Running Title: Control of panicle traits by OsGRF4 1
2
3
OsGRF4 controls grain shape, panicle length and seed 4
shattering in rice 5
6
Pingyong Sun1, 2, 3†, Wuhan Zhang2, 3†, Yihua Wang4, Qiang He2, 3, Fu Shu2, 3, Hai Liu2, Jie Wang2, 7
Jianmin Wang2, Longping Yuan2, 3, Huafeng Deng2, 3* 8
1 College of Agronomy, Hunan Agricultural University, Changsha 410128, China, 2 State Key 9
Laboratory of Hybrid Rice, Hunan Hybrid Rice Research Center, Hunan Academy of Agricultural 10
Sciences, Changsha 410125, China, 3 Collaborative Innovation Center of Grain and Oil Crops in 11
South China, Changsha 410128, China, 4 State Key Laboratory for Crop Genetics and Germplasm 12
Enhancement, Nanjing Agricultural University, Nanjing 210095, China. † These authors 13
contributed equally to this work. 14
* Correspondence: [email protected]. 15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
Abstract Traits such as grain shape, panicle length and seed shattering, play 36
important roles in grain yield and harvest. In this study, the cloning and functional 37
analysis of PANICLE TRAITS 2 (PT2), a novel gene from the Indica rice Chuandali 38
(CDL), is reported. PT2 is synonymous with Growth-Regulating Factor 4 (OsGRF4), 39
which encodes a growth-regulating factor that positively regulates grain shape and 40
panicle length and negatively regulates seed shattering. Higher expression of OsGRF4 41
is correlated with larger grain, longer panicle and lower seed shattering. A unique 42
OsGRF4 mutation, which occurs at the OsmiRNA396 target site of OsGRF4, seems to 43
be associated with high levels of OsGRF4 expression, and results in phenotypic 44
difference. Further research showed that OsGRF4 regulated two cytokinin 45
dehydrogenase precursor genes (CKX5 and CKX1) resulting in increased cytokinin 46
levels, which might affect the panicle traits. High storage capacity and moderate seed 47
shattering of OsGRF4 may be useful in high-yield breeding and mechanized 48
harvesting of rice. Our findings provide additional insight into the molecular basis of 49
panicle growth. 50
51
Keywords: High-yield breeding; mechanized harvesting; OsmiRNA396; panicle traits; 52
plant growth regulator 53
54
55
56
57
58
59
60
61
62
63
64
INTRODUCTION 65
Grain shape, panicle length and seed shattering, play important roles in grain yield, 66
grain quality and harvesting. A few genes controlling grain size have been cloned over 67
the past decades. For example, Grain Length 7 (GL7) encodes a 68
TONNEAU1-recruiting motif protein. Up-regulation of GL7 expression results in 69
longer grain length and narrower width (Wang et al. 2015a). Grain Weight 8 (GW8) 70
encodes a protein that is a positive regulator of cell proliferation, and enhances grain 71
width and yield in rice (Wang et al. 2012). GW8 binds directly to the Grain Width 7 72
(GW7) promoter and represses its expression (Wang et al. 2015b). Grain Weight 2 73
(GW2) encodes a previously unknown RING-type protein with E3 ubiquitin ligase 74
activity. The loss of GW2 function enhances grain width, weight and yield (Song et al. 75
2007). 76
Genes controlling the number of spikelets in the panicle were isolated. Grain 77
Number 1a (GN1a) encodes cytokinin oxidase/dehydrogenase 2 (OsCKX2) that 78
degrades the phytohormone cytokinin. Reducing the expression of OsCKX2 causes 79
cytokinin accumulation in inflorescence meristems and increases the number of 80
spikelets per panicle (Ashikari et al. 2005). ERECT PANICLE 3/LARGER 81
PANICLE (EP3/LP) encodes a Kelch repeat-containing F-box protein, which 82
modulates cytokinin levels in plant tissues, regulates the inflorescence branches and 83
the number of spikelets per panicle (Li et al. 2011b). The QTL for erect panicle on 84
chromosome 9/DENSE AND ERECT PANICLE 1/DENSE PANICLE 1 85
(qPE9-1/DEP1/DN1) encodes a protein homologous to the keratin-associated protein 86
5-4 family, which regulates panicle, grain length and grain weight. The 87
loss-of-function mutation of qPE9-1 leads to more erect panicles (Huang et al. 2009; 88
Zhou et al. 2009; Taguchi-Shiobara et al. 2011). In fact, many panicle trait genes are 89
pleiotropic. For example, Ghd7.1 (Yan et al. 2013) and Ghd8 (Yan et al. 2011) control 90
the number of spikelets, affecting the plant height and heading date. 91
Several genes determining seed shattering were characterized. 92
Shattering1/Shattering4 (SHA1/SH4) encodes a member of the trihelix family of 93
plant-specific transcription factors. Wild rice disperses seeds freely at maturity, unlike 94
the domesticated rice cultivars that have lost the ability to shed their seeds at maturity 95
because of a single amino acid substitution (Lin et al. 2007). The qSH1 (QTL of seed 96
shattering in chromosome 1) encodes a BEL1-type homeobox gene. It represents a 97
single-nucleotide polymorphism (SNP) causing loss of seed shattering owing to the 98
absence of abscission layer formation (Konishi et al. 2006; Zhang et al. 2009). 99
SHATTERING ABORTION1 (SHAT1) encodes an APETALA2 transcription factor, 100
which is required for seed shattering via abscission zone (AZ) development in rice, 101
positively regulated by the trihelix transcription factor SH4. The qSH1 acts 102
downstream of SHAT1 and SH4 (Zhou et al. 2012). Shattering5 (SH5) is highly 103
homologous to qSH1, which induces the expression of SHAT1 and Sh4 (Yoon et al. 104
2014). During mechanical harvest, high seed shattering leads to increased loss of 105
production. 106
Although the genes affecting panicle traits were cloned, the molecular basis of 107
panicle growth is still unclear. In this study, we cloned and functionally analyzed 108
OsGRF4, an allele that shows extraordinary effect on rice panicle traits. Evidence 109
suggests that OsGRF4 is down-regulated by miR396 during grain development. 110
OsGRF4 from CDL carries a mutation in the coding sequence targeted by 111
OsmiRNA396, which enhances the expression levels of OsGRF4, and results in 112
increased grain length, grain width, grain weight, panicle length and reduced seed 113
shattering. Based on our findings, OsGRF4 can be used in breeding new varieties to 114
improve rice grain yield and the seed shattering. 115
116
RESULTS 117
Map-based cloning of PT2 118
We constructed a recombinant inbred line (RIL) and a nearly isogenic line (NIL) 119
population from a cross between cultivar R1126 (medium-grain) and CDL (big-grain). 120
High-resolution mapping with homozygous recombinant plants was carried out. The 121
PT2-containing region was delimited to ~33.2 kb between the markers GL2-35-1 and 122
GL2-12 in the long arm of rice chromosome 2 (Zhang et al. 2013). In this candidate 123
genomic region, there were three predicted gene loci (LOC_Os02g47280, 124
LOC_Os02g47290 and LOC_Os02g47300) according to the Rice Annotation Project 125
(Kawahara et al. 2013). LOC_Os02g 47280 encodes a putative growth-regulating 126
factor OsGRF4, which belongs to the GRF protein family. The GRF protein family 127
contains two conservative domains: WRC (Trp, Arg, Cys) and QLQ (Gln, Leu, Gln), 128
which mediate DNA binding and protein interaction, respectively (Kim et al. 2003). 129
Previous studies have shown that the members of this family regulate rice growth, 130
heading stage, seed development and resistance (Esther et al. 2000; Ye et al. 2004; 131
Luo et al. 2005; Gao et al. 2010), as well as growth of cotyledons, leaves and pistil in 132
Arabidopsis (Kim et al. 2003). LOC_Os02g47290 and LOC_Os02g47300 encode a 133
putative uncharacterized protein, without any gene ontology. Therefore, OsGRF4 is 134
the most probable candidate gene to PT2. 135
136
Confirmation of OsGRF4 as PT2 137
To determine whether OsGRF4 represented the PT2, we generated transgenic plants 138
expressing OsGRF4 (CDL) in the NIL-pt2. We introduced the plasmid carrying 139
OsGRF4 (CDL) (designated gPT2), which contained a 4.07-kb genomic DNA 140
fragment into NIL-pt2, driven by the ubiquitin promoter. A total of 28 putative 141
transgenic plants (T0) were generated, and their genotypes were determined by 142
polymerase chain reaction (PCR) amplification of the hygromycin phosphotransferase 143
gene, of which 18 were positive transgenic lines, whereas the other 10 were negative. 144
We observed an increase in grain size, 1000-grain weight, panicle length and changes 145
in seed shattering of the positive-transgenic plants (T1), compared with the negative 146
plants, without affecting the plant morphology. In contrast, the OsGRF4 RNA 147
interference (RNAi) transgenic plants in the NIL-PT2 background generated medium 148
grains with easy seed shattering (Figures 1, 2). A comparison of relative expression of 149
the OsGRF4 gene overexpression and RNAi transgenic plants (T1) showed that plants 150
with higher OsGRF4 expression levels produced bigger and heavier grains (Figure 2). 151
Therefore, OsGRF4 represents the gene PT2. 152
153
Sequence differences in OsGRF4 154
The full-length complementary DNA (cDNA) of OsGRF4 was isolated by reverse 155
transcription-PCR (RT-PCR) from R1126 and CDL. Alignment of the cDNA 156
sequence with the genomic sequence of Nipponbare indicated that OsGRF4 consists 157
of six exons in R1126 and five exons in CDL (Figure 3). We compared the genomic 158
sequences corresponding to the open reading frame (ORF) and the promoter regions 159
of OsGRF4 between R1126 and CDL, and found that the coding sequence of CDL 160
was 1,185 bp in length, encoding a predicted polypeptide of 394 amino acids, whereas 161
the coding sequence of R1126 was 1,140 bp, encoding a polypeptide of 379 amino 162
acids (Figure S1). There were 6 nucleotide differences in the coding sequences 163
between R1126 and CDL, resulting in the substitution of 3 amino acids (Figure 3). 164
The OsGRF4 gene contains a MicroRNA396 target sequence in the coding region, 165
with two variable bases (AA - TC) between the target sequence of R1126 and CDL. 166
The GRF4 gene is repressed by elevated levels of MicroRNA396 (Jones-Rhoades and 167
Bartel 2004). A comparison of the promoter sequences revealed 20 polymorphisms in 168
the 2-kb region upstream of the translation starting site, including substitutions, 169
deletions and insertions (Figures 3, S2). 170
171
Expression of OsGRF4 in NILs 172
We compared the expression profiles of OsGRF4 in various organs of NILs by 173
quantitative RT-PCR analysis with total RNA. The OsGRF4 transcript levels varied 174
drastically among the tissues. OsGRF4 was preferentially expressed in developing 175
panicles, and the highest levels of expression were found in panicles of 7 cm in length. 176
On the other hand, there was less transcript accumulation in the rice hull, root, stem 177
and leaf sheath. In particular, the transcript was much more abundant in NIL-OsGRF4 178
than in NIL-Osgrf4 in the young panicles measuring 1 cm, 4 cm, 7 cm, 11 cm and 15 179
cm in length (Figure 4A). The differences corresponded with the critical stages of 180
panicle traits. The OsGRF4 effect on panicle traits might be attributed to differences 181
in expression levels. 182
183
Sequence polymorphisms of OsGRF4 in rice germplasm 184
Twenty-five rice germplasms with abundant diversity in grain shape were selected for 185
sequencing promoter regions and coding sequences that cover the four mutation sites 186
in the exon of OsGRF4, and measured the grain length in a total of 25 rice accessions 187
(Tables 1, S1). The coding sequence of the cultivated varieties was divided into two 188
basic haplotypes: Indica-type and Japonica-type. The OsGRF4 of most Indica 189
varieties belongs to Indica-type and the OsGRF4 of most Japonica varieties represents 190
the Japonica-type. Some varieties, such as R1126 and R299, are Indica varieties but 191
their OsGRF4 belongs to Japonica-type. These varieties are usually produced from 192
interspecies crosses between Indica and Japonica. The OsGRF4 of CDL belongs to 193
Indica-type, but an unusual mutation (AA - TC) occurred between the CDL and 194
Indica-type. Similar types as OsGRF4 were not found within the 25 rice accessions 195
and the database (http://ricevarmap.ncpgr.cn/) involved over thousand varieties. 196
Therefore, the OsGRF4 of CDL was unique. The distinct mutation at the 197
OsmiRNA396 target site of OsGRF4 may enhance the expression of OsGRF4, and 198
result in improved grain shape, panicle length and seed shattering. 199
The promoter sequence of the cultivated varieties represents a wide diversity, and 200
comprises six haplotypes: CDL, Gang 46B, R700, Fengyuan B, R1126 and R299 201
types. Six varieties (Yuzhenxiang, Yuzhuxiang, Nongxiang 18, Xiangwanxian17, 202
Nongxiang 21 and Nongxiang 29) of CDL type represent good quality rice with long 203
and narrow grain. OsGRF4 may not be an important gene contributing to the long 204
grain of the six varieties. 205
To determine the specific mutation or promoter regions of OsGRF4 responsible 206
for the phenotypic variation, we expressed the cDNA of OsGRF4 from Nongxiang 18 207
(Indica-type) and R1126 (Japonica-type) respectively, driven by the promoter of CDL. 208
A total of 39 transgenic plants were obtained from pOsGRF4CDL::OsGRF4IcDNA, of 209
which 22 were transgene positive, whereas the other 17 were negative. Forty-one 210
transgenic plants were obtained from pOsGRF4CDL::OsGRF4JcDNA, of which 36 were 211
transgene positive, whereas the other 5 were negative. We observed no increase in 212
grain length in the transgene-positive plants, compared with the NIL-Osgrf4 (Table 213
S2). This result showed that the polymorphisms in the OsGRF4 promoter region may 214
not be responsible for the phenotypic variation. Collectively, the results from the 215
sequencing, expression pattern and transformation studies suggest that the specific 216
mutations in the OsGRF4 coding sequence may determine the grain shape, panicle 217
length and seed shattering. 218
219
Biological roles and characterization of OsGRF4 220
We also examined the inner and outer surfaces of glumes between NILs using a 221
scanning electron microscope (Figure 4B–E). The cell length of glume inner surface 222
in NIL-OsGRF4 was much longer than in NIL-Osgrf4 (Figure 4F). In addition, the 223
cell number of glume inner surface in NIL-OsGRF4 was also higher than in 224
NIL-Osgrf4, although differences were not significant (Figure 4G). Therefore, it is 225
very likely that OsGRF4 positively regulated grain size mainly by increasing cell 226
length partially and cell number, leading to enhanced longitudinal growth in the grain. 227
The anatomical structure of the abscission zone in rice pedicels was investigated 228
by optical microscopy (Figure S3). NIL-OsGRF4 had a partially developed abscission 229
zone, but NIL-Osgrf4 showed a well-developed abscission zone, indicating that 230
OsGRF4 gene improved seed shattering via differential abscission zone formation. 231
Large spikelet hulls are associated with incomplete grain filling (Song et al. 232
2007). Therefore, the NILs for grain filling rate were compared by measuring the 233
fresh and dry weight of the grains during grain filling (Figure S4). Both fresh and dry 234
weights of NIL-OsGRF4 were significantly higher (P < 0.01) than those of 235
NIL-Osgrf4 at day 1 after fertilization, and the differences peaked at ~10 d after 236
fertilization, when dry weights of the grains of NIL-OsGRF4 were 59.69% higher 237
than that of NIL-Osgrf4. Thus, the increase in grain weight and yield per plant 238
resulted from increase in both grain shape and grain filling rate. 239
To determine the sub-cellular localization of OsGRF4, the coding sequence of 240
OsGRF4 was fused with yellow fluorescent protein (YFP). In contrast, Ghd7, which is 241
a nuclear protein, was fused with cyan fluorescent protein (CFP). Both fluorescent 242
proteins were individually driven by the constitutive 35S cauliflower mosaic virus 243
promoter. The constructs were co-transfected into rice protoplasts of etiolated 244
seedlings by polyethylene glycol. The result showed that OsGRF4 co-localized to the 245
nucleus with Ghd7 (Figure 5). 246
247
OsGRF4 genetically regulates cytokinins, cell cycle and panicle traits 248
We analyzed the expression of 25 genes involved in cell cycle (14 putatively involved 249
in the G1/S and 11 in the G2/M phase), 13 panicle trait-related genes and 3 genes in 250
the cytokinin biosynthesis. The transcription levels of 6 cell cycle genes (MAD2, 251
MCM4, CYCB2.1, CYCIaZm, CDKB, and KN) and 2 panicle trait genes, Grain Size 5 252
(GS5) and Gn1a, were greatly elevated in NIL-OsGRF4 when compared with 253
NIL-Osgrf4 plants (Figure 6A–C). In contrast, the expression of 2 cell cycle genes 254
(CAK1 and CYCT1) and 2 cytokinin-related genes (CKX5 and CKX1) was 255
significantly reduced in the NIL-OsGRF4 plants, relative to NIL-Osgrf4 plants 256
(Figure 6A, D). 257
Hormones play important roles in the formation of panicle architecture, especially 258
cytokinin. Cytokinin regulates cell growth and development. The cytokinin content 259
regulates rice grain production (Ashikari et al. 2005). The possible contribution of 260
cytokinins to the bigger grains in NIL-OsGRF4 was determined by monitoring their 261
levels using 7 cm young panicles of NILs. We found that the 4 kinds of cytokinins 262
(isopentenyladenine riboside, trans-zeatin-riboside, cis-zeatin and cis-zeatin-riboside) 263
showed significant differences between the two OsGRF4 alleles (Table 2). The high 264
levels of cytokinin regulated by cytokinin-related genes might result in larger grain, 265
longer panicle and lower seed shattering. 266
267
OsGRF4 enhances rice storage capacity and improves seed shattering 268
To test whether OsGRF4 affects grain yield, we investigated the effects of OsGRF4 269
on grain shape, 1000-grain weight, panicle length and seed shattering. Compared with 270
NIL-Osgrf4, the grains of NIL-OsGRF4 were 12.23% wider and 34.32% heavier 271
leading to a 30.37% increase in storage capacity per plant. It was also discovered that 272
the panicle length, primary branch number and seed setting percentage showed 273
significant differences between NILs. No significant differences were detected in 274
other agronomic traits (Table 3), and the plant type of NIL-Osgrf4 was similar to 275
NIL-OsGRF4 (Figure 7A-C). Interestingly, seeds of NIL-Osgrf4 were easier to thresh 276
than those of NIL-OsGRF4. To test the shattering degree of NIL seeds, we measured 277
the breaking tensile strength (BTS), which was inversely proportional to shattering 278
degree. The Student’s T-test showed significant differences (P < 0.05) in the pulling 279
strength between NILs in three different periods (Figure 7D-F). These results showed 280
that the shattering degree in NIL-OsGRF4 was significantly harder than in 281
NIL-Osgrf4. Since the storage capacity was the basis of yield, and medium seed 282
shattering reduced the loss during mechanized harvesting, the OsGRF4 was very 283
useful in breeding high-yield rice and mechanized harvesting. 284
285
DISCUSSION 286
Panicle traits controlled by quantitative trait loci (QTLs) are complex yield 287
determinants in rice. The molecular mechanisms underlying panicle traits are still 288
unclear. Therefore, identification of QTLs that regulate panicle traits and 289
characterization of the underlying genes enhance our understanding of rice panicle 290
development. In this study, we reported OsGRF4 as a novel gene controlling grain 291
shape, panicle length and rice seed shattering. The functional characterization of 292
OsGRF4 provides a novel insight into the mechanisms controlling panicle traits. We 293
identified the sequence differences in both the promoter region and coding sequence 294
between R1126 and CDL. Expression of OsGRF4IcDNA or OsGRF4JcDNA driven by the 295
CDL promoter revealed no changes in grain length, which indicates that the coding 296
sequence targeted by OsmiRNA396 in CDL may be responsible for phenotypic 297
variation. It was shown that OsGRF4 is down-regulated by miR396 during grain 298
development in rice (Lan et al. 2012). Specific OsGRF4 mutations may resist the 299
regulation by OsmiRNA396, leading to enhanced OsGRF4 expression levels, and 300
resulting in increased grain shape, panicle length and reduced seed shattering. It was 301
reported that OsGRF4 control grain size by activating brassinosteroid responses (Che 302
et al. 2015), and a rare mutation in OsGRF4 affecting the binding site of OsmiR396 303
results in large grains (Duan et al. 2015; Hu et al. 2015). A point mutation in 304
OsSPL14 disrupts OsmiR156-directed regulation of SQUAMOSA PROMOTER 305
BINDING PROTEIN-LIKE 14 (OsSPL14), and higher expression of OsSPL14 in the 306
reproductive stage promotes panicle branching and higher grain yield in rice (Jiao et 307
al. 2010; Miura et al. 2010). The regulation of OsGRF4 by microRNA may be similar 308
to OsSPL14, which requires further investigation. 309
There are three types of molecular mechanisms affecting phenotypic variation in 310
the cloned genes that control grain size. The first mechanism is negative regulation of 311
grain size. An early stop codon from a substitution in the exon of Grain Size 3 (GS3) 312
results in large grains. GS3 acts as a negative regulator of grain size (Fan et al. 2006). 313
Deletion of 1-bp in THOUSAND-GRAIN WEIGHT 6 (TGW6) exon results in a 314
premature stop codon, and the functional loss of TGW6 increases grain weight and 315
yield (Ishimaru et al. 2013) as well as grain enlargement, which is true for GW2, QTL 316
for seed width on chromosome 5/Grain Weight 5 (qSW5/GW5) and QTL for Grain 317
Length 3/Grain Length 3.1 (qGL3/GL3.1) (Song et al. 2007; Shomura et al. 2008; 318
Weng et al. 2008; Zhang et al. 2012). Promoter region variation is another kind 319
of natural mutation. It is reported that GS5 regulates the grain size via polymorphisms 320
in the promoter region, and higher expression of GS5 results in larger grains, 321
suggesting that GS5 positively regulates grain shape (Li et al. 2011a). Similarly, GW8 322
affects grain size due to a critical polymorphism in the promoter region (Wang et al. 323
2012). As a positive regulator of the traits, increased Grain Weight 6a (GW6a) 324
expression enhances grain weight and yield (Song et al. 2015). Copy number variants 325
(CNVs) contribute to phenotypic variation of various traits. A CNV on Grain Length 326
on Chromosome 7 (GL7) locus contributes to diversity in grain size in rice (Wang et al. 327
2015). Our findings provide a new molecular mechanism controlling grain shape, 328
panicle length and seed shattering. We also found that GS5 and Gn1a were greatly 329
elevated in NIL-OsGRF4 plants when compared with NIL-Osgrf4. Studies 330
investigating OsGRF4 regulation of the specific genes will facilitate our 331
understanding of the regulatory network of genes encoding panicle traits. 332
The unusual mutation of OsGRF4 in CDL was not found in more than 20 rice 333
cultivars sequenced in this study and over 1,000 varieties in the database, which 334
indicates that the allele has not been used in rice breeding. OsGRF4 in CDL is a new 335
untapped genetic resource. As a pleiotropic gene, it not only significantly increases 336
rice storage capacity, but also decreases seed shattering. Such agronomic traits are 337
strongly desirable in rice breeding. However, the substantial increase in grain width 338
leads to deterioration in the quality of rice morphologically, while increasing grain 339
length reduces head rice rate. Therefore, we propose three ways to utilize OsGRF4 340
gene: breeding specific high-yielding rice cultivars to produce rice flour, beer and so 341
on; gene polymerization to reduce grain width and cultivate high-yield and 342
high-quality rice with extra-long grain; polymerizing small grains, narrow grains or 343
special genes to breed sterile lines with small grains, and crossbreeding the sterile 344
lines with long and thin grain restorer lines containing large grain gene OsGRF4 to 345
obtain high yield and good quality rice with thousand-grain weight in 30-35 g. 346
Mechanization of rice hybrid seed production based on grain length differences 347
between sterile lines and restorer lines can also be accomplished concurrently. 348
349
MATERIALS AND METHODS 350
Field planting and grain shape measurement 351
Harvested rice grains were air-dried and stored at room temperature for at least 3 352
months before testing. Fully-filled grains were used for measuring grain width, length 353
and weight. Ten randomly chosen grains from each plant were assembled along a 354
vernier caliper to measure grain width and length. Grain weight was calculated based 355
on 200 grains and converted to 1,000-grain weight. 356
357
Characterization of shattering degree phenotype 358
In order to evaluate the shattering degree of NIL-OsGRF4 and NIL-Osgrf4 359
phenotypes, three panicles from the main stem of each plant were harvested at 20, 30 360
and 40 days after full heading, respectively. The breaking tensile strength (BTS) upon 361
detachment of grain from the pedicels by hand pulling was measured using a digital 362
force gauge (Qin et al. 2010). In an individual plant, 20 grains on the uppermost part 363
of each panicle were measured. 364
365
Vector construction and transformation 366
The full-length genomic DNA of OsGRF4 was isolated by PCR with primer 367
1390DL-1 from CDL, and then subcloned into the pCUbi1390 binary vector. The 368
gene fragment was driven by ubiquitin promoter and the resultant plasmid was 369
introduced into NIL-pt2 by means of Agrobacterium tumefaciens-mediated 370
transformation (Hiei et al. 1994). The genotype of transgenic plants was determined 371
by PCR amplification of the hygromycin phosphotransferase gene (hpt) and the 372
analysis of hygromycin resistance. 373
For OsGRF4-RNAi constructs, a 290 bp fragment was isolated by PCR from 374
vector pNW55 with the following primers: I miR-s 375
(agtaaaacgttgacatctcccttcaggagattcagtttga), II miR-a 376
(tgaagggagatgtcaacgttttactgctgctgctacagcc), III miR*s 377
(ctaagggtgatctcaacgttttattcctgctgctaggctg) and IV miR*a 378
(aataaaacgttgagatcacccttagagaggcaaaagtgaa). This fragment was cloned into the plant 379
RNAi vector pCUbi1390. The resultant plasmid was introduced into NIL-PT2. 380
The chimeric construct (pOsGRF4CDL::OsGRF4IcDNA and 381
pOsGRF4CDL::OsGRF4JcDNA ) was prepared in which the 2-kb promoter fragment of 382
OsGRF4 from CDL was fused with the cDNA from Nongxiang 18, containing a 383
coding sequence belonging to the Indica-type (IcDNA), and R1126 whose coding 384
sequence belonged to the Japonica-type (JcDNA), respectively. The promoter 385
fragment was ligated with the cDNA from Nongxiang 18 and R1126, respectively, 386
and then inserted into the pCUbi1390 binary vector. The constructs were transferred 387
into NIL-Osgrf4 by Agrobacterium tumefaciens-mediated transformation (Hiei et al. 388
1994). 389
390
Expression analysis 391
Total RNA was extracted from various rice tissues using TRIzol reagent (Invitrogen) 392
and was reverse transcribed using the TransScript All-in-One First-Strand cDNA 393
Synthesis SuperMix for quantitative PCR (qPCR) kit (TransGen Biotech), following 394
the manufacturer’s instructions. RT-PCR was performed according to Jiang et al. 395
(2007). All assays were repeated at least three times, and Ubiquitin 5 (UBQ5) was 396
used as a reference. The relative expression was analyzed according to Schmittgen et 397
al. (2008). Relevant PCR primers sequences are listed in Tables S3, S4. The qPCR 398
primers involved in cell cycle were selected from the previously reported work (Li et 399
al. 2011a). 400
401
Histological observation 402
Observation of the rice glume traits: The spikelets of NIL-OsGRF4 and NIL-Osgrf4 at 403
mature stage were collected and treated with 2.5% (vol/vol) glutaraldehyde solution, 404
vacuumed three times, and fixed for 24 h as described by Ray (1988) _ENREF_21. The 405
inner and outer surfaces of glumes of the spikelets were observed with a scanning 406
electron microscope S-3000N at an accelerating voltage of 7 kV. Observation of the 407
rice abscission zone: Panicles were harvested about 30 to 40 days after heading. The 408
abscission zone of the pedicel was investigated as described by Ji et al. (2006) using 409
an optical microscope after staining with Fast Green FCF and Safranine. 410
411
Sub-cellular localization of OsGRF4 412
The coding sequence of OsGRF4 (CDL) was fused with PM999–YFP. The fusion 413
protein with the insertion in the right direction was co-transfected into rice protoplasts 414
with Ghd7:CFP as described by Zhou et al. (2009) with minor modifications. The 415
fluorescent image was obtained using a confocal microscope (Leica, Germany) after 416
incubating the transformed cells in the dark at 28°C for 20 h. 417
418
ACKNOWLEDGMENTS 419
We thank Professor Yingguo Zhu (Wuhan University) and Doctor Changchun Yu for 420
helping with vector construction. We are grateful to Professor Yongzhong Xing 421
(Huazhong Agricultural University) for providing the Ghd7-CFP vector. This work 422
was supported by National Natural Science Foundation of China (31571259), 423
National High Technology Research and Development Program of China 424
(2011AA10A101). 425
426
AUTHOR CONTRIBUTIONS 427
H. D. and L. Y. designed the study. P. S., W. Z., Y. W., Q. H., F. S., H. L., J. W. and J. 428
W. performed the experiments. P. S. and W. Z. analyzed the data and wrote the 429
manuscript. 430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
REFERENCES 458
Ashikari M, Sakakibara H, Lin SY, Yamamoto T, Takashi T, Nishimura A, Angeles ER, 459
Qian Q, Kitano H, Matsuoka M (2005) Cytokinin oxidase regulates rice grain 460
production. Science 309: 741–745 461
Che RH, Tong HN, Shi BH, Liu YQ, Fang SR, Liu DP, Xiao YH, Hu B, Liu LC, 462
Wang HR, Zhao MF, Chu CC (2015) Control of grain size and rice yield by 463
GL2-mediated brassinosteroid responses. Nat plants Doi: 464
10.1038/NPLANTS.2015.195 465
Duan PG, Ni S, Wang JM, Zhang BL, Xu R, Wang YX, Chen HQ, Zhu XD, Li YH 466
(2015) Regulation of OsGRF4 by OsmiR396 controls grain size and yield in rice. 467
Nat plants Doi: 10.1038/NPLANTS.2015.203 468
Esther VDK, Jeong HK, Hans K (2000) A novel gibberellin-induced gene from rice 469
and its potential regulatory role in stem growth. Plant physiol 122: 695–704 470
Fan CC, Xing YZ, Mao HL, Lu TT, Han B, Xu C, Li XH, Zhang QF (2006) GS3, a 471
major QTL for grain length and weight and minor QTL for grain width and 472
thickness in rice, encodes a putative transmembrane protein. Theor Appl Gene 473
112: 1164–1171 474
Gao P, Bai X, Yang L, Dekang Lv, Yong L, Hua C, Wei J, Guo DJ, Zhu YM (2010) 475
Over-expression of osa-MIR396c decreases salt and alkali stress tolerance. 476
Planta 231:991–1001 477
Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice 478
(Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the 479
boundaries of the T-DNA. Plant J 6: 271–282 480
Hu J, Wang YX, Fang YX, Zeng LJ, Xu J, Yu HP, Shi ZY, Pan JJ, Zhang D, Kang SJ, 481
Zhu L, Dong GJ, Guo LB, Zeng DL, Zhang GH, Xie LH, Xiong GS, Li JY, 482
Qian Q (2015) A rare allele of GS2 enhances grain size and grain yield in rice. 483
Mol Plant 8: 1455–1465 484
Huang XZ, Qian Q, Liu ZB, Sun HY, He SY, Luo D, Xia GM, Chu CC, Li JY, Fu XD 485
(2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat 486
Genet 41: 494–497 487
Ishimaru K, Hirotsu N, Madoka Y, Murakami N, Hara N, Onodera H, Kashiwagi T, 488
Ujiie K, Shimizu B, Onishi A, Miyagawa H, Katoh E (2013) Loss of function of 489
the IAA-glucose hydrolase gene TGW6 enhances rice grain weight and 490
increases yield. Nat Genet 45:707–711 491
Ji HS, Chu SH, Jiang WZ, Cho YI, Hahn JH, Eun MY, McCouch SR, Koh HJ (2006) 492
Characterization and mapping of a shattering mutant in rice that corresponds to a 493
block of domestication genes. Genetics 173: 995−1005 494
Jiang CF, Gao XH, Liao LL, Harberd NP, Fu XD (2007) Phosphate starvation root 495
architecture and anthocyanin accumulation responses are modulated by the 496
gibberellin-DELLA signaling pathway in Arabidopsis. Plant Physiol 145: 497
1460–1470 498
Jiao YQ, Wang YH, Xue DW, Wang J, Yan MX, Liu GF, Dong GJ, Zeng DL, Lu ZF, 499
Zhu XD, Qian Q, Li JY (2010) Regulation of OsSPL14 by OsmiR156 defines 500
ideal plant architecture in rice. Nat Genet 42:541–544 501
Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant 502
microRNAs and their targets, including a stress-induced miRNA. Mol Cell 14: 503
787–799 504
Kawahara O, Bastide M, Hamilton JP, Kanamori H, McCombie WR, Ouyang S, 505
Schwartz DC, Tanaka T, Wu JZ, Zhou SG, Childs KL, Davidson RM, Lin HN, 506
Quesada-Ocampo L, Vaillancourt B, Sakai H, Lee SS, Kim J, Numa H, Itoh T, 507
Buell CR, Matsumoto V (2013) Improvement of the Oryza sativa Nipponbare 508
reference genome using next generation sequence and optical map data. Rice (N 509
Y) 6: 4 510
Kim JH, Choi D, Kende H (2003) The AtGRF family of putative transcription factors 511
is involved in leaf and cotyledon growth in Arabidopsis. Plant J 36: 94–104 512
Konishi S, Izawa T, Lin SY, Ebana K, Fukuta Y, Sasaki T, Yano M (2006) An SNP 513
caused loss of seed shattering during rice domestication. Science 312: 1392–1396 514
Lan Y, Su N, Shen Y, Zhang RZ, Wu FQ, Cheng ZJ, Wang JL, Zhang X, Guo XP, 515
Lei CL, Wang J, Jiang L, Mao L, Wan JM (2012) Identification of novel 516
MiRNAs and MiRNA expression profiling during grain development in indica 517
rice. BMC Genomics 13: 264 518
Li M, Tang D, Wang KJ, Wu XR, Lu LL, Yu HX, Gu MH, Yan CJ, Cheng ZK (2011b) 519
Mutations in the F-box gene LARGER PANICLE improve the panicle 520
architecture and enhance the grain yield in rice. Plant Biotechnology J 521
9:1002–1013 522
Li YB, Fan CC, Xing YZ, Jiang YH, Luo LJ, Sun L, Shao D, Xu CJ, Li XH, 523
Xiao JH, He YQ, Zhang QF (2011a) Natural variation in GS5 plays an important 524
role in regulating grain size and yield in rice. Nat Genet 43: 1266–1269 525
Lin ZW, Griffith ME, Li XR, Zhu ZF, Tan LB, Fu YC, Zhang WX, Wang XK, Xie DX, 526
Sun CQ (2007) Origin of seed shattering in rice (Oryza sativa L.). Planta 226: 527
11–20 528
Luo AD, Liu L, Tang ZS, Bai XQ, Cao SY, Chu CC (2005) Down-regulation of 529
OsGRF1 gene in rice rhd1 mutant results in reduced heading date. J Integr 530
Plant Biol 47: 745–752 531
Miura K, Ikeda M, Matsubara A, Song XJ, Ito M, Asano K, Matsuoka M, Kitano 532
H, Ashikari M (2010) OsSPL14 promotes panicle branching and higher grain 533
productivity in rice. Nat Genet 42: 545–549 534
Qin Y, Kim SM, Zhao XH, Jia BY, Lee HS, Kim KM, Eun MY, Jin ID, Sohn JK 535
(2010) Identification for quantitative trait loci controlling grain shattering in rice. 536
Genes Genom 32:173–180 537
Ray TL, Payne CD (1988) Scanning electron microscopy of epidermal adherence and 538
cavitation in murine candidiasis: A role for Candida acid proteinase. Infect 539
Immun 56:1942–1949 540
Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative 541
CT method. Nat Protoc 3: 1101–1108 542
Shomura A, Izawa T, Ebana K, Ebitani T, Kanegae H, Konishi S, Yano M (2008) 543
Deletion in a gene associated with grain size increased yields during rice 544
domestication. Nat Genet 40: 1023–1028 545
Song XJ, Huang W, Shi M, Zhu MZ, Lin HX (2007) A QTL for rice grain width and 546
weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat 547
Genet 39: 623–630 548
Song XJ, Kuroha T, Ayano M, Furuta T, Nagai K, Komeda N, Segami S, Miura K, 549
Ogawa D, Kamura T, Suzuki T, Higashiyama T, Yamasaki M, Mori H, Inukai Y, 550
Wu JZ, Kitano H, Sakakibara H, Jacobsen SE, Ashikari M (2015) Rare allele of a 551
previously unidentified histone H4 acetyltransferase enhances grain weight, yield, 552
and plant biomass in rice. Proc Natl Acad Sci USA 112: 76–81 553
Taguchi-Shiobara F, Kawagoe Y, Kato H, Onodera H, Tagiri A, Hara N, Miyao A, 554
Hirochika H, Kitano H, Yano M, Toki S (2011) A loss-of-function mutation of 555
rice DENSE PANICLE 1 causes semi-dwarfness and slightly increased number 556
of spikelets. Breeding Science 61: 17–25 557
Wang S, Li S, Liu Q, Wu K, Zhang JQ, Wang SS, Wang Y, Chen XB, Zhang Y, Gao 558
CX, Wang F, Huang HX, Fu XD (2015b) The OsSPL16-GW7 regulatory module 559
determines grain shape and simultaneously improves rice yield and grain 560
quality. Nat Genet 47: 949–954 561
Wang S, Wu K, Yuan Q, Liu X, Liu Z, Lin X, Zeng R, Zhu H, Dong G, Qian Q, 562
Zhang GQ, Fu XD (2012) Control of grain size, shape and quality by OsSPL16 563
in rice. Nat Genet 44: 950–954 564
Wang YX, Xiong GS, Hu J, Jiang L, Yu H, Xu J, Fang YX, Zeng LJ, Xu E, Xu J, Ye 565
WJ, Meng XB, Liu RF, Chen HQ, Jing YH, Wang YH, Zhu XD, Li JY, Qian Q 566
(2015a) Copy number variation at the GL7 locus contributes to grain size 567
diversity in rice. Nat Genet 47: 944–948 568
Weng JF, Gu SH, Wan XY, Gao H, Guo T, Su N, Lei CL, Zhang X, Cheng ZJ, Guo XP, 569
Wang JL, Jiang L, Zhai HQ, Wan JM (2008) Isolation and initial 570
characterization of GW5, a major QTL associated with rice grain width and 571
weight. Cell Res 18: 1199–1209 572
Yan WH, Liu HY, Zhou XC, Li QP, Zhang J, Lu L, Liu TM, Liu HJ, Zhang CJ, Zhang 573
ZY, Shen GJ, Yao W, Chen HX, Yu SB, Xie WB, Xing YZ (2013) Natural 574
variation in Ghd7.1 plays an important role in grain yield and adaptation in rice. 575
Cell Res 23: 969–971 576
Yan WH, Wang P, Chen HX, Zhou HJ, Li QP, Wang CR, Ding ZH, Zhang YS, Yu SB, 577
Xing YZ, Zhang QF (2011) A major QTL, Ghd8, plays pleiotropic roles in 578
regulating grain productivity, plant height, and heading date in rice. Mol Plant 579
4: 319–330 580
Ye R, Yao QH, Xu ZH, Xue HW (2004) Development of an efficient method for the 581
isolation of factors involved in gene transcription during rice embryo 582
development. Plant J 38: 348–357 583
Yoon JM, Cho LH, Kim SL, Choi HB, Koh HJ, An GH (2014) The BEL1-type 584
homeobox gene SH5 induces seed shattering by enhancing abscission-zone 585
development and inhibiting lignin biosynthesis. Plant J 79: 717–728 586
Zhang LB, Zhu QH, Wu ZQ, Ross-Ibarra J, Gaut BS, Ge S, Sang T (2009) Selection 587
on grain shattering genes and rates of rice domestication. New Phytol 184: 708 588
–720 589
Zhang WH, Sun PY, He Q, Shu F, Wang J, Deng HF (2013) Fine mapping of GS2, a 590
dominant big-grain gene in rice. The Crop J 1: 160 –165 591
Zhang XJ, Wang JF, Huang J, Lan HX, Wang CL, Yin V, Wu YY, Tang HJ, Qian Q, 592
Li JY, Zhang HS (2012) Rare allele of OsPPKL1 associated with grain length 593
causes extra-large grain and a significant yield increase in rice. Proc Natl Acad 594
Sci USA 109: 21534–21539 595
Zhou Y, Lu DF, Li CY, Luo JH, Zhu BF, Zhu JJ, Shangguan YY, Wang ZX, Sang T, 596
Zhou B, Han B (2012) Genetic control of seed shattering in rice by the 597
APETALA2 transcription factor SHATTERING ABORTION1. The Plant 598
Cell 24: 1034–1048 599
Zhou Y, Zhu JY, Li ZY, Yi CD, Liu J, Zhang HG, Tang SZ, Gu MH, Liang GH (2009) 600
Deletion in a quantitative trait gene qPE9-1 associated with panicle erectness 601
improves plant architecture during rice domestication. Genetics 183: 315–324 602
Zhou Yh, Li SB, Qian Q, Zeng DL, Zhang M, Guo LB, Liu XL, Zhang BC, Deng LW, 603
Liu XF, Luo GZ, Wang XJ, Li JY (2009) BC10, a DUF266-containing and 604
Golgilocated type II membrane protein, is required for cell-wall biosynthesis in 605
rice (Oryza sativa L.). Plant J 57: 446–462 606
SUPPORTING INFORMATION 607
608
Figure S1. The predicted protein sequences of the two OsGRF4 alleles 609
Variant amino acids between the two parents are in green and red color 610
611
Figure S2. DNA sequences of the 2-kb promoter region of OsGRF4 between the two 612
parents R1126 and CDL 613
Variant SNPs and InDels between the two types are in red or green color 614
615
Figure S3. Longitudinal sections of abscission zone in grain pedicel tissues 616
(A, B) NIL-OsGRF4. (C, D) NIL-Osgrf4. (A, C): ×100 magnification. (B, D): ×400 617
magnification. F, flower side; P, pedicel side; AZ, abscission zone. 618
619
Figure S4. Time-course of grain weight between NIL-OsGRF4 and NIL-Osgrf4 620
plants (n = 60 grains for each point) 621
622
Table S1. Genomic polymorphisms of OsGRF4 promoter area in 25 accessions 623
624
Table S2. Grain length (mm) of transgenic plants and NIL-Osgrf4 625
626
Table S3. Primers used for sequencing, cloning and qPCR of OsGRF4 627
628
Table S4. Primer sets used for qRT-PCR of the 16 genes involved in panicle traits 629
and cytokinins 630
631
632
633
634
635
636
637
638
639
640
641
642
Figure legends: 643
Figure 1. Comparison of panicle traits in transgenic plants 644
(A) Grains of OX (+) and OX (–), Scale bar = 10 mm. (B) Grains of RNAi (+) and 645
RNAi (−), Scale bar =10 mm. (C) Panicles of OX (+) and OX (−), Scale bar = 10 cm. 646
(D) Panicles of RNAi (+) and RNAi (−), Scale bar = 10 cm. OX, overexpression; 647
RNAi, RNA interference; (+) indicates positive transgenic T1 plants; (−) indicates 648
negative transgenic T1 plants. 649
650
Figure 2. Comparisons of panicle traits, shattering degree, tiller number and 651
relative expression of OsGRF4 in transgenic plants 652
(A) Grain length. (B) Grain width. (C) Setting percentage. (D) Panicle length. (E) 653
BTS. (F) Thousand seed weight. (G) 7 cm young panicles. (H) Flag leaf. Data 654
presented as mean ± SD (n=6 plants). A Student’s t-test was used to generate the P 655
values. OX, overexpression; RNAi, RNA interference; (+) indicates 656
transgenic-positive T1 plants, (−) indicates transgenic-negative T1 plants. 657
658
Figure 3. OsGRF4 gene structure and natural variation in alleles from R1126 659
and CDL 660
Cyan blocks indicate exons; thin yellow lines indicate introns; thick magenta lines 661
indicate promoter; “ATG” and “TGA” represent translation initiation codon and 662
termination codon, respectively. 663
664
Figure 4. Comparison of OsGRF4 expression pattern and glume traits in NILs 665
(A) RH2, RH4 and RH7 represent rice hulls at reproductive stage in 2-cm, 4-cm and 666
7-cm spikelet; 1YP, 4YP, 7YP, 11YP and 15YP are young panicles measuring 1 cm, 4 667
cm, 7 cm, 11 cm and 15 cm length; R, S, FL and LS represent root, stem, flag leaf and 668
leaf sheath at vegetative stage (VS) and reproductive stage (RS). All data are based on 669
experiments in duplicate and expressed as means ± SD. Scanning electron microscopy 670
analysis of glume inner (B, C) and outer (D, E) surfaces of NILs spikelets at mature 671
stage. Scale bars =100 μM. Cell length (F) and cell number (G) of glume inner 672
surfaces of NILs spikelets at mature stage. 673
674
Figure 5. Subcellular localization of OsGRF4 675
Rice protoplasts were co-transformed with fusion constructs 35s::OsGRF4:YFP (A) 676
and 35s::Ghd7:CFP (B); The merged image (C) and bright field image (D). 677
Scale bar = 10 μm. 678
679
Figure 6. Effect of OsGRF4 on genes expressed in cell cycle, panicle traits and 680
cytokinins 681
(A) Cell cycle genes. (B, C) Panicle trait genes. (D) Cytokinins genes. The analysis of 682
relative expression ratios was determined by qRT-PCR using 7-cm young panicles. All 683
data are expressed as means ± SD based on experiments in triplicate. * indicated 684
significantly different (Student’s t-test, P < 0.05). 685
686
Figure 7. Comparison of panicle traits and plant types in NIL-OsGRF4 and 687
NIL-Osgrf4 plants 688
(A) Grains of NILs. Scale bar =10 mm. (B) Panicles of NILs. Scale bar = 10 cm. (C) 689
Plants of NILs. Scale bar =10 cm. (D) 40 days after full heading. (E) 30 days after full 690
heading. (F) 20 days after full heading. The corresponding BST values were measured 691
by force gauge and expressed as mean ± SD (n=3). A Student’s t-test was used to 692
generate the P values. 693
694
695
696
697
698
699
700
701
702
703
704
705
706
Table 1. Genomic polymorphisms of OsGRF4 coding sequence and promoter 707
haplotypes 708
Coding sequence Accessions Class
Grain length (mm) SNP1 SNP2 SNP3 SNP4
Promoter haplotype
CDL Indica 13.52 A TT AA T CDL type
NIL-OsGRF4 Indica 12.67 A TT AA T CDL type
Nongxiang 99 Indica 11.52 A TT TC T CDL type
Yuzhenxiang Indica 13.28 A TT TC T CDL type
Yuzhuxiang Indica 12.74 A TT TC T CDL type
Nongxiang 18 Indica 11.73 A TT TC T CDL type
Xiangwan xian17
Indica 11.60 A TT TC T CDL type
Nongxiang 21 Indica 11.74 A TT TC T CDL type
Nongxiang 29 Indica 12.46 A TT TC T CDL type
Gang 46B Indica 7.81 A TT TC T Gang 46B type
Nongxiang 16 Indica 9.37 A TT TC T Gang 46B type
BL122 Indica 8.41 A TT TC T Gang 46B type
Jiafuzhan Indica 11.46 A TT TC T Gang 46B type
Minghui 86 Indica 10.00 A TT TC T Gang 46B type
Xinyinzhan Indica 8.06 A TT TC T Gang 46B type
R700 Indica 9.31 A TT TC T R700 type
Fengyuan B Indica 9.95 A TT TC T Fengyuan B type
R1126 Indica 10.91 G GC TC G R1126 type
NIL-Osgrf4 Indica 10.49 G GC TC G R1126 type
Nanyangzhan Indica 12.42 G GC TC G R1126 type
R299 Indica 9.92 G GC TC G R299 type
02428 Japonica 7.59 G GC TC G R299 type
C418 Japonica 9.18 G GC TC G R299 type
P7144 Japonica 9.56 G GC TC G R299 type
CY016 Japonica 8.64 G GC TC G R299 type
709
710
711
712
713
714
Table 2. Comparison of hormone levels in NIL-OsGRF4 and NIL-Osgrf4 715
Hormone NIL-Osgrf4 NIL-OsGRF4
N6-isopentenyladenine (iP) 0.062 ± 0.008 0.074 ± 0.007
Isopentenyladenineriboside (iPR) 0.402 ± 0.036 0.775 ± 0.033*** trans-zeatin (tZ) 0.165 ± 0.019 0.174 ± 0.021
cis-zeatin (cZ) 0.056 ± 0.007 0.106 ± 0.014** trans-zeatin-riboside (tZR) 0.299 ± 0.012 0.339 ± 0.025* cis-zeatin-riboside (cZR) 0.334 ± 0.014 0.488 ± 0.067** indole acetic acid (IAA) 47.38 ± 5.83 50.59 ± 2.05
abscisic acid (ABA) 13.28 ± 0.74 14.61 ± 1.69
The content of 8 hormones was determined by liquid chromatography-tandem mass 716
spectrometry (LC-MS/MS) using 7-cm-long young panicles from at least 12 plants, in 717
at least triplicates. All data were expressed as means ± SD. *, ** and *** indicated 718
that phenotypes between NILs were significantly different (Student’s t-test, P < 0.05, 719
0.01 and 0.001, respectively). 720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
Table 3. Grain shape and yield component traits of the two NILs 737
Traits NIL-Osgrf4 NIL-OsGRF4
Panicle length (cm) 21.42 ± 0.51 25.54 ± 0.74***
Primary branch number 10.4 ± 0.55 11.4 ± 0.89*
Secondary branch number 19.8 ± 2.39 18.0 ± 2.45
Spikelet number per panicle 125.4 ± 6.73 126.2 ± 10.31
Grain number per panicle 119.2 ± 8.23 113.0 ± 10.77
Seed setting percentage 95.0 ± 1.88 89.47 ± 1.83***
Tiller number 6.26 ± 1.43 5.91 ± 1.87
Grain length (mm) 10.49 ± 0.26 12.67 ± 0.20***
Grain width (mm) 2.78 ± 0.13 3.12 ± 0.04***
1,000-grain weight (g) 31.7 ± 0.34 42.58 ± 1.58***
Storage capacity per plant (g) 27.82 ± 1.39 36.27 ± 3.25***
Plant height (cm) 108.68 ± 1.2 109.03 ± 1.77
All data were derived from the two NILs planted in random block design in triplicate. 738
All data were expressed as means ± SD (n = 5 plants). * and *** indicated that 739
phenotypes between NILs were significantly different (Student’s t-test, P < 0.05 and 740
0.001, respectively). 741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
Figures: 756
757
758 759
Figure 1. Comparison of panicle traits in transgenic plants 760
(A) Grains of OX (+) and OX (–), Scale bar = 10 mm. (B) Grains of RNAi (+) and 761
RNAi (−), Scale bar =10 mm. (C) Panicles of OX (+) and OX (−), Scale bar = 10 cm. 762
(D) Panicles of RNAi (+) and RNAi (−), Scale bar = 10 cm. OX, overexpression; 763
RNAi, RNA interference; (+) indicates positive transgenic T1 plants; (−) indicates 764
negative transgenic T1 plants. 765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
Figure 2. Comparisons of panicle traits, shattering degree, tiller number and 799
relative expression of OsGRF4 in transgenic plants 800
(A) Grain length. (B) Grain width. (C) Setting percentage. (D) Panicle length. (E) 801
BTS. (F) Thousand seed weight. (G) 7 cm young panicles. (H) Flag leaf. Data 802
presented as mean ± SD (n=6 plants). A Student’s t-test was used to generate the P 803
values. OX, overexpression; RNAi, RNA interference; (+) indicates 804
transgenic-positive T1 plants, (−) indicates transgenic-negative T1 plants. 805
806
807
808
809
810
811
812
813
814
815
816
Figure 3. OsGRF4 gene structure and natural variation in alleles from R1126 817
and CDL 818
Cyan blocks indicate exons; thin yellow lines indicate introns; thick magenta lines 819
indicate promoter; “ATG” and “TGA” represent translation initiation codon and 820
termination codon, respectively. 821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
Figure 4. Comparison of OsGRF4 expression pattern and glume traits in NILs 860
(A) RH2, RH4 and RH7 represent rice hulls at reproductive stage in 2-cm, 4-cm and 861
7-cm spikelet; 1YP, 4YP, 7YP, 11YP and 15YP are young panicles measuring 1 cm, 4 862
cm, 7 cm, 11 cm and 15 cm length; R, S, FL and LS represent root, stem, flag leaf and 863
leaf sheath at vegetative stage (VS) and reproductive stage (RS). All data are based on 864
experiments in duplicate and expressed as means ± SD. Scanning electron microscopy 865
analysis of glume inner (B, C) and outer (D, E) surfaces of NILs spikelets at mature 866
stage. Scale bars =100 μM. Cell length (F) and cell number (G) of glume inner 867
surfaces of NILs spikelets at mature stage. 868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
Figure 5. Subcellular localization of OsGRF4 884
Rice protoplasts were co-transformed with fusion constructs 35s::OsGRF4:YFP (A) 885
and 35s::Ghd7:CFP (B); The merged image (C) and bright field image (D). 886
Scale bar = 10 μm. 887
888
889
890
891
892
893
894
895
896
897
898
899
900
Figure 6. Effect of OsGRF4 on genes expressed in cell cycle, panicle traits and 901
cytokinins 902
(A) Cell cycle genes. (B, C) Panicle trait genes. (D) Cytokinins genes. The analysis of 903
relative expression ratios was determined by qRT-PCR using 7-cm young panicles. All 904
data are expressed as means ± SD based on experiments in triplicate. * indicated 905
significantly different (Student’s t-test, P < 0.05). 906
907
908
909
910
911
912
Figure 7. Comparison of panicle traits and plant types in NIL-OsGRF4 and 913
NIL-Osgrf4 plants 914
(A) Grains of NILs. Scale bar =10 mm. (B) Panicles of NILs. Scale bar = 10 cm. (C) 915
Plants of NILs. Scale bar =10 cm. (D) 40 days after full heading. (E) 30 days after full 916
heading. (F) 20 days after full heading. The corresponding BST values were measured 917
by force gauge and expressed as mean ± SD (n=3). A Student’s t-test was used to 918
generate the P values. 919
920
921
922
923
924
925