tpo) during differentiation.
BMP-4 with 50 ng/ml of Tpo generated 232 ± 48 CFC per 5 x 104 cells, similar to the serum-
control, and this response could be enhanced to 292 ± 42 CFC per 5 x 104 cells by early (between
day 0-5), but not late (after day 5) VEGF treatment.
Conclusion: Moving to SF systems facilitates directed differentiation by eliminating
confounding signals. This paper describes modifications to the N2B27 media that amplify
mesoderm induction and extends earlier work defining blood progenitor cell induction from ESC
with BMP-4, VEGF and Tpo.
75
3.1 Introduction Embryonic stem cells (ESCs) are capable of extensive proliferation and can differentiate into all
cell lineages in the body. They have been shown to produce cardiomyocytes, dopaminergic
neurons, insulin producing cells and hematopoietic cells; with potential applications for cell and
tissue-based therapy. The generation of appropriate numbers of target cells relies on our ability
to develop bioprocesses capable of producing and manipulating cell fates (Dang and Zandstra
2005). To manipulate cell fate, we must first understand the required signals. The presence of
serum in standard differentiation media introduces variability and molecules into the system that
may interfere with the analysis of the effects of signaling factors on ESC differentiation
(Johansson and Wiles 1995). Therefore, to efficiently and reproducibly control cell fate, serum-
free systems are required. Additionally, future cell therapy will likely use ESC-derived cells or
induced pluripotent stem cells (iPSC) maintained and differentiated in a serum-free system; the
lack of controlled differentiation is currently one of the major barriers to their use in translational
applications.
The first chemically defined medium (CDM) reported to maintain ESCs in the absence of serum
consisted of Iscove’s Modified Dulbecco’s Medium (IMDM) plus Ham’s F12 medium
supplemented with known quantities of bovine serum albumin (BSA), glutamine,
monothioglycerol (MTG), insulin, transferrin, and lipids (Johansson and Wiles 1995, Wiles and
Johansson 1997, Ying et al. 2003). In this system, ESC differentiation was responsive to
exogenous factors allowing detailed investigation of mesoderm formation and its subsequent
development. Of note, blood development was monitored in the presence of heparin, activin A,
BMP-4, TGF-β1, TGF-β2, TGF-β3, basic FGF, acidic FGF, erythropoietin (Epo), IL-11, and/or
IL-6. It was found that βH1 mRNA (indicative of primitive erythrocytes) was detected only in
conditions supplemented with 2.0±0.5 ng/ml BMP-4, though βH1 mRNA expression levels were
lower than in serum-containing media (Johansson and Wiles 1995).
In recent years many studies have replaced fetal calf serum (FCS) with Knockout-Serum
Replacement (KO-SR), a commercial serum-free substitute (Nakayama et al. 2000, Adelman et
al. 2002, Kubo et al. 2004, Park et al. 2004), which allows the formation of ES-derived
hematopoietic progenitors or colony forming cells (CFCs). In this system, blood development
can be induced in the presence of different combinations of BMP-4, VEGF, SCF, erythropoietin
76
and thyroid hormone (Adelman et al. 2002). However, KO-SR contains many components that
cannot be altered, rendering serum-free media composition optimization difficult. As a starting
point for our study we used ESCs maintained in N2B27 supplemented with BMP-4 (Kingsley
1994) and LIF (Niwa 2001, Chambers 2004), a recently defined serum-free system that generates
highly enriched populations of undifferentiated ESCs (Ying and Smith 2003). This media
composition was amenable to independent manipulation and investigation, and a complete listing
of the composition of Neurobasal media, N2, and B27 has been published previously (Price and
Brewer 2001). In serum-free cultures, ESCs readily differentiate to neuroectoderm (Wiles and
Johansson 1999), however, the addition of LIF can reduce neural (Ying and Smith 2003) and
mesendoderm differentiation (Johansson and Wiles 1995, Ying and Smith 2003). BMP mediated
Inhibitor of differentiation (Id) gene induction also inhibits neuroectoderm lineage formation
(Finley et al. 1999) but promotes mesoderm differentiation (Johansson and Wiles 1995).
Overall, the actions of LIF and BMP-4 are balanced in supplemented N2B27 such that self-
renewal is stimulated and differentiation is inhibited.
Mesoderm differentiation and blood development occurs through a series of steps which can be
monitored through the expression of transcription factors such as Brachyury/T (Kennedy et al.
1997, Fehling et al. 2003) or cell surface antigens including VEGFR2 (Kabrun et al. 1997,
Hidaka et al. 1999), CD34 (Brown et al. 1991), and CD41 (Mitjavila-Garcia et al. 2002). In
addition to these phenotypic markers, committed hematopoietic progenitor cells (HPCs) can be
quantified using the retrospective colony-forming cell (CFC) assay. Together these methods
were used to monitor the cellular response to N2B27 media modification and exogenous BMP-4,
VEGF and Tpo supplementation at different concentrations and stages of ESC differentiation.
Our results indicate that modified N2B27 media can be employed as a serum-free platform for
mesoderm induction and that early VEGF treatment (day 0-5) in the presence of BMP-4 and Tpo
can enhance HPC production. This serum-free system provides a foundation for future
investigations into controlled differentiation and translational applications with ESCs and future
studies may show its extension to iPS cells.
77
3.2 Materials and Methods
3.2.1 Maintenance of ESCs
The R1 (Nagy et al. 1993) and Brachyury/T (T)-GFP (derived from 129/Ola cell line with GFP
cDNA targeted to the T locus) (Fehling et al. 2003) mouse embryonic stem cell lines were
maintained in 37°C humidified air with 5 % CO2 on 0.2 % bovine skin gelatin- (Sigma, St.
Louis, MO) coated culture flasks (Sarstedt, Newton, NC). Standard ESC maintenance media,
comprised of Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 15 % ES-
qualified fetal bovine serum (FBS, Invitrogen, Carlsbad, CA), 50 U/ml penicillin (Invitrogen), 50
μg/ml streptomycin (Invitrogen), 0.1 mM β-mercaptoethanol (Sigma), 2 mM L-glutamine
(Invitrogen), 0.1 mM non-essential amino acid (Invitrogen), 1 mM sodium pyruvate (Invitrogen),
and 500 pM leukemia inhibitory factor (LIF, Chemicon Temecula, CA) was exchanged daily.
Cells were passaged every second day in ESC maintenance media and used between passages
13-30.
Alternatively, one million cells were seeded in gelatinized T25 flasks in serum-free conditions
using N2B27 (Ying and Smith 2003), 2 mM L-glutamine and 500 pM LIF with or without 10
ng/ml BMP-4 (rhBMP-4, R&D systems, Minneapolis, MN). Media was replaced after two days
and cells were passaged three days after seeding.
3.2.2 ESC Differentiation
To initiate differentiation, ESCs were dissociated using 0.25 % trypsin-EDTA. One million cells
(unless specified) were seeded into 10 cm Greiner petri dishes in 10 ml of ESC differentiation
media, either serum-containing (ESC maintenance media without LIF and sodium pyruvate), or
serum-free (N2B27 (Ying and Smith 2003)) with 2 mM L-glutamine and specified component
alterations. Trypsin-EDTA activity was quenched with serum or DMEM supplemented with
0.25 mg/ml soybean trypsin inhibitor (Invitrogen) dependent on serum conditions. Cytokines
were included as detailed in text: BMP-4 (5 ng/ml unless otherwise specified), VEGF (5, 12.5, or
25 ng/ml, Sigma), and Tpo (25 or 50 ng/ml, R&D Systems).
78
3.2.3 Flow Cytometry
Dissociated cell samples were suspended at a concentration of 106 cells/100 μl in Hank’s
Buffered Saline Solution (HBSS, Invitrogen) supplemented with 2 % v/v FBS (HF). Cells were
incubated for 35 minutes (min) at 4°C with one of the following specified antibodies at
1μg/100μl: PE anti-mouse VEGFR-2 (BD Pharmingen, Mississauga, ON), PE anti-mouse CD34
(BD Pharmingen), FITC anti-mouse CD41 (BD Pharmingen). Negative control cells were
similarly incubated with 1μg/100μl fluorochrome-labelled isotype control antibodies: PE rat
IgG2a,κ (BD Pharmingen) and/or FITC rat IgG1,κ. Stained cells were washed twice in ice cold
HF, and 1μg/ml 7-amino-actinomycin D (7-AAD, Molecular Probes, Eugene, OR) was added to
each sample as an indicator of viability.
To detect intracellular protein, cells were treated with IntraPrepTM Fixation Reagent A and
Permeabilization Reagent B (according to the manufacturer's instructions, Immunotech,
Marseille, France). Samples were incubated with 2.5 μg/ml mouse anti-Oct-3/4 monoclonal
antibody (BD Biosciences Transduction Laboratories) for 20 min. Cells were washed twice with
HF and then incubated for 20 min with 1 μl/100 μl FITC-conjugated goat anti-mouse IgG F
(ab’)2 antibody (Sigma). Stained samples were washed twice with HF before analysis.
The cells were analyzed on a Coulter Epics XL machine using EXPO32 ADC 1.1 software
(Beckman Coulter, Sacramento, CA). Positive staining was defined as the fluorescent emission
exceeding 99.5 % of the negative control cells from the same population.
3.2.4 Embryoid Body (EB) Formation Assay
We employed the assay described by Palmqvist et al. (Palmqvist et al. 2005) as a surrogate in
vitro assay of undifferentiated ESC cell numbers. Briefly, single cell suspensions were seeded at
500-2 x 105 cells (depending on the time of differentiation) in 35 mm Greiner dishes in ESC
differentiation methylcellulose medium: 0.9 % methylcellulose (Fluka, Biochemistry), 15 %
FBS, 2 mM L-glutamine, 150 μM MTG (Sigma), and 40 ng/ml murine stem cell factor (SCF,
R&D Systems). EBs were scored based on their morphology and development potential
following 5-6 days in culture and % EB formation was calculated based on the number of input
cells.
79
3.2.5 Colony Forming Cell (CFC) Assay
5 x 104 cells were seeded in 35 mm Greiner dishes containing 1 ml of methylcellulose based
M3434 (Stem Cell Technologies) and scored by morphology 7 days after plating, as previously
described (Dang et al. 2002).
3.2.6 Blast (BL-) CFC Assay
Hemangioblast production was examined using the standard BL-CFC assay (Choi et al. 1998),
which employs screened serum (10 %), 15 % D4T conditioned media, 5 ng/ml VEGF and 100
ng/ml kit ligand in a 1 % methylcellulose-IMDM mix also containing MTG (4 x 10-4 M Sigma),
ascorbic acid (50 μg/ml), and iron-saturated transferrin (200 μg/ml, Roche). Cells were
dissociated using TrypLE (Gibco BRL), washed and plated at 105/35 mm Greiner dish. Colonies
were scored/photographed 4 days after plating and individual blast colonies were picked and
cultured further, as previously described (Choi et al. 1998), to confirm their potential for
hematopoietic and endothelial cell lineages.
3.2.7 RT-PCR
Total RNA was quantified by a UV spectrophotometer with the use of GenEluteTM Mammalian
Total RNA Miniprep Kit (Sigma), following a manufacturer-provided protocol. RT-PCR
reactions were carried out using the One-Step RT-PCR kit (Quiagen, Mississauga, ON) utilizing
the following primers and annealing temperatures: T forward primer, 5’-
TCCAGGTCGTATATATTGCC-3’; T reverse primer, 5’-TGCTGCCGTTGAGTCATAAC-3’,
50°C; HNF3-β forward primer, 5’-ACCTGAGTCCGAGTCTGAC-3’; HNF3-β reverse primer,
5’-GGCACCTTGAGAAAGCAGTC-3’, 54°C; Sox-1 forward primer, 5’-
CCTCGGATGTCTGGTCAAGT-3’; Sox-1 reverse primer, 5’-
TAGACAGCCGGCAGTCATAC -3’, 53°C; VEGFR-2 forward primer, 5’-
TAGGTGCCTCCCCATACCCTGG -3’; VEGFR-2 reverse primer, 5’-
TGGCCGGCTCTTTCGCTTACT -3’, 60°C. PCR amplification consisted of 30 cycles: 1 min
denaturation at 95°C, 1 min annealing at the temperature indicated above, and 1 min extension at
72°C. Actin (forward primer 5’-AGGGGCCGGACTCATCGTACTC-3’; reverse primer 5’-
80
GTGACGAGGCCCAGAGCAAGAG-3’, 60°C) was used as a template integrity control. The
amplified cDNA products were run on a 1 % agarose gel.
3.2.8 Statistical Analysis
Statistical analyses were performed using GraphPad Prism version 5.01 for Windows, GraphPad
Software, San Diego California USA, www.graphpad.com. Experiments measuring differences
between media conditions and multiple treatments were assessed using one-way ANOVA with
Dunnett’s post test (Figures 3.3-3.5). Experiments using one or more base media conditions, and
different treatment times were assessed using two-way ANOVA with Bonferroni post tests
(Figure 3.6). All data are reported as mean ± standard deviation from at least three independent
replicates or as indicated.
81
3.3 Results
3.3.1 ESC maintenance in N2B27 serum-free defined media
The serum-free system developed by Ying et al. (Ying and Smith 2003) has also been employed
to evaluate small molecules for mESC self-renewal (Chen et al. 2006) and to screen human ESC
media (Liu et al. 2006b). We demonstrate undifferentiated ESC expansion with mouse (R1)
ESC cells. Adherent cell growth in N2B27 media led to an 8-10-cell fold increase every three
days (Figure 3.1A), with a slight reduction in growth rate through initial passage (Figure 3.1B).
LIF and BMP-4 effectively maintained Oct-4 expression (Figure 3.1C) and pluripotency
(Figure 3.1D). The reduced pluripotency of day 2 and 4 differentiated EBs, a consequence of
differentiation is shown for comparison. Additionally, four days after reintroduction into serum-
containing differentiation media VEGFR-2 (mesoderm), Sox-1 (ectoderm), and HNF3-β
(endoderm) mRNA expression was detected (Figure 3.1E). These markers, representative of the
three embryonic germ layers were also confirmed using the T-GFP 129/Ola ESC line
(Figure 3.1E); ectoderm was less abundant in these conditions. Hematopoietic colony forming
cells (CFC) (Dang et al. 2002) were also detected on day 7 (data not shown). With these
baselines, the next step was to further investigate blood development with this serum-free
defined system.
3.3.2 BMP-4 promotes dose-dependent T and VEGFR-2 expression: differentiation towards hematopoietic progenitor cells in N2B27 serum-free defined media
The T-GFP 129/Ola ESC line has been used to illustrate that early blood development progresses
through the following stages: T-GFP-VEGFR-2- (Oct-4+), T-GFP+VEGFR-2-, and
T-GFP+VEGFR-2+ (Fehling et al. 2003). The latter two phenotypes where shown to have
enriched mesoderm and hemangioblast containing cell populations, respectively (Fehling et al.
2003). We used this phenotypic expression pattern to follow early blood development in our
serum-free system in the presence of various cytokines. EBs differentiated in N2B27 media
alone generated less than 1.5 ± 0.7 % T-GFP+ cells, and VEGFR-2+ cells were not detected
during the 7-day time course (Figure 3.2). As BMP-4 has been shown to promote mesodermal
82
Figure 3.1. BMP-4 and LIF allow cell expansion and maintain the undifferentiated cell
phenotype in N2B27 media. A: Every 3 days, viable cell number was measured by trypan blue
exclusion from the N2B27+LIF+BMP-4 condition and cells were reseeded at 2 x 106 cells/ T-25 flask. B:
The growth rate at the time of passage was calculated and shown for serum and the N2B27+LIF+BMP-4
condition. C: Percent Oct-4 expression was measured by flow cytometry every 3 days in the LIF+BMP-4
supplemented culture. D: Percentage of EB formation performed at various times on R1 ESCs
differentiated from cells maintained in serum-containing culture or N2B27+LIF+BMP-4 for 15 days. E:
VEGFR-2, Sox-1, and HNF3-β mRNA expression was detected by RT-PCR for R1 and T-GFP 129/Ola
cells maintained for 15 days in N2B27+LIF+BMP-4 or differentiated for 4 days in serum-containing
media. Groupings from different parts of the same gel or from different gels are indicated by black
dividing lines.
83
differentiation (Johansson and Wiles 1995), we first applied BMP-4 (2, 5, or 10 ng/ml) during
the first four days of differentiation and observed the induction of T and VEGFR-2 expression
(data not shown). Consequently, we employed the highest concentration of BMP-4 to monitor
the development of the mesoderm phenotype in culture.
The addition of BMP-4 (10 ng/ml) to the media promoted statistically significant increases (p ≤
0.002) in T-GFP+ and T-GFP+VEGFR-2+ frequencies between days 3-6 and 4-6, respectively,
compared to no cytokine addition (Figure 3.2). The kinetics of T-GFP and VEGFR-2 expression
were similar for cells cultured in BMP-4 supplemented serum-free and serum-containing media
(Figure 3.2B,C). T-GFP expression was first detected in EBs on day 3 of differentiation and
dramatic increases followed with a maximal frequency of 76 ± 5 % T-GFP+ cells on day 4 in
serum, and 63 ± 13 % on day 5 in serum-free media (Figure 3.2B). The T-GFP+VEGFR-2+
population was observed to peak at day 5 for both serum and serum-free conditions, 31±6% and
12 ± 3 % respectively (Figure 3.2C). Thus, our results confirm that BMP-4 can promote T-GFP
and VEGFR-2 expression, indicative of early blood development. However, when compared to
serum-containing media, N2B27 serum-free media with BMP-4 produces a lower frequency of
VEGFR-2 expression. In order to optimize T-GFP+VEGFR-2+ production, we hypothesized that
components in the serum-free media are not optimal or may even prevent mesodermal
development and that other cytokines may be required. The likely suboptimal candidates in
N2B27 are Neurobasal medium (NbM) and B27 supplement (B27), which have been used to
support neuronal growth (Brewer et al. 1993). As the kinetics did not appear to change between
conditions with peak frequencies for T-GFP and VEGFR-2 occurring on days 4 and 5, we used
these time points to compare the effect media alteration or of exogenous cytokines on early
blood development.
84
Figure 3.2. Phenotypic expression of developing EBs cultured in N2B27 media
supplemented with or without 10 ng/ml BMP-4 or serum control. A: VEGFR-2 and T-GFP
expression was monitored during six days of differentiation with each row specifying the media
treatment. Within each individual plot, the X-axis represents the fluorescent intensity of T-GFP cells,
while the Y-axis represents fluorescent intensity of cells stained with anti-VEGFR-2-PE. B: Percentage of
T-GFP expression as a function of time. C: Percentage of T-GFP+VEGFR-2+ cells as a function of time.
85
3.3.3 Development of serum-free mesodermal enhancing media
To determine whether B27 and/or NbM negatively affect (s) mesoderm development, these
components were removed from N2B27 media (Figure 3.3). When B27 supplement was
removed from N2B27 media (“N2” condition) T-GFP expression remained the same (63 ± 6 %
p=0.605), whereas VEGFR-2+ (18 ± 5 %, p=0.049), and GFP-T+VEGFR-2+ (17 ± 5 % p=0.050)
expression increased. Similarly elevated levels of expression were observed when both B27
supplement and NbM were withdrawn from N2B27 (“N2-NbM” condition) (Figure 3.3A).
These results suggest that the presence of B27 supplement blocks the generation of VEGFR-2
expressing cells. In addition to phenotypic expression, total cell expansion was measured after 4
days in culture using trypan blue exclusion. In the absence of B27 or of both B27 and NbM, cell
proliferation was significantly reduced with 0.9±0.2 (p=0.026) and 0.7±0.3 (p=0.026) cell-fold
expansion, respectively, in comparison to N2B27 media (Figure 3.3B). Phenotypic expression
was combined with the proliferative output to provide the number of T-GFP+ cells generated per
input ESC by day 4 in N2 and N2-NbM medias (0.8 ± 0.1 and 0.6 ± 0.2, respectively). These
yields were substantially lower (p=0.012) than the 9 ± 1 T-GFP+ cells per input ESC observed in
N2B27 media (Figure 3.3C). These results suggest that the B27 supplement increases cell
expansion, either by increasing proliferation or decreasing cell death. B27 supplement contains
many antioxidants, such as reduced glutathione, tocopherol (vitamin E), catalase, and superoxide
dismutase, which may play a cell-protective role (Castro-Obregon and Covarrubias 1996).
Antioxidants have been shown to inhibit apoptosis by removing superoxide anion radicals or
hydrogen peroxide and the decreased cell-fold expansion may be caused by the lower levels of
antioxidants following B27 removal. Therefore, we tested whether β-mercaptoethanol (BME,
2mM) could act as a substitute antioxidant and improve viability (the “N2BME” and
“N2BME-NbM” conditions, Figure 3.3).
In the absence of B27 supplement, the addition of BME to the media did not affect the frequency
of T-GFP+ and VEGFR-2+ cells generated (p≤0.089, Figure 3.3A). However, the presence of
BME significantly increased cell output (Figure 3.3B). In the N2BME condition, 11.2 ± 0.2
T-GFP+, 3.6 ± 0.6 VEGFR-2+, and 3.4 ± 0.7 T-GFP+VEGFR-2+ cells were obtained (day 4) per
input ESC (Figure 3.3C). However, BME was unable to maintain cell viability when NbM was
86
Figure 3.3. Removal of B27 and the addition of BME improves the yield of VEGFR-2+ and
T-GFP+VEGFR-2+ cells. Media composed of DMEM, F12, N2 and L-glutamine with (+) or without
(-) Neurobasal medium (NbM), B27 supplement (B27) and β-mercaptoethanol (BME) were tested on day
4 of differentiation for their ability to support T-GFP and VEGFR-2 expression in the presence of 5 ng/ml
BMP-4 (n ≥ 2). A: Percentage of T-GFP and/or VEGFR-2 expressing cells. B: Viable cell fold-increase
determined by trypan blue exclusion. C: Calculated yield of cells expressing T-GFP and/or VEGFR-2 per
input ESC. * and # Indicate a significant difference between the test condition and the N2B27 or FCS
conditions, respectively (p < 0.05).
87
removed. Although T-GFP+ and VEGFR-2+ cell frequencies were not altered (p≥0.443, Figure
3.3A) in the N2BME-NbM condition, a decrease in cell viability was observed compared to
N2B27 or FCS conditions (Figure 3.3B) suggesting that NbM is an important supplement in the
serum-free system. When the yields of all five serum-free conditions were compared the highest
number of T-GFP+, VEGFR-2+, and T-GFP+VEGFR-2+ cells obtained per input ESC were
observed in N2BME, with significantly greater numbers of VEGFR-2+ (p=0.020) and
T-GFP+VEGFR-2+ (p=0.021) cells than in N2B27. This indicates that changes to the serum-free
media composition can dramatically affect cell output. Although total cell yield of VEGFR-2+
and T-GFP+VEGFR-2+ cells were still lower in serum-free media upon comparison to the serum-
containing media (p≤0.049, Figure 3.3C) we have shown that N2BME provides a measurable
improvement to N2B27 in the phenotypic response to exogenous BMP-4.
3.3.4 Serum-free differentiation of ESC
As we planned to use the modified serum-free media to study the effect of various cytokines on
blood development we repeated the dose response to BMP-4 in N2BME as initially tested in
N2B27 media. Interestingly, in N2BME the maximum T-GFP+ and T-GFP+VEGFR-2+ cell
frequencies were generated at a BMP-4 concentration of 5 ng/ml instead of at 10 ng/ml BMP-4
(Figure 3.4A). In N2BME with 5 ng/ml BMP-4, 75 ± 8 % T-GFP+ and 24 ± 4 %
T-GFP+VEGFR-2+ expressing cells were obtained, levels similar to those observed under serum-
containing conditions (p≥0.369). The plateau concentration of 5 ng/ml BMP-4 was used in
subsequent studies, unless specified. Based on the cell phenotype observed, BMP-4 may play a
role in promoting mesoderm and hemangioblast cells. This was confirmed with the blast (BL)-
CFC assay as BL-CFC were morphologically/functionally detected (Figure 3.4B) in the BMP-4
supplemented N2BME serum-free system similar to the serum control (~1/12500 day 4 input
cells).
88
A
Figure 3.4. T-GFP and VEGFR-2 expression changes in response to cytokine
supplementation of N2BME. A: T-GFP and VEGFR-2 expression was measured on day 4 of
differentiation in N2BME serum-free defined media supplemented with different concentrations of BMP-
4. B: Hemangioblasts could also be detected in the serum-free system. EBs were dissociated at day 4 of
differentiation in N2BME+BMP-4 (5 ng/ml), and plated in the standard BL-CFC assay (Choi et al. 1998).
Blasts were identified by morphology 4 days later (~1/12500 cells) and picked to assess hematopoietic
and endothelial cell capacity. Representative colonies of two picked blasts are shown following 4 days
growth. Hematopoietic and endothelial components are apparent in (i) whereas only hematopoietic cells
are apparent in (ii). A secondary CFC assay was completed from individual picked BL-CFC and
representative monocyte/granulocyte (iii) and erythroid (iv) colonies are shown. C: Percentage of
T-GFP+VEGFR-2+ cells obtained by flow cytometry performed on day 4 and day 5 of differentiation in
the presence of 0 or 5 ng/ml of BMP-4; 0, 5, 12.5 or 25 ng/ml of VEGF; 0, 25, 50 ng/ml of Tpo; and 0 or
15 % FCS, as specified on the x-axis. * Indicates a significant difference between the test condition and
5ng/ml BMP-4 (p < 0.05).
89
3.3.5 Effect of cytokines on hematopoietic progenitor cell development
Using a cell density of 1 x 105 cells/ml and 5 ng/ml of BMP-4, we investigated whether the addition
of VEGF (Nakayama et al. 2000, Park et al. 2004) or Tpo (Perlingeiro et al. 2003) could improve the
generation of hemogenic mesoderm; these factors were chosen based on earlier studies
demonstrating that they mediate expansion of hematopoietic and endothelial cell progenitors.
Neither factor effected T-GFP+ and VEGFR-2+ cell frequencies on day 4 (data not shown), however,
by day 5 the presence of VEGF (in the presence of BMP-4) increased T-GFP+VEGFR-2+ expression
in a dose dependent manner (Figure 3.4C). No significant effect was seen on these early
mesodermal markers with the addition of Tpo.
Cultures were carried out until day 8 of differentiation and assessed for hematopoietic progenitor
cells (HPCs); characterized both phenotypically as CD34+CD41+ cells and in functional ME-
CFC assays. We studied the CD41+ population as it has been reported CD41 expressing cells are
capable of generating CFCs, regardless of the CD34 phenotype (Mitjavila-Garcia et al. 2002).
Serum-free media supplemented with 5 ng/ml BMP-4 generated 1.8 ± 0.3 % CD34+CD41+, 7 ± 3
% CD41+, and 129 ± 42 CFCs per 5 x 104 cells and these values were used to normalize the
results of combined and continuously provided factors as summarized in Figure 3.5.
Additionally, to determine whether exogenous BMP-4 was required after T-GFP+VEGFR-2+
formation on day 5, BMP-4 was removed. No significant changes in phenotype or ME-CFC
formation were observed suggesting that exogenous BMP-4 is not required for the further
development of blood progenitors in this system (Figure 3.6E).
The addition of VEGF to BMP-4 cultures did not affect the generation of CD34+CD41+ cells,
CD41+ cells or the number of ME-CFCs (Figure 3.5A,B). However, a significant 6 ± 1-fold
increase in CD34+CD41- cell frequency was observed at high VEGF concentrations (5 ng/ml
BMP-4 + 25ng/ml VEGF; p= 0.001) (Figure 3.5C). Conversely, the addition of Tpo (25 and 50
ng/ml) to BMP-4 cultures did not influence the frequency of CD34+CD41- cells, but significantly
increased the frequency of CD34+CD41+ and CD41+ cells (Figure 3.5A,C).
90
Figure 3.5. The cytokine cocktail effects hematopoietic differentiation as measured
following eight days of treatment. ESC were differentiated in the continuous presence of 0 or 5
ng/ml of BMP-4; 0, 5, 12.5 or 25 ng/ml of VEGF; 0, 25, 50 ng/ml of Tpo; and 0 or 15 % FCS, as
specified on the x-axis for 8 days. A: Percentage of CD34+CD41+ cells, B: percentage of CD41+ cells, C:
percentage of CD34+CD41- cells, as measured by flow cytometry on day 8 of differentiation. D: Number
of CFCs obtained from day 8 differentiated EB cells. * and # indicate a significant difference between
the condition and the 5ng/ml BMP-4 or FCS conditions, respectively (p < 0.05).
91
Of note, 50 ng/ml of Tpo added to BMP-4 generated a similar number of CFCs as the serum-control
(232 ± 48 CFCs per 5 x 104 cells, Figure 3.5D). This result indicates that Tpo, but not VEGF, can
promote the formation of CFC hematopoietic progenitor cells. Combining BMP-4, VEGF and Tpo
supplementation resulted in a similar number of CFCs in comparison to the BMP-4 and VEGF
condition, suggesting that VEGF had a negative effect on CFC generation. To study this effect in
greater detail, exogenous VEGF was withdrawn from BMP-4 containing cultures with or without
Tpo at day 5 (Figure 3.6). VEGF removal from BMP-4 culture did not affect the generation of
CD34+CD41+ (p=0.059) and CD41+ (p=0.312) cells or the number of CFC (p=0.231), but
significantly reduced the generation of CD34+CD41- (p=0.001) cells. In contrast, VEGF removal
from cultures containing BMP-4 and Tpo increased the frequency of CD34+CD41+ cells (p=0.023),
CD41+ cells (p=0.046) and CFC (p=0.026), but decreased the percentage of CD34+CD41- cells
(p=0.003). These results indicate that VEGF signaling between day 5 and 8 may hinder blood
development and potentially promote non-hematopoietic (endothelial) development.
Figure 3.6. Delivery time of VEGF effects hematopoietic CFC output, while early BMP-4
(d0-5) delivery is as effective as continuous treatment (d0-8). ESCs were differentiated in the
presence of 5 ng/ml of BMP-4 and 0 or 50 ng/ml of Tpo from day 0 to 8 as specified on the x-axis. 25
ng/ml VEGF was either provided continuously (from day 0 to 8, black bars) or during the first 5 days of
differentiation (open bars). On day 8 of differentiation, phenotypic and functional assays were
performed. * Indicates a significant difference between the day 0-8 and 0-5 conditions (p < 0.05). A:
Percentage of CD34+CD41+ cells, B: CD41+ cells, C: CD34+CD41- cells and D: the number of CFCs
following 8 days of differentiation. E: Early BMP-4 is as effective as continuous treatment in the
mesodermal response. Cells were treated with BMP-4 for day 0-5 or 0-8 in the presence of Tpo. Cells
were phenotypically assessed on day 5 and functionally assessed on day 8. No significant difference in
cellular outputs resulted from the two treatment windows.
92
93
3.4 Discussion In this study we examined the effect of serum-free media components and exogenous cytokines
on ESC differentiation, using cell phenotypic and functional analysis of blood development as a
model system. We chose a defined media able to maintain ESC self-renewal as our initial
serum-free culture system, confirming results published by Ying et al. (Ying and Smith 2003).
The presence of BMP-4 and LIF in N2B27 promoted ESC self-renewal for an extended period of
time (Figure 3.1). Utilizing the N2B27 serum-free system for blood development (BMP-4 with
or without VEGF in the absence of LIF) resulted in low levels of T-GFP and VEGFR-2 co-
expression in comparison to the serum control. We adjusted the formulation and used N2BME
to increase the number of T-GFP+VEGFR-2+ cells as the presence of B27 apparently decreased
both mesodermal differentiation and cell proliferation. With respect to the altered cell
differentiation, the most likely candidate in the B27 supplement is retinoic acid (RA), a
derivative of vitamin A. Although RA treatment between days 5 and 7 (10-7–10-9 M) enhances
differentiation into mesoderm-derived cardiomyocytes (Wobus et al. 1997) and vascular smooth
muscle cells (Drab et al. 1997); it has been shown that RA (10-7–10-8 M) can repress mesodermal
gene expression including T (Bain et al. 1996) and can strongly promote neural differentiation
(Bain et al. 1995, Fraichard et al. 1995, Strubing et al. 1995). The inhibitory signals resulting
from B27 supplementation (i.e. signaling from RA and perhaps from the neuroectoderm cells)
appeared sufficient to block VEGFR-2-induction by BMP-4.
The presence of inhibitory signals due to B27 supplementation was further supported by the fact
that a higher concentration of the mesoderm inducing factor, BMP-4 was required for the
generation of fewer VEGFR-2+ and T-GFP+VEGFR-2+ cells. In the absence of B27 supplement,
less BMP-4 was required to generate similar frequencies of T-GFP+VEGFR-2+ mesoderm cells.
However, B27 played an important role on cell proliferation during differentiation. The absence
of B27 reduced cell generation, which we recovered by supplementing the media with BME, an
antioxidant (Ono and Alter 1995). Therefore, removing the B27 supplement and adding BME to
the serum-free media improved VEGFR-2+ and T-GFP+VEGFR-2+ cell frequencies and required
less exogenous BMP-4 to obtain such a response, making this system more cost effective and
responsive to mesoderm-inducing signals. Specifically, 10 ng/ml BMP-4 in N2B27 peaked
induction at 12 ± 3 % T-GFP+VEGFR-2+ on day 5, while 5 ng/ml BMP-4 in N2BME peaked at
24 ± 4 % on day 4.
94
Among the cytokines tested (BMP-4, VEGF, and Tpo) only the addition of BMP-4 increased the
frequency of T-GFP expression. Under serum-free conditions a low frequency of T expression
was observed without cytokine supplementation. As ESCs (Winnier et al. 1995) and
differentiated cells (Park et al. 2004) produce BMP-4, autocrine and paracrine BMP-4 signaling
may be sufficient to induce this low level of T expression. However, exogenous BMP-4 was
required to induce significant frequencies of T-GFP+ and VEGFR-2+ cells, in a dose-dependent
manner. These results support the in vivo observation that mutant BMP-4 embryos show
deficient mesoderm differentiation (Winnier et al. 1995) and agree with literature detailing a role
for BMP-4 in mesoderm induction in vitro. Specifically it has been reported that hematopoietic
and endothelial commitment from the mesoderm occurs via BMP-4-mediated signals (Park et al.
2004) and that only BMP-4 induces gene expression reminiscent of the primitive streak-like
population required for the subsequent development of hematopoietic mesoderm (Wiles and
Johansson 1997, Nakayama et al. 2000, Chadwick et al. 2003, Pick et al. 2007). We also showed
the frequency of T-GFP+ and VEGFR-2+ cells depend on BMP-4 with higher concentrations
yielding greater numbers of T-GFP+ and VEGFR-2+ co-expressing cells. Interestingly, T+ and
VEGFR-2+ cells are formed in the posterior region of the primitive streak (Huber et al. 2004)
where BMP-4 activity is the highest (Beddington and Robertson 1999). This observation
suggests that cell types generated in vitro with sufficient BMP-4 signaling respond in a manner
similar to those induced in the primitive streak, supporting the use of the EB system as a model
to study signaling events that mimic early development (Wiles and Johansson 1999). Most
recently a study of the transcriptional activation in serum vs. a serum-free system with 2 ng/ml
BMP-4 concluded that the regulation of stem cell genes and activation of epiblast/primitive
streak genes is similar in serum and defined media, but that the subsequent mesoderm
differentiation is strongly influenced by the composition of the media (Bruce et al. 2007).
In our system, BMP-4 signaling appears to be involved in two stages that lead to blood
development: initial induction of T-GFP expressing cells and generation of T-GFP and
VEGFR-2 co-expressing cells. Based on the cell phenotype observed, BMP-4 may play a role in
promoting mesoderm and hemangioblast cells. This was confirmed with the blast (BL)-CFC
assay; similar numbers of BL-CFC formed in the serum and BMP-4 supplemented N2BME
serum-free system (Figure 3.5A). However, there is one important caveat with this observation
suggesting that either the serum-free expansion or differentiation media does not fully
95
recapitulate the activity of serum or that the conditions of the blast-assay itself require
modification, as blasts only formed at very low passage (p15-16). The capacity of cells to read-
out in the blast assay was lost while functional CFC could still be produced. Our results also
suggest that exogenous BMP-4 signaling past day 5 of differentiation does not affect
differentiation into hematopoietic (CFC) and endothelial cells (CD34+CD41-) (Figure 3.6E).
Serum studies also indicate the importance of BMP-4 early in culture as a pulse of Smad1
expression (day 2 - 2.25) expands the hematopoietic progenitor population (Zafonte et al. 2007)
and recent work with hESCs also indicates the importance of BMP-4 in initiating mesoderm
induction (Zhang et al. 2008). The role that endogenous BMP-4 (Park et al. 2004) plays at later
stages remains to be elucidated. Further analysis of the changes in expression of CD41 with time
would also be informative. Hierarchical analysis of the relationship between the early CD41
cells and the subsequent functional cell types generated (for example by cell sorting and further
culturing) is one possible future research direction.
We also investigated the time- and concentration-dependent role of VEGF on blood
development. Exogenous VEGF is not required for CFC (Hidaka et al. 1999, Schuh et al. 1999),
with smaller and fewer blast-colonies generated from VEGFR-2 null EBs compared to wild type
EBs (Schuh et al. 1999), but VEGF has been shown to positively influence hematopoietic
response/fate in a dose and time-dependent manner (Park et al. 2004, Pearson et al. 2008). In our
system, VEGF appears to promote the expansion of T-GFP+VEGFR-2+ cells between day 4 and
5. Day 5 VEGFR-2+ cells have been previously shown to give rise to both hematopoietic and
endothelial cells (Kabrun et al. 1997), suggesting that the T-GFP+VEGFR-2+ cells generated are
still bipotential, although we do not specifically demonstrate that the CFC come directly from the
T-GFP+VEGFR-2+ cells. The addition of VEGF (and BMP-4) to N2BME (from day 5 to 8)
increased CD34+CD41- formation without affecting CFC outcome. However, the addition of
VEGF and Tpo after day 5 decreased the number of CFC generated while CD34+CD41- cell
frequency increased. The CFC reduction in response to VEGF may be explained by an
inhibition of hematopoietic progenitor cell specification and/or expansion. The latter hypothesis
improbable because VEGFR-2 null EBs generate similar numbers of CFCs when compared to
wild type (Schuh et al. 1999) and VEGFR-2 expression is rapidly lost upon commitment to the
hematopoietic lineage (Eichmann et al. 1997, Hirashima et al. 2003). Furthermore, these results
are consistent with studies showing that the presence of VEGF in cultures containing VEGFR-2+
96
sorted cells promotes the expression of endothelial markers (Eichmann et al. 1997, Hirashima et
al. 2003) while reducing hematopoietic cell colony formation (Eichmann et al. 1997). Therefore,
it appears the concentration of VEGF affects lineage fate choices of VEGFR-2+ hemangioblast
cells. Single cell studies are required to definitively show this.
Tpo has recently been shown to support BL-CFC formation, independent of VEGF signaling
(Perlingeiro et al. 2003), suggesting that it may play a role in blood development. Although the
Tpo receptor c-mpl is expressed by day 3 of differentiation (Kabrun et al. 1997, Perlingeiro et al.
2003), exogenous Tpo signaling does not appear to affect the expression of T-GFP+VEGFR-2+
during the first five days of differentiation. Beyond day 5 of differentiation, Tpo signaling
promotes an increase in CFC generation without affecting CD34+CD41- cell frequency
(Figure 3.5C). HPCs maintain c-mpl expression (Zeigler et al. 1994, Ku et al. 1996a, Yagi et al.
1999) and numerous studies have established that Tpo has an important role in their maintenance
and expansion (Kobayashi et al. 1996, Ku et al. 1996a, Young et al. 1996, Yagi et al. 1999, Ema
et al. 2000) and most recently a role in HPC generation (Petit-Cocault et al. 2007). Thus, the
observed increase in CFCs is most likely explained by Tpo promoting hematopoietic expansion
as opposed to progenitor specification, as recently reported (Abkowitz and Chen 2007). The
presence of VEGF (25 ng/ml d0-8) blocks the CFC induction by Tpo either as a result of direct
inhibition of HPC specification or as a result of hemangioblast specification to non-
hematopoietic cells (Figure 3.5). Regardless of the inhibition mechanism, VEGF predominates
making it difficult to determine whether Tpo plays a role in CFC specification. It is of interest to
note that Tpo may also promote VEGF production (Kirito et al. 2005), a 3-fold induction of
mRNA was reported although translation to protein was not reported and may be negligible in
bulk cultures. Nevertheless, it is clear that exogenous VEGF should be removed from the culture
system past day 5 of differentiation and Tpo should be supplemented to optimize hematopoietic
CFC formation.
In summary, we have developed a serum free system and investigated both concentration and
temporal effects of BMP-4, VEGF, and TPO. Specifically, we have shown that 5 ng/ml BMP-4
with 50 ng/ml TPO and early VEGF treatment (25 ng/ml d0-5) is comparable to or surpasses
serum induction, producing 292 ± 42 CFCs per 5 x 104 cells. This work contributes towards the
understanding of mesoderm differentiation and should serve as a foundation for the development
of a bioprocess to reproducibly control cell fate for therapeutic purpose.
97
3.5 Acknowledgements We thank D. van der Kooy for manuscript review, C. Park and M. Lynch-Kattman for advice on
the BL-CFC assay, and G.H. Fong for the Flt-1-/- cells. P.W.Z. is a Canadian Research Chair in
Stem Cell Bioengineering and A.N. is a Canadian Institutes of Health Research (CIHR) Senior
Scientist. This work was accomplished with support from Natural Sciences and Engineering
Research Council of Canada, CIHR, National Cancer Institute of Canada, and Ontario Graduate
Scholarship in Science and Technology.
Chapter 4
Endogenous Control and Local Delivery of Inductive Factors to Guide Serum-Free Blood Development from
Mouse Pluripotent Stem Cells
This chapter will be submitted to Tissue Engineering: Part A. Collaborators include Andrés
Bratt-Leal, Todd McDevitt, and Peter Zandstra.
Author Contributions:
Kelly A. Purpura- Conception and design, collection and/or assembly of data, data analysis and
interpretation, manuscript writing, final approval of manuscript; Andrés Bratt-Leal - provision
of study material; Todd McDevitt - provision of study material; Peter W. Zandstra- conception
and design, data analysis and interpretation, manuscript writing, final approval of manuscript.
98
99
4.0 Abstract Pluripotent stem cells can provide insight into development as well as provide the basis for
emerging cell therapies and tissue engineering applications. It is thought that designs mimicking
characteristics of the stem cell niche or in vivo microenvironment during mesoderm specification
can lead to methods that generate clinically relevant hematopoietic stem cells (HSCs) from
embryonic stem cells (ESCs). In this study we took a novel approach, influencing the
microenvironment through aggregate size control, oxygen tension, and local growth factor
delivery using gelatin microparticles. In order to describe mesodermal differentiation more
clearly we examined early phenotypic markers (E-cadherin, brachyury, PDGFRα, Flk1) and
their capacity for hematopoiesis through cell sorting. Subsequently, we determined how the
initial aggregate size influenced the emergent phenotypes and established that colony forming
cell (CFC) output was maximal with 100 cells per aggregate. We combined this aggregate size
with a low oxygen environment and local delivery of two inductive molecules, BMP4 and TPO
(bone morphogenetic protein-4 and thrombopoietin) obtaining a more robust response to
physiologically presented cues than bulk delivery alone. These processes could also be applied
with larger-scale bioreactor systems due to the efficiency of the localized delivery and size-
control system, providing a tunable platform for developing cell therapies.
100
4.1 Introduction In the gastrulating embryo cells are at an intermediate stage of differentiation as they transition
from pluripotent endothelium, termed the epiblast, to specific lineages. This process transforms
the embryo from the single layered epiblast to a trilayered structure composed of the three germ
layers: ectoderm, mesoderm and endoderm (Gardner and Rossant 1979). These differentiation
stages have been extensively studied using differential expression of molecular markers, and cell
and transplantation tracking experiments to try to understand spatiotemporal events in early
tissue specification. Mesoderm and endoderm are produced via ingression through the primitive
streak and the remaining epiblast cells give rise to surface ectoderm and neuroectoderm (Tam
and Behringer 1997). The emphasis of many developing cell therapies and tissue engineering
concepts is to promote or mimic aspects of development and to provide cells or promote healing
within specific microenvironmental contexts.
Pluripotent stem cells such as embryonic stem cells (ESCs) provide a useful tool for elucidating
mechanisms of development and have potential for regenerative cell therapies. Capable of
extensive self-renewal in vitro and of differentiating into cells from all primitive germ layers,
ESCs are an excellent resource for a variety of cell transplantation and tissue engineering
applications. Progress has been made in generating many cell types such as neurons (Strubing et
al. 1995, Lee et al. 2000, Carpenter et al. 2001, Ying and Smith 2003) cardiomyocytes (Wobus et
al. 1997, Kehat et al. 2001, Zandstra et al. 2003, Sargent et al. 2009), hepatocytes (Abe et al.
1996, Kubo et al. 2004), chondrocytes (Kramer et al. 2000, Nakayama et al. 2003), and
hematopoietic progenitors (Schmitt et al. 1991, Nakano et al. 1994). However, as pluripotent
cells tend to develop into functionally immature progenitors or neonatal HSCs (Matsumoto et al.
2009) the motivation remains to develop appropriate and scalable inductive processes.
Differentiation is typically induced as a cell aggregate of pluripotent stem cells, termed an
embryoid body (EB); a structure thought to recapitulate various morphogenetic cues from
gastrulation and respond to exogenous factors relevant to the desired lineage. These methods
have been recently reviewed and are broadly applicable to both sources of pluripotent cells
(Kurosawa 2007). EBs do produce some temporal and spatial relationships found during
embryogenesis (Leahy et al. 1999), however, they clearly lack many of the organizational cues
that occur during development. We hypothesized that greater spatiotemporal control may
101
efficiently direct differentiation to specific cell types, thus focused on developing processes to
aid the appropriate maturation of therapeutically useful cells.
Cell differentiation and migration during gastrulation involves cell adhesive interactions
mediated primarily by cadherins, a family of Ca2+ dependent transmembrane adhesion receptors
(Burdsal et al. 1993, Gumbiner 1996). Undifferentiated ESCs express epithelial-cadherin
(E-cad) which mediates both EB formation and the agglomeration of EBs at later stages if
expression is sustained (Dang et al. 2004). We wanted to characterise the early markers of
mesodermal differentiation and relate them to the emerging blood colony forming cells (CFC),
thus we monitored E-cad expression, the pan mesodermal marker brachyury (Wilkinson et al.
1990, Herrmann 1991, Keller et al. 1993), and two receptor tyrosine kinases from the platelet
derived growth factor (PDGF) family: PDGFRα and vascular endothelial growth factor (VEGF)
receptor-2 (Flk1) (Yoshida et al. 1998). Differential cadherin expression has been associated
with various cell phenotypes and is downregulated in mesoderm (Burdsal et al. 1993), while
PDGFRα is expressed in the posterior mesoderm and Flk1 is first detected in the mid to late
streak stage (E7.0) of the embryo (Kataoka et al. 1997).
Microenvironmental factors such as aggregate size, soluble factors, and cell-cell or -extracellular
matrix (ECM) interactions are important parameters when engineering systems to enhance the
homogeneity and differentiation yield of specific lineages from EBs (Bratt-Leal et al. 2009). To
influence endogenous interactions with the microenvironment we took advantage of recent
advances to control EB size though forced centrifugation in micro-pyramidal wells (Ungrin et al.
2008). The physical size of EBs has been reported to influence the proportion of cells
differentiating toward specific lineages (Ng et al. 2005, Hwang et al. 2009b, Mohr et al. 2009,
Niebruegge et al. 2009) and impacts diffusion of soluble molecules as well as cellular
interactions. We investigated a range of cell aggregate sizes using mouse ESCs and evaluated
the predictive value of the monitored mesoderm phenotypes (E-cadherin, T-GFP,
PDGFRα, Flk1) with respect to blood progenitor (CFC) output.
We hypothesized that a system allowing combinatorial control of the microenvironment through
specific cell aggregation, modulating physiochemical parameters such as oxygen tension, and
providing local delivery of growth factors could support the generation of hematopoietic
progenitors in a more physiologically relevant manner. Controlled release has been shown
102
previously from VEGF loaded alginate scaffolds (Kanczler et al. 2009), with scaffolds
impregnated with gelatin microparticles (MPs) loaded with BMP-2, IGF-1 (Chen et al. 2009a) or
VEGF (Patel et al. 2008a), with bFGF (basic fibroblast growth factor) loaded gelatin
microspheres used as a cell substrate (Zhu et al. 2008), and finally with poly (lactide-co-
glycolide) (PLGA) microparticles loaded with VEGF, PlGF (placental growth factor), or bFGF
and embedded in large human EBs (30 000 cells) (Ferreira et al. 2008) or loaded with RA
(retinoic acid) and allowed to freely incorporate into mouse EBs with rotation (Carpenedo et al.
2009). However, none of the previous systems used small aggregates of ESCs or induced cells
to the hematopoietic lineage. In this way, we took a novel approach to enhance hematopoietic
differentiation in our serum-free system using controlled aggregation, hypoxic conditions and
local delivery of BMP4 and thrombopoietin (TPO), via gelatin microparticles. Additionally, this
process incorporates flexibility and could easily be modified to produce other target cell
populations. Together these systems confine the inductive molecules to the local cell
environment, enabling efficiencies in cell yield.
103
4.2 Materials and Methods
4.2.1 Cell Culture
Brachyury-GFP cells were maintained on 0.5 % gelatin coated flasks in a humidified 5 % CO2
atmosphere as described previously (Dang et al. 2002). Cells were maintained in a modified
serum-free media containing 500 pM LIF (CellGenix, Antioch, IL), 10 ng/ml BMP4 (R&D
Systems, Inc. Minneapolis, MN), 2 mM Glutamax (Invitrogen, Carlsbad, CA), 4.5 x 10-4 M
monothiolglycerol (MTG) (Sigma-Aldrich, St.Louis, MO), 0.5 mg/ml bovine serum albumin
(BSA), 0.5 % N2, 1 % B27, 1 % penicillin/streptomycin (P/S) in a base of 50 % DMEM/F12 and
50 % Neurobasal medium (GIBCO® Invitrogen). The differentiation media was the same as the
maintenance media except that the base was changed to 75 % IMDM and 25% F12, B27 without
retinoic was used, P/S was reduced to 0.75 %, 1.5 mM Glutamax was used on d0 and increased
to 3.5 mM on d2, and 0.025 mg/ml ascorbic acid was supplemented with 5 ng/ml BMP4, 25
ng/ml VEGF (Sigma), and 50 ng/ml TPO (R&D) in normoxia or hypoxia as indicated.
4.2.2 Fluorescent Automated Cell Sorting (FACS)
Flow cytometric analysis of phenotypic expression and cell sorting was carried out as described
elsewhere (Dang et al. 2002). Briefly, EBs were enzymatically dissociated with 0.25 % trypsin-
EDTA and the reaction was stopped with FBS containing media prior to resuspending the cells
in HBSS with 2 % FBS (HF) at 107 cells/ml prior to staining. Staining of more than 5 samples
was completed in a V-bottom 96 well plate with 20 µl of sample or control cells. Primary
antibodies, E-cadherin (R&D) and PDGFRα-biotin (eBioscience Inc. San Diego, CA) were
added at 1:100 for 20 min on ice before washing twice with HF. Secondary or conjugated
antibodies (BD, Franklin Lakes, NJ) were added at 1:200 for 35 min on ice: goat anti-ms PECy7
(Santa Cruz Biotechnology Inc., Santa Cruz, CA), Stv-APC-Cy7, Flk-1-APC or isotype rat IgG2
before washing twice and resuspending in 1μg/ml 7-amino-actinomycin D (7AAD, Molecular
Probes). Cells were analyzed on a BD FACSCanto (Firmware version 1.14), using BD
FACSDiva software (Version 5.0.1) with positive staining defined as fluorescence emission >
99.1 % of negative control cells from the same starting population or undifferentiated cells.
Cells were sorted on the BD FACSAria and were collected in IMDM supplemented with 2 %
serum, washed and resuspended in serum-free medium.
104
4.2.3 Hematopoietic Cell Assays
Embryoid bodies (EBs) were dissociated by incubation (3 min, 37 °C) in 0.25 % trypsin-EDTA
(Sigma) before seeding the myeloid-erythroid colony forming cell assay (ME-CFC) at
50 000 c/ml in 35 mm duplicate plates (M3434, Stem Cell Technologies, Vancouver, BC).
Previously sorted cells were seeded in 300 µl M3434 at variable densities below 20 000 c/ml into
24 well plates. Colonies were enumerated 7-10 days after seeding as previously detailed (Eaves
et al. 1992).
4.2.4 Size Controlled Aggregation
Full or partial inserts (Ungrin et al. 2008) were attached to 6- or 24-well plates using
polydimethylsiloxane, and allowed to cure overnight at 37ºC. Plates were sterilized under UV
light for 30 min and then filled with 70 % ethanol prior to centrifuging at 900g for 2 min to
remove air bubbles. Wells were washed 2-3x with PBS and coated with 5 % (w/v) Pluronic
F-127 (Sigma) for 30 min. Wells were washed twice more with PBS, and allowed to stand in
media for a minimum of 30 min at 37 ºC prior to seeding. Media was exchanged and air bubbles
were removed by centrifuging at 900g for 2 min prior to adding cells. Full well inserts were
seeded with a single cell suspension in growth medium, adding the desired number of
cells/microwell and centrifuging for 5 min at 200g. Partial well inserts were similarly seeded,
however, cells were suspended in DMEM (Invitrogen) at a maximal volume in order to minimize
the effect of having an uneven surface area covered by the insert. Cells falling outside the
micropatterned square-pyramidal wells were carefully removed by aspiration and the proper
volume of growth media was then added.
4.2.5 Encapsulation Process
To encapsulate 100 cell aggregates 2.4 x 106 cells were seeded in 200 µm microwells in a 6-well
plate. The mESC aggregates from an individual well were harvested and settled to 100 µl
approximately 24 hours later and mixed with 100 µl of HBSS. The aggregates were quickly
added to 400 µl of molten 2 % agarose (37ºC; SeaPrep Agarose, Lonza Inc. Allendale, NJ) with
20 µl of Pluronic F-68 (Sigma) using a P1000 pipetteman, dispersed in 5 ml
dimethylpolysiloxane (37 ºC; Sigma) and vortexed for 1 min set at 7.25 (Vortex-Genie2®,
Scientific Industries Inc. Bohemia, NY ) before cooling on ice for 10-15 min. Aggregates were
washed twice before use (Dang et al. 2004); briefly, 5 ml of HBSS was added to the chilled
105
aggregate-agarose mixture and centrifuged for 5 min at 500 rpm (4 ºC). Aggregates were
counted pre-and post-encapsulation in a grided 35 mm petri dish.
4.2.6 Manufacturing and Loading Gelatin Microparticles
The gelatin microparticles were generated by standard methods (Oner and Groves 1993).
Briefly, 5 g gelatin type B (Sigma) was dissolved in 4.5 ml ddH2O (60 ºC). Corn oil was
homogenized at 5000 rpm (Polytron PT 3100) while 2 ml of the gelatin solution was added
dropwise, and mixing continued for 5 min. Following mixing, the solution was cooled at 4 ºC
for 10 min; 50 ml of cold acetone was added and the solution was allowed to stand a further 10
min. The microparticles were sonicated for 30 s at 5W (Misonix Sonicator 3000), and washed
with acetone to remove the oil prior to crosslinking overnight with agitation in 0.1 % wt solution
of Tween 80 in 70 % ethanol containing 5 mM gluteraldehyde (Electron Microscopy Sciences).
MPs were collected and washed 3x with ddH2O prior to mixing in a 25 mM glycine solution
(VWR, West Chester, PA) for 1 h to block any remaining aldehyde groups; particles were
washed three more times prior to labeling and/or lyophilizing.
Blue, green and red fluorescent MP conjugates were prepared with amine-reactive Alexa Fluor®
succinimidyl esters (350, 488, 546) as they provide bright, photostable signals that are pH
independent (Molecular Probes). The MPs were sterilized in 70 % ethanol for a minimum of 30
min before washing three times with ddH2O. The MP batch was centrifuged to remove the water
prior to freezing at -80 ºC and lyophilizing. Dry MPs were resuspended in PBS and counted on a
hemocytometer to determine the concentration by weight; growth factors were added at 5 µl/mg.
4.2.7 Generating Mixed Aggregates of Microparticles and Cells
A single cell suspension was generated from undifferentiated cells and centrifuged into the
prepared wells as described above; 200g for 5 min. Microparticles were suspended at a known
concentration and added to the wells to obtain the desired MP:cell ratio (1:4-1:8) before
centrifuging a second time at 200g for 5 min. Aggregates were removed 24h later for
encapsulation and/or dilution in 10 cm Petri dishes.
4.2.8 Statistical Analysis
All data are reported as mean ± s.d. Differences in CFC output was assessed using paired two-
tailed Student's t-test with n ≥ 3, p ≤ 0.05 unless otherwise noted.
106
4.3 Results
4.3.1 Cell populations distinguished by phenotype have distinct hemogenic capacity
We previously demonstrated that in serum-free conditions the addition of a trio of mesoderm
inducing cytokines, BMP4, VEGF, and TPO (BVT) resulted in an induction of myeloid-
erythroid colony forming cells (ME-CFC) (Purpura et al. 2008b). To trace the dynamic process
of mesodermal specification in greater detail we employed the Brachyury (T)-GFP line (Fehling
et al. 2003), and also monitored E-cadherin, Flk1 and PDGFRα expression. We postulated that
the dynamic upregulation of brachyury and downregulation of E-cadherin, that appear to signal
the upregulation of these two mesodermal receptors, could be used in combination to identify the
hemogenic population.
Monitoring the expression of E-cadherin, brachyury, PDGFRα, and Flk1 during differentiation
distinguishes 16 possible phenotypes (Figure 4.1A). Once differentiation was initiated with BVT
supplementation E-cadherin expressing cells (E+T-P-F-; E-cadherin+T-PDGFRα−Flk1-)
progressively downregulated that marker while the expression of brachyury and both surface
receptors were upregulated (Figure 4.1B). The presence of either one or both of the tracked
receptors in the absence of brachyury was only observed after the initial peak of E-T+P+F+/- cells
and may correspond to more differentiated cells (day 5, Figure 4.1B). Due to the rarity of many
of the phenotypic populations it is likely that they represent transient expression states during
lineage specification or are not physiologically relevant. A schematic of the growth protocol is
also included for reference (Figure 4.1A).
Figure 4.1. Monitoring mesodermal specification. Four-colour FACS employing a GFP-T+ cell
line sheds light onto pan mesoderm development by additionally tracking the surface expression of E-
cadherin, PDGFRα and Flk1 (A). Comparison of undifferentiated cells to cells after 3.75 or 5 days in
serum free differentiation media with or without BVT highlights the dynamic progression of these lineage
markers and demonstrates that not all phenotypic combinations occur (B). The most abundant or likely
phenotypes to be associated with hemogenic mesoderm were sorted prior to assessing their CFC potential.
Populations were sorted singly ( ) or in combination ( ) as indicated, with the gates overlayed in
bold in (A); E-T+P+F+ cells generated colonies at the highest frequency.
107
A
Time [day] 0 Treatment BVT
Seed CFC 7
Analyze CFC 14
FACS Analysis/Sort 3.75
EB formation
B
ME
M
Late M
mES 0 BVT 0 BVT0
20
40
60
80
010
Day 5
% p
ositi
ve
Treatment
E-T-P-F- E+T-P-F- E+T+P-F+ E+T+P-F- E+T-P+F- E+T-P-F+ E+T-P+F+ E-T+P-F- E-T-P-F+ E-T-P+F- E-T-P+F+ E-T+P-F+ E-T+P+F- E-T+P+F+ E+T+P+F- E+T+P+F+
Day3.75 Unsort
ed
E+T+P
+(F-)
E+T+P
-(F-)
E-T+P+F
-
E-T+P+F
+
E-T-P
+/F+
0.0
0.2
0.4
0.6
0.8
1.0
Effi
cien
cy o
f CFC
form
atio
n (%
see
ded
d6.7
5)
E
108
We grouped the expression patterns based on literature expectations into populations that could
broadly be classified as having mesendoderm (ME), mesoderm (M), endoderm (E), or unknown
potential (Figure 4.1B), and differences in their gene expression profiles demonstrate this
(Supplementary Figure 1). Based on these groupings and the hypothesis that populations down
regulate brachyury after VEGF/PDGF receptors are expressed, we sorted the most abundant
day 3.75 phenotypes thought to be associated with hemogenic mesoderm and assessed their
colony forming capacity after further 3 days of culture. We found that the E-T+P+F+ population
had the greatest hemogenic capacity, 1 CFC in 174 ± 34 cells with approximately 345-fold
enrichment over the unsorted population. Colonies also formed at lower efficiency in the
E+T+P+F+/-, E+T+P-F+/-, or E-T-P+/-F+/- fractions (Figure 4.1B). The number of colonies generated
from the unsorted population was equivalent to the sum produced by the sorted fractions once
the initial frequency of these phenotypes was accounted for. This work allows us to use this
phenotype to further track and optimize parameters of hemogenic mesoderm differentiation.
4.3.2 Embyronic stem cell aggregate size influences subsequent mesodermal phenotype and development
Genetic programs coordinate the highly complex process of embryogenesis in concert with the
dynamic microenvironment that the cells both encounter and create with time. Meeting the
challenge to apply stem cells therapeutically requires means to both monitor and direct lineage
fate decisions. We hypothesized that local modulation of cell fate may be influenced by the
interplay of endogenous and exogenous signals (Figure 4.2A), as a function of the initial number
of cells per aggregate. Local cell density would effect the concentration of endogenous
stimulatory or inhibitory signals, as it is typically assumed that autocrine and paracrine factors
remain within a thin layer of unstirred media surrounding the cells (Groebe and Mueller-Klieser
1991, Vajta et al. 2000, Peerani et al. 2009). The bulk media or macroenvironmental nutrients
and growth factors would be similarly provided for all conditions with regard to the total cell
density per well.
109
As heterogeneous differentiation often results from cultures containing a variety of EB sizes
(Metallo et al. 2007, Carpenedo et al. 2009), we used a centrifugal forced-aggregation strategy
(Ungrin et al. 2008) to generate large numbers of uniform aggregates, effectively controlling the
local cell density. Total cell density was controlled by seeding different cell numbers into 200 or
400 micron square-pyramidal well inserts that covered an eighth, quarter, half or full well within
6-well plates (Figure 4.2B). Cells that did not land within a micropatterned area were removed.
Thus, 5, 10 and 20 cell aggregates were initiated at an effective density of 40 000 c/ml, while 50,
100, and 200 cell aggregates were initiated at 50 000 cm/ml. Single cells were also tested in 200
micron wells, and maintaining an equivalent media depth resulted in a lower effective density
(8 000 c/ml). Utilizing the phenotypes characterized during mesoderm differentiation we
investigated the impact of exogenous cytokine interactions with the endogenous
microenvironment as a function of the initial number of cells per aggregate. These influences
have been demonstrated previously with both 2- and 3-D systems (Davey and Zandstra 2006,
Park et al. 2007, Peerani et al. 2007, Hoelker et al. 2009).
Figure 4.2. Controlling initial cell aggregate size influences mesodermal specification. A
schematic showing the impact of endogenously produced factors. The overall effect would depend on the
balance of stimulatory or inhibitory regulars that are secreted by the mixture of cell types. The cells at a
higher local density would condition the microenvironment with more endogenous factors than lower
density conditions (A). Using two sizes of micropatterned pyramidal wells and partial coverage allows
similar overall cell densitites in an equal volume to be compared. Initial 10 or 100 cell aggregates are
shown in 200 and 400 µm inserts respectively, immediately after spinning down the cells and following
four days of growth (B). The mesodermal phenotypes associated most closely with CFC are shown as a
stacked percentage of expression for aggregates that were initially 1-200 cells (C). Overall expression
increased with increasing aggregate size. The predicted CFC output from the frequencies of the sorted
populations (left-axis) is overlayed on the actual CFC produced (right-axis) (D). CFC are maximal with
the 100 cell aggregates, and higher than predictions.
110
A
10 50 100 200
20
40
60
0
100
200
300
CFC
/50
000c
Pre
dict
ed C
FC
Initial Aggregate Size
predicted CFC measured CFC
B C
D
Endogenous factors
Inhibitory factors
Stimulatory factors
Exogenous factors
Day 0 Day 4
100 μm
1 5 10
1 20 10
200 μm inserts
50 100 200
100
400 μm inserts
1 5 10 20 50 100200 10 100 0
20
40
60 MesodermBVT
% p
ositi
ve
Initial Aggregate Size
E-T-P+/-F+, E-T-P+F-
E-T+P-F+ E-T+P+F+
No GF
Uncontrolled
111
We analyzed cell phenotype at approximately 3.75 days for each condition (1-200 initiating
cells); BVT induction modestly enhanced mesoderm phenotypes associated with CFC potential
with increasing cell numbers (Figure 4.2C). We proceeded to examine hematopoietic colony
formation from day seven aggregates to assess whether the hemogenic capacity mirrored the
trends of the combined phenotypic response; specifically, we tested functionality for 10, 50, 100,
and 200 cell aggregates (Figure 4.2D). To insure that similar differentiation kinetics occurred
across the different aggregate sizes we evaluated the CFC output of day 7, 8, or 9 EBs
(Supplementary Figure 2); trends were consistent with the greatest output occurring on day 7
(Figure 4.2D). The hematopoietic output with BVT treatment did increase with aggregate size,
to a frequency of 1 in 145 ± 8 d7 cells from initial 100 cell aggregates. This mimicked the raw
phenotypic trend but exceeded the predicted CFC output calculated by multiplying the average
efficiency of CFC formation from the sorted fractions with their frequency (Figure 4.2D),
suggesting that CFC formation is negatively affected by the dissociation and sorting methods or
that other cell fractions continue to play a beneficial role within intact aggregates. Without
inductive factors very low levels of spontaneous differentiation to mesoderm (or CFC) were
observed (data not shown). These studies allowed us to define an aggregate size that would be
used in further investigations.
4.3.3 Inducing the niche by reducing environmental oxygen
With an aim to enhance endogenous signals from within the aggregate, we decided to assess the
effectiveness of hypoxic induction using our serum-free system with size controlled aggregates.
Previously, we used the hypoxic environment as a means to induce endogenous production of
VEGF (Forsythe et al. 1996, Purpura et al. 2008a) and enhance CFC output. We encapsulated
100 cell aggregates the day after formation in agarose, generating 85 ± 11 % singly encapsulated
aggregates with a process yield of 65.5 ± 5.2 % (n=18) (Supplementary Figure 3). This process
facilitates transference of the aggregates to high density suspension and bioreactor culture (Dang
and Zandstra 2005). The aggregates continued to grow as single entities in the low oxygen
environment (5 % O2) and demonstrated that exogenous BMP4 with TPO were as effective in
inducing a mesodermal phenotype and CFC as BVT (Figure 4.3A). This work showed that one
of the exogenous signals was redundant (VEGF) and could be efficiently supplied by the cells
when they were grown in a hypoxic environment.
112
0.0 1.0 2.0 3.0 4.0 5.00
10
20
30
40
50 Microparticles (MP) Soluble BMP4
% m
esod
erm
MP-BMP4 (ng) sBMP4 (ng/ml)0.0 1.0 2.0 3.0 4.0 5.0
0
10
30
40
20
50 Microparticles (MP) Soluble BMP4
% m
esod
erm
MP-BMP4 (ng) sBMP4 (ng/ml)0.0 1.0 2.0 3.0 4.0 5.0
0
10
20
30
40
sBMP4 (ng/ml)
CFC
/ 50
000
cells
MP-BMP4 (ng)
Microparticles (MP) Soluble BMP4
A
D
igure 4.3. Endogenous growth factors can be induced using hypoxia and exogenous
CFC formed (D) followed the BMP4 dose response.
igure 4.3. Endogenous growth factors can be induced using hypoxia and exogenous
CFC formed (D) followed the BMP4 dose response.
2d BT0
1
2Hypoxia
CFC
: Fol
d-2d
BV
T
Seeded: d7 d8
4d BVT0
1
2Normoxia
CFC
: Fol
d-2d
BV
T
B
C
BMP4-MP UNLOADED-MP
FF
factors can be delivered locally with gelatin microparticles. Cell aggregates generated CFC as
efficienty with 2 vs. 4 day BVT delivery in normoxia, and exogenous VEGF was no longer required in
hypoxic conditions (A). Fluorescent images of blue BMP4 loaded microparticles mixed at different ratios
with red unloaded microparticles (B). The percent of mesoderm induced (C) as well as the number of
factors can be delivered locally with gelatin microparticles. Cell aggregates generated CFC as
efficienty with 2 vs. 4 day BVT delivery in normoxia, and exogenous VEGF was no longer required in
hypoxic conditions (A). Fluorescent images of blue BMP4 loaded microparticles mixed at different ratios
with red unloaded microparticles (B). The percent of mesoderm induced (C) as well as the number of
113
4.3.4 Tuning the microenvironment with localized growth factor release
We next wanted to mimic and induce endogenous signaling more closely, by incorporating
growth factor delivery within the aggregate. We first demonstrated that the growth factors were
only required for a short timeframe, as the CFC output was similar between 2 or 4 day treatments
with soluble BVT in normoxia (Figure 4.3A). Local delivery may enhance differentiation by
increasing the effective growth factor concentration, by altering receptor cycling, or by either
limiting or creating gradients. PLGA microparticles have recently been employed to release
factors in large hESC aggregates of 15-30 000 cells to enhance vascular differentiation (Ferreira
et al. 2008), or in mESC aggregates to enhance cystic EB formation (Carpenedo et al. 2009).
Alternatively, gelatin particles loaded with bFGF have been used as a matrix for human
umbilical vein endothelial cells (HUVEC), encouraging vascularization (Zhu et al. 2008). We
utilized gelatin microparticles and varied seeding ratios with 100 cell aggregates finding 1 MP to
4 or more cells produced the most stable aggregate with fully incorporated particles (data not
shown).
The bioactivity of growth factor containing gelatin microparticles was tested with 100 cell
aggregates. The MP:cell ratio was held constant in order to maintain equivalent levels of
particles within the aggregates and the ratio of BMP4 loaded to unloaded MPs was varied to
manipulate BMP4 dosing (Figure 4.3B). BMP4 is highly expressed in the primitive streak
during embryogenesis and initiates mesoderm differentiation and brachyury expression in serum-
free conditions in vitro (Winnier et al. 1995, Wiles and Johansson 1997, Fujiwara et al. 2002).
We completed immunostaining to confirm BMP4 was retained within the aggregates
(Supplementary Figure 4) and monitored mesoderm induction at day 3.75. With increasing
numbers of BMP4-MPs within the aggregate brachyury expression levels approached that of
soluble delivery at 5 ng/ml BMP4 (Figure 4.3C). The MP induced cells were also capable of
CFC output to levels similar or exceeding the soluble control (Figure 4.3D). One notable
difference was that a greater number of secondary EBs were produced with soluble BMP4 than
with microparticle BMP4 delivery to the aggregates (data not shown). These results demonstrate
that local delivery of BMP4 induces mesoderm differentiation as effectively and possibly more
specifically than the soluble factor.
114
4.3.5 Integrating microparticle growth factor delivery with low environmental
bination augments mesoderm induction when provided for similar timeframes in
oxygen
We and others have shown that low oxygen tension is beneficial in generating hemogenic
mesoderm (Ramirez-Bergeron et al. 2004, Purpura et al. 2008a), thus we wanted to test the
effectiveness of local growth factor delivery within encapsulated aggregates grown in either
hypoxic or normoxic environments to contrast differences between exogenous and endogenous
factor delivery. Equivalent numbers of gelatin microparticles were delivered to the aggregates to
support mesoderm development either loaded with BMP4 or TPO, or as unloaded controls
(Figure 4.4Ai). Cells were allowed to form stable aggregates for 24 hours before they were
removed from the microwells and encapsulated in agarose to prevent further cell agglomeration
following transfer (Figure 4.4Aii). In normoxia 25 ng/ml VEGF was provided in addition to the
soluble growth factor controls (BMP4, TPO) with brachyury induction apparent after 3 days
(Figure 4.4Aiii). We previously identified that the hypoxic induction of mesoderm results from
the production and dynamic competition for VEGF (Purpura et al. 2008a) and that this growth
factor com
serum-free conditions (Purpura et al. 2008b).
Figure 4.4. Combining local growth factor delivery with hypoxic induction of exogenous
factors supports mesodermal development. Aggregates formed within the 200 µm wells with blue
BMP4 loaded and red TPO loaded microparticles (Ai) can be removed and encapsulated for further
culture (Aii). The agarose shell is hightlighted with a dashed white ring. The aggregates can respond to
media nutrients and soluble factors as demonstrated by the expression of brachyury by this control
aggregate seeded with unloaded MPs and differentiated with BVT (Aiii). Either BMP4, TPO or both
factors were provided as indicated with the balance of unloaded microparticles and exogenous factors
acting as controls (B). Hypoxic conditions enhanced CFC output, with the highest output observed with
dual growth factor delivery. Representative myeloid and erythroid colonies from BMP4 and TPO
microparticle delivery are shown (C).
115
A i ii iii B
BMP4-MP TPO-MP T-GFP
0
50
100
150
200
250
300
CFC
/50
000
cells
Normoxia + sVEGF Hypoxia
sGF:Treatment
MP: UNLOADED BMP4 TPO BMP4+TPO BT T B
C
116
on and whether one or both
cto
).
apac n
ypo ixed
olon
esoderm differentiation. For BMP4 approximately 0.13-0.76 ng/ml was effective vs. 5 ng/ml
k delivery of the factor and for TPO approximately 1.2-6.7 ng/ml was effective vs. 50 ng/ml
in bulk. When the total growth factor loaded into the microparticles and encapsulation yield are
accounted for, roughly 20-30x less was required for lo
In all, we have demonstrated that controlling the microenvironm
aggregation with microparticles that release BMP4 and TPO can generate greater num
CFCs in a low oxygen environment than soluble delivery of BVT in norm
conditions.
The phenotypic induction was similar regardless of oxygen tensi
fa rs were provided in bulk so
Differences became appa
ity for colony form
xia was combined with mi
ies are shown from this condition
lution or through microparticle
rent between the normoxic a
ation was assessed (Figure 4.4B
croparticle release.
(Figure 4.4C). In all,
release (Supplementary Figure
nd hypoxic conditions when the
); larger induction was seen whe
Representative erythroid, myeloid and m
lower concentrations of growth
en superior
5
c
h
c
factors within the spatial context of the aggregate appear to induce comparable or ev
m
bul
cal delivery than for soluble bulk delivery.
ent through specified
bers of
oxic or BT in hypoxic
117
4.4 Discussion Modulating cell-cell interactions and the effects of autocrine, paracrine, and exogenous factors
through initial aggregate size, oxygen tension, and local growth factor delivery, has provided
insights into directed differentiation by monitoring both cellular phenotypes and functional
responses. We first explored the differential expression of mesodermal cell phenotypes and the
functional CFC response to exogenous growth factors in a serum-free media. We used a serum-
free culture system that maintains the self-renewal of undifferentiated ESCs (Ying and Smith
2003, Purpura et al. 2008b) and the embryoid body system to model blood development as it
induces differentiation similar to embryonic gastrulation. We have previously shown that BMP4
with VEGF and TPO can generate mesodermal cells that are brachyury and Flk1 positive by day
four in culture and that are capable of blood colony formation by day seven (Purpura et al.
2008b). In an aim to better define and characterize subsets of nascent mesodermal cells we
monitored E-cadherin, brachyury, PDGFRα and Flk1. Treatment with the three growth factors
(5 ng/ml BMP4, 25 ng/ml VEGF, 50 ng/ml TPO) resulted in the down regulation of E-cadherin
and the upregulation of the transcription factor brachyury and the surface receptor tyrosine
inases (RTKs) PDGFRα and Flk1 (Figure 4.1).
Monitoring E-cadherin and T-GFP (Fehling et al. 2003) provided an indication that
differentiation was proceeding and that mesoderm was being effectively induced; PDGFRα and
Flk1 were used to delineate potential hematopoietic progenitors (Brunkow et al. 1995). Overall,
these receptors have been associated with axial, paraxial and lateral plate mesoderm.
Specifically, Flk1 positive mesodermal cells have been associated with hematopoiesis and
vasculogenesis (Shalaby et al. 1997, Niwa et al. 2009), as well as cardiogenesis (Yamashita et al.
2005, Nelson et al. 2009), myogenesis (Motoike et al. 2003), and chondrogenesis (Nakayama et
al. 2003). It has recently been shown by cell sorting that PDGFRα+Flk1- cells generated through
the induction of Pax3 are myogenic (Darabi et al. 2008), while sorted PDGFRα+Flk1+ cells
enhanced cardiac potential (Hirata et al. 2007). It has also been shown that T+Flk1+ cells are
hemangioblasts, a subset of mesoderm associated with hematopoietic and vascular commitment
(Fehling et al. 2003, Huber et al. 2004).
Interestingly, we found that cells co-expressing brachyury (T), Flk1, and PDGFRα had the
highest frequency of CFC formation (1 in 174 ± 34, n=2) when they did not express E-cadherin.
k
118
Cells that had downregulated both E-cadherin and brachyury but maintained surface receptor
ained CFC capacity, but at a lower frequency (1 in 750, n=1).
ay have been underestimated due to cell
sorting and viability issues or the progenitor cell population may continue to expand or be
to the assessment of phenotypic expression, we
expression also maint
Hematopoietic colonies formed at a lower frequency (~1 in 5400 ± 2100, n=5) when cells
expressed E-cadherin and brachyury regardless of whether either one or both of the surface
receptors (Flk1/PDGFRα) were expressed. This low frequency was similar to the highly variable
output observed with dissociated but unsorted cells (~1 in 4600 ± 3900 cells, n=3). These
frequencies represent the cell autonomous capacity of the sorted phenotypes, as the cells were
allowed to mature for an additional three days without added growth factors. Future studies may
further interrogate the intrinsic differentiation capacity of these cells into multiple lineages, or
examine the influence of various factors to enhance or support the hematopoietic capacity of the
sorted fractions. Insight from these phenotypes will aid further process developments to generate
the appropriate cues and phenotypes that will further mature into therapeutically useful cells.
The presence of positive endogenous signals or a supportive microenvironment that continues
enhancing mesoderm development within intact EBs between d3.75 and 7 was demonstrated by
the fact that a higher number of colonies formed in comparison to the frequencies predicted from
cell sorting (Figure 4.2B). The predicted frequencies m
induced by microenvironmental factors within the intact EBs. The local cell density is thought to
impact many of these factors, including ECM interactions and neighbouring cell communication
through the secretion of locally active factors or cell-cell contacts, effecting ES cell
differentiation (Peerani et al. 2007, Bauwens et al. 2008). As we did not specifically control EB
density between d3.75 and 7, EB cultures may have had an advantage with both a higher
macroenvironmental and local cell density. EBs of approximately 650-1600 cells were growing
at 147 600 ± 9 200 cells/ml (range 14 100-374 600 cell/ml) by day 7 in contrast to the sorted
cells, that were in single cell suspension or exhibiting low levels of aggregation or adherence, at
75-100 000 cells/ml or less.
Focusing on parameters that may easily be incorporated into engineered systems to enhance
hematopoietic specification, we next investigated the influence of local cell density. Examining
the initial developmental stages leading up
showed an increasing proportion of hemogenic cells with increasing aggregate size (1-200 cells),
with a maximum at 100 cell aggregates (Figure 4.2B). Aggregates seeded with 5-200 cells with
119
or without growth factors continued to expand at similar growth rates, such that there were no
significant differences in population doublings between the conditions (1-way ANOVA). As the
rate of aggregate growth was not strongly influenced by initial cell numbers, controlling both
aggregate size and the total aggregates per well assured similar numbers of the bioactive
molecules (BMP4, VEGF, or TPO) were available on a per cell basis in the bulk media or
macroenvironment.
Upon determining that 100 cell aggregates produced the most CFC we developed a protocol to
encapsulate the aggregates, preventing agglomeration and facilitating transfer to alternative
growth conditions or bioreactor systems (Dang et al. 2004). Future cell therapy or tissue
engineering designs may find incorporating modified hydrogel into the differentiation process
beneficial; the capsule may contain immobilized ECM or growth factors (Ferreira et al. 2007), or
heparin that would retain endogenous heparin-binding growth factors (HBGF) or serve to deliver
cell production within bioreactor systems.
added HBGFs (Joung et al. 2008). We also confirmed that in our serum-free system low oxygen
eliminates the need for exogenous VEGF supplementation (Purpura et al. 2008a), providing
another facet or link to the endogenous microenvironment.
Taking advantage of the capacity for microenvironmental control from within the aggregate itself
we used gelatin MPs as a local delivery vehicle. BMP4 was first used alone to induce
mesodermal cells (Figure 4.3B). The dose response indicated that the single factor could induce
differentiation to levels comparable to soluble delivery and that less BMP4 was required, making
this system more cost effective and the aggregate more responsive to mesoderm-inducing
signals. Finally, we demonstrated a system incorporating microparticle delivery of BMP4 and
TPO into 100 cell aggregates, which under low oxygen tension supports the generation of
hematopoietic progenitors to a greater extent than bulk delivery. In all, integration of a
microparticle approach for bioactive molecule delivery within EBs provides both the opportunity
to optimize differentiation, and to scale-up
120
4.5 Acknowledgements The authors would like to thank N. Rahman, H. Song, M. Ungrin, and C. Yoon at the University
of Toronto for technical assistance. This work is funded by CIHR (MOP-57885), NSERC, and
the Canadian Stem Cell Network. K.A.P. was supported by an Ontario Graduate Scholarship;
A.M.B.L. is currently supported by an NIH Training Grant (GM008433), as well as funding
from the Goizueta Foundation. T.C.M. is supported by grants from the National Science
Foundation (CBET 0651739) and the National Institutes of Health (GM088291).
121
4.6 Supplementary Figures
Supplementary Figure 1. Gene expression profile from sorted cell populations. Genes
related to self-renewal (Oct4, Stat3), as well as ectoderm (Nestin), and endoderm (Foxa2, Sox17) were
monitored; gene expression for surface receptors Flk1 and PDGFRα were monitored to confirm sorting
efficiency. A panel of mesodermal and hematopoietic markers were also included: Tie2, is associated
with the maintenance of LTR activity of HSCs (Gomei et al. 2010); Cdx4, enhances hematopoiesis during
ESC differentiation and upregulates HoxB4 (Lengerke et al. 2007); Scl, is important in hematopoietic
commitment and LTR-HSCs (Kallianpur et al. 1994, Chung et al. 2002, D'Souza et al. 2005, Lacombe et
al. 2010); Runx1 (Runt-related transcription factor/core binding factor-α (CBFα), is essential for
hematopoetic commitment (Lacaud et al. 2002, Ema and Rossant 2003); Gata2, is expressed in HSCs and
progenitors (Ling et al. 2004, Lugus et al. 2007); Gata4 and Gata6 are associated with cardiac or gut
mesoderm (Arceci et al. 1993, Laverriere et al. 1994, Kuo et al. 1997, Burch 2005, Sargent et al. 2009);
Fibronectin, is expressed by cardiac fibroblasts promoting cardiomyocyte proliferation (Ieda et al. 2009),
during somatogenesis (Perkinson and Norton 1997), and additionally the protein is essential for
embryogenesis (Yang et al. 1993, Watt and Hodivala 1994) and interacts with VEGF (Goerges and
Nugent 2004).
0.001
0.01
0.1
Rel
ativ
e ex
pres
sion
1
10
100E+T+P-F- E+T+P+F- E-T+P+F- E-T+P+F+
Hemogenic mesoderm Pluripotent/mesendoderm
Oct4 Stat3 Nestin Foxa2 Sox17 Flk1 PDGFRα Tie2 Cdx4 Scl Runx1 Gata2 Gata4 Gata6 Fibronectin
Unsorted population
122
Table 1. Primers used for qRT-PCR of the phenotypically sorted cells.
Gene Forward primer Reverse primer
Oct4 AGTTGGCGTGGAGACTTTGC CAGGGCTTTCATGTCCTGG
Stat3 TGGCACCTTGGATTGAGAGTC GCAGGAATCGGCTATATTGCT
Nestin AACTGGCACACCTCAAGATGT TCAAGGGTATTAGGCAAGGGG
Foxa2 TAGCGGAGGCAAGAAGACC CTTAGGCCACCTCGCTTGT
Sox17 GATGCGGGATACGCCAGTG CCACCACCTCGCCTTTCAC
Flk1 TTTGGCAAATACAACCCTTCAGA GCAGAAGATACTGTCACCACC
PDGFRα TGGCATGATGGTCGATTCTA CGCTGAGGTGGTAGAAGGAG
Tie2 CGGCCAGGTACATAGGAGGAA TCACATCTCCGAACAATCAGC
Cdx4 TGACATGACCTCCCCAGTTTT GCCGGAGTCAAGAGAAACCA
Scl CACTAGGCAGTGGGTTCTTTG GGTGTGAGGACCATCAGAAATCT
unx1 GCAGGCAACGATGAAAACTACT GCAACTTGTGGCGGATTTGTA
Gata2 TGCATGCAAGAGAAGTCACC ACCACCCTTGATGTCCATGT
R
Gata4 CTCGATATGTTTGATGACTTCT CGTTTTCTGGTTTGAATCCC
Gata6 GGCAGTGTGAGTGGAGGTG TGGTACGTTCCGTTCAGCG
Fibronectin GCAGTGACCACCATTCCTG CCTGTCTTCTCTTTCGGGTTCA
123
400
1 2 3 4 5 60
20
40
60
80
100
% C
umul
ativ
e
No. aggregates/gel
ementary dep FC
t for 10-200 s sh
D - Not
Supplementary Figure 3. Aggregate encapsulation is an efficient process. 100 cell aggregates
ere encapsulated in agarose and the yields were recorded for 18 experiments showning that the majority
encapsulated.
aggr
eate
s
Suppl Figure 2. Kinetic CFC output is endent on initial aggregate size. C
outpu cell aggregates seeded from day 7-9 EB ow similar trends with a maximal output on
day 7. N determined.
w
were singly
10 50 1000
200
100
200
300
Day7 Day8 Day9
CFC
/50
000
ce
e
lls
Initial aggregate siz
ND
124
2 4 6 80
10
20
30
40
50
Inte
grat
ed D
ensi
ty/E
B a
rea
BMP4 [ng/ml]
d1 d2
Supplementary Figure 4. BMP4 was released from the gelatin MPs and detected within the
embryoid bodies. EBs were fixed in 4 % formaldehyde one to two days following spin aggregation,
eabilized overnight with Permeabilization Reagent B (Immunotech, Marseille, France) and blocked
BSA in PBS. Samples were stained overnight with a human BMP2/4 antibody (A
then stained for 2-3 hours with an anti-goat Alexa Fluor® 488 secondary
taken with fixed exposures using the AxioVision program (AxioVS40 V4.8.1
ions) on a Zeiss Observer.D1 system (10x NA 0.5 objective). Images were an
ageJ (http://rsb.info.nih.gov/ij/index.html), and the increasing fluorescent trend follows the am
perm
with 5% F355 R&D),
ashed and (Molecular Probes).
ages were .0 Carl Zeiss
Imging Solut alyzed with
ount of
BMP4 loaded.
w
Im
Im
125
th factor delivery. BMP4 and TPO show a simlar induction of the mesodermal
UNLOADED BMP4 TPO BMP4+TPO0
20
40
60
80
100
sGF:
% m
esod
erm
Treatment (4 days)
Normoxia + sVEGF Hypoxia
MP: BT T B
Supplementary Figure 5. Similar mesodermal phenotypes observed with soluble or
microparticle grow
phenotype in normoxia (with addional VEGF supplementation) and hypoxia, indpendent of the delivery
method (soluble or embedded gelatin microparticles).
126
Chapter 5
Thesis Summary and Future Directions
127
5.0 Thesis Summary We set out to develop a system to catalyze endo ents during ESC differentiation that
initiate an appropriate cascade of events towa ent. To improve current
methods, we ai eproducibility,
optimization, and cell production. With these design criteria in mind, we sought to mimic
icroenvironment to modulate or provide the necessary factors and
signals for mesoderm specification, and hematopoietic development. The factors we employed
included oxygen tension, serum-free media, initial aggregate size, local delivery of BMP4 and
TPO, and shear forces (~ 3 dyn/cm2 (Kao et al. 2007)). We hypothesized that applying critical
aspects of the dynamic in vivo microenvironment to ESC aggregates would positively influence
mesoderm specification and facilitate the controlled production of hematopoietic progenitor cells
from pluripotent stem cells. There has been significant progress in understanding the complexity
of the embryonic origins of the hematopoietic system, the developmental migration and the
important molecular cues that occur before adult long-term repopulating hematopoietic stem
cells are established in the bone marrow. Heterogeneity of the developing HSCs, with respect to
surface marker expression and quantification assays, has delayed the production of definitive
HSCs from pluripotent stem cells. As embryonic development is complex, we wanted to build a
framework that would provide both insight into the developmental processes and integrate
multiple engineering controls to manipulate cell fate during ESC differentiation.
To address the first objective, regarding the impact and mechanism of hypoxia on hematopoietic
progenitor cell production, we used a stirred-suspension bioreactor with oxygen control and
showed that blood and endothelial tissue specification is enabled by temporally changing levels
of Flk-1 signaling. As detailed in Chapter 2 we demonstrated a novel role for soluble VEGFR-1
(sFlt-1) in modulating hemogenic mesoderm fate by measuring VEGF and VEGFRs. Early
transient Flk-1 signaling occurred in hypoxia due to low levels of sFlt-1 and high levels of
VEGF, enhancing CFC generation. Sustained (or delayed) Flk-1 activation preferentially
yielded hemogenic mesoderm-derived endothelial cells. The localized interplay of these factors
may be essential in establishing the hemogenic niche and may allow independent initiation of
hemogenic niches in different parts of the embryo.
genous elem
rds blood developm
med to incorporate scalable methods and controls for culture r
characteristics of the in vivo m
128
This concept of the embryonic environment promoting hematopoiesis, in this case with low
for biomechanical forces. As embryonic hematopoietic clusters
ocault et al. 2007). In vitro, the presence of
TPO is essential to generate and maintain both long- and short-term repopulating mouse HSCs
oxygen, has also been explored
are associated with the dorsal aorta, the fluid shear stress in that environment was estimated and
applied in vitro (5 dyn/cm2), increasing Runx1 expression in CD41+cKit+ cells (Adamo et al.
2009). The bioreactor also provides shear stress, approximately 2.8 dyn/cm2 (based on literature
(Kao et al. 2007)), that may benefit hematopoietic development in conjunction with hypoxia.
Regarding the hypoxic bioreactor system, the pH was maintained at 7.4 buffered with CO2 while
O2 was maintained at 4 % oxygen tension. It has been reported that HEPES-buffer maintains
mononuclear stem cells on stroma for a greater period of time than 5 % CO2-bicarbonate-
buffered cultures (9 vs. 7 weeks (Tennant et al. 2000)). One early study examined tissue
oxygenation of rats in increased CO2 (hypercapnia) with either normal or low oxygen (Streeter et
al. 1975). Hypoxic-hypercapnic rats experienced greater detrimental effects despite being less
hypoxic and less hypercapnic than groups exposed to single environmental stresses (due to
increased ventilation). Erythropoietic activity ceased, and the rats had lower liver glycogen
levels, and lower growth rates with normal food intake. In our system we typically observed
more than 5% CO2 was required to maintain the pH. In the future it may be of interest to test the
hypoxic bioreactor with HEPES-buffer and constant 5% CO2, supplementing with fresh media if
cell growth begins to acidify the reactor or perfusing throughout the culture period. Overall, we
were able to examine and extend fundamental biology while determining a process that enhances
hematopoietic output by approximately 4- to 5-fold (CFC output).
We next moved to a serum-free system to facilitate directed differentiation by eliminating
confounding signals. Modifications to the N2B27 media were described in Chapter 3, as
mesoderm induction from ESC was examined with varying concentrations and timing of BMP-4,
VEGF and TPO supplementation. During embryogenesis extraembryonic secretion of BMP4
induces the node and primitive streak, while its expression in the embryo proper patterns and
mediates the formation of ventral mesoderm, including hematopoietic precursors (Johansson and
Wiles 1995, Fujiwara et al. 2002). Thus, BMP4 was provided to induce endogenous factors
within differentiating ESC aggregates. TPO and its receptor cMpl are expressed in the AGM
where HSCs clusters emerge, and in the FL, where both ligand and receptor play a role in the
early steps of definitive adult hematopoiesis (Petit-C
129
(Yagi et al. 1999) and TPO can enhance the number of LTC-IC from human bone marrow
(CD34+CD38- (Petzer et al. 1996)). Additionally, TPO/cMpl signaling promotes hematopoiesis
in the ventral blood island and the dorsal-lateral plate mesoderm in Xenopus (Kakeda et al.
2002). As this work was completed in normoxia, the timing for VEGF treatment (day 0-5)
followed the pattern discovered by investigating hypoxia in Chapter 2. By providing a few key
inductive and supportive factors that mimic some of the dynamic embryonic microenvironment,
these factors may be experienced by the differentiating cells as a surrogate for temporal
migration. Serum induction was surpassed with 5 ng/ml BMP-4, 50 ng/ml TPO and early VEGF
treatment (25 ng/ml d0-5), producing 292 ± 42 CFCs per 5 x 104 cells.
In Chapter 4 we continued to investigate the phenotype of developing hematopoietic stem cells
and extended our microenvironmental control systems. We found that an early phenotype,
E-cadherin-T+PDGFRα+Flk1+, is associated with CFC capacity. We also examined how
aggregate size affected the developing phenotypes and established that CFC output was maximal
with 100 cells per aggregate. Supporting the idea that controlling aggregate size influences the
relative importance of endogenous vs. exogenous factors, both computational modeling and
measuring local Stat3 phosphorylation demonstrate that a 2D 100 μm colony, equivalent to ~100
cells, was the minimum population to show the effect of endogenous signaling (Peerani et al.
2009). The aggregate size may also affect the opportunity and length scale of cell migration, as
cells down-regulate E-cadherin. In the future, live cell imaging of 3D aggregates would be an
exciting avenue of investigation. As well, we confirmed that exogenous VEGF is no longer
neutral (polar or nonpolar) side chains, that together give a protein its overall charge. At a pH
required in hypoxia, and that low oxygen supports mesoderm development under serum-free
conditions. In addition to VEGF, other soluble mediators and/or receptors are upregulated in
hypoxia and may maintain HSCs, for instance, cKit (Jogi et al. 2002), FGF-2 (Conte et al. 2008),
IGF-2 (Pringle et al. 2007), and Notch-1 (Gustafsson et al. 2005).
Finally, combining optimal aggregate size with local delivery of BMP4 and TPO from gelatin
microparticles in a low oxygen environment resulted in a more robust response to these inductive
cues than soluble delivery from the bulk media. Small volumes of the factors are added to
lyophilized gelatin particles and they are absorbed and released over time through swelling and
electrostatic mechanisms. The pH at which a particular molecule or surface carries no net
electrical charge is called the isoelectric point (pI). Amino acids may have positive, negative, or
130
below their pI, proteins carry a net positive charge; above their pI they carry a net negative
charge. We employed gelatin type B microparticles (pI 4.7-5.4) because they would be
negatively charged in a neutral buffered solution and have greater affinity to the positively
charged BMP4 or TPO (see Table 2), although certain factors may be more effective with gelatin
type A (pI 7.0-9.0). These processes could be applied with larger-scale bioreactor systems due to
the efficiency of the localized delivery and size-control system, providing a tunable platform for
developing cell therapies.
Table 2. Isoelectric points of various proteins
pI MW Est Charge 1(kDa) (pH 7)
BMP4 2 cMpl 3 FGF-2 4 IGF-1 5 IGF-2 5 TPO 1 VEGF 1
7.7 5.5 9.6 8.0 6.2
~9.3 ~8
13.1 85-92
18 7.7 7.5 38
24.5
0.2
8.2 4.6
1 http://www.scripps.edu/cgi-bin/cdputnam/protcalc3
2 Celeste et al. 1990
3 Moliterno and Spivak 1999
4 Cote et al. 2004
5 Enberg et al. 1984
We sought to expand our repertoire of microenvironmental control by incorporating growth
factor delivery within the aggregate. Interestingly, it has been reported that an outer shell forms
around the EB consisting of ECM, primarily collagen type I, a squamous layer with tight cell-
cell adhesions associated with E-cadherin, and a collagen type IV lining that is indicative of a
basement membrane (Sachlos and Auguste 2008). The authors suggest that this layer begins to
form after three days and report that molecular diffusion is reduced by more than 80 % during
EB differentiation (Sachlos and Auguste 2008). In our differentiation scheme we provided
exogenous factors in the first four days of culture, and determined the inductive capacity as a
result of this time frame. Thus, EB architecture would not be expected to limit the diffusion of
the soluble factors, and self-organization of the aggregates would create spheres that vary in
diameter by only 40 μm. However, the local delivery within the aggregate interior may provide
different and more numerous concentration gradients than the external delivery of the molecules
131
from the bulk media, altering the spatial response and overall cell activity or fate. Differences in
aggregate size due to cell number can also be related to a decrease in total surface area with
increasing aggregate size (0.34-fold decrease between 24 000, 5 cell aggregates and 750, 200 cell
aggregates). Additionally, it is possible that differences in aggregate size and resulting CFC
output was influenced by the exterior surface area and receptor interactions. These simple
geometric considerations suggest that changes in EB diameter will impact the relative ratio of
extraembryonic endoderm and related signaling molecules to the cells within the centre of the
EB.
In onclusion, w eter critical aspects of the dynamic in vivo microenvironment that
enhance hematopoietic progenitor generation are hypoxia, the concentration and timing of
BMP4, VEGF and TPO, and the size of the cell aggregate. We established that hypoxia
enhances hematopoietic progenitor cell production due to the competition of sVEGFR1 for
VEGF. Initial aggregate size may influence hematopoietic output due to differences in
endogenous factors, signaling gradients, or cell migration and HPCs were maximal with 100 cell
microparticles from within the aggregate
SC output, although future studies should confirm that the MP:cell ratio
change the optimal aggregate size. Nevertheless, using 100 cell
combination of hypoxia, shear stress, BMP4 and TPO delivery (with/without
EGF) appears to provide sufficient direction to produce a mature cell + +
c e d mined
aggregates. Providing the factors locally with gelatin
itself also enhanced H
and internal delivery does not
aggregates with the
provision of early V
population that may contain LTR cells (4% CD150 ,~12% CD45 Appendix A, Figure A6.B).
Additionally, we hypothesize that changing the exogenous signaling cues to reflect a different
microenvironment may influence hematopoietic output/maturation. Thus, three factors (BMP4,
Activin A, Wnt3a) that may represent an earlier developmental microenvironment than provision
of BVT were explored in Appendix A.
132
5.1 Future Directions
5.1.1 Philosophy
It is convenient to think that lineages segregate during development and that cell fate choices and
outcomes are distinct and can be determined or identified by definitive phenotypes. However,
recent clonal lineage information and current advances in cell reprogramming may
fundamentally change the way we view cell interactions and capabilities. Cells may retain
potential beyond that which is apparent to observation of their interaction with a typical
al and surface ectoderm segregation (Tzouanacou
et al. 2009). There may be a closer genealogical relation between neurectoderm and mesoderm
than between surface and neural ectoderm, implying that perhaps the emphasis of the three germ
layers should be on morphology and location rather than lineage specification. Related to this,
an intermediate layer that gives rise to both endoderm and mesoderm has been termed
mesendoderm (Rodaway and Patient 2001, Lewis and Tam 2006). However, evidence of this
bipotent progenitor was minimal in the study that detected N-M between E8.5-10.5; few
mesendodermal clones were detected (Tzouanacou et al. 2009). In a separate study, T and Foxa2
environment, growth pattern or even history. Given the proper cues with a supportive
environment, the plasticity of cells may continue to surprise us. Recently, induced pluripotent
stem (iPS) cells with similar capacities to ESCs regarding self-renewal and differentiation have
been created from both mouse and human somatic cells by transducing a combination of
embryonic genes into the cells (Takahashi and Yamanaka 2006, Takahashi et al. 2007, Wernig et
al. 2007, Yu et al. 2007, Park et al. 2008, Woltjen et al. 2009). Consider that upon provision of
the four Yamanaka factors c-myc, Klf4, Oct4, and Sox2, differentiated cells that had been
fulfilling a particular function can be reborn as it were and regenerate anew. Cells are resilient to
stresses and this continuum of cell behaviour and pliable nature has been recently been explored
in reviews on cellular fate and reprogramming (Graf and Enver 2009, MacArthur et al. 2009,
Nagy and Nagy 2010).
Clonal lineage tracing has challenged the paradigm that the primary branchpoint in
differentiation occurs during gastrulation as the three germ layers form and the pluripotent
epiblast differentiates towards specific tissues. A recent study using a genetic method to label
single cells in utero demonstrated that common neuromesodermal (N-M) progenitors persist
during gastrulation, past the point of endoderm
133
were mutually exclusive in their upregulation patterns in the early streak, indicative of
derm respectively (Burtscher and Lickert 2009). The existence
tent progenitors suggests that initial differentiation steps may employ the
m cells is shown below (Figure 5.1); as they provide answers to many
prospective mesoderm and endo
of multiple bi- or tri-po
same genetic pathways to regulate and coordinate diverse tissue development. Thus, we observe
the strong overlap in phenotypic markers and difficulty in directed differentiation.
As complex extrinsic and intrinsic processes coordinate the dynamic expression of countless
genes and proteins, cell fate control likely involves both deterministic and stochastic elements.
In a systems biology approach, cell types can be thought of as balanced states or ‘attractors’ of
molecular mechanisms or regulatory networks (MacArthur et al. 2009) First conceptualized over
50 years ago, Delbrück and Waddington independently described an ‘epigenetic landscape’ of
hills and valleys; different paths or cell fate outcomes that occur during developmental processes
result from traversing particular routes and surpassing barriers to differentiation before resting at
a local minima (stable state) with a unique molecular signature (MacArthur et al. 2009). With
this perspective, differentiation is not terminal and given sufficient perturbation cells can take on
different states, demonstrating a great degree of flexibility. Advances in lineage reprogramming
through the use of transcription factors has enhanced our understanding of cell fate choice during
differentiation, emphasizing the importance of transcription factor cross antagonisms in binary
cell fate choices (reviewed in Graf and Enver 2009). An interpretive representation of the
“infinite” potential of ste
biological questions and a viable source for many therapeutic applications. There are many
barriers, however, that must be overcome to reach this potential, to understand the differentiation
paths that may lead to a multitude of regenerative therapies.
134
Figure 5.1. Pluripotent stem cells: unlocking the potential. Embryonic stem cells were spun
into microwells overlaid with a mesh to prevent aggregate loss from the wells. The infinity symbol was
incorporated to represent the power of stem cells and the canvas was filled with mesh, representing the
obstacles that must be removed. Looking at the infinite potential, at first things may not be clear (as
represented by the opening on the left), however, as things are brought into focus and order, the cells
emselves become visible and are the key to moving forward. The power and influence of stem cells are
shown breaking down or distorting the barrier. The bubbles encompass the varied approaches and
directions that can be taken with stem cells, and the breach in the barrier allows new ideas/therapeutics to
spring forth. This is represented by a coloured bubble containing a photo of an endothelial cell network
that was generated within an embryoid body that looks like a man reaching out a helping hand to a
woman, as well as a heart.
th
135
5.1.2 Further Insights into ESC-HSC Phenotype and Function
nitive HSCs arise locally from the embryo body or from migrant yolk
sac cells, the cell-lineage relationship was studied with in vivo cell tracing of pulse-labeled cells
based on Cre/loxP recombination. This studied showed that E7.5 Runx1+ cells develop into fetal
lymphoid progenitors and adult HSCs (Samokhvalov et al. 2007). One caveat, however, is that
The disconnect between ESC-HSC phenotype and function in comparison to definitive HSCs in
part reflects the complexity of embryonic blood development as the process occurs in multiple
sites that are spatially and temporally separated. Circulation also confounds the ancestry and site
of origin of adult hematopoiesis and thus it remains a topic of research and discussion. One
point of debate is whether adult hematopoietic cells arise from the epiblast or from
extraembryonic cells that migrate from the yolk sac to the AGM. This insight would either
strengthen the idea that EB differentiation through yolk sac stages could produce the definitive
HSC, or may result in a shift in differentiation strategies (i.e. more focus on collagen type IV or
stroma cells) to focus on the microenvironment where definitive HSC are formed de novo.
However, this would not preclude the possibility that EB differentiation could generate primitive
HSCs similar to the yolk sac stages and later produce definitive HSC of an independent ancestry,
and in fact, the presence of extraembryonic cells may be required for the development of
definitive HSCs although they are unrelated by ancestry. Tissue grafting using non-mammalian
vertebrates (avian, amphibian, and xenopus models) demonstrated that the yolk sac was not the
source of definitive hematopoiesis (Dzierzak and Speck 2008). Mouse transplantation studies
demonstrated that cells capable of LTR appear only from E10.5 in the AGM region of the
embryo, and in the vitelline and umbilical arteries (Medvinsky and Dzierzak 1996, de Bruijn et
al. 2000). Definitive myeloid progenitors have been shown to develop in the yolk sac using two
mutant mice with deficiencies that do not establish a circulation between the yolk sac and
embryo body: VE-cadherin (Cdh5-/-) mutants that have no vascular connection (Rampon and
Huber 2003) and Ncx1-/- mutants that lack a heartbeat (Lux et al. 2008). Repopulation studies in
the mouse and explant cultures with human yolk sac cells found that only the PSp-AGM tissues
isolated prior to the onset of circulation contained cells with lymphoid-myeloid potential
(Cumano et al. 1996, Cumano et al. 2001, Tavian et al. 2001), although, definitive HSC
precursors derived from the yolk sac that require hemodynamic stresses to complete
differentiation would be missed. Instead of using transplantation/explant assays to address the
question of whether defi
136
Runx1 is also expressed within 0.5-1 day of detecton in the yolk sac at the base of the allantois
n of embryonic and in the PSp (Zeigler et al. 2006, Nottingham et al. 2007). Thus, the imprecisio
staging and the site of Cre recomination makes it difficult to conclude the unequivocal identity of
the Runx1+ cells.
As the origin of HSCs remains ambiguous, the direct precursors to definitive hematopoietic cells
also remain elusive. Evidence suggests, however, that FL and adult BM HSCs originate from a
subset of endothelial cells that line the blood vessels in the mouse, known as the hemogenic
endothelium (Yoshimoto and Yoder 2009). Time-lapse photography has shown that 48 h after
plating a transient cell population that expresses endothelial markers displays the potential to
form both primitive and definitive hematopoietic colonies (Lancrin et al. 2009). Another time-
lapse study tracked individually plated mouse ESC-derived mesoderm cells and found that 1.2 %
displayed properties of adherent endothelial cells, giving rise to non-adherent HSCs (Eilken et al.
2009). Runx1 expression was shown to be essential (E8.25-11.5) for the formation of HSCs
from hemogenic endothelium (Chen et al. 2009b), and a genetic tracing study of the AGM
endothelium demonstrated that this cell population and not the underlying mesenchyme was
capable of generating HSCs that would then migrate to the FL and BM (Zovein et al. 2008).
Together, these studies suggest that definitive HSCs can arise from hemangioblasts through a
hemogenic intermediate and that distinct and unrelated classes of functional hematopoietic cells
likely exist.
In all, it is encouraging that the SLAM family receptors can be used to isolate highly enriched
murine HSCs. The SLAM-enriched population is useful for gene transfer studies (Laje et al.
2009) as well as providing a tool to assess HSC self-renewal and ESC derived HSCs to further
guide differentiation strategies. The differential expression of SLAM family receptors may also
shed light on sources of human hematopoietic progenitors or stem cells, given the success of this
strategy in mice. One study showed that their expression patterns are not conserved across
species (Sintes et al. 2008). In humans, CD48, CD84, and CD244 are pan-hematopoietic
progenitor/stem cell markers, while CD150 and CD229 are not expressed. This is in contrast to
the mouse where CD84 and CD229 are pan-hematopoietc progenitor/stem cells while
CD150+CD48-CD244- clearly discriminate HSCs from progenitors (CD150-CD48+CD244+)
(Kiel et al. 2005). Functional studies may help characterize the potential of the populations
identified with the SLAM family receptors, and SLAM-associate proteins (SAP) appear
137
important in autoimmune and immunological disorders (Yin et al. 1997, Furukawa et al. 2010).
Investigation of SLAM family receptors and SAP may provide insights into human HSC
function in time, but currently our laboratory has established that human HSCs are best tracked
with AC133+CD38- as this characteristic phenotype does not change in ex vivo cultures and
enriches for LTC-IC and SCID-repopulating cells (Yin et al. 1997, Ito et al. 2010).
atal HSCs but did not affect adult HSCs. Virtually all long-term multilineage cells
(Sca1+Lin-cKit+CD48-) were Sox17+ in FL and neonatal cells, although it was undetectable in
Also of interest in understanding the phenotype and function of fetal and adult stem cells, are the
gene profiles and regulatory transcripts. In recent years, two members of the F-group Sox family
genes, Sox7 and Sox17 have come to light as being involved in lineage choices and
hematopoietic function in the murine system. Sox7 was enriched in day 5 EB Flk1+ cells as
compared to Flk1- cells (~20-fold), and at this timepoint the Flk1- cells were associated with
Sox17. Additional sorting of the Flk1+ cells on the chemokine receptor (CXCR4) showed that
Sox7 was associated with non-cardiac or vascular progenitors and not CXCR4+ cardiac
progenitors (Nelson et al. 2009). A narrow window of Sox7 expression appears important to
hemangioblast specification and hematopoietic commitment; Sox7 knockdown significantly
decreases the formation of both primitive and definitive hematopoietic progenitors and
endothelial progenitors, while sustained Sox7 expression promotes the maintenance of
multipotent hematopoietic precursors (Gandillet et al. 2009). Germline deletion of Sox17
resulted in a severe defect in fetal hematopoiesis and the conditional deletion of Sox17 decreased
fetal and neon
HSCs from 8-week old mice. Overall, Sox17 maintains fetal and neonatal HCS until
approximately 4 weeks after birth, a time associated with reduced proliferation and adult
phenotype (Mac1-AA4.1-) (Kim et al. 2007). With a greater understanding in the regulatory
networks and specific cell identity, strategies to engineer this state can only grow.
Interesting advances in our understanding of the dynamic aspects of the cellular environment
have also been emerging. Blood flow may fundamentally impact the development or maturation
potential of hematopoietic stem cells. Establishment of circulation (E8.5, in the mouse) delivers
oxygen and nutrients more widely throughout the embryonic tissues and the resulting fluid shear
stress or biomechanical forces are important in the formation of the heart and vessels (Hove et al.
2003, Lucitti et al. 2007). All vertebrate species have demonstrated functional HSCs arising
from the dorsal aorta (Cumano and Godin 2007), and both mouse (Adamo et al. 2009) and
138
zebrafish (North et al. 2009) models have shown that fluid shear stress enhances HSC number,
suggesting that it is an evolutionarily conserved phenomenon.
In the mouse, hematopoietic Runx1+ areas appear between E9-10.5 and it was hypothesized that
biomechanical forces might promote hematopoiesis given the anatomical relationship of HPCs
with mechano-responsive endothelium and the temporal correlation between circulation and the
ckout mice of
Nos3 (endothelial Nos) reduced hematopoietic progenitors (North et al. 2009). Pulsatile flow
appearance and expansion of HSCs. Applying the approximate aortic wall shear stress to
disaggregated EBs replated on gelatin for 48 h increased expression of CD31+, CD41+cKit+
hematopoietic precursors, as well as upregulated Runx1, Myb (myeloblastosis oncogene), and
Klf2 (Krueppel-like factor 2) (Adamo et al. 2009). Para-aortic splanchnopleura explants (E9.5),
the precursors of the AGM, also showed an increase in CFC with exposure to shear stress.
Ncx1-/- embryos fail to initiate a heartbeat and lack circulation due to a mutation in the sodium-
calcium exchanger Ncx1 (Koushik et al. 2001). The mutant embryos are deficient in P-Sp CFCs
(Lux et al. 2008), and have reduced CD41+ progenitors in the placenta (Rhodes et al. 2008).
Using this knockout model, it was shown that Runx1 and Klf2 levels are reduced in the
P-Sp/AGM region compared to wildtype controls and that shear stress applied to explant cultures
increases Runx1 to levels comparable to littermate controls (Adamo et al. 2009).
Using a zebrafish model, flow-modifying compounds were screened showing that
vasoconstrictors decreased blood flow and Runx1/cmyb cells while vasodilators increased HSC
formation (North et al. 2009). HSCs were reduced in silent heart embryos that lack a heartbeat
and blood circulation. The effects of blood flow was linked to the nitric oxide (NO) signaling
pathway, a known modulator of hematopoiesis (Aicher et al. 2003, Krasnov et al. 2008, Adamo
et al. 2009) that is regulated by shear-stress (Garcia-Cardena et al. 1998). Specifically, nitric
oxide synthase, Nos1, is responsible for HSC formation in zebrafish while kno
may induce NO to trigger HSC maturation and this may lead to bioprocess improvements that
enhance hematopoietic development in vitro. Alluding to this possibility, an earlier study
showed higher engraftment and multilineage reconstitution with CD34+ UCB grown in stirred-
culture as opposed to static culture (Yang et al. 2008). Additionally, megakaryocyte platelet
production is increased in the presence of shear (Dunois-Larde et al. 2009). Thus, the bioreactor
system may provide a crucial element for hematopoietic differentiation, and a necessary
component for later stages of differentiation to produce long-term repopulating HSCs.
139
5.1.3 Experimental Strategies
Intracellular and intercellular networks impact developmental fate decisions as cells reside in
, and 10 BAW
temporally dynamic and adaptive 3D microenvironments. Patterning of blood development
occurs in the embryo through complex interactions between embryonic and extraembryonic
lineages including organized cell migration, cell-cell contact, and autocrine/paracrine secretion,
employing multiple signaling pathways and transcription factors. We have described a flexible
bioreactor system that provides physiochemical controls including oxygen tension and shear, as
well as microparticle growth factor delivery. This work can be extended by combining these
methods with others and by looking at various aspects of the experimental observations in
greater detail.
The differences between the developing phenotypes during early stages of differentiation as
described in Chapter 4 were not fully explored at later time points. The baseline capacity of the
cells to differentiate into LTR cells that express the fetal or adult HSC phenotype
(CD45+EPCR+CD48-CD150+ or CD45+cKit+Lin-Sca1+CD150+) at day 7 (or later) could be
examined as well as influencing the cells after day 4 either post-sort or in aggregate form. As a
first step, we assessed the phenotypes of three cell treatments: 100 HBT, 100 BVT
(see Appendix A for details) and determined that the BVT conditions generated a more mature
cell phenotype with ~3.5% CD45+CD150+ while BAW induced a more immature phenotype
~30% CD41, with minimal CD45/CD150 expression. Transferring these conditions into hypoxia
for an additional five days, starting with three days of BT treatment, did not enhance CD150
from the original BVT conditions, although it did reduce CD41 to ~5% for the 10 BAW cells and
induce ~14% CD45+ by day 14. Thus, after determining peak expression of CD45 and CD150
from day 7 - 12, the CD45+ population could be compared to the CD41+ population using a
NOD-SCID mouse model. Sorting larger cell populations may allow sufficient cell recovery to
investigate and focus on the second phase of growth/differentiation that occurs after day 4. This
phase, however, appears to have a slower cycling rate as changes in cell number between day 4
and 7 were minimal (based on the cell counts completed to set up FACS and the CFC assay).
The effects of reaggregation and aggregate size, cell density, various cytokines, growth factors or
transcription factor combinations, and the influence of shear or oxygen tension would be
expected to impact cell function and yields. Additionally, the multipotency of the early
140
phenotypes (E-cadherin, T, PDGFRα, Flk1) could be assessed immediately post-sort in
rowth factor release and enhance the reproducibility of the delivery system.
conditions supportive of the three germ layers.
Developing a greater understanding of the patterning that occurs with MP growth factor delivery
and further optimization will be important to future applications. As a first step, we have started
to work on developing a microfluidic device to generate more uniform gelatin microparticles
(Figure 5.2A). A polydimethylsiloxane (PDMS) mold was prepared with one central channel for
the molten gelatin and two inlet ports to introduce an oil phase that pinches off droplets based on
shear before they are collected in a chilled tube prior to crosslinking. This design may be revised
to initiate gelatin crosslinking on-chip. The uniform particles (~12 μm) will allow greater
control over g
Following this improvement, more detailed studies of the aggregates with microparticle
incorporation and protein release can be undertaken. With microparticle delivery, the growth
factor is localized in the immediate cellular environment and is absent in the bulk media; the
release rate of the factor is important to the stages of differentiation and gaining a greater
capacity to tune this variable will be important. Factor combinations and release may be fine
tuned as slower release is associated with PLGA particles, and commercially available
LumAvidinTM microspheres may provide covalently bound biotinylated ligands for the length of
the culture period. The orientation of growth factor delivery may also be an important
parameter. As the completed studies employed a relatively homogenous distribution of MPs, it
may be informative to deliver factors in a shell and core configuration or from one hemisphere
(Janus particle) (Figure 5.2B).
141
A
desired outcome, it is important to understand the fundamental
characteristics of the end state as well as the important stages along the way, remembering that a
cell does not typically act in isolation and that regulatory measures likely depend on the
population as a whole. Keeping this in mind, it is important to retain flexibility when trying to
envision a feasible cell differentiation program, as we have started with this project. Cell
aggregates of variable size can be generated, with MPs containing particular growth factors
(release rates may be tunable through extent of crosslinking or type of particle used), MPs can be
homogenously distributed or in a specific configuration, the aggregates may be dissociated or
not, sorted/purified by FACS or magnetic columns, and grown in the presence of shear in
suspension, or on surfaces. However the actual path taken by the cells may not be clear, and
thus, moving forward with studies that involve ectopic transcription factors will be equally
B
Figure 5.2. Future methods: gelatin microparticle formation and their incorporation into
aggregates. Approximately 4000 gelatin microparticles can be formed per second barring flow
disturbances. This project is in collaboration with Prof. Eugenia Kumacheva, and the work has been
completed by Ethan Tumarkin (supplied image) (A). The scale bar is 200 μm. Microparticles can be
incorporated homogeneously for uniform delivery (Bi), with a distinctive core (blue PLGA MPs) and
shell (red gelatin MPs) configuration to provide ‘doughnut’ delivery (Bii), or as a Janus particle to
provide hemispherical delivery (Biii-iv). Ongoing work related to growth factor release and MP
orientation is in collaboration with Prof. Todd McDevitt and Andrés Bratt-Leal (supplied images).
In order to direct a cell to the
i ii iii
Gelatin-MP PLGA-MP
142
important. Instead of starting with an embryonic stem cell and directing its developmental path
could be discovered it may be possible to
u
tiation is necessary to
t
rentiated cell closer to the
Delivery of certain transcription factors may be problematic due to instability of particular
proteins. For example early developmental processes, such as body-part patterning along the
pinal axis, are coordinated by HOX transcription factors which have a highly conserved DNA-
inding motif or homeodomain. In mammals, the four main families of HOX factors are
rrang linear m ifferent loci (groups A, B, C and D) and are conventionally
ription
factor 1) that cooperatively dimerizes with HOXB4 (Krosl et al. 1998, Krosl et al. 2003b).
to investigate how intracellular concentration affects HSC fate (Csaszar et al. 2009). The
forward, if the cellular ground state of HSCs
circ mvent this and directly reprogram somatic cells. Or it may be that a nested combination of
tion factor-mediated lineage conversion with directed differen
e cell of interest. You can envision resetting a committed cell to an earlier branchpoin
and then differentiating or reprogramming again, or moving an undiffe
desired progenitor type, and giving the final nudge through transcription factors.
transcrip
obtain th
s
b
a ed in a co- anner at d
numbered based on their chromosomal order. The role of this gene family has been studied in
hematopoietic development as some HOX factors are expressed by HSCs or dysregulated with
acute myeloid leukaemia (Magli et al. 1997). In particular, HOXB4 has been extensively studied
as a way to increase self-renewal of HSCs (Sauvageau et al. 1995) and transduced BM cells
expressing HOXB4 transplanted into lethally irradiated mice result in normal numbers of HSCs
subject to natural homeostatic controls. Although the mechanism is not fully characterized, this
expansion can be further increased by downregulating PBX1 (pre-B-cell leukaemia transc
Interestingly, TPO has been implicated as a positive regulator of HOXB4 expression (Kirito et
al. 2003) and in enhancing nuclear import of HOXA9 (Kirito et al. 2004).
Coupled with growth on supportive OP9 stroma, HOXB4 has also been induced in ESCs to
generate HSCs that engraft lethally irradiated adult mice and contribute to long-term,
multilineage hematopoiesis (Kyba et al. 2002, McKinney-Freeman et al. 2008, Matsumoto et al.
2009). To avoid genetic manipulation HOXB4 can be delivered ectopically as a TAT-HOXB4
protein (Krosl et al. 2003a), however, manual dosing strategies are labor intensive due to the
protein’s instability and produce concentration fluctuations. Our lab recently developed an
automated dosing system that accounts for the short intracellular (1.4 ± 0.2 h) and extracellular
(3.7 ± 1.8 h and 78 ± 27 h at 37 ºC and 4 ºC, respectively) half-life of the TAT-HOXB4 protein
143
delivery of HOXB4 to differentiating ESCs may favour generation and expansion of a HSC
population. The automated system was coupled with a mathematical model to control dosing
and validated with primary human peripheral blood samples showing significant expansion of
primitive progenitor cells (Csaszar et al. 2009). As this clinically relevant tool is a small volume
bioreactor system, EB dissociation and population purification would likely be required before
incorporating it into the ESC differentiation scheme. This may be an intermediate step in the
differentiation route and may also need to be followed by a process that incorporates shear.
Methods from
Overall, the application of cytokines and microenvironmental controls to regulate transcription
factors and gene networks, or direct application of transcription factors point to a multifaceted
approach to facilitate the development of a robust system capable of generating large numbers of
HSC. The single cell LTC-IC assay (Moore et al. 1997) will be essential to assess the functional
capacity of highly purified cell populations (CD45+EPCR+CD48-CD150+ or
CD45+cKit+Lin-Sca1+CD150+). To explore population dynamics and effects on differentiation it
might be interesting to separate out Flk1+ and Flk1- cells (FACS or magnetic antibodies), and
culture them at different doses with undifferentiated cells to see if they help direct
differentiation. Also, if OP9s are a necessity to HSC development and suspension culture is
desirable, they can likely be cultured in the agarose gel drops with fibronectin mixed in prior to
gellation (Karoubi et al. 2009). An integrative approach that incorporates experimental
advancement with computational modeling and understanding of transcriptional regulatory
networks will inform future directions.
5.1.4 Transfer of Scaleable Propagation and DifferentiationmESC to a Serum-Free hESC or hiPSC System
In our lab, stirred suspension culture systems for mouse ESC differentiation have proven
amenable to the production of hematopoietic cells or cardiomyocytes (Dang et al. 2004,
Bauwens et al. 2005). Physicochemical control of oxygen tension or glucose concentration can
enhance target cell production, and embryoid bodies initially grow within agarose hydrogel
capsules to prevent aggregation within the bioreactors. Ideally, many of the systems developed
for mouse ES cells can be successfully adapted. Human ESC (hESC) culture has advanced
greatly over the past 10 years and an offshoot of this work are human induced pluripotent stem
cells (hiPSCs), somatic cells converted by forced expression of key ESC-associated transcription
factors to a state sharing many characteristics with hESC. With the aim of realizing the clinical
144
potential of PSCs, transferring technology from the murine to human model will require
innovative strategies for expansion as well as control strategies for differentiation.
Our lab is currently pursing methods to propagate hESC in an undifferentiated state with
conditioned/defined media in a 3D spheroid in a hypoxic stirred suspension culture system or
Aggrewell plate system (Ungrin et al. 2008), such that the spheroid is easily transferable to
differentiation cultures pre-formed or as a newly formed aggregate. Embryoid bodies have been
shown to grow from small numbers of initiating cells in slowly turning lateral suspension
nto tissue constructs that are oxygen limited.
from the mouse to the
cultures (Gerecht-Nir et al. 2004a), and hypoxic conditions may improve undifferentiated cell
expansion and EB formation (Ezashi et al. 2005). Thus, combining the two ideas may prove
beneficial. As poor cell growth is often observed following EB formation (Niebruegge et al.
2009) it may be necessary to maximize hESC numbers prior to inducing differentiation, such that
a selective process occurs leaving only the targeted cell type. The first report of forced
aggregation of single hES cells estimated an HPC frequency of 1:500 input cells and optimal
myeloid-erythroid-output with 1000 cells/EB (Ng et al. 2005). Control over aggregate size is an
important variable, thus we developed a more high-throughput method of cell aggregation
(Ungrin et al. 2008), and have also begun to investigate MP growth factor delivery within hESC
aggregates. One application of these advances would be to combine MP delivery of high
concentrations of VEGF with hypoxia to enhance the formation of vascular networks; a
multitude of small aggregates could then be combined to generate a larger vascular network
(Gentile et al. 2008) or be incorporated i
Although the studies in this thesis all involved mESCs, some of the hematopoietic findings from
the hESC system were also introduced. The exact steps needed to move
human system and ultimately to bring PSC derived hematopoietic therapies into the clinic cannot
be presently foretold. I believe, however, that the cumulative knowledge and continued efforts
within this field will lead to the successful application of ex vivo derived/expanded
hematopoietic stem and progenitor cells.
Both mouse and human ESCs were derived from blastocyst-stage embryos, but the literature
demonstrates there are several differences in their biological properties and in the signaling
pathways associated with their self-renewal or differentiation. hESCs form large flattened
colonies that are two to four cells thick over feeders, while mESCs form rounder compact 3D
145
colonies (Ginis et al. 2004). This may reflect that human epiblast cells form a simple flattened
structure called the embryonic disc after blastocyst formation while rodent epiblast cells
reorganize from a ball of cells into a cup-shaped epithelium. Additionally, the doubling time of
nzymatic
dissociation of hESCs disrupts E-cadherin signaling, and fatally perturbs integrin signaling. In
hESCs is 3-4 times longer than mESCs (12 h), and the cell-surface markers associated with
pluripotency are differentially expressed (reviewed by Hyslop et al. 2005). Distinct mechanisms
of self-renewal are also apparent for mESCs and hESCs although both express the pluripotency
factors Oct4 and Nanog. In serum-free conditions, mESC self-renewal occurs in the presence of
LIF and BMP4; Jak/Stat3 is activated to inhibit differentiation to mesoderm and endoderm
lineages and Smad1/5 activates Id expression to inhibit neuroectoderm. On the other hand,
hESCs inhibit BMP4 via FGF2 and noggin, SMAD2/3 is activated by TFGβ, activin A or nodal,
and the PI3K/AKT pathway and stabilization of β-catenin are also involved (summarized by
Hyslop et al. 2005). This suggests that the biological properties and cell culture requirements for
mESC and hESC reflect distinct states of pluripotency.
As mentioned previously, hESCs are sensitive to enzymatic dissociation with massive cell death
resulting from single cell suspensions. Using the ROCK inhibitor prevents apoptosis allowing
cultures to be manipulated similarly to mESCs (Watanabe et al. 2007), although the mechanism
involving the actin cytoskeleton is not clear. Recently, a high-throughput chemical screen
identified the mechanism of action of two compounds that enhance the survival of hESCs (Xu et
al. 2010). Cell survival and self-renewal can be regulated by cell-cell adhesion mediated by
E-cadherin signaling and by cell-ECM adhesion mediated by integrin signaling. E
contrast, mESCs quickly stabilize newly synthesized E-cadherin and remain viable following
dissociation. Of great interest, hESCs were cultured with LIF in the presence of mitogen-
activated protein kinase/extracellular signal-regulated kinase (MEK) inhibitor and p38 inhibitor;
the converted hESCs grew faster and displayed compact rounded colony morphology similar to
mESCs. In all, hESC conditions favour integrin signaling while mouse conditions favour
E-cadherin signaling (Xu et al. 2010).
To understand differences between conventionally derived mESC and hESCs, cell lines have
been derived from postimplantation mouse epiblasts in the presence of Fgf and activin (Brons et
al. 2007, Tesar et al. 2007). Termed EpiSCs, these cells express pluripotency factors (Oct4,
Sox2, Nanog) but do not contribute to blastocyst chimeras. mESCs can also be converted to
146
EpiSCs in culture (Guo et al. 2009), and may be analogous to hESCs (Rossant 2008). It has been
proposed that mESCs (preimplantation ICM stage) represent a naïve pluripotent ground state
while mEpiSCs and conventional hESCs may represent a primed state or later stage of
pluripotency (Nichols and Smith 2009). Understanding the initial developmental status of the
different pluripotent lines is important to define starting conditions for differentiation and to
extend mESC findings to therapeutically relevant cell types. One promising avenue of research
that may align hESC differentiation protocols with mESC results is the conversion of typical
hESCs to a more immature state that would have properties similar to naïve pluripotent mESCs.
This has recently been achieved with hESCs by ectopic induction of Oct4 in the presence of LIF,
forskolin (to induce Klf4 and Klf2), and inhibitors of glycogen synthase kinase 3β (GSK3β) and
the MAPK pathway (Hanna et al. 2010). Thus, the challenges of deriving hematopoietic
therapies from PSCs will be met in the future.
Appendix A
The Impact of Exogenous Factors
147
148
Questions remain regarding what sta topoietic progenitors represent, how
they compare to cells isolated from adult sources, and how well they function in vivo. Gene
expression occurs i imics the normal
embryonic development and specification of hematopoetic cells (Keller 2005). GATA2
functions at multiple steps in hemangioblast development and is a direct target of BMP4 (Ling et
al. 2004, Lugus et al. 2007), and enforced expression can upregulate Bmp4, Flk1, and Scl,
enhancing expansion of hemangioblasts (Flk1+ cKit+ cells), primitive erythroid progenitors and
endothelial cells. Wnt signaling pathways are involved in regulating the development and
proliferation of immature hematopoietic progenitors, and play multiple roles during lymphocyte
growth (Staal and Clevers 2005). A stage-specific role of the Wnt/β-catenin pathway has also
been demonstrated (Naito et al. 2006); activation during EB formation (day 0-3) enhances
cardiomyocytes while suppressing differentiation into hematopoietic and vascular lineages while
late activation (day 5-10) has the inverse effect.
During embryonic development the adhesive interactions between cells and/or their surrounding
ECM are important. In the mouse, E-cadherin is present from the morula stage (Halbleib and
Nelson 2006) and remains high until epiblast cells undergo the epithelial-mesenchymal transition
and form the primitive streak mesoderm (Damjanov et al. 1986). Disrupting E-cadherin function
can cause epiblast cells from the streak stage to acquire increased cell-substratum adhesion
characteristic of mesoderm (Burdsal et al. 1993). Brachyury (the T gene) also plays a role in
mesoderm formation and organization, and homozygous mutants show a reduction in mesoderm
and severe morphological disruption of mesoderm-derived structures (Wilkinson et al. 1990).
Wild-type embryos express T in nascent mesoderm and in the notochord; the severity of defects
observed with different mutant alleles relate to the disruption of the primitive streak and correlate
to brachyury expression along the body axis (Herrmann 1991).
The primitive streak can be described as the conduit of cell migration during germ layer
formation; thus it has been extensively studied during gastrulation for patterns of endodermal
and mesodermal precursor migration (Mikawa et al. 2004), as well as with in vitro EB correlates
(Leahy et al. 1999). During EB differentiation brachyury expressing cells have demonstrated
endoderm potential in addition to mesoderm commitment to the hematopoietic and endothelial
ge ESC derived hema
n an ordered fashion during EB differentiation that m
149
lineages (Kubo et al. 2004). Thus, to explore the potential hematopoietic progenitors more
clearly we additionally monitored two RTKs, PDGFRα and Flk-1, from cluster II (PDGFRα/c-
of E-cadherin expression by day 3.5 (Figure
A.1A). Mesodermal differentiation occurred as Brachyury (T-GFP) rapidly increased from day
d (Figure A.1Ci-iv).
Kit/Flk1) on chromosome 5 (Brunkow et al. 1995). Both PDGFRα and Flk-1 have been detected
with in situ hybridization in the early mesoderm of gastrulating embryos (Orr-Urtreger and Lonai
1992, Schatteman et al. 1992, Yamaguchi et al. 1993). The receptors are expressed in
unpatterned mesoderm and the subsequent downregulation of Flk1 has been associated with
paraxial mesoderm whereas the downregulation of PDGFRα has been associated with lateral
plate mesoderm (Sakurai et al. 2006).
We were intrigued by the thought that the various methods or growth factors used to induce
mesoderm may mimic different niches and result in hematopoietic progenitors with different
capacities. Using the serum-free media system, we examined an alternate trio of mesoderm
inducing cytokines, 1 ng/ml BMP-4, 2 ng/ml Activin, and 3 ng/ml Wnt3A (BAW) that may
represent an early primitive streak stage or earlier inductive signal than BVT. Treatment with
BAW resulted in an almost complete reduction
two to three, and PDGFRα expression mimicked this increase about 12 hours later. Flk1 was
also upregulated, but in contrast to PDGFRα a maxima was reached around day 3.5. By tracking
the progressive expression of E-cadherin, Brachyury, PDGFR-α, and Flk1 during differentiation
we have 16 possible phenotypes that emerge over time (Figure A.1B). It is not known whether
each of these combinations has a unique trajectory of differentiation or functional capacity. The
broadly mesodermal population (E-T+) mainly contains P+F+/- cells until day 3.25/3.5, after which
time a P-F+ population emerges. Based on the kinetics of the phenotypic progression and
hypothesis that populations down regulate brachyury after VEGF/PDGF receptors are expressed,
we collapsed the 16 phenotypes to 8 characteristic phenotypes. Differentiation kinetics were
monitored for four independent experiments, with similar responses observe
150
0 1 2 3 40
20
40
60
80
100
% p
ositi
ve
Time [day]
Ecad T Flk1 PDGFRα
0 1 2 3 40
20
40
60
80
100
% e
xpre
ssio
n
Time [day]
E+T+P+F+ E+T+P+F- E-T+P+F+ E-T+P+F- E-T+P-F+ E+T+P-F+ E+T+P-F- E-T+P-F- E+T-P+F+ E+T-P+F- E-T-P+F+ E-T-P+F- E-T-P-F+ E+T-T-F+ E+T-P-F- E-T-P-F-
cadherin drop dramatically from day 2-3.5, while the remaining three markers increase expression starting
day 2, with T and PDGFRα reaching the highest levels of expression. All combinations of factors
expressed are shown (B), with the factors grouped based on literature expectations into broad categories
(Ci-iv). The expression patterns of these markers demonstrate that the dynamic induction varies slightly
with passage/line history. Cells were initiated in liquid suspension culture at 75 000 c/ml.
A B
C
Figure A.1. The general progression of lineage commitment can be tracked over time. Single
marker expression is shown for E-cadherin, brachyury (T), PDGFRα and Flk1 (A). High levels of E-
} Mesendoderm } Mesoderm } Endoderm
0 1 2 3 40
20
40
60
80
100
% e
xpre
ssio
n
Time [day]
0 1 2 3 40
20
40
60
80
100
Time [day]
0 1 2 3 40
20
40
60
80
100
% e
xpre
ssio
n
Time [day]
0 1 2 3 40
20
40
60
80
100
Time [day]
E+T+P+F+/- E+T-P+F+/- E-T+P+/-F+/- E-T-P+/-F+/- E+T+P-F+/- E+T-P-F+/- E-T+P-F- E-T-P-F-
151
Mesendoderm Mesoderm Endoderm0
20
40
60
80
100
% p
heno
typi
c ex
pres
sion
BAW treatment
1 5 10 20 50 100 200
Mesendoderm Mesoderm Endoderm0
20
40
60
80
100
% p
heno
typi
c ex
pres
sion
BVT treatment
1 5 10 20 50 100 20
In addition to comparing the two growth factor combinations we wanted to explore the effects of
tely
lls
igure A.2. In response to growth factor cocktail different numbers of initiating cells
nhance mesodermal potential. Cells grown in serum free differentiation media with 1 ng/ml BMP4,
ng/ml Activin and 3 ng/ml Wnt3a (BAW) from d2-4 were assessed by flow cytometry and categorized
having mesendoderm (E+T+/-P+F+/-), mesoderm (E-T+/-P+F+/- or E-T+/-P-F+), endoderm (E+T+P-F+/- or
T condition.
aggregate size on mesodermal differentiation. We examined cell phenotype at approxima
.75 days for each condition (1-200 initiating cells) grown in either BAW or BVT. With the
xception of the 1 cell per aggregate condition which maintained or lost cell numbers, the ce
oubled (log (N/No)/log (2)) 2.6-5.0 times over the four days prior to phenotype assessment, with
o significant differences between cytokine cocktail or initial size (ANOVA). With BAW
duction, mesoderm potential appeared to decrease with aggregate size, as endoderm potential
creased (Figure A.2A). In contrast, BVT induction modestly enhanced mesoderm potential
ith increasing initial cell numbers while endoderm potential decreased (Figure A.2B).
B
3
e
d
n
in
in
w
A 0
F
e
2
as
E+T-P-F+/-), or unknown (E-T+/-P-F-) potential. Initiating differentiation with one to ten cells produces
mesodermal phenotypes in 69.4 ± 11.5 % of the total cells on d3.75. Aggregates initiated with 20-50 cells
had decreasing and more variable mesoderm induction before dropping to 22.3 ± 14.4 % induction for
100-200 cell aggregates (A). Cells (1-10) treated with 5 ng/ml BMP4, 25 ng/ml VEGF, and 50 ng/ml Tpo
(BVT) produced 21.0 ± 3.5 % mesodermal phenotype, with a modest increase to 34.8 ± 4.4 % for 100-
200 cell aggregates (B). For both treatment conditions, endoderm potential was detected in an opposite
trend to mesoderm, and more cells were categorized as having unknown potential in the BV
152
Figure A.3. The cytokine cocktail influences CFC output and endoderm gene induction
We proceeded to examine hematopoietic colony formation from day seven EBs to assess
whether the hemogenic capacity mirrored the trends of the combined phenotypic response that
was observed upon varying initial aggregate size. Following BAW treatment, as predicted by the
phenotype, more hematopoietic colonies were generated from 10 rather than 100 cell aggregates
(Figure A.3A). 10 cell aggregates treated with either BAW or BVT produced a similar number
of colonies, although this would not have been predicted based on the phenotypic expression
(67.9 ± 9.6 % vs. 29.8 ± 3.6 %). A striking increase in CFC was observed with 100 cell
aggregates treated with BVT, matching its phenotypic trend.
A B
differently based on the initial aggregate size. Minimal CFC form in the absence of cytokines.
Aggregates initiated with 10 cells in serum free differentiation media with 5 ng/ml BMP4, 25 ng/ml
VEGF, and 50 ng/ml Tpo (BVT) generate similar CFCs as compared to providing 1 ng/ml BMP4, 2
ng/ml Activin A, and 3 ng/ml Wnt3a (BAW) from day 2 (129 ± 21 vs. 159 ± 4 respectively). Greater
numbers of CFC are produced from 100 aggregate cells with BVT (d0-4) in contrast to BAW treatment
(d2-5) (346 ± 20 vs. 60 ± 7) (A). Replated day 7 EBs were grown on matrigel with 5 ng/ml bFGF to
induce endoderm formation until harvest on day 14, at which point qRT-PCR analysis was completed. 10
or 100 cell aggregates from BAW or BVT treatments were compared to LSC aggregates initially grown
without growth factors. E14.5 FL cells were used as a positive control. Large 100 cell aggregates
initially treated with either BVT or BAW demonstrated greater expression of endoderm genes than 10 cell
aggregates and had a similar gene induction pattern as FL cells, with the exception of Tat. (B).
50 100 200 10 100 10 50 100 200
1
1
2
2
3
3 1050
0
50
00
50
00
50
00
CFC
/50
000
cells
itial aggregate size and cytokine treatmentBVTBAW
InNo cytokines Sox17 Afp Alb1 Tat Cps1-2
0
2
4
6
8
10BVT
Gen
e ex
pres
sion
no
rmal
ized
to G
AP
DH
100BVT 10BAW 100BAW FL
LSC-0
153
To examine whether lineage specification for endoderm potential followed the phenotypic trends
based on initial aggregate size d7 EBs were transferred onto matrigel coated plates. The cells
were maintained for an additional seven days in a serum-free endoderm supportive media
containing bFGF (Kubo et al. 2004). Following adherence the cells from the EBs dispersed,
displaying a 2D morphology for the remainder of the culture period (data not shown). RNA was
harvested from the plates and analyzed for primitive and definitive endoderm markers. 10 or 100
cell aggregates initially grown in the different growth factor treatments were compared to LSC
cells initially grown without growth factors, as well as to embryonic day 14.5 fetal liver (E14.5
to endoderm development, including:
theses genes are the
Cps1) and
Sox17) to
Αfp and
ards higher
. Initial 10 cell
ere induced
the greatest
FL) cells (Figure A.3B). We monitored genes related
Sox17, as it is associated with both primitive and definitive endoderm (Qu et al. 2008, Niakan et
al. 2010); α−fetoprotein (Afp) and alubmin (Alb1), as the upregulation of
earliest indicators of hepatic specification; and carbamoyl phosphate synthetase I (
tyrosine aminotransferase (Tat), two enzymes characteristic of maturing hepatocytes (Gouon-
Evans et al. 2006). E14.5 FL cells exhibited a progression of markers from primitive (
definitive endoderm, (Cps1, Tat); larger aggregates from both conditions had enhanced
Alb1 (primers listed in Table 3). Cells treated with BAW showed a trend tow
induction than BVT, and additionally expressed the enzyme encoded by Cps1
aggregates showed minimal expression of endoderm, although low levels of Alb1 w
with BAW. Overall, the phenotypic prediction held for the BAW condition with
endoderm induction occurring in the large aggregates, although this was not the case for BVT.
This was probably due to the relative differences in the observed phenotype; for 10 and 100 cell
aggregates respectively, BAW expressed 5.1 ± 1.6 % vs. 47.2 ± 8.1 % endoderm potential while
BVT had nearly the same expression in both sizes 14.8 ± 2.9 % and 12.9 ± 9.5 %. Further
studies would be required to determine whether BAW treatment causes mesendoderm
progenitors to make an earlier commitment choice such that aggregate size favours one or the
other cell fate (i.e. mesoderm with small aggregates and endoderm with large) while BVT seems
to maintain bi-potency (i.e. both mesoderm and endoderm output increased with aggregate size).
Nevertheless, BVT appears less inductive for the assayed endoderm gene expression.
154
Table 3. Primers used for qRT-PCR: assessing the endoderm potential of d14 plated EBs.
Gene Forward primer Reverse primer
Sox17 GATGCGGGATACGCCAGTG CCACCACCTCGCCTTTCAC
Αfp/αFP GTCTGCTGGCACGCAAGA TCGGCAGGTTCTGGAAACTG
Alb1 GCTACGGCACAGTGCTTG CAGGATTGCAGACAGATAGTC
Tat ACCTTCAATCCCATCCGA TCCCGACTGGATAGGTAG
Cps1 ATGACGAGGATTTTGACAGC CTTCACAGAAAGGAGCCTGA
A difference in the mechanism behind commitment was also hinted at by an experiment that
queried whether mesoderm induction could be affected by the conditioned media of different
sized aggregates (Figure A.4A); conditioned media (CM) from 10 cell aggregates supplemented
100 cell aggregate cultures and vice versa. The two different exogenous growth factor cocktails
had maximal CFC output with different initial sizes, 10 cells with BAW and 100 cells with BVT.
Media was conditioned from days 2-3.5 before being used in an experiment started 1.5 days later
such that 50:50 fresh to CM was exchanged between aggregate sizes. Specifically, fresh media
with the respective growth factors was supplied to 10 cell aggregates with 100 cell CM and to
100 cell aggregates with 10 cell CM. As mentioned previously, 10 cell aggregates with BAW
produced similar numbers of CFC compared to the 100 cell aggregates with BVT, and the output
was not affected by the alternate size media exchange (Figure A.4A). We hypothesize that
endogenous factors have more of an effect with increasing aggregate size, and that the small
aggregates would be most affected by the exogenous factors (BAW or BVT). We outline the
interplay between exogenous and endogenous factors in a schematic that highlights the
difference between treatments; maximal CFC are produced with BAW when exogenous factors
are most influential (low cell numbers), while endogenous factors play a role with BVT (Figure
A.4B). The factors produced by 100 cell aggregates would have a greater balance of stimulatory
effects in BVT and inhibitory effects in BAW. This mechanistic view can explain the response
to the conditioned media exchange as depicted in Figure A.4C. The inhibitory factors were
sufficiently diluted by the media exchange, as the 100 BAW aggregates approached the 10 BAW
CFC response and the 10 cell aggregate CFC numbers were not reduced by the 100 cell CM. On
e other hand, the stimulatory factors produced by 100 BVT aggregates enhanced the 10 BVT
CFC response and the 10 cell CM had no appreciable effect on larger aggregate output. One
th
155
would be able to test the strength of the inhibitory conditioning by using a transwell insert to
e a well with both 10 and 100 cell aggregates. produc
A
10 10+100CM 100 100+10CM LSC0
20
40
60
80
100
CFC
/50
000
d7 c
ells
Aggregate Size (+CM d2-4, 50:50)
BAW BVT
Inhibitory
Stimulatory
Conditioned media
Endogenous factors
Exogenous BVT Exogenous BAW
Endogenous factors
CFC output
CFC output
B
C
Addition of Stimulatory Endogenous factors
Dilution of Inhibitory Endogenous factors
156
Figure A.4. Conditioned media can enhance the CFC output of the least inductive
Similar numbers of CFC were generated by 10 cell aggregates with BAW and 100 cell
aggregates with BVT (factors provided d2-4; n=1). The CM exchange did not significantly alter these
outputs (flat trend line indicated), however, both of the conditions that produced the least CFC with
regular feeding benefited from the CM exchange (arrows) (A). A schematic of CFC response based on
the aggregate size and growth factors provided (BAW or BVT). The maximal CFC response is depicted
at the top of the triangle and the influence of the exogenous or endogenous factors are shown below
(BAW on the left hand side, BVT on the right). The media was exchanged within each treatment group
between the 10 and 100 cell aggregates as indicated (B). The CFC response leveled out and approached
the maximal level as a result of the media exchange (C). A possible mechanism that accounts for the
contrasting trends of BAW and BVT is shown; 10 CM to 100 cell aggregates in BAW may dilute
inhibitory factors while 100 CM to 10 cell aggregates in BVT may add stimulatory factors resulting in an
increase in CFC output.
plete this idea, experiments would explore the endogenous factors and differences
between the cell populations in greater detail. General approaches that could be taken would be
to compare the transcriptional repertoire of the different aggregate sizes and treatments,
identifying up- and down- regulated genes that correspond to different functional responses, or
identifying and accurately quantitating proteins or a set of proteins of interest. The first approach
is based on affinity reagents and specific antibodies using an array of methods for detection,
while the second would typically employ mass spectrometry (MS)-based quantitative proteomics
(Picotti et al. 2009), although large-scale western blot assays can identify large numbers (> 600)
of protiens, signaling molecules, and phosphorylation events (Schulz et al. 2007). MS-based
proteomics most often employ a shotgun strategy to identify a subset of peptides present in a
est following collision-induced dissociation by a tandem mass spectrometer
(Aebersold and Mann 2003). The drawback of such studies is that they can only be performed in
highly specialized laboratories, and would entail a significant amount of time/labour, and
experimental and computationl overhead.
The Luminex® system is a technology that color-codes tiny microspheres to allow over 100
ytokines/chemokines of interest to be quantified simultaneously. Preliminary work (in
collaboration with Edward Sykes), screened 10 factors associated with the differentiation and
conditions.
To com
tryptic dig
c
157
proliferation of hematopoietic progenitor and stem cells. The base media of our serum-free
differentiation system contains a variety of hematopoietic cytokines, with IL-2 and IL-10 the
that would initiate the signaling pathways.
most abundant of those tested (Figure A.5A). The fold-change over the base media shows that
interferon-gamma (INFγ), IL-4, and IL-12 were most consistently secreted upon treatment with
the different mesoderm and hematopoietic supportive conditions (Figure A.5B). IFNγ has a dual
effect on GM-CFC, limiting the proliferative response to CSF while decreasing the rate of cell
death (Kan et al. 1991) and also selectively inhibits proliferation and differentiation of primitive
stem cells but not more mature progenitors (Snoeck et al. 1994). IL-4 and IL-12 are early acting
cytokines that stimulate proliferation of primitive progenitors. Specifically, IL-4 appears to
function as a synergistic factor, regulate cell cycle, and may promote lineage restriction (Ogawa
1993, Nicholls et al. 1995). IL-12 has structural similarities to IL-6, G-CSF, IL-11, and LIF
(Ogawa 1993) and can stimulate hematopoietic recovery following severe myelosuppression
(Chen et al. 2007).
Intriguingly, a reciprocal relationship between INFγ and IL-4 in monocytic or granulocytic
colony formation has been reported (Snoeck et al. 1993) and both cytokines appear to stimulate
the expansion and recruitment of early myeloid progenitors (Snoeck et al. 1996). It is also of
interest that the stimulatory effects of IL-12 can be inhibited and mediated by IL-12-induced
IFNγ (Eng et al. 1995). The difference in cytokines produced as a result of the particular factor
treatment scheme is shown in Figure A.5C. The exogenous factors provided with the base media
and the relative enrichment through endogenous cell production resulted from media
conditioning between days 5-7. As this detected endogenous factors towards the end of
differentiation it would be interesting to expand the factors detected, contrast to BAW treatment
as well as to examine the earlier differentitiation phase (d2-4) that was collected during the CM
experiments from the different size and treated aggregates. Other factors that may generate an
interacting network and respond differently to the intial BVT or BAW treatment include the
induction of Nodal/Activin, Wnts, BMPs, FGFs, Hedgehogs, and their antagonists such as Lefty,
follistatin or noggin, as well as the receptors
158
IL1b IL10 IL6 IL12 GM IFN IL5 TNF IL2 IL4 0
10
20
30
40
50
60
−
CSFγ α
Bas
e m
edia
: N2B
ME
[pg/
ml]
Cytokine
A B
C D
IL1b IL10 IL6 IL12 GM INF IL5 TNF IL2 IL40
5
10
15
20
25
30
− α
Treatment (d0-7)Continuous:BBTD0->5: B->0BT->0BTV->BTBTV->T
Fold
bas
e m
edia
-N2B
ME
CytokineCSF
γ
50
Figure A.5. Screen of 10 hematopoietic cytokines. The initial concentration of the 10 cytokines
was measured in freshly prepared N2BME (A). LSC differentiation was initiated in N2BME serum-free
media and EBs were treated with different combinations of 5 ng/ml BMP4, 25 ng/ml VEGF and 50 ng/ml
TPO for 7 days. The media was conditioned between d5-7 and then compared to the base media to detect
differences (B). Briefly, cells were treated continuously with B, BT, or BVT; treated for 5 days with B or
BT before changing to differentitaition media without factors or treated for 5 days with BVT before
anging to either B or BT supplementation. As continuous treatment with BVT was not expected to
on was not included in part (B) which highlights the
tokines upregulated by the hemogenic treatments. The stacked fold-change (C) and the CFC output (D)
of all the factors for each treatment are also shown.
ch
enhance hematopoietic CFC formation this conditi
cy
B B BT BT BTV BTV BTV0
20
30
40
10
BT T BTV 0 BT 0 B D0-5:D5-7:
Fold
bas
e m
edia
-N2B
ME
Treatment
IL4 IL2 TNFα IL5 INFγ GM-CSF IL12 IL6 IL10 IL1b
Treatment
Day 0-5Day 5 -8
CFC
per
5x1
0 4
cells
100
200
300
400
BV BVB
BVBT
BTBT
BVTBT
B BTT
Treatment
Day 0-5Day 5 -8
CFC
per
5x1
0 4
cells
100
200
300
400
BVBV BVBBVB
BVBTBVBT
BTBTBTBT
BVTBTBVTBT
BB BTTBTT
159
inally, to extend the analysis of the cellular response of the 10 cell aggregate to BAW and the
100 cell aggregate to BVT treatment the phenotypes were analyzed on day 9 for CD41,
e
F
CD34/45, and CD150, with the day 7 CFC results shown for reference (Figure A.6A,B).
moxia with BVT treatment resulted in a population that was
ixed) than CD41, and that was ~4% and ~3% positive for CD150,
ositive for CD45. Strikingly, the BAW treated
inimal expression of CD34/45 and CD150. This
re immature progenitor population than BVT induction. To see
e conditions were transferred to hypoxia and treated
in incubation with trypsin. The phenotypes were
s were removed from the media on day 12
for the different treatments and representativ
colonies are shown (Figure A.6D). Trypsinization seemed to enhance the phenotypic markers of
10 BAW, but not for the BVT/HBT conditions, although this did not translate to CFC capacity.
Similar numbers of CFC were seen from the 10 BAW condition seeded day 7 and 14, however,
there was a higher proportion of GEMMs on d14 which may reflect a population shift from
CD41 to CD45. For the 100 HBT condition, CFC capacity was reduced approximately 90%.
Overall, the 100 HB(V)T condition appears promising and may contain ESC-derived HSCs that
may be detected in a SCID model.
Hypoxia with BT treatment and nor
higher in CD34/45 (m
respectively. Nearly all CD150 cells were also p
cells were 30% positive for CD41 and had m
suggests that BAW induces a mo
whether the cells could continue maturing, th
with BT either directly or following a 2 m
assessed again on day 12 and 14, and the factor
(Figure A.6C). The CFC assay was seeded on d14
Figure A.6. Comparing the hematopoietic progenitors produced with BAW or BVT
treatment. To explore the outputs of the different treatment conditions 100 cell aggregates were either
treated with BVT in normoxia or with BT in hypoxia, while 10 cell aggregates were treated with BAW in
normoxia. The hypoxic condition was started 24 h after aggregation and the cytokines were provided
from day 2-4. Day 7 EBs were plated in a CFC assay (A), and the cell phenotypes were assessed for
CD41, CD34/45, and CD150 on day 9 (B) prior to moving all conditions to hypoxia for an additional 5
days. From day 9-12 the conditions were treated with BT either directly or following 2 minutes in a
trypsin-EDTA solution. The experimental timeline is shown at the top. The cell phenotypes were
assessed on day 12 and 14 (C) and plated in a CFC assay on day 14 (D). Representative colonies from
the three conditions are also shown.
160
100HBT 100BVT 10BAW0
10
20
30
40
% p
ositi
ve
Day 9 CD41+ CD34+/45+ CD150+ CD34+/45+CD150+
100HBT 100BVT 10BAW0
10
20
% p
ositi
ve
Day 12Transfer to hypoxia d9Treat with BT d9-12EB EB+2min trypsin
CD41+ CD34+ CD45+ CD150+
100HBT 100BVT 10BAW0
10
20
% p
ositi
ve
Day 14Transfer to hypoxia d9Treat with BT d9-12EB EB+2min trypsin
CD41+ CD44+ CD45+ CD150+
NS
0
50
100
150
200
250
100 HBT 100 BVT 10 BAW
CFC
/ 50
000
d7 c
ells
0
50
100
150
200
250
100 HBT 100 BVT 10 BAW
Treatment [d0-2] (transfer to hypoxia d9-14)
CFC
/ 50
000
d14
cells
Treat EB directlyTrypsinize EB - 2 min
Day 9-12: BT100 HBT
100 BVT
10 BAW
D
Time [day] 0
Treatment BAW
Seed CFCFACS Analysis
7
Seed CFCFACS Analysis
14
FACS Analysis
3.75
Spin-EB formation
9 12
Analyze CFC
212
100
BVTBT
10
Normoxia
Hypoxia
FACS Analysis
}Hypoxia
}Time [day] 0
Treatment BAW
Seed CFCFACS Analysis
7
Seed CFCFACS Analysis
14
FACS Analysis
3.75
Spin-EB formation
9 12
Analyze CFC
212
100
BVTBT
10
Normoxia
Hypoxia
FACS Analysis
}Hypoxia
}}
C
B A
161
References
162
Abe, K., H. Niwa, K. Iwase, et al. (1996). e expression in embryonic stem cells differentiated to embryoid bodies
"Endoderm-specific gen." Exp Cell Res 229(1): 27-34.
bkowitz, J. L., S. N. Catlin, M. T. McCallie, et al. (2002). "Evidence that the number of hematopoietic stem cells per animal is conserved in mammals." Blood
A 100(7): 2665-2667.
Abkowitz, J. L. and J. Chen (2007). "Studies of c-Mpl function distinguish the replication of hematopoietic stem cells from the expansion of differentiating clones." Blood 109(12): 5186-5190.
branches, E., E. Bekman, D. Henrique, et al. (2007). "Expansion of mouse embryonic stem cells on microcarriers." Biotechnol Bioeng
A 96(6): 1211-1221.
damo, L., O. Naveiras, P. L. Wenzel, et al. (2009). "Biomechanical forces promote embryonic haematopoiesis." Nature
A 459(7250): 1131-1135.
delman, C. A., S. Chattopadhyay and J. J. Bieker (2002). "The BMP/BMPR/Smad pathway directs expression of the erythroid-specific EKLF and GATA1 transcription factors during embryoid body differentiation in serum-free media." Development
A
129(2): 539-549.
by Adelman, D. M., M. Gertsenstein, A. Nagy, et al. (2000). "Placental cell fates are regulated in vivo HIF-mediated hypoxia responses." Genes Dev 14(24): 3191-3203.
Adelman, D. M., E. Maltepe and M. C. Simon (1999). "Multilineage embryonic hematopoiesis requires hypoxic ARNT activity." Genes Dev 13(19): 2478-2483.
ebersold, R. and M. Mann (2003). "Mass spectrometry-based proteomics." NatureA 422(6928): 198-207.
, et al. (2003). "Essential role of endothelial nitric oxide synthase for mobilization of stem and progenitor cells." Nat Med
Aicher, A., C. Heeschen, C. Mildner-Rihm 9(11): 1370-1376.
lexander, W. S., A. W. Roberts, N. A. Nicola, et al. (1996). "Deficiencies in progenitor cells of multiple hematopoietic lineages and defective megakaryocytopoiesis in mice lacking the thrombopoietic receptor c-Mpl." Blood
A
87(6): 2162-2170.
Alvarez-Silva, M., P. Belo-Diabangouaya, J. Salaun, et al. (2003). "Mouse placenta is a major hematopoietic organ." Development 130(22): 5437-5444.
Ambati, B. K., M. Nozaki, N. Singh, et al. (2006). "Corneal avascularity is due to soluble VEGF receptor-1." Nature 443(7114): 993-997.
it, M., M. K. Carpenter, M. S. Inokuma, et al. (2000). "Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture." Dev Biol
Am
227(2): 271-278.
embryonic and induced pluripotent stem cells." Stem Cell RevAmit, M., J. Chebath, V. Margulets, et al. (2010). "Suspension culture of undifferentiated human
6(2): 248-259.
163
Arceci, R. J., A. A. King, M. C. Simon, et al. (1993). "Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart." Mol Cell Biol 13(4): 2235-2246.
Attisano, L. and J. L. Wrana (2002). "Signal transduction by the TGF-beta superfamily." Science 296(5573): 1646-1647.
Audet, J., C. L. Miller, C. J. Eaves, et al. (2002). "Common and distinct features of cytokine effects on hematopoietic stem and progenitor cells revealed by dose-response surface analysis." Biotechnol Bioeng 80(4): 393-404.
A. S. and W. H. Fleming (2003). "Converging roads: evidence for an adult hemangioblast." Bailey, p ExHematol 31(11): 987-993.
o." Bain, G., D. Kitchens, M. Yao, et al. (1995). "Embryonic stem cells express neuronal properties in vitrDev Biol 168(2): 342-357.
Bain, G., W. J. Ray, M. Yao, et al. (1996). "Retinoic acid promotes neural and represses mesoderexpression in mouse embryonic stem cells in cultu
mal gene re." Biochem Biophys Res Commun 223(3):
Barker,
691-694.
J. N. and J. E. Wagner (2002). "Umbilical cord blood transplantation: current state of the art." Curr Opin Oncol 14(2): 160-164.
Barleon, B., P. Reusch, F. Totzke, et al. (2001). "Soluble VEGFR-1 secreted by endothelial cells and monocytes is present in human serum and plasma from healthy donors." Angiogenesis 4(2): 143-
Baron, M oiesis and vascular development: a
154.
. H. (2001). "Molecular regulation of embryonic hematopnovel pathway." J Hematother Stem Cell Res 10(5): 587-594.
Baron, M. H. (2003). "Embryonic origins of mammalian hematopoiesis." Exp Hematol 31(12): 1160-1169.
Baron, M. H. (2005). "Early patterning of the mouse embryo: Implications for hematopoietic commitment and differentiation." Exp Hematol 33(9): 1015-1020.
, S., D. Guarnieri, C. Borselli, et al. (2005). Battista "The effect of matrix composition of 3D constructs on embryonic stem cell differentiation." Biomaterials 26(31): 6194-6207.
., R. Tamm, D. Petschow, et al. (1975). "Oxygen affinity aBauer, C nd allosteric effects of embryonic mouse haemolglobins." Nature 257(5524): 333-334.
Baumann, C. I., A. S. Bailey, W. Li, et al. (2004). "PECAM-1 is expressed on hematopoietic stem cells throughout ontogeny and identifies a population of erythroid progenitors." Blood 104(4): 1010-1016.
s, C., T. Yin, S. DBauwen ang, et al. (2005). "Development of a perfusion fed bioreactor for embryonic cyte stem cell-derived cardiomyocyte generation: oxygen-mediated enhancement of cardiomyo
output." Biotechnol Bioeng 90(4): 452-461.
164
Bauwens, C. L., R. Peerani, S. Niebruegge, et al. (2008). "Control of human embryonic stem cell colony and aggregate size heterogeneity influences differentiation trajectories." Stem Cells 26(9): 2300-2310.
Beddington, R. S. and E. J. Robertson (1999). "Axis development and early asymmetry in mammals." Cell 96(2): 195-209.
Benveniste, P., C. Cantin, D. Hyam, et al. (2003). "Hematopoietic stem cells engraft in mice with absoluefficiency."
te Nat Immunol 4(7): 708-713.
Benveniste, P., C. Frelin, S. Janmohamed, et al. (2010). "Intermediate-term hematopoietic stem cells with extended but time-limited reconstitution potential." Cell Stem Cell 6(1): 48-58.
Bernex, F., P. De Sepulveda, C. Kress, et al. (1996). "Spatial and temporal patterns of c-kit-expressing cells in WlacZ/+ and WlacZ/WlacZ mouse embryos." Development 122(10): 3023-3033.
Bertrand, J. Y., S. Giroux, R. Golub, et al. (2005). "Characterization of purified intraembryonic hematopoietic stem cells as a tool to define their site of origin." Proc Natl Acad Sci U S A 102(1): 134-139.
Betsholtz, C., L. Karlsson and P. Lindahl (2001). "Developmental roles of platelet-derived growth factors." Bioessays 23(6): 494-507.
Bhatia, M., D. Bonnet, U. Kapp, et al. (1997a). "Quantitative analysis reveals expansion of human hematopoietic repopulating cells after short-term ex vivo culture." J Exp Med 186(4): 619-624.
Bhatia, M., D. Bonnet, D. Wu, et al. (1999). "Bone morphogenetic proteins regulate the developmental program of human hematopoietic stem cells." J Exp Med 189(7): 1139-1148.
Bhatia, ive human hematopoietic cells capable of repopulating immune-deficient mice." Proc Natl Acad Sci U S AM., J. C. Wang, U. Kapp, et al. (1997b). "Purification of primit
94(10): 5320-5325.
Bichet, S., R. H. Wenger, G. Camenisch, et al. (1999). "Oxygen tension modulates beta-globin switching in embryoid bodies." Faseb J 13(2): 285-295.
Bisgrov n of midline development by antagonism of lefty and nodal signaling." Developmente, B. W., J. J. Essner and H. J. Yost (1999). "Regulatio
126(14): 3253-3262.
Bock, T ." Stem Cells. A. (1997). "Assay systems for hematopoietic stem and progenitor cells 15 Suppl 1: 185-195.
Bodine, bination of interleukins 3 and 6 preserves stem cell function in culture and enhances retrovirus-mediated gene transfer into hematopoietic D. M., S. Karlsson and A. W. Nienhuis (1989). "Com
stem cells." Proc Natl Acad Sci U S A 86(22): 8897-8901.
Bodine, D. M., D. Orlic, N. C. Birkett, et al. (1992). "Stem cell factor increases colony-forming unit-spleen number in vitro in synergy with interleukin-6, and in vivo in Sl/Sld mice as a single factor." Blood 79(4): 913-919.
M. B., D. G. Kent, M. R. Copley, et al. (2007Bowie, ). "Steel factor responsiveness regulates the high self-renewal phenotype of fetal hematopoietic stem cells." Blood 109(11): 5043-5048.
165
Bowie, M. B., K. D. McKnight, D. G. Kent, et al. (2006). "Hematopoietic stem cells proliferate until afterbirth and show a reversible phase-specific engraftment defect."
J Clin Invest 116(10): 2808-2816.
Bradley, H. L., C. Couldrey and K. D. Bunting (2004). "Hematopoietic-repopulating defects from
dSTAT5-deficient bone marrow are not fully accounted for by loss of thrombopoietin responsiveness." Bloo 103(8): 2965-2972.
m cell differentiation." Biotechnol ProgBratt-Leal, A. M., R. L. Carpenedo and T. C. McDevitt (2009). "Engineering the embryoid body
microenvironment to direct embryonic ste 25(1): 43-51.
Brennan, J., C. C. Lu, D. P. Norris, et al. (2001). "Nodal signalling in the epiblast patterns the early mouse embryo." Nature 411(6840): 965-969.
Brewer, G. J., J. R. Torricelli, E. K. Evege, et al. (1993). "Optimized survival of hippocampal neurons iB27-supplemented Neurobasal, a new serum-free medium combination."
n J Neurosci Res 35(5):
567-576.
Brons, Imalian embryos." Nature
. G., L. E. Smithers, M. W. Trotter, et al. (2007). "Derivation of pluripotent epiblast stem cells from mam 448(7150): 191-195.
se ci U S A
Brotherton, T. W., D. H. Chui, J. Gauldie, et al. (1979). "Hemoglobin ontogeny during normal moufetal development." Proc Natl Acad S 76(6): 2853-2857.
34, is
fibroblasts." Int Immunol
Brown, J., M. F. Greaves and H. V. Molgaard (1991). "The gene encoding the stem cell antigen, CDconserved in mouse and expressed in haemopoietic progenitor cell lines, brain, and embryonic
3(2): 175-184.
Bruce, S s during ES cell differentiation towards mesoderm in serum versus serum-freeBMP4 culture." BMC Genomics. J., B. B. Gardiner, L. J. Burke, et al. (2007). "Dynamic transcription program
8:
Brunkow, M. E., D. L. Nagle, A. Bernstein, et al. (1995). "A 1.8-Mb YAC contig spanning three
365.
members of the receptor tyrosine kinase gene family (Pdgfra, Kit, and Flk1) on mouse chromosome 5." Genomics 25(2): 421-432.
Bruschi, M. L., M. L. Cardoso, M. B. Lucchesi, et al. (2003). "Gelatin microparticles containing propolisobtained by spray-drying technique: preparation and characterizat
ion." Int J Pharm 264(1-2): 45-
55.
Bunn, H . O. Poyton (1996). "Oxygen sensing and molecular adaptation to hypoxia." Physiol . F. and RRev 76(3): 839-885.
Burch, J. B. (2005). "Regulation of GATA gene expression during vertebrate development." Semin Cell Dev Biol 16(1): 71-81.
Burdick, J. A. and K. S. Anseth (2002). "Photoencapsulation of osteoblasts in injectable RGD-modifiePEG hydrogels for bone tissue engineering."
d Biomaterials 23(22): 4315-4323.
Burdick, J. A., C. Chung, X. Jia, et al. (2005). "Controlled degradation and mechanical behavior of photopolymerized hyaluronic acid networks." Biomacromolecules 6(1): 386-391.
Burdick, J. A. and G. Vunjak-Novakovic (2009). "Engineered microenvironments for controlled stem cell differentiation." Tissue Eng Part A 15(2): 205-219.
166
Burdsal, C. A., C. H. Damsky and R. A. Pedersen (1993). "The role of E-cadherin and integrins in mesoderm differentiation and migration at the mammalian primitive streak." Development 118(3): 829-844.
Burton, e embryo l Obstet Fertil
G. J. and E. Jaunaiux (2001). "Maternal vascularisation of the human placenta: does thdevelop in a hypoxic environment?" Gyneco 29(7-8): 503-508.
germ Burtscher, I. and H. Lickert (2009). "Foxa2 regulates polarity and epithelialization in the endodermlayer of the mouse embryo." Development 136(6): 1029-1038.
Calvi, L. M., G. B. Adams, K. W. Weibrecht, et al. (2003). "Osteoblastic cells regulate the haematopoietic stem cell niche." Nature 425(6960): 841-846.
Cameron, C. M., W. S. Hu and D. S. Kaufman (2006). "Improved development of human embryonic stemcell-derived embryoid bodies by stirred vessel cultivation." Biotechnol Bioeng 94(5): 938-948.
Carmeliet, P., V. Ferreira, G. Breier, et al. (1996). "Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele." Nature 380(6573): 435-439.
Carpenedo, R. L., A. M. Bratt-Leal, R. A. Marklein, et al. (2009). "Homogeneous and organized differentiation within embryoid bodies induced by microsphere-mediated delivery of small molecules." Biomaterials 30(13): 2507-2515.
Carpenter, M. K., M. S. Inokuma, J. Denham, et al. (2001). "Enrichment of neurons and neural precursors from human embryonic stem cells." Exp Neurol 172(2): 383-397.
Carver-Moore, K., H. E. Broxmeyer, S. M. Luoh, et al. (1996). "Low levels of erythroid and myeloid progenitors in thrombopoietin-and c-mpl-deficient mice." Blood 88(3): 803-808.
bregon, S. and L. Castro-O Covarrubias (1996). "Role of retinoic acid and oxidative stress in embryonic stem cell death and neuronal differentiation." FEBS Lett 381(1-2): 93-97.
Celeste,otein purified from bovine bone." Proc Natl Acad
A. J., J. A. Iannazzi, R. C. Taylor, et al. (1990). "Identification of transforming growth factor beta family members present in bone-inductive prSci U S A 87(24): 9843-9847.
Cerdan,an embryonic stem cells." Blood
C., A. Rouleau and M. Bhatia (2004). "VEGF-A165 augments erythropoietic development from hum 103(7): 2504-2512.
an embryonic stem cells." BloodChadwick, K., L. Wang, L. Li, et al. (2003). "Cytokines and BMP-4 promote hematopoietic
differentiation of hum 102(3): 906-915.
y TGF-beta1." Cell Stem Cell
Challen, G. A., N. C. Boles, S. M. Chambers, et al. (2010). "Distinct hematopoietic stem cell subtypes aredifferentially regulated b 6(3): 265-278.
Chambers, I. (2004). "The molecular basis of pluripotency in mouse embryonic stem cells." Cloning StemCells 6(4): 386-391.
Chambers, I., D. Colby, M. Robertson, et al. (2003). "Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells." Cell 113(5): 643-655.
167
Chang, C. F., M. W. Lee, P. Y. Kuo, et al. (2007). "Three-dimensional collagen fiber remodeling bymesenchymal stem cells requires the integrin-matrix interaction."
J Biomed Mater Res A 80
466-474. (2):
hematopoietic stem cells." Immunity
Chen, C. Z., L. Li, M. Li, et al. (2003). "The endoglin(positive) sca-1(positive) rhodamine(low) phenotype defines a near-homogeneous population of long-term repopulating
19(4): 525-533.
Chen, F nses to scaffolds containing two microencapsulated growth factors." Biomaterials. M., R. Chen, X. J. Wang, et al. (2009a). "In vitro cellular respo
30(28): 5215-5224.
Chen, M uired for the endothelial to haematopoietic cell transition but not thereafter." Nature. J., T. Yokomizo, B. M. Zeigler, et al. (2009b). "Runx1 is req
457(7231): 887-891.
Chen, SProc Natl Acad Sci U S A., J. T. Do, Q. Zhang, et al. (2006). "Self-renewal of embryonic stem cells by a small molecule."
103(46): 17266-17271.
Chen, T ery of endogenous hematopoiesis and the engraftment of stem cells after ionizing radiation." Exp Hematol., K. A. Burke, Y. Zhan, et al. (2007). "IL-12 facilitates both the recov
35(2):
Chen, W ). "Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse
203-213.
. S., K. Manova, D. C. Weinstein, et al. (1994
embryos." Genes & Development 8(20): 2466-2477.
Chen, Y. and A. F. Schier (2001). "The zebrafish Nodal signal Squint functions as a morphogen." Nature
Cheshier, S. H., S. J. Morrison, X. Liao, et al. (1999). "In vivo proliferation and cell cycle kinetics of
411(6837): 607-610.
long-term self-renewing hematopoietic stem cells." Proc Natl Acad Sci U S A 96(6): 3120-3125.
Cho, S. K., T. D. Webber, J. R. Carlyle, et al. (1999). "Functional characterization of B lymphocytes generated in vitro from embryonic stem cells." Proc Natl Acad Sci U S A 96(17): 9797-9802.
., M. Kennedy, A. Kazarov, et aChoi, K l. (1998). "A common precursor for hematopoietic and endothelial cells." Development 125(4): 725-732.
Choi, Y molecule E-cadherin in Xenopus embryos begins at gastrulation and predominates in the ectoderm." J Cell Biol. S. and B. Gumbiner (1989). "Expression of cell adhesion
108(6): 2449-2458.
Chung, mangioblast as defined by FLK1 and SCL expression." Development
Y. S., W. J. Zhang, E. Arentson, et al. (2002). "Lineage analysis of the he 129(23): 5511-5520.
Chute, J atopoietic stem cells with long-term repopulating capacity following harvest from lethally irradiated mice." Exp Hematol. P., J. Fung, G. Muramoto, et al. (2004a). "Ex vivo culture rescues hem
Chute, J. P., G. Muramoto, J. Fung, et al. (2004b). "Quantitative analysis demonstrates expansion of ng ex
32(3): 308-317.
SCID-repopulating cells and increased engraftment capacity in human cord blood followivivo culture with human brain endothelial cells." Stem Cells 22(2): 202-215.
168
Cimetta, E., E. Figallo, C. Cannizzaro, et al. (2009). "Micro-bioreactor arrays for controlling cellular environments: design principles for human embryonic stem cell applications." Methods 47(2): 81-89.
Clark, D. E., S. K. Smith, Y. He, et al. (1998). "A vascular endothelial growth factor antagonist iproduced by the human placenta and released into the maternal circulation."
s Biol Reprod 59(6):
1540-1548.
Clough, J. R. and D. G. Whittingham (1983). "Metabolism of [14C]glucose by postimplantation mouse embryos in vitro." J Embryol Exp Morphol 74: 133-142. (Abstract only).
ion of Conley, B. J., J. C. Young, A. O. Trounson, et al. (2004). "Derivation, propagation and differentiathuman embryonic stem cells." Int J Biochem Cell Biol 36(4): 555-567.
Conte, C., E. Riant, C. Toutain, et al. (2008). "FGF2 translationally induced by hypoxia is involved in negative and positive feedback loops with HIF-1alpha." PLoS One 3(8): e3078.
ine Cormier, J. T., N. I. zur Nieden, D. E. Rancourt, et al. (2006). "Expansion of undifferentiated murembryonic stem cells as aggregates in suspension culture bioreactors." Tissue Eng 12(11): 32333245.
-
Corn, P. G., B. D. Smith, E. S. Ruckdeschel, et al. (2000). "E-cadherin expression is silenced by 5' CpGisland methylation in acute leukemia." Clin Cancer Res 6(11): 4243-4248.
Cote, M. F., G. Laroche, E. Gagnon, et al. (2004). "Denatured collagen as support for a FGF-2 delivery system: physicochemical characterizations and in vitro release kinetics and bioactivity." Biomaterials 25(17): 3761-3772.
Coucouvanis, E. and G. R. Martin (1995). "Signals for death and survival: a two-step mechanism for cavitation in the vertebrate embryo." Cell 83(2): 279-287.
Crossley, P. H. and G. R. Martin (1995). "The mouse Fgf8 gene encodes a family of polypeptides andexpressed in regions that direct outgrowth and patterning in the developing embryo."
is
Development 121(2): 439-451.
Csaszar 9). "An automated system for delivery of an unstable transcription factor to hematopoietic stem cell cultures." Biotechnol Bioeng, E., G. Gavigan, M. Ungrin, et al. (200
103(2): 402-412.
Cumanomouse, is restricted to caudal intraembryonic splanchnopleura." Cell, A., F. Dieterlen-Lievre and I. Godin (1996). "Lymphoid potential, probed before circulation in
86(6): 907-916.
Cumano yolk sac hematopoietic precursors, isolated before circulation, provide long-term multilineage reconstitution." Immunity, A., J. C. Ferraz, M. Klaine, et al. (2001). "Intraembryonic, but not
Cumano 2007). "Ontogeny of the hematopoietic system." Annu Rev Immunol
15(3): 477-485.
, A. and I. Godin ( 25: 745-785.
Czyz, J. and A. Wobus (2001). "Embryonic stem cell differentiation: the role of extracellular factors." Differentiation 68(4-5): 167-174.
D'Souza, S. L., A. G. Elefanty and G. Keller (2005). "SCL/Tal-1 is essential for hematopoietic commitment of the hemangioblast but not for its development." Blood 105(10): 3862-3870.
169
Dai, Y., M. Xu, Y. Wang, et al. (2007). "HIF-1alpha induced-VEGF overexpression in bone marrow scells protects cardiomyocytes against ischemia."
tem J Mol Cell Cardiol 42(6): 1036-1044.
Damert, A., L. Miquerol, M. Gertsenstein, et al. (2002). "Insufficient VEGFA activity in yolk sac endoderm compromises haematopoietic and endothelial differentiation." Development 1291881-1892.
(8):
Damjanov, I., A. Damjanov and C. H. Damsky (1986). "Developmentally regulated expression of the cell-cell adhesion glycoprotein cell-CAM 120/80 in peri-implantation mouse embryos and extraembryonic membranes." Dev Biol 116(1): 194-202.
Dang, S. M., S. Gerecht-Nir, J. Chen, et al. (2004). "Controlled, scalable embryonic stem cell differentiation culture." Stem Cells 22(3): 275-282.
Dang, S. M., M. Kyba, R. Perlingeiro, et al. (2002). "Efficiency of embryoid body formation and hematopoietic development from embryonic stem cells in different culture systems." Biotechnol Bioeng 78(4): 442-453.
Dang, Ss Mol Biol
. M. and P. W. Zandstra (2005). "Scalable production of embryonic stem cell-derived cells." Method 290: 353-364.
Darabi, R., K. Gehlbach, R. M. Bachoo, et al. (2008). "Functional skeletal muscle regeneration from differentiating embryonic stem cells." Nat Med 14(2): 134-143.
Davey, R. E. and P. W. Zandstra (2006). "Spatial organization of embryonic stem cell responsiveness to autocrine gp130 ligands reveals an autoregulatory stem cell niche." Stem Cells 24(11): 2538-2548.
Dawson, E., G. Mapili, K. Erickson, et al. (2008). "Biomaterials for stem cell differentiation." Adv Drug Deliv Rev 60(2): 215-228.
de Bruijn, M. F., N. A. Speck, M. C. Peeters, et al. (2000). "Definitive hematopoietic stem cells first develop within the major arterial regions of the mouse embryo." Embo J 19(11): 2465-2474.
de Caestecker, M. (2004). "The transforming growth factor-beta superfamily of receptors." Cytokine Growth Factor Rev 15(1): 1-11.
Dean, S. K., Y. Yulyana, G. Williams, et al. (2006). "Differentiation of encapsulated embryonic stem cells after transplantation." Transplantation 82(9): 1175-1184.
Deng, C. X., A. Wynshaw-Boris, M. M. Shen, et al. (1994). "Murine FGFR-1 is required for early postimplantation growth and axial organization." Genes Dev 8(24): 3045-3057.
k, R. and Y. E. ZhDerync ang (2003). "Smad-dependent and Smad-independent pathways in TGF-beta family signalling." Nature 425(6958): 577-584.
Descham ., E. van den Akker, S. Forlani, et al. (1999). "Initiation, establishment and maintenance of Hox gene expression patterns in the mouse." Int J Dev Biolps, J
43(7): 635-650.
Dexter, et al. (1984). "The regulation of hemopoietic cell development by the stromal cell environment and diffusible regulatory molecules." Prog Clin Biol ResT. M., P. Simmons, R. A. Purnell,
148: 13-33.
170
Doetschman, T. C., H. Eistetter, M. Katz, et al. (1985). "The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium." J Embryol Exp Morphol 87: 27-45.
Drab, Mmooth muscle cells: a retinoic acid and db-cAMP in vitro differentiation model."
Faseb J
., H. Haller, R. Bychkov, et al. (1997). "From totipotent embryonic stem cells to spontaneously contracting s
11(11): 905-915.
Drake, C ed on." Proc Natl Acad Sci U S A
. J. and C. D. Little (1995). "Exogenous vascular endothelial growth factor induces malformand hyperfused vessels during embryonic neovascularizati 92(17): 7657-7661.
Drake, C ion: implications for normal and pathological vessels." J Histochem Cytochem. J. and C. D. Little (1999). "VEGF and vascular fus
47(11): 1351-1356.
Duan, Zbined with PLGA copolymers." J Huazhong Univ Sci Technolog Med
., Q. Zheng, X. Guo, et al. (2007). "Experimental research on ectopic osteogenesis of BMP2-derived peptide P24 comSci 27(2): 179-182.
Duggal, . (2009). "Phenotype and gene expression of human mesenchymal stem cells in alginate scaffolds." Tissue Eng Part A S., K. B. Fronsdal, K. Szoke, et al
15(7): 1763-1773.
Dunois- man megakaryocytes to high shear rates accelerates platelet production." BloodLarde, C., C. Capron, S. Fichelson, et al. (2009). "Exposure of hu
114(9): 1875-1883.
Durandors of definitive hematopoietic stem cells." Proc Natl Acad Sci U S A
, C., C. Robin, K. Bollerot, et al. (2007). "Embryonic stromal clones reveal developmental regulat 104(52): 20838-20843.
Dush, M ). "Analysis of mouse Evx genes: Evx-1 displays graded expression in the primitive streak." Dev Biol. K. and G. R. Martin (1992
151(1): 273-287.
Dykstradifferentiation programs in vivo." Cell Stem Cell, B., D. Kent, M. Bowie, et al. (2007). "Long-term propagation of distinct hematopoietic
1(2): 218-229.
Dzierza ce of definitive hematopoietic stem cells." Curr Opin Hematolk, E. (2003). "Ontogenic emergen 10(3): 229-234.
Dzierza em cells: embryonic beginnings." J Cell Physiolk, E., M. J. Sanchez, A. Muller, et al. (1997). "Hematopoietic st
173(2): 216-218.
Dzierza alian hematopoietic stem cells." Nat Immunolk, E. and N. A. Speck (2008). "Of lineage and legacy: the development of mamm
9(2): 129-136.
Eaves, A c implications of the growth of hematopoietic progenitor cells in vitro. Current Therapy in Hematology-Oncology. C. E. a. C. J. (1992). Diagnostic and therapeuti
. Toronto, B.C. Decker: 159-
Eaves, C., C. Fraser, C. Udomsakdi, et al. (1992). "Manipulation of the hematopoietic stem cell in vitro."
167.
Leukemia 6 Suppl 1: 27-30.
171
Eichmann, A., C. Corbel, V. Nataf, et al. (1997). "Ligand-dependent development of the endothelial and hemopoietic lineages from embryonic mesodermal cells expressing vascular endothelial growfactor receptor 2."
th Sci U S AProc Natl Acad 94(10): 5141-5146.
Eilken, H. M., S. Nishikawa and T. Schroeder (2009). "Continuous single-cell imaging of blood generation from haemogenic endothelium." Nature 457(7231): 896-900.
Ema, H., K. Sudo, J. Seita, et al. (2005). "Quantification of self-renewal capacity in single hematopoietic stem cells from normal and Lnk-deficient mice." Dev Cell 8(6): 907-914.
., H. Takano,Ema, H K. Sudo, et al. (2000). "In vitro self-renewal division of hematopoietic stem cells." J Exp Med 192(9): 1281-1288.
Ema, M lk1 and Tal1 on vascular and hematopoietic development in the mouse." Genes Dev., P. Faloon, W. J. Zhang, et al. (2003). "Combinatorial effects of F
17(3): 380-393.
Ema, M . and J. Rossant (2003). "Cell fate decisions in early blood vessel formation." Trends CardiovascMed 13(6): 254-259.
olated by e growth
factor 1." Eur J Biochem
Enberg, G., M. Carlquist, H. Jornvall, et al. (1984). "The characterization of somatomedin A, ismicrocomputer-controlled chromatography, reveals an apparent identity to insulin-lik
143(1): 117-124.
Eng, V. terleukin (IL)-12 on hematopoiesis are antagonized by IL-12-induced interferon gamma in vivo." J Exp Med M., B. D. Car, B. Schnyder, et al. (1995). "The stimulatory effects of in
181(5):
Engler, Sen, H. L. Sweeney, et al. (2006). "Matrix elasticity directs stem cell lineage specification." Cell
1893-1898.
A. J., S. 126(4): 677-689.
Eppig, J the developmental competence of mouse oocytes grown in vitro: oxygen concentration." Mol Reprod Dev. J. and K. Wigglesworth (1995). "Factors affecting
42(4): 447-456.
Evans, ripotential cells from mouse embryos." Nature
M. J. and M. H. Kaufman (1981). "Establishment in culture of plu 292(5819): 154-156.
Ezashi, M. Roberts (2005). "Low O2 tensions and the prevention of differentiation of hES cells." Proc Natl Acad Sci U S AT., P. Das and R.
102(13): 4783-4788.
Faloon, P., E. Arentson, A. Kazarov, et al. (2000). "Basic fibroblast growth factor positively regulates hematopoietic development." Development 127(9): 1931-1941.
Fambro rse signaling pathways activated by growth factor receptors induce broadly overlapping, rather than independent, sets of genes." Cellugh, D., K. McClure, A. Kazlauskas, et al. (1999). "Dive
Fehling 3). "Tracking mesoderm induction and its specification to the hemangioblast during embryonic stem cell differentiation." Development
97(6): 727-741.
, H. J., G. Lacaud, A. Kubo, et al. (200 130(17): 4217-
Feldman, B., M. L. Concha, L. Saude, et al. (2002). "Lefty antagonism of Squint is essential for normal gastrulation." Curr Biol
4227.
12(24): 2129-2135.
172
Ferkowicz, M. J., M. Starr, X. Xie, et al. (2003). "CD41 expression defines the onset of primitive and definitive hematopoiesis in the murine embryo." Development 130(18): 4393-4403.
Fernandes, A. M., P. A. Marinho, R. C. Sartore, et al. (2009). "Successful scale-up of human embryonic stem cell production in a stirred microcarrier culture system." Braz J Med Biol Res 42(6)522.
: 515-
Ferrara, N., K. Carver-Moore, H. Chen, et al. (1996). "Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene." Nature 380(6573): 439-442.
Ferrara, N. and W. J. Henzel (1989). "Pituitary follicular cells secrete a novel heparin-binding growth factor specific for vascular endothelial cells." Biochem Biophys Res Commun 161(2): 851-858.
Ferreira, L., T. Squier, H. Park, et al. (2008). "Human embryoid bodies containing nano- and microparticlulate delivery vehicles." Adv Mater 20: 2285-2291.
Ferreira, L. S., S. Gerecht, J. Fuller, et al. (2007). "Bioactive hydrogel scaffolds for controllable vascular differentiation of human embryonic stem cells." Biomaterials 28(17): 2706-2717.
Figallo, E., C. Cannizzaro, S. Gerecht, et al. (2007). "Micro-bioreactor array for controlling cellular microenvironments." Lab Chip 7(6): 710-719.
Finley, M. F., S. Devata and J. E. Huettner (1999). "BMP-4 inhibits neural differentiation of murine embryonic stem cells." J Neurobiol 40(3): 271-287.
Fischer, B. and B. D. Bavister (1993). "Oxygen tension in the oviduct and uterus of rhesus monkeys, hamsters and rabbits." J Reprod Fertil 99(2): 673-679.
Fishley, bopoietin signalling in physiology and disease." Growth B. and W. S. Alexander (2004). "ThromFactors 22(3): 151-155.
Flaim, C bing cellular differentiation." Nat Methods. J., S. Chien and S. N. Bhatia (2005). "An extracellular matrix microarray for pro
2(2): 119-125.
Fok, E. ntrolled single-step mouse embryonic stem cell expansion and embryoid body-based differentiation." Stem CellsY. and P. W. Zandstra (2005). "Shear-co
23(9): 1333-1342.
Folkma aturen, J. and C. Haudenschild (1980). "Angiogenesis in vitro." N 288(5791): 551-556.
dothelium." Dev DynFong, G. H., J. Klingensmith, C. R. Wood, et al. (1996). "Regulation of flt-1 expression during mouse
embryogenesis suggests a role in the establishment of vascular en 207(1): 1-10.
Fong, Gembly of vascular endothelium." Nature
. H., J. Rossant, M. Gertsenstein, et al. (1995). "Role of the Flt-1 receptor tyrosine kinase in regulating the ass 376(6535): 66-70.
Fong, G. H., L. Zhang, D. M. Bryce, et al. (1999). "Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice." Development 126(13): 3015-3025.
Fong, W. J., H. L. Tan, A. Choo, et al. (2005). "Perfusion cultures of human embryonic stem cells." Bioprocess Biosyst Eng.
173
Forsythe, J. A., B. H. Jiang, N. V. Iyer, et al. (1996). "Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1." Mol Cell Biol 16(9): 4604-4613.
Fraichard, A., O. Chassande, G. Bilbaut, et al. (1995). "In vitro differentiation of embryonic stem cells into glial cells and functional neurons." J Cell Sci 108 (Pt 10): 3181-3188.
Frank, D. B., A. Abtahi, D. J. Yamaguchi, et al. (2005). "Bone morphogenetic protein 4 promotes pulmonary vascular remodeling in hypoxic pulmonary hypertension." Circ Res 97(5): 496-504.
Fujiwara, T., D. B. Dehart, K. K. Sulik, et al. (2002). "Distinct requirements for extra-embryonic and embryonic bone morphogenetic protein 4 in the formation of the node and primitive streak and
coordination of left-right asymmetry in the mouse." Development 129(20): 4685-4696.
Furukawa, H., S. Tohma, H. Kitazawa, et al. (2010). "Role of SLAM-associated protein in thepathogenesis of autoimmune diseases and immunological disorde
rs." Arch Immunol Ther Exp
(Warsz) 58(1): 37-44.
Furuta, oblasts and hemangioblasts in the early gastrulating mouse embryo." DevelopmentC., H. Ema, S. Takayanagi, et al. (2006). "Discordant developmental waves of angi
133(14): 2771-2779.
Gadue, rm layer induction from embryonic stem cells." Exp HematolP., T. L. Huber, M. C. Nostro, et al. (2005). "Ge
33(9): 955-964.
Gadue, d TGF-beta signaling are required for the induction of an in vitro model of primitive streak formation using embryonic stem cells." Proc P., T. L. Huber, P. J. Paddison, et al. (2006). "Wnt an
Natl Acad Sci U S A 103(45): 16806-16811.
Gandillet, A., A. G. Serrano, S. Pearson, et al. (2009). "Sox7-sustained expression alters the balance between proliferation and differentiation of hematopoietic progenitors at the onset of blood specification." Blood 114(23): 4813-4822.
Garcia-Cardena, G., R. Fan, V. Shah, et al. (1998). "Dynamic activation of endothelial nitric oxide synthase by Hsp90." Nature 392(6678): 821-824.
er cell Gardner, R. L. and J. Rossant (1979). "Investigation of the fate of 4-5 day post-coitum mouse innmass cells by blastocyst injection." J Embryol Exp Morphol 52: 141-152.
Gekas, C., F. Dieterlen-Lievre, S. H. Orkin, et al. (2005). "The placenta is a niche for hematopoietic stem cells." Dev Cell 8(3): 365-375.
Gentile,minal vascular spheroids." Dev Dyn
C., P. A. Fleming, V. Mironov, et al. (2008). "VEGF-mediated fusion in the generation of unilu 237(10): 2918-2925.
George, S. H., M. Gertsenstein, K. Vintersten, et al. (2007). "Developmental and adult phenotyping directly from mutant embryonic stem cells." Proc Natl Acad Sci U S A 104(11): 4455-4460.
l Gerber, H. P., A. K. Malik, G. P. Solar, et al. (2002). "VEGF regulates haematopoietic stem cell survivaby an internal autocrine loop mechanism." Nature 417(6892): 954-958.
Gerber, H. P., T. H. Vu, A. M. Ryan, et al. (1999). "VEGF couples hypertrophic cartilage remodelingossification and angiogen
, esis during endochondral bone formation." Nat Med 5(6): 623-628.
174
Gerecht-Nir, S., S. Cohen and J. Itskovitz-Eldor (2004a). "Bioreactor cultivation enhances the efficiencof human embryoid body (hEB) formation and differentiation."
y Biotechnol Bioeng 86(5): 493-
502.
Gerecht inate scaffolds provide a conducive environment for generation of well-vascularized embryoid bodies from -Nir, S., S. Cohen, A. Ziskind, et al. (2004b). "Three-dimensional porous alg
human embryonic stem cells." Biotechnol Bioeng 88(3): 313-320.
Gerecht-Nir, S., J. E. Dazard, M. Golan-Mashiach, et al. (2005). "Vascular gene expression and phenotypic correlation during differentiation of human embryonic stem cells." Dev Dyn 232(2487-497.
):
Gerecht, S., J. A. Burdick, L. S. Ferreira, et al. (2007). "Hyaluronic acid hydrogel for controlled self-renewal and differentiation of human embryonic stem cells." Proc Natl Acad Sci U S A 104(27):
Giaccia, A. J., M. C. Simon and R. Johnson (2004). "The biology of hypoxia: the role of oxygen sensing
11298-11303.
in development, normal function, and disease." Genes Dev 18(18): 2183-2194.
Giles, P. B., C. L. Candy, P. A. Fleming, et al. (2005). "VEGF directs newly gastrulated mesoderm to the endothelial lineage." Dev Biol 279(1): 169-178.
Ginis, I., Y. Luo, T. Miura, et al. (2004). "Differences between human and mouse embryonic stem cells." Dev Biol 269(2): 360-380.
H. and C. J. Eaves (1999). "Direct evidence foGlimm, r multiple self-renewal divisions of human in vivo repopulating hematopoietic cells in short-term culture." Blood 94(7): 2161-2168.
Godin, y rs." Nature
I. E., J. A. Garcia-Porrero, A. Coutinho, et al. (1993). "Para-aortic splanchnopleura from earlmouse embryos contains B1a cell progenito 364(6432): 67-70.
to ar matrix storage and release." J Biol Chem
Goerges, A. L. and M. A. Nugent (2004). "pH regulates vascular endothelial growth factor binding fibronectin: a mechanism for control of extracellul 279(3): 2307-2315.
Gomei, een two Tie2 ligands, angiopoietin-1 and -2, in regulation of adult bone marrow hematopoietic stem cells." Exp
Y., Y. Nakamura, H. Yoshihara, et al. (2010). "Functional differences betw
Hematol 38(2): 82-89.
Goodell, M. A., M. Rosenzweig, H. Kim, et al. (1997). "Dye efflux studies suggest that hematopoietic Nat stem cells expressing low or undetectable levels of CD34 antigen exist in multiple species."
Med 3(12): 1337-1345.
Gordon, M. Y. and N. M. Blackett (1998). "Reconstruction of the hematopoietic system after stem cetransplantation."
ll Cell Transplant 7(4): 339-344.
Goumans, M. J. and C. Mummery (2000). "Functional analysis of the TGFbeta receptor/Smad pathway through gene ablation in mice." Int J Dev Biol 44(3): 253-265.
Gouon-Evans, V., L. Boussemart, P. Gadue, et al. (2006). "BMP-4 is required for hepatic specification mouse embryonic stem cell-derived definitive endoderm."
of Nat Biotechnol 24(11): 1402-1411.
Graf, T. and T. Enver (2009). "Forcing cells to change lineages." Nature 462(7273): 587-594.
175
Green, J. (2002). "Morphogen gradients, positional information, and Xenopus: interplay of theory and experiment." Dev Dyn 225(4): 392-408.
Gritsman, K., J. Zhang, S. Cheng, et al. (1999). "The EGF-CFC protein one-eyed pinhead is essential for nodal signaling." Cell 97(1): 121-132.
K. and W. Mueller-Klieser (1991). "Distributions of oxygen, nutrieGroebe, nt, and metabolic waste concentrations in multicellular spheroids and their dependence on spheroid parameters." Eur Biophys J 19(4): 169-181.
Gumbiner, B. M. (1996). "Cell adhesion: the molecular basis of tissue architecture and morphogenesis." Cell 84(3): 345-357.
Guo, Gripotency." Development
., J. Yang, J. Nichols, et al. (2009). "Klf4 reverts developmentally programmed restriction of ground state plu 136(7): 1063-1069.
Gurdon, J. B. and P. Y. Bourillot (2001). "Morphogen gradient interpretation." Nature 413(6858): 797-803.
Gustafsson, M. V., X. Zheng, T. Pereira, et al. (2005). "Hypoxia requires notch signaling to maintain the undifferentiated cell state." Dev Cell 9(5): 617-628.
Halbleib, J. M. and W. J. Nelson (2006). "Cadherins in development: cell adhesion, sorting, and tissue morphogenesis." Genes Dev 20(23): 3199-3214.
AHanna, J., A. W. Cheng, K. Saha, et al. (2010). "Human embryonic stem cells with biological and
epigenetic characteristics similar to those of mouse ESCs." Proc Natl Acad Sci U S 107(20): 9222-9227.
Hata, A ing by specifically competing with the Smad4 tumor suppressor." Genes Dev., G. Lagna, J. Massague, et al. (1998). "Smad6 inhibits BMP/Smad1 signal
12(2): 186-197.
Hayashd functions as an antagonist of TGFbeta signaling." Cell
i, H., S. Abdollah, Y. Qiu, et al. (1997). "The MAD-related protein Smad7 associates with the TGFbeta receptor an 89(7): 1165-1173.
He, Y., S. K. Smith, K. A. Day, et al. (1999). "Alternative splicing of vascular endothelial growth factor (VEGF)-R1 (FLT-1) pre-mRNA is important for the regulation of VEGF activity." Mol Endocrinol 13(4): 537-545.
Heldin, C. H., A. Ostman and L. Ronnstrand (1998). "Signal transduction via platelet-derived growth factor receptors." Biochim Biophys Acta 1378(1): F79-113.
Herrmann, B. G. (1991). "Expression pattern of the Brachyury gene in whole-mount TWis/TWis mutant embryos." Development 113(3): 913-917.
Hidaka, M., W. L. Stanford and A. Bernstein (1999). "Conditional requirement for the Flk-1 receptor in the in vitro generation of early hematopoietic cells." Proc Natl Acad Sci U S A 96(13): 7370-7375.
Hirashima, M., M. Ogawa, S. Nishikawa, et al. (2003). "A chemically defined culture of VEGFR2+ cells derived from embryonic stem cells reveals the role of VEGFR1 in tuning the threshold for VEGF in developing endothelial cells." Blood 101(6): 2261-2267.
176
Hirata, H., S. Kawamata, Y. Murakami, et al. (2007). "Coexpression of platelet-derived growth factor receptor alpha and fetal liver kinase 1 enhances cardiogenic potential in embryonic stem cell differentiation in vitro." J Biosci Bioeng 103(5): 412-419.
Hiratsuka, S., Y. Kataoka, K. Nakao, et al. (2005a). "Vascular endothelial growth factor A (VEGF-A) is involved in guidance of VEGF receptor-positive cells to the anterior portion of early embryos." Mol Cell Biol 25(1): 355-363.
Hiratsuka, S., O. Minowa, J. Kuno, et al. (1998). "Flt-1 lacking the tyrosine kinase domain is sufficient for normal development and angiogenesis in mice." Proc Natl Acad Sci U S A 95(16): 9349-
Hiratsuka, S., K. Nakao, K. Nakamura, et al. (2005b). "Membrane fixation of vascular endothelial growth
9354.
factor receptor 1 ligand-binding domain is important for vasculogenesis and angiogenesis in mice." Mol Cell Biol 25(1): 346-354.
Hitchcock, I. S., M. M. Chen, J. R. King, et al. (2008). "YRRL motifs in the cytoplasmic domain of the thrombopoietin receptor regulate receptor internalization and degradation." Blood 112(6): 2222-2231.
Ho, Q. factor: biology and therapeutic applications." Int J Biochem Cell Biol
T. and C. J. Kuo (2007). "Vascular endothelial growth 39(7-8): 1349-1357.
Hock, H i-1 restricts proliferation and preserves functional integrity of haematopoietic stem cells." Nature., M. J. Hamblen, H. M. Rooke, et al. (2004). "Gf
431(7011): 1002-1007.
Hoelkercs of Bovine Preimplantative Embryos with Respect to Micro and
Macroenvironments." Reprod Domest Anim
, M., F. Rings, Q. Lund, et al. (2009). "Effect of Embryo Density on In vitro Developmental Characteristi
Epub.
Houck, lar endothelial growth factor bioavailability by genetic and proteolytic mechanisms." J Biol ChemK. A., D. W. Leung, A. M. Rowland, et al. (1992). "Dual regulation of vascu
267(36):
Hove, J. R., R. W. Koster, A. S. Forouhar, et al. (2003). "Intracardiac fluid forces are an essential
26031-26037.
epigenetic factor for embryonic cardiogenesis." Nature 421(6919): 172-177.
H. and R. Auerbach (1993). "Huang, Identification and characterization of hematopoietic stem cells from the yolk sac of the early mouse embryo." Proc Natl Acad Sci U S A 90(21): 10110-10114.
Huang, g monodisperse microdroplet for 5-fluorouracil loaded genipin-gelatin microcapsules." J Control ReleaseK. S., K. Lu, C. S. Yeh, et al. (2009). "Microfluidic controllin
137(1): 15-19.
Huber, 4). "Haemangioblast commitment is initiated in the primitive streak of the mouse embryo." Nature
T. L., V. Kouskoff, H. J. Fehling, et al. (200 432(7017): 625-630.
Huckle,nous inhibitor of vascular endothelial growth factor." J Cell Biochem
W. R. and R. I. Roche (2004). "Post-transcriptional control of expression of sFlt-1, an endoge 93(1): 120-132.
Hwang, Y. S., J. Cho, F. Tay, et al. (2009a). "The use of murine embryonic stem cells, alginate encapsulation, and rotary microgravity bioreactor in bone tissue engineering." Biomaterials 30(4): 499-507.
177
Hwang, Y. S., B. G. Chung, D. Ortmann, et al. (2009b). "Microwell-mediated control of embryoid bodsize regulates embryonic stem cell fate via differential expression of WNT5a and WNT11."
y roc P
Natl Acad Sci U S A 106(40): 16978-16983.
Hyslop, L. A., L. Armstrong, M. Stojkovic, et al. (2005). "Human embryonic stem cells: biology and clinical implications." Expert Rev Mol Med 7(19): 1-21.
Ieda, M., T. Tsuchihashi, K. N. Ivey, et al. (2009). "Cardiac fibroblasts regulate myocardial proliferation through beta1 integrin signaling." Dev Cell 16(2): 233-244.
, J. L. aIfkovits nd J. A. Burdick (2007). "Review: photopolymerizable and degradable biomaterials for tissue engineering applications." Tissue Eng 13(10): 2369-2385.
Ihle, J. N. (1995). "Cytokine receptor signalling." Nature 377(6550): 591-594.
Inman, K. E. and K. M. Downs (2007). "The murine allantois: emerging paradigms in development of the mammalian umbilical cord and its relation to the fetus." Genesis 45(5): 237-258.
., K. KInoue, T ibata, M. Suzuki, et al. (2000). "Identification of a vascular endothelial growth factor (VEGF) antagonist, sFlt-1, from a human hematopoietic cell line NALM-16." FEBS Lett 469(1):
Ito, C. Y., D. C. Kirouac, G. J. Madlambayan, et al. (2010). "The AC133+CD38-, but not the rhodamine-
14-18.
low, phenotype tracks LTC-IC and SRC function in human cord blood ex vivo expansioncultures." Blood 115(2): 257-260.
Itskovitz-Eldor, J., M. Schuldiner, D. Karsenti, et al. (2000). "Differentiation of human embryonic stecells into embryoid bodies compromising the three embryonic germ layers."
m l MedMo 6(2): 88-
ouse "
s Res Commun
95.
Iwama, A., I. Hamaguchi, M. Hashiyama, et al. (1993). "Molecular cloning and characterization of mTIE and TEK receptor tyrosine kinase genes and their expression in hematopoietic stem cells.Biochem Biophy 195(1): 301-309.
cells A
Jogi, A., I. Ora, H. Nilsson, et al. (2002). "Hypoxia alters gene expression in human neuroblastomatoward an immature and neural crest-like phenotype." Proc Natl Acad Sci U S 99(10): 7021-7026.
Johanssmorphogenetic protein 4 in mammalian mesoderm and hematopoietic development." Mol Cell on, B. M. and M. V. Wiles (1995). "Evidence for involvement of activin A and bone
Biol 15(1): 141-151.
Jordan, C. T., C. M. Astle, J. Zawadzki, et al. (1995). "Long-term repopulating abilities of enriched fetal liver stem cells measured by competitive repopulation." Exp Hematol 23(9): 1011-1015.
Jordan, C. T. and I. R. Lemischka (1990). "Clonal and systemic analysis of long-term hematopoiesis in the mouse." Genes Dev 4(2): 220-232.
Joung, Y. K., J. W. Bae and K. D. Park (2008). "Controlled release of heparin-binding growth factors Delivusing heparin-containing particulate systems for tissue regeneration." Expert Opin Drug
5(11): 1173-1184.
178
Juliano, R. L. and S. Haskill (1993). "Signal transduction from the extracellular matrix." J Cell Biol 120(3): 577-585.
Jung, Y., J. Wang, A. Havens, et al. (2005). "Cell-to-cell contact is critical for the survival of hematopoietic progenitor cells on osteoblasts." Cytokine 32(3-4): 155-162.
Kabrun, N., H. J. Buhring, K. Choi, et al. (1997). "Flk-1 expression defines a population of early embryonic hematopoietic precursors." Development 124(10): 2039-2048.
Kakeda, M., J. Kyuno, T. Kato, et al. (2002). "Role of the thrombopoietin (TPO)/Mpl system: c-Mpl-like molecule/TPO signaling enhances early hematopoiesis in Xenopus laevis." Dev Growth Differ 44(1): 63-75.
Kallianpur, A. R., J. E. Jordan and S. J. Brandt (1994). "The SCL/TAL-1 gene is expressed in progenitors of both the hematopoietic and vascular systems during embryogenesis." Blood 83(5): 1200-1208.
Kan, O. rvival and influences the development of bipotential granulocyte-macrophage colony-forming cells." Blood, C. M. Heyworth, T. M. Dexter, et al. (1991). "Interferon-gamma stimulates the su
Kanczle P. J. Ginty, L. White, et al. (2009). "The effect of the delivery of vascular endothelial growth factor and bone morphogenic protein-2 to osteoprogenitor cell populations on bone
78(10): 2588-2594.
r, J. M.,
formation." Biomaterials 31(6): 1242-1250.
-M., C.-I. Chen, S.-C. Huang, et al. Kao, P. (2007). "Effects of shear stress and mass transfer on chitinase production by Paenibacillus sp. CHE-N1." Biochemical Engineering Journal 34: 172–178.
Karoubnced survival of human marrow stromal cells." Biomaterials
i, G., M. L. Ormiston, D. J. Stewart, et al. (2009). "Single-cell hydrogel encapsulation for enha 30(29): 5445-5455.
Kataoka, H., N. Takakura, S. Nishikawa, et al. (1997). "Expressions of PDGF receptor alpha, c-Kit and Flk1 genes clustering in mouse chromosome 5 define distinct subsets of nascent mesodermal cells." Dev Growth Differ 39(6): 729-740.
Kaufman, D. S. (2009). "Toward clinical therapies using hematopoietic cells derived from human pluripotent stem cells." Blood 114(17): 3513-3523.
Kaufman, D. S., E. T. Hanson, R. L. Lewis, et al. (2001). "Hematopoietic colony-forming cells derived from human embryonic stem cells." Proc Natl Acad Sci U S A 98(19): 10716-10721.
n, M. H., E. J. RobertsKaufma on, A. H. Handyside, et al. (1983). "Establishment of pluripotential cell lines from haploid mouse embryos." J Embryol Exp Morphol 73: 249-261.
Kaushan tsky, K. (2009). "Molecular mechanisms of thrombopoietin signaling." J Thromb Haemos 7 Suppl 1: 235-238.
Kearney al. (2002). "Vascular endothelial growth factor receptor Flt-1 negatively regulates developmental blood vessel formation by modulating endothelial cell , J. B., C. A. Ambler, K. A. Monaco, et
division." Blood 99(7): 2397-2407.
, J. B., N. C. KappaKearney s, C. Ellerstrom, et al. (2004). "The VEGF receptor flt-1 (VEGFR-1) is a positive modulator of vascular sprout formation and branching morphogenesis." Blood 103(12): 4527-4535.
179
Kehat, I., D. Kenyagin-Karsenti, M. Snir, et al. (2001). "Human embryonic stem cells can differentiainto myocytes with
te structural and functional properties of cardiomyocytes." J Clin Invest 108(3):
407-414.
Kehoe, tor Culture of Human Pluripotent Stem Cells." Tissue Eng Part AD. E., D. Jing, L. T. Lock, et al. (2009). "Scalable Stirred-suspension Bioreac
.
Keller, biology and medicine." Genes Dev
G. (2005). "Embryonic stem cell differentiation: emergence of a new era in 19(10): 1129-1155.
Keller, m cell differentiation in culture." Mol Cell Biol
G., M. Kennedy, T. Papayannopoulou, et al. (1993). "Hematopoietic commitment during embryonic ste 13(1): 473-486.
Keller, G. M. (1995). "In vitro differentiation of embryonic stem cells." Curr Opin Cell Biol 7(6): 862-869.
Kendall, R. L., G. Wang and K. A. Thomas (1996). "Identification of a natural soluble form of the vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR." Biochem Biophys Res Commun 226(2): 324-328.
Kennedy, M., M. Firpo, K. Choi, et al. (1997). "A common precursor for primitive erythropoiesis and definitive haematopoiesis." Nature 386(6624): 488-493.
Kent, D. G., M. R. Copley, C. Benz, et al. (2009). "Prospective isolation and molecular characterization of hematopoietic stem cells with durable self-renewal potential." Blood 113(25): 6342-6350.
Keyt, B. A., H. V. Nguyen, L. T. Berleau, et al. (1996). "Identification of vascular endothelial growth e factor determinants for binding KDR and FLT-1 receptors. Generation of receptor-selectiv
VEGF variants by site-directed mutagenesis." J Biol Chem 271(10): 5638-5646.
Kiel, M. J., O. H. Yilmaz, T. Iwashita, et al. (2005). "SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells." Cell 121(7): 1109-1121.
Kim, I., T. L. Saunders and S. J. Morrison (2007). "Sox17 dependence distinguishes the transcriptional regulation of fetal from adult hematopoietic stem cells." Cell 130(3): 470-483.
Kinder, S. J., T. E. Tsang, G. A. Quinlan, et al. (1999). "The orderly allocation of mesodermal cells to the extraembryonic structures and the anteroposterior axis during gastrulation of the mouse embryo." Development 126(21): 4691-4701.
Kingsley, D. M. (1994). "The TGF-beta superfamily: new members, new receptors, and new genetic tesof function in different organisms."
ts Genes Dev 8(2): 133-146.
Kirito, K., N. Fox and K. Kaushansky (2003). "Thrombopoietin stimulates Hoxb4 expression: an explanation for the favorable effects of TPO on hematopoietic stem cells." Blood 102(9): 3172-3178.
Kirito, Ktial mechanism by which the hormone favorably affects
hematopoietic stem cells." Mol Cell Biol
., N. Fox and K. Kaushansky (2004). "Thrombopoietin induces HOXA9 nuclear transport in immature hematopoietic cells: poten
24(15): 6751-6762.
180
Kirito, K., N. Fox, N. Komatsu, et al. (2005). "Thrombopoietin enhances expression of vascular endothelial growth factor (VEGF) in primitive hematopoietic cells through induction of HIF-1alpha." Blood 105(11): 4258-4263.
is." Kirito, K., M. Osawa, H. Morita, et al. (2002). "A functional role of Stat3 in in vivo megakaryopoiesBlood 99(9): 3220-3227.
Kispert, A. and B. G. Hermann (1993). "The Brachyury gene encodes a novel DNA binding protein." Embo J 12(12): 4898-4899.
Kitajima, K., M. Tanaka, J. Zheng, et al. (2003). "In vitro differentiation of mouse embryonic stemto hematopoietic cells on an OP9 stromal cell monolayer."
cells Methods Enzymol 365: 72-83.
rved signaling in vivo despite divergent embryological functions." Mol Cell
Klinghoffer, R. A., P. F. Mueting-Nelsen, A. Faerman, et al. (2001). "The two PDGF receptors maintainconse 7(2): 343-354.
Kobayashi, M., J. H. Laver, T. Kato, et al. (1996). "Thrombopoietin supports proliferation of humanprimitive hematopoietic cells in synergy with steel factor and/or interleukin-3." Blood 88(2)436.
: 429-
Kodama, H., M. Nose, S. Niida, et al. (1994). "Involvement of the c-kit receptor in the adhesion of hematopoietic stem cells to stromal cells." Exp Hematol 22(10): 979-984.
Faseb J
Koushik, S. V., J. Wang, R. Rogers, et al. (2001). "Targeted inactivation of the sodium-calcium exchanger (Ncx1) results in the lack of a heartbeat and abnormal myofibrillar organization."
15(7): 1209-1211.
Kramer tion , J., C. Hegert, K. Guan, et al. (2000). "Embryonic stem cell-derived chondrogenic differentiain vitro: activation by BMP-2 and BMP-4." Mech Dev 92(2): 193-205.
Krasnov, P., T. Michurina, M. A. Packer, et al. (2008). "Neuronal nitric oxide synthase contributes to theregulation of hematopoiesis."
Mol Med 14(3-4): 141-149.
Krawetz, R., J. T. Taiani, S. Liu, et al. (2009). "Large-Scale Expansion of Pluripotent Human EmbryoniStem Cells in Stirred Suspension Bioreactors."
c Tissue Eng Part C Methods.
Krosl, J., P. Austin, N. Beslu, et al. (2003a). "In vitro expansion of hematopoietic stem cells by recombinant TAT-HOXB4 protein." Nat Med 9(11): 1428-1432.
Krosl, J., S. Baban, G. Krosl, et al. (1998). "Cellular proliferation and transformation induced by HOXB4 and HOXB3 proteins involves cooperation with PBX1." Oncogene 16(26): 3403-3412.
Krosl, J., N. Beslu, N. Mayotte, et al. (2003b). "The competitive nature of HOXB4-transduced HSC is n limited by PBX1: the generation of ultra-competitive stem cells retaining full differentiatio
potential." Immunity 18(4): 561-571.
Krussel, J. S., P. Bielfeld, M. L. Polan, et al. (2003). "Regulation of embryonic implantation." Eur J Obstet Gynecol Reprod Biol 110 Suppl 1: S2-9.
F. Hirayama, T. Kato, et al. (1996a). "Soluble thrombopoietin Ku, H., receptor (Mpl) and granulocyte colony-stimulating factor receptor directly stimulate proliferation of primitive hematopoietic progenitors of mice in synergy with steel factor or the ligand for Flt3/Flk2." Blood 88(11): 4124-4131.
181
Ku, H., Y. Yonemura, K. Kaushansky, et al. (1996b). "Thrombopoietin, the ligand for the Mpl resynergizes with steel factor and other early acting cytokines in supporting proliferation of primitive hematopoietic progenitors o
ceptor,
f mice." Blood 87(11): 4544-4551.
lture." DevelopmentKubo, A., K. Shinozaki, J. M. Shannon, et al. (2004). "Development of definitive endoderm from
embryonic stem cells in cu 131(7): 1651-1662.
eart tube formation." Genes DevKuo, C. T., E. E. Morrisey, R. Anandappa, et al. (1997). "GATA4 transcription factor is required for
ventral morphogenesis and h 11(8): 1048-1060.
Kurosawa, H. (2007). "Methods for inducing embryoid body formation: in vitro differentiation system ofembryonic stem cells." J Biosci Bioeng 103(5): 389-398.
Kyba, M. and G. Q. Daley (2003). "Hematopoiesis from embryonic stem cells: lessons from and for ontogeny." Exp Hematol 31(11): 994-1006.
Kyba, M., R. C. Perlingeiro and G. Q. Daley (2002). "HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors." Cell 109(1): 29-37.
S A
Kyba, M., R. C. Perlingeiro, R. R. Hoover, et al. (2003). "Enhanced hematopoietic differentiation ofembryonic stem cells conditionally expressing Stat5." Proc Natl Acad Sci U 100 Suppl 1: 11904-11910.
Lacaud, the elopment in vitro." Blood
G., L. Gore, M. Kennedy, et al. (2002). "Runx1 is essential for hematopoietic commitment athemangioblast stage of dev 100(2): 458-466.
Lacaud, G., G. Keller and V. Kouskoff (2004). "Tracking mesoderm formation and specification to the hemangioblast in vitro." Trends Cardiovasc Med 14(8): 314-317.
Lacombe, J., S. Herblot, S. Rojas-Sutterlin, et al. (2010). "Scl regulates the quiescence and the long-term competence of hematopoietic stem cells." Blood 115(4): 792-803.
protocol." Gene Laje, P., P. W. Zoltick and A. W. Flake (2009). "SLAM-enriched hematopoietic stem cells maintain long-
term repopulating capacity after lentiviral transduction using an abbreviated Ther.
Lancrin last generates haematopoietic cells through a haemogenic endothelium stage." Nature, C., P. Sroczynska, C. Stephenson, et al. (2009). "The haemangiob
457(7231): 892-895.
Larrivee duces survival of hematopoietic progenitor cells." J Biol Chem, B., D. R. Lane, I. Pollet, et al. (2003). "Vascular endothelial growth factor receptor-2 in
278(24): 22006-22013.
Larue, L., C. Antos, S. Butz, et al. (1996). "A role for cadherins in tissue formation." Development 122(10): 3185-3194.
Larue, L., M. Ohsugi, J. Hirchenhain, et al. (1994). "E-cadherin null mutant embryos fail to form a trophectoderm epithelium." Proc Natl Acad Sci U S A 91(17): 8263-8267.
t Laughlin, M. J., J. Barker, B. Bambach, et al. (2001). "Hematopoietic engraftment and survival in adulrecipients of umbilical-cord blood from unrelated donors." N Engl J Med 344(24): 1815-1822.
182
Laverriere, A. C., C. MacNeill, C. Mueller, et al. (1994). "GATA-4/5/6, a subfamily of three transcriptionfactors transcribed in developing heart and gut."
J Biol Chem 269(37): 23177-23184.
Le Good, J. A., K. Joubin, A. J. Giraldez, et al. (2005). "Nodal stability determines signaling range." Curr Biol 15(1): 31-36.
Leahy, A., J. W. Xiong, F. Kuhnert, et al. (1999). "Use of developmental marker genes to define temporal and spatial patterns of differentiation during embryoid body formation." J Exp Zool 284(1): 681.
7-
." J Cell BiolLee, S., S. M. Jilani, G. V. Nikolova, et al. (2005). "Processing of VEGF-A by matrix metalloproteinases
regulates bioavailability and vascular patterning in tumors 169(4): 681-691.
rons echnol
Lee, S. H., N. Lumelsky, L. Studer, et al. (2000). "Efficient generation of midbrain and hindbrain neufrom mouse embryonic stem cells." Nat Biot 18(6): 675-679.
Lee, Y. M., C. H. Jeong, S. Y. Koo, et al. (2001). "Determination of hypoxic region by hypoxia marker in developing mouse embryos in vivo: a possible signal for vessel development." Dev Dyn 220(2): 175-186.
Lemaire, P. and L. Kodjabachian (1996). "The vertebrate organizer: structure and molecules." Trends Genet 12(12): 525-531.
Lengerke, C. and G. Q. Daley (2010). "Autologous blood cell therapies from pluripotent stem cells." Blood Rev 24(1): 27-37.
Lengerke, C., S. McKinney-Freeman, O. Naveiras, et al. (2007). "The cdx-hox pathway in hematopoietic stem cell formation from embryonic stem cells." Ann N Y Acad Sci 1106: 197-208.
Lessard, J., A. Faubert and G. Sauvageau (2004). "Genetic programs regulating HSC specification, maintenance and expansion." Oncogene 23(43): 7199-7209.
Levesque, J. P., I. G. Winkler, J. Hendy, et al. (2007). "Hematopoietic progenitor cell mobilization results in hypoxia with increased hypoxia-inducible transcription factor-1 alpha and vascular endothelial growth factor A in bone marrow." Stem Cells 25(8): 1954-1965.
Levy, A. P., N. S. Levy, S. Wegner, et al. (1995). "Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia." J Biol Chem 270(22): 13333-13340.
Lewis, S. L. and P. P. Tam (2006). "Definitive endoderm of the mouse embryo: formation, cell fates, and morphogenetic function." Dev Dyn 235(9): 2315-2329.
Lim, S. M., L. Pereira, M. S. Wong, et al. (2009). "Enforced expression of Mixl1 during mouse ES cell m differentiation suppresses hematopoietic mesoderm and promotes endoderm formation." Ste
Cells 27(2): 363-374.
Ling, K. W., K. Ottersbach, J. P. van Hamburg, et al. (2004). "GATA-2 plays two functionally distinroles during the ontogeny of hematopoietic stem cells."
ct J Exp Med 200(7): 871-882.
Liu, H., S. F. Collins and L. J. Suggs (2006a). "Three-dimensional culture for expansion and differentiation of mouse embryonic stem cells." Biomaterials 27(36): 6004-6014.
183
Liu, Y., Z. Song, Y. Zhao, et al. (2006b). "A novel chemical-defined medium with bFGF and N2B27 supplements supports undifferentiated growth in human embryonic stem cells." Biochem Biophys Res Commun 346(1): 131-139.
Lock, L kakis (2009). "Expansion and differentiation of human embryonic stem cells to endoderm progeny in a microcarrier stirred-suspension culture." Tissue Eng Part A. T. and E. S. Tzana
15(8):
Lu, C. C., J. Brennan and E. J. Robertson (2001). "From fertilization to gastrulation: axis formation in the mouse embryo." Curr Opin Genet Dev
2051-2063.
11(4): 384-392.
Lucitti, uires hemodynamic force." Development
J. L., E. A. Jones, C. Huang, et al. (2007). "Vascular remodeling of the mouse yolk sac req 134(18): 3317-3326.
Lugus, development and differentiation." Development
J. J., Y. S. Chung, J. C. Mills, et al. (2007). "GATA2 functions at multiple steps in hemangioblast 134(2): 393-405.
Lux, C. cells emerging before E10 in the mouse embryo are products of the yolk sac." Blood
T., M. Yoshimoto, K. McGrath, et al. (2008). "All primitive and definitive hematopoietic progenitor 111(7): 3435-3438.
Mac Ga l (2004). "Model of competitive binding of vascular endothelial growth factor and placental growth factor to VEGF receptors on endothelial cells." Am J Physiol Heart bhann, F. and A. S. Pope
Circ Physiol 286(1): H153-164.
MacArthur, B. D., A. Ma'ayan and I. R. Lemischka (2009). "Systems biology of stem cell fate and cellular reprogramming." Nat Rev Mol Cell Biol 10(10): 672-681.
Magli, M. C., C. Largman and H. J. Lawrence (1997). "Effects of HOX homeobox genes in blood cell differentiation." J Cell Physiol 173(2): 168-177.
Marshall, C. J., C. Kinnon and A. J. Thrasher (2000). "Polarized expression of bone morphogenetic protein-4 in the human aorta-gonad-mesonephros region." Blood 96(4): 1591-1593.
l, C. J. and A. J. Thrasher (2001). "The embryonic origins of humMarshal an haematopoiesis." Br J Haematol 112(4): 838-850.
Martin, ed in medium conditioned by teratocarcinoma stem cells." Proc Natl Acad Sci U S AG. R. (1981). "Isolation of a pluripotent cell line from early mouse embryos cultur
78(12): 7634-7638.
Martin, th VEGF to suppress apoptosis at the onset of hematopoiesis." DevelopmentR., R. Lahlil, A. Damert, et al. (2004). "SCL interacts wi
131(3): 693-702.
Matsubls throughout development." J Exp Med
ara, A., A. Iwama, S. Yamazaki, et al. (2005). "Endomucin, a CD34-like sialomucin, marks hematopoietic stem cel .
Matsumoto, K., T. Isagawa, T. Nishimura, et al. (2009). "Stepwise development of hematopoietic stem cells from embryonic stem cells." PLoS One 4(3): e4820.
Matsuoka, S., K. Tsuji, H. Hisakawa, et al. (2001). "Generation of definitive hematopoietic stefrom murine early yolk sac and paraaortic splanchnopleures by aorta-gonad-meson
m cells ephros region-
derived stromal cells." Blood 98(1): 6-12.
184
McKinney-Freeman, S. L., O. Naveiras and G. Q. Daley (2008). "Isolation of hematopoietic stem cellsfrom mouse embryonic stem cells."
Curr Protoc Stem Cell Biol Chapter 1: Unit 1F 3.
McKinney-Freeman, S. L., O. Naveiras, F. Yates, et al. (2009). "Surface antigen phenotypes of hematopoietic stem cells from embryos and murine embryonic stem cells." Blood 114(2): 268-278.
Medvinsky, A. and E. Dzierzak (1996). "Definitive hematopoiesis is autonomously initiated by the AGM region." Cell 86(6): 897-906.
Medvinsky, A. and E. Dzierzak (1999). "Development of the hematopoietic stem cell: can we describe it?" Blood 94(10): 3613-3614.
Medvinsky, A. L., N. L. Samoylina, A. M. Muller, et al. (1993). "An early pre-liver intraembryonic source of CFU-S in the developing mouse." Nature 364(6432): 64-67.
Meno, C., K. Gritsman, S. Ohishi, et al. (1999). "Mouse Lefty2 and zebrafish antivin are feedback inhibitors of nodal signaling during vertebrate gastrulation." Mol Cell 4(3): 287-298.
Metallo, C. M., J. C. Mohr, C. J. Detzel, et al. (2007). "Engineering the stem cell microenvironment." Biotechnol Prog 23(1): 18-23.
Mikawain the amniote." Dev Dyn
, T., A. M. Poh, K. A. Kelly, et al. (2004). "Induction and patterning of the primitive streak, an organizing center of gastrulation 229(3): 422-432.
on of Mikkola, H. K., Y. Fujiwara, T. M. Schlaeger, et al. (2003). "Expression of CD41 marks the initiatidefinitive hematopoiesis in the mouse embryo." Blood 101(2): 508-516.
ic cells." DevelopmentMitjavila-Garcia, M. T., M. Cailleret, I. Godin, et al. (2002). "Expression of CD41 on hematopoietic
progenitors derived from embryonic hematopoiet 129(8): 2003-2013.
e of Mitsui, K., Y. Tokuzawa, H. Itoh, et al. (2003). "The homeoprotein Nanog is required for maintenancpluripotency in mouse epiblast and ES cells." Cell 113(5): 631-642.
Miyazawa, K., M. Shinozaki, T. Hara, et al. (2002). "Two major Smad pathways in TGF-beta supersignalling."
family Genes Cells 7(12): 1191-1204.
Miyazono, K., K. Kusanagi and H. Inoue (2001). "Divergence and convergence of TGF-beta/BMP signaling." J Cell Physiol 187(3): 265-276.
Miyazono, K., S. Maeda and T. Imamura (2005). "BMP receptor signaling: transcriptional targets, regulation of signals, and signaling cross-talk." Cytokine Growth Factor Rev 16(3): 251-263.
rder ." Biomaterials
Mohr, J. C., J. Zhang, S. M. Azarin, et al. (2009). "The microwell control of embryoid body size in oto regulate cardiac differentiation of human embryonic stem cells 31(7): 1885-1893.
Molitern sing of the thrombopoietin receptor is impaired in polycythemia vera." Bloodo, A. R. and J. L. Spivak (1999). "Posttranslational proces
94(8): 2555-2561.
Moore, lood
K. A., H. Ema and I. R. Lemischka (1997). "In vitro maintenance of highly purified, transplantable hematopoietic stem cells." B 89(12): 4337-4347.
185
Morita, Y., H. Ema and H. Nakauchi (2010). "Heterogeneity and hierarchy within the most primitive hematopoietic stem cell compartment." J Exp Med 207(6): 1173-1182.
Morrison, S. J., H. D. Hemmati, A. M. Wandycz, et al. (1995). "The purification and characterizfetal liver hematopoietic stem cells."
ation of Proc Natl Acad Sci U S A 92(22): 10302-10306.
Motoike, T., D. W. Markham, J. Rossant, et al. (2003). "Evidence for novel fate of Flk1+ progenitor: contribution to muscle lineage." Genesis 35(3): 153-159.
Muller, A. M. and E. A. Dzierzak (1993). "ES cells have only a limited lymphopoietic potential after adoptive transfer into mouse recipients." Development 118(4): 1343-1351.
Murray, P. D. F. (1932). "The development in vitro of the blood of the early chick embryo." Proc R Soc Lond B Biol Sci 111: 497.
Nagy, A. (2000). "Cre recombinase: the universal reagent for genome tailoring." Genesis 26(2): 99-109.
Nagy, A Nat . and K. Nagy (2010). "The mysteries of induced pluripotency: where will they lead?"Methods 7(1): 22-24.
Nagy, A 93). "Derivation of completely cell culture-derived mice from early-passage embryonic stem cells." Proc Natl Acad Sci U S A., J. Rossant, R. Nagy, et al. (19
90(18): 8424-8428.
Nair, L. ng and controlled drug delivery." Adv Biochem Eng Biotechnol S. and C. T. Laurencin (2006). "Polymers as biomaterials for tissue engineeri
102: 47-90.
Naito, A ic biphasic roles of Wnt/beta-catenin signaling in cardiomyogenesis and hematopoiesis." Proc Natl Acad Sci U S A. T., I. Shiojima, H. Akazawa, et al. (2006). "Developmental stage-specif
Nakano, T. (1995). "Lymphohematopoietic development from embryonic stem cells in vitro." Semin
103(52): 19812-19817.
Immunol 7(3): 197-203.
Nakano, T., H. Kodama and T. Honjo (1994). "Generation of lymphohematopoietic cells from embryonic stem cells in culture." Science 265(5175): 1098-1101.
Nakayama, N., D. Duryea, R. Manoukian, et al. (2003). "Macroscopic cartilage formation with embryonic stem-cell-derived mesodermal progenitor cells." J Cell Sci 116(Pt 10): 2015-2028.
Nakayama, N., J. Lee and L. Chiu (2000). "Vascular endothelial growth factor synergistically enhances onic bone morphogenetic protein-4-dependent lymphohematopoietic cell generation from embry
stem cells in vitro." Blood 95(7): 2275-2283.
Nelson, T. J., A. Chiriac, R. S. Faustino, et al. (2009). "Lineage specification of Flk-1+ progenitors is associated with divergent Sox7 expression in cardiopoiesis." Differentiation 77(3): 248-255.
Neufeld, G., T. Cohen, S. Gengrinovitch, et al. (1999). "Vascular endothelial growth factor (VEGF) and its receptors." Faseb J 13(1): 9-22.
Ng, E. S., R. P. Davis, L. Azzola, et al. (2005). "Forced aggregation of defined numbers of human embryonic stem cells into embryoid bodies fosters robust, reproducible hematopoietic
differentiation." Blood 106(5): 1601-1603.
186
Niakan, K. K., H. Ji, R. Maehr, et al. (2010). "Sox17 promotes differentiation in mouse embryonic stecells by directly regulating extraembryonic gene expression and indirect
m ly antagonizing self-
renewal." Genes Dev 24(3): 312-326.
Nicholl y rapidly stimulating lineage restriction of bipotent granulocyte-macrophage colony-forming cells."
s, S. E., C. M. Heyworth, T. M. Dexter, et al. (1995). "IL-4 promotes macrophage development b
J Immunol 155(2): 845-853.
Nichols, J. and A. Smith (2009). "Naive and primed pluripotent states." Cell Stem Cell 4(6): 487-492.
Nichols cells in the mammalian embryo depends on the POU transcription factor Oct4." Cell, J., B. Zevnik, K. Anastassiadis, et al. (1998). "Formation of pluripotent stem
95(3): 379-391.
Nie, H., (2008). "Three-dimensional fibrous PLGA/HAp composite scaffold for BMP-2 delivery." Biotechnol Bioeng B. W. Soh, Y. C. Fu, et al.
99(1): 223-234.
Nie, Y., V. Bergendahl, D. J. Hei, et al. (2009). "Scalable culture and cryopreservation of human embryonic stem cells on microcarriers." Biotechnol Prog 25(1): 20-31.
Niebruegge, S., C. L. Bauwens, R. Peerani, et al. (2009). "Generation of human embryonic stem cell-derived mesoderm and cardiac cells using size-specified aggregates in an oxygen-controlled bioreactor." Biotechnol Bioeng 102(2): 493-507.
Nishikawa, S. I., S. Nishikawa, M. Hirashima, et al. (1998). "Progressive lineage analysis by cell sortingand culture identifies FLK1+VE-cadherin+ cells at a diverg
ing point of endothelial and
hemopoietic lineages." Development 125(9): 1747-1757.
Niwa, A t emoangiogenic progenitors." J Cell Physiol
., K. Umeda, H. Chang, et al. (2009). "Orderly hematopoietic development of induced pluripotenstem cells via Flk-1(+) h 221(2): 367-377.
Niwa, H. (2001). "Molecular mechanism to maintain stem cell renewal of ES cells." Cell Struct Funct
ells." Nat Genet
26(3): 137-148.
Niwa, H., J. Miyazaki and A. G. Smith (2000). "Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES c 24(4): 372-376.
North, T. E., W. Goessling, M. Peeters, et al. (2009). "Hematopoietic stem cell development is dependent on blood flow." Cell 137(4): 736-748.
Nottingham, W. T., A. Jarratt, M. Burgess, et al. (2007). "Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer." Blood 110(13): 4188-4197.
Nuttelman, C. R., M. C. Tripodi and K. S. Anseth (2004). "In vitro osteogenic differentiation of human mesenchymal stem cells photoencapsulated in PEG hydrogels." J Biomed Mater Res A 68(4): 773-782.
Oberlin, E., M. Tavian, I. Blazsek, et al. (2002). "Blood-forming potential of vascular endothelium in thehuman embryo."
Development 129(17): 4147-4157.
Odorico, J. S., D. S. Kaufman and J. A. Thomson (2001). "Multilineage differentiation from humanembryonic stem cell lines." Stem Cells 19(3): 193-204.
187
Ogawa, M. (1993). "Differentiation and proliferation of hematopoietic stem cells." Blood 81(11): 2844-2853.
Oh, S. K., A. K. Chen, Y. Mok, et al. (2009). "Long-term microcarrier suspension cultures of human embryonic stem cells." Stem Cell Res.
, O. and V. L. Bautch (1997). Ohneda "Murine endothelial cells support fetal liver erythropoiesis and myelopoiesis via distinct interactions." Br J Haematol 98(4): 798-808.
Ohneda, O., C. Fennie, Z. Zheng, et al. (1998). "Hematopoietic stem cell maintenance and differentiation dare supported by embryonic aorta-gonad-mesonephros region-derived endothelium." Bloo 92(3):
tem Cell Res
908-919.
Olmer, R., A. Haase, S. Merkert, et al. (2010). "Long term expansion of undifferentiated human iPS and ES cells in suspension culture using a defined medium." S 5(1): 51-64.
Olofsson, B., M. Jeltsch, U. Eriksson, et al. (1999). "Current biology of VEGF-B and VEGF-C." Curr Opin Biotechnol 10(6): 528-535.
Olsson, A. K., A. Dimberg, J. Kreuger, et al. (2006). "VEGF receptor signalling - in control of vasculafunction."
r Nat Rev Mol Cell Biol 7(5): 359-371.
Oner, L. and M. J. Groves (1993). "Optimization of conditions for preparing 2- to 5-micron-range gelatin microparticles by using chilled dehydration agents." Pharm Res 10(4): 621-626.
. and B. P. Alter (1995). "Effects of low oxygen tension andOno, K antioxidants on human erythropoiesis in vitro." Exp Hematol 23(13): 1372-1377.
Oostend rta-gonads-mesonephros subregions are potent supporters of hematopoietic stem cell activity." Bloodorp, R. A., K. N. Harvey, N. Kusadasi, et al. (2002). "Stromal cell lines from mouse ao
Oostendorp, R. A., C. Robin, C. Steinhoff, et al. (2005). "Long-term maintenance of hematopoietic stem Cells
99(4): 1183-1189.
cells does not require contact with embryo-derived stromal cells in cocultures." Stem 23(6): 842-851.
Orkin, S. H. and L. I. Zon (2008). "Hematopoiesis: an evolving paradigm for stem cell biology." Cell 132(4): 631-644.
Orr-Urtreger, A. and P. Lonai (1992). "Platelet-derived growth factor-A and its receptor are expresseseparate, but adjacent cell layers of the mouse embryo."
d in Development 115(4): 1045-1058.
Osawa, M., K. Hanada, H. Hamada, et al. (1996). "Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell." Science 273(5272): 242-245.
Ottersbach, K. and E. Dzierzak (2005). "The murine placenta contains hematopoietic stem cells within the vascular labyrinth region." Dev Cell 8(3): 377-387.
Palacios, R., E. Golunski and J. Samaridis (1995). "In vitro generation of hematopoietic stem cells from d an embryonic stem cell line." Proceedings of the National Academy of Sciences of the Unite
States of America 92(16): 7530-7534.
188
Palis, J., R. J. Chan, A. Koniski, et al. (2001). "Spatial and temporal emergence of high proliferative potential hematopoietic precursors during murine embryogenesis." Proc Natl Acad Sci U S A 98(8): 4528-4533.
Palis, J. "Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse." Development, S. Robertson, M. Kennedy, et al. (1999).
126(22): 5073-5084.
Palmqv onic stem cell gene expression profiles with functional measures of pluripotency." Stem Cellsist, L., C. H. Glover, L. Hsu, et al. (2005). "Correlation of murine embry
23(5): 663-680.
Papathaematopoietic stem cells is regulated by Ikaros." Stem Cells
nasiou, P., J. L. Attema, H. Karsunky, et al. (2009). "Self-renewal of the long-term reconstituting subset of h 27(12): 3082-3092.
ic stem cells." Development
Park, C., I. Afrikanova, Y. S. Chung, et al. (2004). "A hierarchical order of factors in the generation of FLK1- and SCL-expressing hematopoietic and endothelial progenitors from embryon
131(11): 2749-2762.
Park, I. 8). "Reprogramming of human somatic cells to pluripotency with defined factors." NatureH., R. Zhao, J. A. West, et al. (200
451(7175): 141-146.
Park, J., fabrication-based modulation of embryonic stem cell differentiation." Lab Chip C. H. Cho, N. Parashurama, et al. (2007). "Micro
7(8): 1018-1028.
Parmar, lls in the bone marrow according to regional hypoxia." Proc Natl Acad Sci U S A K., P. Mauch, J. A. Vergilio, et al. (2007). "Distribution of hematopoietic stem ce
104(13): 5431-5436.
Patel, Z in vivo release of vascular endothelial growth factor from gelatin microparticles and biodegradable composite scaffolds." Pharm Res. S., H. Ueda, M. Yamamoto, et al. (2008a). "In vitro and
Patel, Z H. Ueda, et al. (2008b). "Biodegradable gelatin microparticles as delivery systems for the controlled release of bone morphogenetic protein-2." Acta Biomater
25(10): 2370-2378.
. S., M. Yamamoto, 4(5): 1126-
Pearson, S., P. Sroczynska, G. Lacaud, et al. (2008). "The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4, activin A, bFGF and VEGF."
1138.
Development 135(8): 1525-1535.
Peault, B. (1996). "Hematopoietic stem cell emergence in embryonic life: developmental hematology revisited." J Hematother 5(4): 369-378.
Peerani, R., K. Onishi, A. Mahdavi, et al. (2009). "Manipulation of signaling thresholds in "engineered stem cell niches" identifies design criteria for pluripotent stem cell screens." PLoS One 4(7): e6438.
Peerani, R., B. M. Rao, C. Bauwens, et al. (2007). "Niche-mediated control of human embryonic stem cell self-renewal and differentiation." Embo J 26(22): 4744-4755.
Peerani, R. and P. W. Zandstra (2010). "Enabling stem cell therapies through synthetic stem cell-niche engineering." J Clin Invest 120(1): 60-70.
Perkinson, R. A. and P. A. Norton (1997). "Expression of the mouse fibronectin gene and fibronectin-lacZ transgenes during somitogenesis." Dev Dyn 208(2): 244-254.
189
Perlingeiro, R. C., M. Kyba, S. Bodie, et al. (2003). "A role for thrombopoietin in hemangioblast development." Stem Cells 21(3): 272-280.
Pesce, M., X. Wang, D. J. Wolgemuth, et al. (1998). "Differential expression of the Oct-4 transcription factor during mouse germ cell differentiation." Mech Dev 71(1-2): 89-98.
Petit-Cocault, L., C. Volle-Challier, M. Fleury, et al. (2007). "Dual role of Mpl receptor during the establishment of definitive hematopoiesis." Development 134(16): 3031-3040.
Petzer, A. L., P. W. Zandstra, J. M. Piret, et al. (1996). "Differential cytokine effects on primitive (CD34+CD38-) human hematopoietic cells: novel responses to Flt3-ligand and thrombopoietin." J Exp Med 183(6): 2551-2558.
Phillips, B. W., R. Horne, T. S. Lay, et al. (2008). "Attachment and growth of human embryonic stem cells on microcarriers." J Biotechnol 138(1-2): 24-32.
Phillips, P. G., L. M. Birnby and A. Narendran (1995). "Hypoxia induces capillary network formation in cultured bovine pulmonary microvessel endothelial cells." Am J Physiol 268(5 Pt 1): L789-800.
Pick, M., L. Azzola, A. Mossman, et al. (2007). "Differentiation of human embryonic stem cells in serum-th
in hematopoiesis." Stem Cellsfree medium reveals distinct roles for bone morphogenetic protein 4, vascular endothelial growfactor, stem cell factor, and fibroblast growth factor 2 25(9): 2206-2214.
Picotti, S. cerevisiae by targeted proteomics." CellP., B. Bodenmiller, L. N. Mueller, et al. (2009). "Full dynamic range proteome analysis of
138(4): 795-806.
Piedra, the chick embryo." Development
M. E. and M. A. Ros (2002). "BMP signaling positively regulates Nodal expression during left right specification in 129(14): 3431-3440.
Piek, E., C. H. Heldin and P. Ten Dijke (1999). "Specificity, diversity, and regulation in TGF-beta superfamily signaling." Faseb J 13(15): 2105-2124.
Pilat, S., S. Carotta, B. Schiedlmeier, et al. (2005). "HOXB4 enforces equivalent fates of ES-cell-derived and adult hematopoietic cells." Proc Natl Acad Sci U S A 102(34): 12101-12106.
, Z., T. Cohen, R. Sivan, et al. (199Poltorak 7). "VEGF145, a secreted vascular endothelial growth factor isoform that binds to extracellular matrix." J Biol Chem 272(11): 7151-7158.
Potocni 7). "Hemato-lymphoid in vivo reconstitution potential of subpopulations derived from in vitro differentiated embryonic stem cells." Proc Natl Acad Sci U k, A. J., H. Kohler and K. Eichmann (199
S A 94(19): 10295-10300.
C., R. GPouget, autier, M. A. Teillet, et al. (2006). "Somite-derived cells replace ventral aortic hemangioblasts and provide aortic smooth muscle cells of the trunk." Development 133(6): 1013-
Price, P. J. and G. J. Brewer (2001). Serum-Free Media for Neural Cell Cultures: Adult and Embryonic.
1022.
Protocols for Neural Cell Culture. Fedoroff, S. and A. Richardson. Totowa, NJ, Humana Press, Inc.: 255-264.
190
Pringle, K. G., K. L. Kind, J. G. Thompson, et al. (2007). "Complex interactions between hypoxiainducible factors, insulin-like growth factor
-II and oxygen in early murine trophoblasts." Placenta
28(11-12): 1147-1157.
Punzel, man hematopoietic progenitors is altered only by the cellular microenvironment." Exp Hematol
M., D. Liu, T. Zhang, et al. (2003). "The symmetry of initial divisions of hu 31(4): 339-347.
Purpura activation to control hematopoietic and endothelial development in an oxygen-responsive manner." Stem Cells, K. A., S. H. George, S. M. Dang, et al. (2008a). "Soluble Flt-1 regulates Flk-1
Purpura stra (2008b). "Analysis of the temporal and concentration-dependent effects of BMP-4, VEGF, and TPO on development of embryonic stem cell-derived
26(11): 2832-2842.
, K. A., J. Morin and P. W. Zand
mesoderm and blood progenitors in a defined, serum-free media." Exp Hematol 36(9): 1186-1198.
Purton, L. E. and D. T. Scadden (2007). "Limiting factors in murine hematopoietic stem cell assays." Cell Stem Cell 1(3): 263-270.
Qu, X. B., J. Pan, C. Zhang, et al. (2008). "Sox17 facilitates the differentiation of mouse embryonic stem cells into primitive and definitive endoderm in vitro." Dev Growth Differ 50(7): 585-593.
T. P., KQuinn, . G. Peters, C. De Vries, et al. (1993). "Fetal liver kinase 1 is a receptor for vascular endothelial growth factor and is selectively expressed in vascular endothelium." Proc Natl Acad Sci U S A 90(16): 7533-7537.
Radisic, M., J. Malda, E. Epping, et al. (2006). "Oxygen gradients correlate with cell density and cell viability in engineered cardiac tissue." Biotechnol Bioeng 93(2): 332-343.
Radisic, M., L. Yang, J. Boublik, et al. (2004). "Medium perfusion enables engineering of compact and contractile cardiac tissue." Am J Physiol Heart Circ Physiol 286(2): H507-516.
Ramirez-Bergeron, D. L., A. Runge, K. D. Dahl, et al. (2004). "Hypoxia affects mesoderm and enhances hemangioblast specification during early development." Development 131(18): 4623-4634.
Ramirez-Bergeron, D. L. and M. C. Simon (2001). "Hypoxia-inducible factor and the development of stem cells of the cardiovascular system." Stem Cells 19(4): 279-286.
Rampon, C. and P. Huber (2003). "Multilineage hematopoietic progenitor activity generated autonomously in the mouse yolk sac: analysis using angiogenesis-defective embryos." Int J Dev Biol 47(4): 273-280.
Rhodes, K. E., C. Gekas, Y. Wang, et al. (2008). "The emergence of hematopoietic stem cells is initiated in the placental vasculature in the absence of circulation." Cell Stem Cell 2(3): 252-263.
Risau, W., H. Sariola, H. G. Zerwes, et al. (1988). "Vasculogenesis and angiogenesis in embryonic-stem-cell-derived embryoid bodies." Development 102(3): 471-478.
Robertsr Flt-1 (VEGFR-1) modulates Flk-1 (VEGFR-2) signaling during blood vessel
formation." Am J Pathol
, D. M., J. B. Kearney, J. H. Johnson, et al. (2004). "The vascular endothelial growth factor (VEGF) recepto
164(5): 1531-1535.
191
Robertson, E. J. (1987). Embryo-derived stem cell lines. Teratocarcinomas and Embryonic Stem Cells: A practical Approach. Robertson, E. J. Oxford, IRL Press: 71-112.
Robertson, S. M., M. Kennedy, J. M. Shannon, et al. (2000). "A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1." Development 127(11):2447-2459.
Robinson, C. J. and S. E. Stringer (2001). "The splice variants of vascular endothelial growth factor (VEGF) and their receptors." J Cell Sci 114(Pt 5): 853-865.
Rodaway, A. and R. Patient (2001). "Mesendoderm: An ancient germ layer?" Cell 105(2): 169-172.
Rosenkranz, S. and A. Kazlauskas (1999). "Evidence for distinct signaling properties and biological responses induced by the PDGF receptor alpha and beta subtypes." Growth Factors 16(3): 201216.
-
posterior embryonic visceral endoderm in the early post-implantation mouse embryo." Mech Dev
Rosenquist, T. A. and G. R. Martin (1995). "Visceral endoderm-1 (VE-1): an antigen marker that distinguishes anterior from
49(1-2): 117-121.
Rossant, J. (2008). "Stem cells and early lineage development." Cell 132(4): 527-531.
Roth, D., M. Piekarek, M. Paulsson, et al. (2006). "Plasmin modulates vascular endothelial growth fA-mediated angiogenesis during wound repair."
actor-Am J Pathol 168(2): 670-684.
Sabin, F. R. (1920). "Studies on the origin of blood vessels and of red blood corpuscles as seen in the living blastoderm of chicks during the second day of incubation." Contrib Embryol Cargegie Institue Pub. 214 or 9: 9 or 213-262.
Sachlos, E. and D. T. Auguste (2008). "Embryoid body morphology influences diffusive transport of inductive biochemicals: a strategy for stem cell differentiation." Biomaterials 29(34): 4471-4480.
Sakurai, H., T. Era, L. M. Jakt, et al. (2006). "In vitro modeling of paraxial and lateral mesoderm differentiation reveals early reversibility." Stem Cells 24(3): 575-586.
Samokhvalov, I. M., N. I. Samokhvalova and S. Nishikawa (2007). "Cell tracing shows the contributioof the yolk sac to adult haematopoiesis."
n Nature 446(7139): 1056-1061.
Sanchez, M. J., A. Holmes, C. Miles, et al. (1996). "Characterization of the first definitive hematopoietic stem cells in the AGM and liver of the mouse embryo." Immunity 5(6): 513-525.
Sargent, C. Y., G. Y. Berguig and T. C. McDevitt (2009). "Cardiomyogenic differentiation of embryoid bodies is promoted by rotary orbital suspension culture." Tissue Eng Part A 15(2): 331-342.
Sasaki, K., Y. Nagao, Y. Kitano, et al. (2005). "Hematopoietic microchimerism in sheep after in utero transplantation of cultured cynomolgus embryonic stem cells." Transplantation 79(1): 32-37.
Sauvageau, G., U. Thorsteinsdottir, C. J. Eaves, et al. (1995). "Overexpression of HOXB4 in d in hematopoietic cells causes the selective expansion of more primitive populations in vitro an
vivo." Genes Dev 9(14): 1753-1765.
Schatteman, G. C., K. Morrison-Graham, A. van Koppen, et al. (1992). "Regulation and role of PDGF receptor alpha-subunit expression during embryogenesis." Development 115(1): 123-131.
192
Schier, A. F. (2003). "Nodal signaling in vertebrate development." Annu Rev Cell Dev Biol 19: 589-621.
Schlange, T., H. H. Arnold and T. Brand (2002). "BMP2 is a positive regulator of Nodal signaling during left-right axis formation in the chicken embryo." Development 129(14): 3421-3429.
Schmidt, J. J., J. Rowley and H. J. Kong (2008). "Hydrogels used for cell-based drug delivery." J Biomed Mater Res A 87(4): 1113-1122.
Schmitt tic development of embryonic stem cells in vitro: cytokine and receptor gene expression." Genes Dev, R. M., E. Bruyns and H. R. Snodgrass (1991). "Hematopoie
5(5): 728-740.
Schoemans, H., K. Theunissen, J. Maertens, et al. (2006). "Adult umbilical cord blood transplantation: a comprehensive review." Bone Marrow Transplant 38(2): 83-93.
Schroeder, M., S. Niebruegge, A. Werner, et al. (2005). "Differentiation and lineage selection of mouse embryonic stem cells in a stirred bench scale bioreactor with automated process control." Biotechnol Bioeng 92(7): 920-933.
er, T. (2010). "Hematopoietic stem cell heterogSchroed eneity: subtypes, not unpredictable behavior." Cell Stem Cell 6(3): 203-207.
Schuh, A. C., P. Faloon, Q. L. Hu, et al. (1999). "In vitro hematopoietic and endothelial potential of flk-1(-/-) embryonic stem cells and embryos." Proc Natl Acad Sci U S A 96(5): 2159-2164.
Schuldiner, M., O. Yanuka, J. Itskovitz-Eldor, et al. (2000). "Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells." Proc Natl Acad Sci U S A 97(21): 11307-11312.
Schulz, T. C., A. M. Swistowska, Y. Liu, et al. (2007). "A large-scale proteomic analysis of human embryonic stem cells." BMC Genomics 8: 478.
Sefton, M., M. H. Johnson and L. Clayton (1992). "Synthesis and phosphorylation of uvomorulin during mouse early development." Development 115(1): 313-318.
Shalaby, F., J. Ho, W. L. Stanford, et al. (1997). "A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis." Cell 89(6): 981-990.
Shalaby, F., J. Rossant, T. P. Yamaguchi, et al. (1995). "Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice." Nature 376(6535): 62-66.
Shi, Y. and J. Massague (2003). "Mechanisms of TGF-beta signaling from cell membrane to the nucleus." Cell 113(6): 685-700.
Shibuya, M., S. Yamaguchi, A. Yamane, et al. (1990). "Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family." Oncogene 5(4519-524.
):
th factor Shinbrot, E., K. G. Peters and L. T. Williams (1994). "Expression of the platelet-derived growbeta receptor during organogenesis and tissue differentiation in the mouse embryo." Dev Dyn 199(3): 169-175.
Shweiki, D., A. Itin, D. Soffer, et al. (1992). "Vascular endothelial growth factor induced by hypoxia mmediate hypoxia-initiated angiogenesis."
ay Nature 359(6398): 843-845.
193
Sieburg, H. B., R. H. Cho, B. Dykstra, et al. (2006). "The hematopoietic stem compartment consists of a limited number of discrete stem cell subsets." Blood 107(6): 2311-2316.
Siepman d on hydroxypropyl methylcellulose (HPMC)." Adv Drug Deliv Revn, J. and N. A. Peppas (2001). "Modeling of drug release from delivery systems base
48(2-3): 139-157.
Simon, role of oxygen availability in embryonic development and stem cell function." Nat Rev Mol Cell BiolM. C. and B. Keith (2008). "The
9(4): 285-296.
Singla, rts self-renewal of embryonic stem cells." Biochem Biophys Res CommunD. K., D. J. Schneider, M. M. LeWinter, et al. (2006). "wnt3a but not wnt11 suppo
345(2): 789-795.
Sintes, CD150 (SLAM) family receptors by human hematopoietic stem and progenitor cells." Exp Hematol
J., X. Romero, P. Marin, et al. (2008). "Differential expression of 36(9): 1199-1204.
Sitnicka n and tic stem cells." Blood
, E., N. Lin, G. V. Priestley, et al. (1996). "The effect of thrombopoietin on the proliferatiodifferentiation of murine hematopoie 87(12): 4998-5005.
tite-alginate composite microspheres." J Biomed Mater Res ASivakumar, M. and K. P. Rao (2003). "Preparation, characterization, and in vitro release of gentamicin
from coralline hydroxyapa 65(2): 222-228.
Smith, A. G. (2001). "Embryo-derived stem cells: of mice and men." Annu Rev Cell Dev Biol 17: 435-462.
Smith, A its urine embryonal carcinoma and embryonic stem cells." Dev Biol
. G. and M. L. Hooper (1987). "Buffalo rat liver cells produce a diffusible activity which inhibthe differentiation of m 121(1): 1-9.
Snoeck rferon-gamma and interleukin-4 reciprocally regulate the production of monocytes/macrophages and neutrophils through a direct effect on
, H. W., F. Lardon, M. Lenjou, et al. (1993). "Inte
committed monopotential bone marrow progenitor cells." Eur J Immunol 23(5): 1072-1077.
Snoeck, H. W., M. Lenjou, G. Nys, et al. (1996). "Interleukin 4 and interferon gamma costimulate the
d its integration with the regulation of the immune response." Leukemia
expansion of early human myeloid colony-forming cells. Proposal of a model for the regulation of myelopoiesis by interleukin 4 and interferon gamma an
10(1): 117-122.
Snoeck, ma selectively inhibits very primitive CD342+CD38- and not more mature CD34+CD38+ human hematopoietic progenitor H. W., D. R. Van Bockstaele, G. Nys, et al. (1994). "Interferon gam
cells." J Exp Med 180(3): 1177-1182.
Snyder, A., S. T. Fraser and M. H. Baron (2004). "Bone morphogenetic proteins in vertebrate hematopoietic development." J Cell Biochem 93(2): 224-232.
rg, S. S., GSoderbe . Karlsson and S. Karlsson (2009). "Complex and context dependent regulation of hematopoiesis by TGF-beta superfamily signaling." Ann N Y Acad Sci 1176: 55-69.
Solter, Durr Top Dev Biol
. and B. B. Knowles (1979). "Developmental stage-specific antigens during mouse embryogenesis." C 13 Pt 1: 139-165.
Staal, F. J. and H. C. Clevers (2005). "WNT signalling and haematopoiesis: a WNT-WNT situation." Nat Rev Immunol 5(1): 21-30.
194
Steinberg, M. S. and M. Takeichi (1994). "Experimental specification of cell sorting, tissue spreading, and specific spatial patterning by quantitative differences in cadherin expression." Proc Natl Acad Sci U S A 91(1): 206-209.
Steiner, ferentiation of human embryonic stem cells in suspension." Nat Biotechnol D., H. Khaner, M. Cohen, et al. (2010). "Derivation, propagation and controlled dif
28(4): 361-364.
Streeter oxygenation and splenic erythropoiesis during chronic hypoxia and hypercapnia." J Appl Physiol, R. G., W. E. Pepelko and S. M. Cain (1975). "Tissue
38(2): 309-314.
Strubing mbryonic stem cells into the neuronal lineage in vitro gives rise to mature inhibitory and excitatory neurons." Mech , C., G. Ahnert-Hilger, J. Shan, et al. (1995). "Differentiation of pluripotent e
Dev 53(2): 275-287.
Sugi, Y. and J. Lough (1994). "Anterior endoderm is a specific effector of terminal cardiac myocyte differentiation of cells from the embryonic heart forming region." Dev Dyn 200(2): 155-162.
Sutherland, H. J., C. J. Eaves, A. C. Eaves, et al. (1989). "Characterization and partial purification of human marrow cells capable of initiating long-term hematopoiesis in vitro." Blood 74(5): 1563-1570.
Taiani, J., R. J. Krawetz, N. Z. Nieden, et al. (2009). "Reduced Differentiation Efficiency of Murine Embryonic Stem Cells in Stirred Suspension Bioreactors." Stem Cells Dev.
Takahashi, H. and M. Shibuya (2005). "The vascular endothelial growth factor (VEGF)/VEGF receptor system and its role under physiological and pathological conditions." Clin Sci (Lond) 109(3): 227-241.
Takahashi, K., K. Tanabe, M. Ohnuki, et al. (2007). "Induction of pluripotent stem cells from adult human fibroblasts by defined factors." Cell 131(5): 861-872.
shi, K. and S. Yamanaka (2006). "Induction of pluripotent stem cells from mouse embryonic aTakaha nd adult fibroblast cultures by defined factors." Cell 126(4): 663-676.
Takeuch
ow." Blood
i, M., T. Sekiguchi, T. Hara, et al. (2002). "Cultivation of aorta-gonad-mesonephros-derived hematopoietic stem cells in the fetal liver microenvironment amplifies long-term repopulating activity and enhances engraftment to the bone marr 99(4): 1190-1196.
Tam, P. P. and R. R. Behringer (1997). "Mouse gastrulation: the formation of a mammalian body plan." Mech Dev 68(1-2): 3-25.
Tavian, M. and B. Peault (2005). "Embryonic development of the human hematopoietic system." Int J Dev Biol 49(2-3): 243-250.
Tavian, M., C. Robin, L. Coulombel, et al. (2001). "The human embryo, but not its yolk sac, generates lympho-myeloid stem cells: mapping multipotent hematopoietic cell fate in intraembryonic mesoderm." Immunity 15(3): 487-495.
Tennant, G. B., L. N. Truran, R. Bailey-Wood, et al. (2000). "Control of pH in human long-temarrow cultures with low-glucose medium containing z
rm bone witterion buffer lengthens the period of
haemopoietic activity." Br J Haematol 109(4): 785-787.
195
Tesar, P. J., J. G. Chenoweth, F. A. Brook, et al. (2007). "New cell lines from mouse epiblast share defining features with human embryonic stem cells." Nature 448(7150): 196-199.
Thomson, J. A., J. Itskovitz-Eldor, S. S. Shapiro, et al. (1998). "Embryonic stem cell lines derived from human blastocysts." Science 282(5391): 1145-1147.
Thomson, J. A., J. Kalishman, T. G. Golos, et al. (1995). "Isolation of a primate embryonic stem cell line." Proc Natl Acad Sci U S A 92(17): 7844-7848.
Tian, X., J. K. Morris, J. L. Linehan, et al. (2004). "Cytokine requirements differ for stroma and embryoid body-mediated hematopoiesis from human embryonic stem cells." Exp Hematol 32(10): 1000-1009.
Tzouanacou, E., A. Wegener, F. J. Wymeersch, et al. (2009). "Redefining the progression of lineage segregations during mammalian embryogenesis by clonal analysis." Dev Cell 17(3): 365-376.
Ueno, H. and I. L. Weissman (2006). "Clonal analysis of mouse development reveals a polyclonal origin for yolk sac blood islands." Dev Cell 11(4): 519-533.
, Y., YUmaoka . Noda, K. Narimoto, et al. (1991). "Developmental potentiality of embryos cultured under low oxygen tension with superoxide dismutase." J In Vitro Fert Embryo Transf 8(5): 245-249.
Umaoka y development of mouse embryos." Mol Reprod Dev, Y., Y. Noda, K. Narimoto, et al. (1992). "Effects of oxygen toxicity on earl
31(1): 28-33.
Ungrin,lar organization from single cell suspension-derived human embryonic stem cell
aggregates." PLoS One
M. D., C. Joshi, A. Nica, et al. (2008). "Reproducible, ultra high-throughput formation of multicellu
3(2): e1565.
Vajta, G of zona-included or zona-free embryos: the Well of the Well (WOW) system." Mol Reprod Dev., T. T. Peura, P. Holm, et al. (2000). "New method for culture
55(3): 256-264.
van der a culture-medium perspective." Trends Biotechnol
Pol, L. and J. Tramper (1998). "Shear sensitivity of animal cells from 16(8): 323-328.
Vanderv s oort, J. and A. Ludwig (2004). "Preparation and evaluation of drug-loaded gelatin nanoparticlefor topical ophthalmic use." Eur J Pharm Biopharm 57(2): 251-261.
Varlet, I., J. Collignon and E. J. Robertson (1997). "nodal expression in the primitive endoderm is required for specification of the anterior axis during mouse gastrulation." Development 124(5): 1033-1044.
Vodyan homson, et al. (2005). "Human embryonic stem cell-derived CD34+ cells: efficient production in the coculture with OP9 stromal cells and analysis of ik, M. A., J. A. Bork, J. A. T
lymphohematopoietic potential." Blood 105(2): 617-626.
Waltenberger, J., L. Claesson-Welsh, A. Siegbahn, et al. (1994). "Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor." J Biol Chem 269(43):
Wang, J tic differentiation of human embryonic stem cells induced by co-culture with human bone marrow stromal cells and low dose cytokines." Cell Biol Int
26988-26995.
., H. P. Zhao, G. Lin, et al. (2005a). "In vitro hematopoie
.
196
Wang, L., L. Li, F. Shojaei, et al. (2004). "Endothelial and hematopoietic cell fate of human embryostem cells originates from primitive endothelium with hemangioblastic properties."
nic Immunity
21(1): 31-41.
Wang, L ietic development from human embryonic stem cell lines." Exp Hematol., P. Menendez, C. Cerdan, et al. (2005b). "Hematopo
33(9): 987-996.
Wang, Y tem cell-derived hematopoietic stem cells." Proc Natl Acad Sci U S A., F. Yates, O. Naveiras, et al. (2005c). "Embryonic s
102(52): 19081-19086.
Wang, Zy embryonic stem cells to hematopoietic cells." Ann N Y Acad Sci
., J. Skokowa, A. Pramono, et al. (2005d). "Thrombopoietin regulates differentiation of rhesus monke 1044: 29-40.
Watanabe, K., M. Ueno, D. Kamiya, et al. (2007). "A ROCK inhibitor permits survival of dissociatedhuman embryonic stem cells." Nat Biotechnol 25(6): 681-686.
Watt, F. M. and K. J. Hodivala (1994). "Cell adhesion. Fibronectin and integrin knockouts come unstuck." Curr Biol 4(3): 270-272.
Weksberg, D. C., S. M. Chambers, N. C. Boles, et al. (2008). "CD150- side population cells represent a functionally distinct population of long-term hematopoietic stem cells." Blood 111(4): 2444-2451.
Wernig tro reprogramming of fibroblasts into a pluripotent ES-cell-like state." Nature
, M., A. Meissner, R. Foreman, et al. (2007). "In vi 448(7151): 318-324.
Whitma lln, M. (2001). "Nodal signaling in early vertebrate embryos: themes and variations." Dev Ce
ors
1(5): 605-617.
Wierzbowska, A., T. Robak, A. Wrzesien-Kus, et al. (2003). "Circulating VEGF and its soluble receptsVEGFR-1 and sVEGFR-2 in patients with acute leukemia." Eur Cytokine Netw 14(3): 149-153.
rmation ll in vitro differentiation." Leukemia
Wiles, M. V. and B. M. Johansson (1997). "Analysis of factors controlling primary germ layer foand early hematopoiesis using embryonic stem ce 11 Suppl 3: 454-456.
Wiles, M t in a chemically defined medium." Exp Cell Res. V. and B. M. Johansson (1999). "Embryonic stem cell developmen
247(1): 241-248.
Wiles, M re." Development
. V. and G. Keller (1991). "Multiple hematopoietic lineages develop from embryonic stem (ES)cells in cultu 111(2): 259-267.
Wilkinson, D. G., S. Bhatt and B. G. Herrmann (1990). "Expression pattern of the mouse T gene and its role in mesoderm formation." Nature 343(6259): 657-659.
Wilson, A., E. Laurenti, G. Oser, et al. (2008). "Hematopoietic stem cells reversibly switch from dormancy to self-renewal during homeostasis and repair." Cell 135(6): 1118-1129.
, G., M. BlessinWinnier g, P. A. Labosky, et al. (1995). "Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse." Genes Dev 9(17): 2105-2116.
197
Wobus, A. M., G. Kaomei, J. Shan, et al. (1997). "Retinoic acid accelerates embryonic stem cell-derivedcardiac differentiation and enhances development of ventricular cardiomyocytes."
J Mol Cell
Cardiol 29(6): 1525-1539.
." BloodWoll, P. S., J. K. Morris, M. S. Painschab, et al. (2008). "Wnt signaling promotes hematoendothelial cell
development from human embryonic stem cells 111(1): 122-131.
Woltjen, K., I. P. Michael, P. Mohseni, et al. (2009). "piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells." Nature 458(7239): 766-770.
odWrenzycki, C., D. Herrmann, L. Keskintepe, et al. (2001). "Effects of culture system and protein
supplementation on mRNA expression in pre-implantation bovine embryos." Hum Repr 16(5): 893-901.
Xu, C., undifferentiated human embryonic stem cells." Nat BiotechnolM. S. Inokuma, J. Denham, et al. (2001). "Feeder-free growth of
19(10): 971-974.
Xu, M. timulation of mouse and human primitive hematopoiesis by murine embryonic aorta-gonad-mesonephros-derived stromal cell lines." BloodJ., K. Tsuji, T. Ueda, et al. (1998). "S
92(6): 2032-
Xu, R. H . Peck, D. S. Li, et al. (2005). "Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells." Nat Methods
2040.
., R. M 2(3): 185-190.
Xu, Y., g regulatory mechanism for pluripotent stem cell survival and self-renewal by small molecules." Proc Natl Acad Sci U S A
X. Zhu, H. S. Hahm, et al. (2010). "Revealing a core signalin
Yagi, M., K. A. Ritchie, E. Sitnicka, et al. (1999). "Sustained ex vivo expansion of hematopoietic stem
107(18): 8129-8134.
cells mediated by thrombopoietin." Proc Natl Acad Sci U S A 96(14): 8126-8131.
Yamaguchi, T. P., D. J. Dumont, R. A. Conlon, et al. (1993). "flk-1, an flt-related receptor tyrosine kinase is an early marker for endothelial cell precursors." Development 118(2): 489-498.
ita, J. K., M.Yamash Takano, M. Hiraoka-Kanie, et al. (2005). "Prospective identification of cardiac progenitors by a novel single cell-based cardiomyocyte induction." Faseb J 19(11): 1534-1536.
Yang, F ). "The effect of incorporating RGD adhesive peptide in polyethylene glycol diacrylate hydrogel on osteogenesis of bone marrow stromal cells." ., C. G. Williams, D. A. Wang, et al. (2005
Biomaterials 26(30): 5991-5998.
Yang, J. T., H. Rayburn and R. O. Hynes (1993). "Embryonic mesodermal defects in alpha 5 integrin-deficient mice." Development 119(4): 1093-1105.
Yang, S., H. Cai, H. Jin, et al. (2008). "Hematopoietic reconstitution of CD34+ cells grown in static and stirred culture systems in NOD/SCID mice." Biotechnol Lett 30(1): 61-65.
Yeo, C. and M. Whitman (2001). "Nodal signals to Smads through Cripto-dependent and Cripto-independent mechanisms." Mol Cell 7(5): 949-957.
Yin, A. H., S. Miraglia, E. D. Zanjani, et al. (1997). "AC133, a novel marker for human hematopoietic stem and progenitor cells." Blood 90(12): 5002-5012.
198
Yin, C. H., W. Chen, C. C. Hsiao, et al. (2007). "Production of mouse embryoid bodies with hepatic differentiation potential by stirred tank bioreactor." Biosci Biotechnol Biochem 71(3): 728-734.
Ying, Q. L., J. Nichols, I. Chambers, et al. (2003). "BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3." Cell 115(3): 281-292.
Ying, Q. L. and A. G. Smith (2003). "Defined conditions for neural commitment and differentiation." Methods Enzymol 365: 327-341.
Yoder, M. C., K. Hiatt, P. Dutt, et al. (1997). "Characterization of definitive lymphohematopoieticcells in the day 9 murine yolk sac."
stem Immunity 7(3): 335-344.
Yoshida, H., N. Takakura, M. Hirashima, et al. (1998). "Hematopoietic tissues, as a playground of receptor tyrosine kinases of the PDGF-receptor family." Dev Comp Immunol 22(3): 321-332.
Yoshimoto, M. and M. C. Yoder (2009). "Developmental biology: Birth of the blood cell." Nature
Young, . Bruno, K. M. Luens, et al. (1996). "Thrombopoietin stimulates megakaryocytopoiesis, myelopoiesis, and expansion of CD34+ progenitor cells from single CD34+Thy-1+Lin- primitive
457(7231): 801-803.
J. C., E
progenitor cells." Blood 88(5): 1619-1631.
Young, P. E., S. Baumhueter and L. A. Lasky (1995). "The sialomucin CD34 is expressed on hematopoietic cells and blood vessels during murine development." Blood 85(1): 96-105.
. A. Vodyanik, K. SmYu, J., M uga-Otto, et al. (2007). "Induced pluripotent stem cell lines derived from human somatic cells." Science 318(5858): 1917-1920.
Yu, X. a es to autografts for bridging peripheral nerve gaps." Tissue Engnd R. V. Bellamkonda (2003). "Tissue-engineered scaffolds are effective alternativ
9(3): 421-430.
Zachary actions of the vascular endothelial growth factor family." Cardiovasc Res, I. and G. Gliki (2001). "Signaling transduction mechanisms mediating biological
49(3): 568-581.
Zafontewithin a limited developmental window." Blood, B. T., S. Liu, M. Lynch-Kattman, et al. (2007). "Smad1 expands the hemangioblast population
109(2): 516-523.
Zandstr ived a, P. W., C. Bauwens, T. Yin, et al. (2003). "Scalable production of embryonic stem cell-dercardiomyocytes." Tissue Eng 9(4): 767-778.
i U S AZandstra, P. W., E. Conneally, A. L. Petzer, et al. (1997). "Cytokine manipulation of primitive human
hematopoietic cell self-renewal." Proc Natl Acad Sc 94(9): 4698-4703.
sm applicable to hematopoiesis." Blood
Zandstra, P. W., D. A. Lauffenburger and C. J. Eaves (2000). "A ligand-receptor signaling threshold model of stem cell differentiation control: a biologically conserved mechani
96(4): 1215-1222.
Zeigler, antois and chorion, when isolated before circulation or chorio-allantoic fusion, have hematopoietic potential." Development B. M., D. Sugiyama, M. Chen, et al. (2006). "The all
133(21): 4183-4192.
199
Zeigler, F. C., F. de Sauvage, H. R. Widmer, et al. (1994). "In vitro megakaryocytopoietic and thrombopoietic activity of c-mpl ligand (TPO) on purified murine hematopoietic stem cells." Blood 84(12): 4045-4052.
Zeng, Gg during blood vessel formation." Blood
., S. M. Taylor, J. R. McColm, et al. (2007). "Orientation of endothelial cell division is regulated by VEGF signalin 109(4): 1345-1352.
of Zhang, J., C. Niu, L. Ye, et al. (2003). "Identification of the haematopoietic stem cell niche and controlthe niche size." Nature 425(6960): 836-841.
Zhang, P., J. Li, Z. Tan, et al. (2008). "Short-term BMP-4 treatment initiates mesoderm induction in human embryonic stem cells." Blood 111(4): 1933-1941.
Zhu, X. H., Y. Tabata, C. H. Wang, et al. (2008). "Delivery of basic fibroblast growth factor from gmicrosphere scaffold for the growth of human umbilical vein endothelial cells."
elatin t Tissue Eng Par
A 14(12): 1939-1947.
Zimmer . Ketteler, et al. (2004). "Effects of telomerase modulation in human hematopoietic progenitor cells." Stem Cellsmann, S., S. Glaser, R
22(5): 741-749.
Zovein, A. C., J. J. Hofmann, M. Lynch, et al. (2008). "Fate tracing reveals the endothelial origin of hematopoietic stem cells." Cell Stem Cell 3(6): 625-636.
ighly chnol
zur Nieden, N. I., J. T. Cormier, D. E. Rancourt, et al. (2007). "Embryonic stem cells remain hpluripotent following long term expansion as aggregates in suspension bioreactors." J Biote 129(3): 421-432.
Zwaka, an embryonic stem cells occurs through symmetric cell division." Stem CellsT. P. and J. A. Thomson (2005). "Differentiation of hum
23(2): 146-149.
200
Purpur 8). Soluble Flt-1 regulates Flk-1 activation to control hematopoietic and endothelial development in an oxygen-
Purpura K.A., Morin J.G., Zandstra P.W. (2008). Analysis of the temporal and concentration-
mesode : 1186-9
Copyright Acknowledgements Chapter 2
a K.A., George S.H., Dang S.M., Choi K., Nagy A., Zandstra P.W. (200
responsive manner. Stem Cells. Nov; 26(11): 2832-42.
Chapter 3
dependent effects of BMP-4, VEGF and Tpo on the development of embryonic stem cell-derivedrm and blood progenitors in a defined, serum-free media. Exp Hematol. Sep; 36(9)8.
doi:10.1016/j.exphem.2008.04.003
