COPERTINA 1128 T 27-06-2007 9:08 Pagina 1Editors - Editeurs - Editores: S. Galal & J. Boyazoglu...

COPERTINA 1128 T 27-06-2007 9:08 Pagina 1

Editors - Editeurs - Editores:S. Galal & J. Boyazoglu

Viale delle Terme di Caracalla,00153 Rome, Italy

Animal Genetic Resources Information ispublished under the auspices of the Food andAgriculture Organization of the UnitedNations (FAO). It is edited in the AnimalGenetic Resources Group of the AnimalProduction and Health Division of FAO. Itis available direct from FAO or through FAOsales agents.

ANIMAL GENETIC RESOURCESINFORMATION will be sent free of chargeto those concerned with the sustainabledevelopment conservation of domesticlivestock. Anyone wishing to receive itregularly should send their name andaddress to the Editor, at the addressshown above.AGRI can also be found in the “Library”of DAD-IS at www.fao.org/dad-is.

Le Bulletin d’information sur les ressourcesgénétiques animales est publié sous lesauspices de l’Organisation des Nations Uniespour l’alimentation et l’agriculture (FAO).Cette publication est éditée par le Groupe desressources génétiques de la Division de laproduction et de la santé animales de la FAO.On peut se le procurer directement au siègede la FAO ou auprès des dépositaires etagents de vente des publications del’Organisation.

LE BULLETIN D’INFORMATION SURLES RESSOURCES GÉNÉTIQUESANIMALES sera envoyé gratuitement auxpersonnes intéressées par ledéveloppement durable et la conservationdu cheptel national. Les personnessouhaitant recevoir cette publicationrégulièrement voudront bien faire parvenirleurs nom et adresse à l’éditeur, àl’adresse susmentionnée.AGRI peut être consulté également dansla “Bibliothèque” de DAD: www.fao.org/dad-is.

El Boletín de información sobre recursosgenéticos animales se publica bajo losauspicios de la Organización de las NacionesUnidas para la Agricultura y la Alimentación(FAO). Se edita en el Grupo de RecursosZoogenéticos de la Dirección de Produccióny Sanidad Animal de la FAO. Se puedeobtener directamente de la FAO o a travésde sus agentes de venta.

EL BOLETÍN DE INFORMACIÓN SOBRERECURSOS GENÉTICOS ANIMALES seráenviado gratuitamente a quienes esténinteresados en el desarrollo sostenible yla conservación del ganado doméstico. Sise desea recibirlo regularmente, se ruegacomunicar nombre, apellido y direcciónal editor a la dirección arriba indicada.AGRI puede consultarse también en la“Biblioteca” de DAD-IS en:www.fao.org/dad-is.

ANIMAL GENETICRESOURCES INFORMATION

BULLETIND’INFORMATIONSUR LES RESSOURCESGÉNÉTIQUES ANIMALES

BOLETÍN DEINFORMACIÓN SOBRE RECURSOSGENÉTICOS ANIMALES

CONTENTS Page

402007

FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS

ORGANISATION DES NATIONS UNIES POUR L’ALIMENTATION ET L’AGRICULTURE

ORGANIZACIÓN DE LAS NACIONES UNIDAS PARA LA AGRICULTURA Y LA ALIMENTACIÓN

Editorial ..................................................................................................................... I

The use of reproductive and molecular biotechnology in Animal GeneticResources management – a global overview...................................................... 1

D. Pilling, R. Cardellino, M. Zjalic, B. Rischkowsky,K.A. Tempelman & I. Hoffmann

The status of cattle genetic resources in North Ethiopia: On-farmcharacterization of six major cattle breeds ........................................................ 15

M. Zerabruk, O. Vangen & M. Haile

Acciones para la caracterización y conservacióndel bovino criollo Peruano (Bos taurus) ........................................................... 33

E. Rivas, E. Veli, Y. Aquino, V. Rivas, S. Pastor & R. Estrada

Caractérisation phénotypique des bovins àviande (Bos taurus et Bos indicus) au centre (Bouaké)et au nord (Korhogo) de la Côte d’Ivoire ......................................................... 43

D.P. Sokouri, N.E. Loukou, C.V. Yapi-Gnaoré, F. Mondeil & F. Gnangbe

On-farm characterization and present status ofNorth Bengal Grey (NBG) cattle in Bangladesh ................................................ 55

M. Al-Amin, A. Nahar, A.K.F.H. Bhuiyan & M.O. Faruque

The N’Dama cattle genetic improvement programme: a review .............................. 65N.A. Bosso, N. Corr, M. Njie, A. Fall, E.H. van der Waaij,J.A.M. van Arendonk, J. Jaitner, L. Dempfle & K. Agyemang

The Poltava chicken breed of Ukraine:its history, characterization and conservation .................................................. 71

I.G. Moiseyeva, M.N. Romanov, A.T. Kovalenko, T.V. Mosyakina,Yu.V. Bondarenko, P.I. Kutnyuk, A.P. Podstreshny & A.A. Nikiforov

Pure line laying chickens at the Agassiz Research Centre ..................................... 79F.G. Silversides, D. McQ. Shaver & Y. Song

Status and conservation of Mewari and Jaisalmeri camels in India ....................... 87S.C. Mehta, B. Bhardwaj & M.S. Sahani

Recent publications ............................................................................................. 103

Editorial Policies and Procedures ......................................................................... 109

Editorial Advisory Board (EAB) of Animal Genetic Information (AGRI)

• Editor-in-Chief: I. Hoffmann, Chief Animal Production Service, FAO• Editors: J. Boyazoglu (Greece)

S. Galal (Egypt)• Technical Editor: C. Mosconi (Italy)• Editorial Board: L. Ollivier, Chairperson (France)

L. Alderson (United Kingdom)J.S. Barker (Australia)P. Bhat (India)J.V. Delgado Bermejo (Spain)M. Djemali (Tunisia)J. Hodges (Canada)K. Ramsay (South Africa)E. Rege (ILRI)A. Tewolde (Mexico)

The following is the address for each of the members of the Editorial Advisory Board.

• Irene Hoffmann, FAO, Viale delle Terme di Caracalla 1, 00100 Rome, ItalyTel.: +33 06 5705 52796, [email protected]

• Jean Boyazoglu, Senior Livestock Specialist, 51 Porte de France, 06500 Menton, FranceTel.: +33 49 3284617, [email protected]

• Salah Galal, Animal Production Department, Faculty of Agriculture, University of Ain Shams,PO Box 68, Hadaeq Shubra 11241, Cairo, EgyptTel.: +20 2 634408, [email protected]

• Louis Ollivier, INRA-Station de Génétique Quantitative et Appliquée, CRJ, Domaine de Vilvert,78352 Jouy-en-Josas Cédex, FranceTel.: +33 1 34652190, [email protected]

• Lawrence Alderson, Countrywide Livestock Ltd, 6 Harnage, SY5 6EJ Shrewsbury, Shropshire, UKTel.: +44 195 2510030, [email protected]

• J. Stuart Barker, Dept. of Animal Science, University of New England, NSW 2351 Armidale,AustraliaTel.: +61 7 54358365, [email protected]

• Pushkar Nath Bhat, Indian Association for Animal Production, World Buffalo Trust, Flat Nº 205Nº F64-C/9 Sector 40, 201 303 Noida (UP), IndiaTel.: +91 11 91579627, [email protected]

• Juan Vicente Delgado Bermejo, Departamento de Genética, Universidad de Córdoba, Campus deRabanales Edificio C-5 (Gregor Mendel), 14071 Córdoba, SpainTel.: +34 957 218661, [email protected]

• Mnouer Djemali, Institut National Agronomique de Tunis, 43, avenue Charles Nicole,Tunis, Tunisia,Tel.: +216 1 289683/289431, [email protected]

• John Hodges, Lofererfeld 16, 5730 Mittersill, Austria,Tel.: +43 6562 5481, [email protected]

• Keith Ramsay, Senior Livestock Specialist, Private Bag X 138, 0001 Pretoria, Gauteng, South AfricaTel.: +27 12 3197448, [email protected]

• Ed Rege, Animal Breeding and Production Systems, ILRI, PO Box 5689, Addis Ababa, Ethiopia,Tel.: +251 1 613215, [email protected]

• Assefaw Tewolde, Inovacion y Tecnologia/Biotecnologia, Instituto Interamerican de Cooperacionpara la Agricultura (IICA), Sede Central, Coronado, San Jose, Costa Rica, [email protected]

• Cesare Mosconi, EAAP, Via G. Tomassetti 3, 00161 Rome, ItalyTel.:+39 06 44202639, [email protected]

I

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

Editorial - The Interlaken Conference

In December 2006, the Intergovernmental WorkingGroup on Animal Genetic Resources convened inRome for its fourth session1. The Working Groupmade a series of recommendations to FAO’sCommission on Genetic Resources on GeneticResources for Food and Agriculture on how best toaddress opportunities and challenges for animalgenetic resources through international policymeasures. The finalization of The State of the World’sAnimal Genetic Resources for Food and Agriculture, andthe upcoming International Technical Conferenceon Animal Genetic Resources, to be held inSeptember this year in Interlaken2, Switzerland,make 2007 an important year for intergovernmentalpolicy-making in the area of animal geneticresources.

The first draft of The State of the World’s AnimalGenetic Resources for Food and Agriculture 3, the firstever global assessment of the status and trends ofanimal genetic resources, and the capacity ofcountries to manage them, was presented to theWorking Group. The Working Group asked FAO torevise the document on the basis of commentsprovided by countries. The revised State of theWorld’s Animal Genetic Resources for Food andAgriculture is expected to be approved in June by theCommission, for publication and presentation at theInterlaken Conference.

The Working Group recommended that theInterlaken Conference, in addition to thepresentation of The State of the World’s Animal GeneticResources for Food and Agriculture, negotiates andadopts a Global Plan of Action for Animal GeneticResources, as its main outcome. This Global Plan ofAction will be based on the Strategic Priorities forAction document, which was prepared togetherwith The State of the World’s Animal Genetic Resourcesfor Food and Agriculture and reflects national,regional and international priorities for action. It

addresses four main areas for action:characterization, inventory and monitoring,sustainable use and development, conservation,and policies institutions and capacity building. TheCommission on Genetic Resources for Food andAgriculture will convene in June, in Rome, toprepare the various elements of the Global Plan ofAction for the Interlaken Conference.

The Interlaken Conference will mark a historicopportunity for the international community tomake strategic choices on the future management ofanimal genetic resources. There is a greater needthan ever, for those concerned about themanagement of animal genetic resources, to worktogether to formulate well-informed positions onpriorities for action, sensible approaches to theconservation and better use of animal geneticresources to enhance food security and sustainabledevelopment, securing broad access to animalgenetic resources for farmers and breeders, and thefair and equitable sharing of benefits deriving fromthese resources. The preparation of the InterlakenConference calls for collaboration at national,regional and international levels, among a broadrange of stakeholders, including policy-makers,scientists, non-governmental organizations,breeders and livestock keepers.

On a final note, we are happy to announce thatthe latest version of the Domestic Animal DiversityInformation System - DAD-IS:3 has been launched4,eleven years after DAD-IS:1 went live. Countrieshave full responsibility and ownership for theirdata; DAD-IS: 3 enables countries and regions to setup their own national5 or regional informationsystems6, and exchange data with the globalinformation system. The new system is moreuser-friendly and provides additional tools for themanagement of animal genetic resources.

1 Documentation at www.fao.org/ag/againfo/programmes/en/genetics/angrvent2006.html2 See www.fao.org/ag/againfo/programmes/en/genetics/angrvent2007.html3 See www.fao.org/ag/againfo/programmes/en/genetics/documents/AH473e00.pdf4 See ww.fao.org/dad-is/; contact the DAD-IS moderator at [email protected] See Poland’s Farm Animal Biodiversity Information System at http://efabis.izoo.krakow.pl/6 See European Farm Animal Biodiversity Information System at http://efabis.tzv.fal.de/

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

II

Éditorial - La Conference de Interlaken

En décembre 2006 le Groupe de Travail pour lesressources génétiques animales a célébré saquatrième session à Rome1. Le Groupe de Travail àl’occasion a fait une série de recommandations à laCommission pour les Ressources Génétiques pourl’Alimentation et l’Agriculture de la FAO surcomment utiliser au mieux les opportunités et faireface aux défis que représentent les ressourcesgénétiques animales à travers des mesurespolitiques internationales. La finalisation durapport sur la Situation Mondiale des RessourcesGénétiques Animales pour l’Alimentation etl’Agriculture, ainsi que la prochaine ConférenceTechnique Internationale sur les RessourcesGénétiques Animales qui aura lieu au mois deseptembre à Interlaken2, en Suisse, fait de 2007 uneannée importante pour la politiqueintergouvernementale dans le domaine desressources génétiques animales.

Le premier brouillon sur la Situation Mondiale desRessources Génétiques Animales pour l’Alimentation etl'Agriculture 3, le premier contrôle global sur lasituation et tendances des ressources génétiquesanimales, et la capacité de gestion de la part despays, ont été présentés au Groupe de Travail. LeGroupe de Travail a demandé à la FAO de revoir ledocument sur la base des commentaires fait par lespays. Le document revu sur la Situation Mondiale desRessources Génétiques Animales pour l’Alimentation etl’Agriculture sera présenté pour approbation par laCommission en juin, pour son ultérieurepublication et présentation à la Conférence deInterlaken.

Le Groupe de Travail a recommandé que laConférence de Interlaken en outre à la présentationde la Situation Mondiale des Ressources Génétiques

Animales pour l’Alimentation et l’Agriculture, negotieet adopte un Plan d’Action Global pour lesRessources Génétiques Animales comme objectifprincipal. Ce Plan d’Action Global sera basé sur ledocument sur les Priorités Stratégiques d’Action quia été préparé en même temps que le rapport sur laSituation Mondiale des Ressources Génétiques Animalespour l’Alimentation et l’Agriculture et reflète lespriorités d’action aux niveaux national, régional etinternational. Le document contient quatredomaines principaux d’action: la caractérisation,l’inventaire et le suivi, l’utilisation durable et ledéveloppement, la conservation, et les politiquesinstitutionnelles et capacité d’action. LaCommission pour les Ressources Génétiques pourl’Alimentation et l’Agriculture se réunira en juin àRome pour préparer les différents élémentsnécessaires au Plan d’Action Global pour laConférence de Interlaken.

La Conférence de Interlaken représentera uneopportunité historique pour la communautéinternationale qui pourra réaliser des choixstratégiques pour le futur de la gestion desressources génétiques animales. Il y a aujourd’huiun besoin croissant pour ceux qui se préoccupentde la gestion des ressources génétiques animales detravailler ensemble pour formuler des positions biendocumentées sur les priorités d’action, établir desapproches adéquates pour la conservation etmeilleure utilisation des ressources génétiquesanimales pour améliorer la sécurité alimentaire et ledéveloppement durable, assurer un plus ampleaccès aux ressources génétiques animales de la partdes éleveurs et améliorateurs, et une meilleure etplus équitable distribution des bénéfices dérivés deces ressources. La préparation de la Conférence de

1 Documentation sur www.fao.org/ag/againfo/programmes/en/genetics/angrvent2006.html2 Voir www.fao.org/ag/againfo/programmes/en/genetics/angrvent2007.html3 Voir www.fao.org/ag/againfo/programmes/en/genetics/documents/AH473e00.pdf

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

III

Interlaken nécessite de la collaboration aux niveauxnational, régional et international des propriétaires,y compris les législateurs, chercheurs, organisationsnon gouvernementales, améliorateurs et éleveurs.

Finalement, nous sommes heureux d’annoncerque la dernière version du Système d’Informationsur la Diversité des Animaux Domestiques –DAD-IS 3 a été lancée4 onze ans après la création duDAD-IS 1. Les pays sont pleinement responsables et

propriétaires de leurs données; DAD-IS 3 permettraaux pays et régions de développer leur propressystèmes d’information national5 ou régional6, ainsique d’échanger des données avec le système globald’information. Le nouveau système a été conçu pourune utilisation plus facile et proportionne des outilscomplémentaires pour la gestion des ressourcesgénétiques animales.

4 Voir ww.fao.org/dad-is/; contact the DAD-IS moderator at [email protected] Voir Poland’s Farm Animal Biodiversity Information System at http://efabis.izoo.krakow.pl/6 Voir European Farm Animal Biodiversity Information System at http://efabis.tzv.fal.de/

IV

Editorial - La Conferencia de Interlaken

En diciembre del 2006 se reunió en Roma en sucuarta sesión el Grupo de TrabajoIntergubernamental para los RecursosZoogenéticos. El Grupo de Trabajo hizo una serie derecomendaciones a la Comisión para los RecursosGenéticos para la Alimentación y la Agricultura dela FAO sobre como aprovechar mejor lasoportunidades y enfrentarse a los desafíosplanteados por los recursos zoogenéticos a travésde una serie de medidas políticas internacionales.La finalización del informe sobre la SituaciónMundial de los Recursos Zoogenéticos para laAlimentación y la Agricultura, así como la próximaConferencia Técnica Internacional sobre recursoszoogenéticos que tendrá lugar en septiembre enInterlaken, en Suiza, hace del 2007 un añoimportante en cuanto al establecimiento de políticasintergubernamentales en el campo de los recursoszoogenéticos.

El primer borrador de la Situación Mundial de losRecursos Zoogenéticos para la Alimentación y laAgricultura, el primer control sobre la situación ytendencias de los recursos zoogenéticos, así como lacapacidad de los paises de gestionarlos, fuepresentado al Grupo de Trabajo. El Grupo deTrabajo pidió a la FAO revisar el documento en basea los comentarios proporcionados por los paises. Laversión revisada de la Situación Mundial de losRecursos Zoogenéticos para la Alimentación y laAgricultura se espera sea aprobada en junio por laComisión para su posterior publicación ypresentación a la Conferencia de Interlaken.

El Grupo de Trabajo recomendó que laConferencia de Interlaken, además de lapresentación de la Situación Mundial de los RecursosZoogenéticos para la Alimentación y la Agricultura,

negociara y adoptara un Plan de Acción Globalpara los Recursos Zoogenéticos como puntoprincipal del programa. Este Plan Global de Acciónse basara sobre el documento sobre las PrioridadesEstratégicas de Acción que fue preparado junto conla Situación Mundial de los Recursos Zoogenéticos parala Alimentación y la Agricultura y que refleja lasprioridades de acción a nivel nacional, regional einternacional. El documento se centra en cuatrotemas principales de acción: la caracterización, elinventario y seguimiento, la utilización sostenible yel desarrollo, la conservación, y las políticasinstitucionales y capacidad de acción. La Comisiónsobre Recursos Genéticos para la Alimentación y laAgricultura se reunirá en junio en Roma parapreparar los distintos elementos necesarios para laelaboración del Plan Global de Acción para laConferencia de Interlaken.

La Conferencia de Interlaken representa unaoportunidad histórica para la comunidadinternacional de realizar elecciones estratégicassobre la gestión futura de los recursos zoogenéticos.Hoy en día es incluso mayor la necesidad paraaquéllos preocupados por la gestión de los recursoszoogenéticos trabajar juntos para formularposiciones comunes bien documentadas sobre lasprioridades de acción, enfocar mejor laconservación y mejorar el uso de los recursoszoogenéticos para favorecer la seguridadalimentaria y el desarrollo sostenible, asegurar unacceso mayor a los recursos zoogenéticos a losganaderos y mejoradores, y garantizar un mejor ymas equilibrado reparto de los beneficiosprovenientes de estos recursos. La preparación de laConferencia de Interlaken necesita de la

1 Documentación en www.fao.org/ag/againfo/programmes/en/genetics/angrvent2006.html2 Ver www.fao.org/ag/againfo/programmes/en/genetics/angrvent2007.html3 Ver www.fao.org/ag/againfo/programmes/en/genetics/documents/AH473e00.pdf

V

colaboración a nivel nacional, regional einternacional, de un amplio panel de propietarios,incluidos los legisladores, científicos,organizaciones non gubernamentales, mejoradoresy ganaderos.

Por fin, nos alegra anunciar que la ultimaversión del Sistema de Información sobre laDiversidad de los Animales Domésticos – DAD-IS 3

ha sido lanzada4 tras once años después de lacreación del DAD-IS 1. Los paises son plenamenteresponsables y propietarios de sus propios datos;DAD-IS 3 permite a los paises y regiones instalar supropio sistema nacional5 o regional6 e intercambiardatos con el sistema de información global. Elnuevo sistema ha sido diseñado para facilitar suutilización y proporciona herramientas adicionalespara la gestión de los recursos zoogenéticos.

4 Ver ww.fao.org/dad-is/; contact the DAD-IS moderator at [email protected] Ver Poland’s Farm Animal Biodiversity Information System at http://efabis.izoo.krakow.pl/6 Ver European Farm Animal Biodiversity Information System at http://efabis.tzv.fal.de/

asdg

1

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 1-13

The use of reproductive and molecular biotechnology in AnimalGenetic Resources management – a global overview1

D. Pilling, R. Cardellino, M. Zjalic, B. Rischkowsky, K.A. Tempelman & I. Hoffmann

Animal Production and Health Division, FAO, V.le delle Terme di Caracalla 1, 00100 Rome, Italy

1This paper updates and completes the preliminaryanalysis published in an earlier paper by Cardellino etal., 2005.

Summary

As part of the country-driven strategy for themanagement of animal genetic resources, FAOinvited 188 countries to participate in thepreparation of the First Report on the State of theWorld’s Animal Genetic Resources. Utilizing theinformation provided in the 148 country reportsready for analysis in July 2005, this paper presentsa global overview of the state of capacity andutilization of reproductive and molecularbiotechnologies in the management of animalgenetic resources. Regional descriptions outline thedistribution of different biotechnologies, along witha discussion of the species and breed focus of theiruse, and stakeholder involvement in servicedelivery. Unsurprisingly, there is a big gap inbiotechnology use between developed anddeveloping countries, with artificial inseminationbeing the technology most widely applied indeveloping countries. More complex technologiessuch as embryo transfer and molecular tools, areeven less common in developing countries. Use ofbiotechnologies is in general biased towards cattle,and examples of the application of biotechnologiesin the management of locally adapted breeds arelimited. Most developing countries express the wishto increase the utilization of biotechnologies.However, in many cases clear plans forincorporating technologies into animal geneticresource management are lacking.

Resumen

Como parte de la estrategia de liderazgo de lospaíses en la gestión de los recursos zoogenéticos, laFAO invitó 188 países a participar en lapreparación del Primer Informe sobre la situaciónmundial de los recursos zoogenéticos. Utilizando lainformación proporcionada por los 148 informesnacionales listos para analizar en julio del 2005,este artículo presenta una visión global de lacapacidad y utilización des las biotecnologíasreproductivas y moleculares en la gestión de los

recursos zoogenéticos. Las descripciones regionalesevidencian la distribución de las distintasbiotecnologías junto con una discusión sobreespecies y razas focalizada sobre su uso, así comola implicación de los ganaderos en la entrega deservicios. Se comprueba sin sorpresa que existe unagran diferencia en la utilización de la biotecnologíaentre países desarrollados y en desarrollo.Tecnologías más complejas, tales como latransferencia de embriones y herramientasmoleculares son incluso menos comunes en lospaíses en desarrollo. La utilización debiotecnologías está orientada hacia los bovinos ylos ejemplos de aplicación de biotecnologías en lagestión de razas locales adaptadas es muy limitado.Muchos de los países en desarrollo solicitan unaumento en la utilización de las biotecnologías. Sinembargo, en muchos casos existe una escasez deplanes efectivos para la incorporación de nuevastecnologías en la gestión de los recursoszoogenéticos.

Keywords: Biotechnology, Animal genetic resources,Artificial insemination, Embryo transfer, Moleculargenetics.

Introduction

The development of biotechnologies in the fields ofbreeding, reproduction and molecular genetics hasadvanced markedly in recent years. Reproductivebiotechnologies for livestock have the potential toincrease reproductive efficiency and rates of animalgenetic improvement. Advances in artificialinsemination (AI) and multiple ovulation followedby embryo transfer (MOET) have already had amajor impact on livestock improvementprogrammes in developed countries. AI and MOET

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

2Biotechnology - a global overview

speed up genetic progress, reduce the risk of diseasetransmission and expand the number of animalsthat can be bred from a superior parent.Technologies such as genomics and molecularmarkers are valuable in understanding,characterizing and managing animal geneticresources (FAO, 2004).

Recent years have also seen an increasedrecognition that farm animal genetic diversity is animportant resource, which enables the livestocksector to meet diverse requirements and to adapt toemerging needs and challenges. Similarly, it isrecognized that this diversity is eroding at aworrying speed. The urgent need to address theissue is heightened by rapid changes to thelivestock sector associated with the increasingdemand for livestock products, which is occurringin many developing countries (Delgado et al., 1999).At the same time, the Millennium DevelopmentGoals have focussed attention on povertyalleviation, and the immediate concerns in thedeveloping world are for food security andeconomic development. While reproductivebiotechnologies, have the potential to enhancelivestock productivity, there is also a concern thatinappropriate or unplanned use, in particular of AI,can lead to increased rates of genetic erosion andbreed extinction.

The Food and Agriculture Organization of theUnited Nations (FAO) has been asked by its membercountries to develop and implement acountry-driven Global Strategy for the Managementof Farm Animal Genetic Resources. One part of theprocess is to understand and analyse the nationaland global state of animal genetic resources. FAOinvited 188 countries to submit country reports(CRs), which are currently being analysed to obtaina global picture and to produce the First Report onthe State of the World’s Animal Genetic Resources.

The objective of this paper is to distil andanalyse the information provided in the CRsregarding the use of biotechnologies in livestockbreeding and reproduction, as well as for researchinto livestock genetics. Examples, illustrating theapplication of biotechnologies, in particular in themanagement of locally adapted breeds of livestock,are drawn from the CRs. It should be noted thatapplications of biotechnology, not related toreproduction and breeding, are not considered.Moreover, a detailed assessment of the use ofbiotechnologies for the purposes ofcryoconservation is not included. The paper alsooutlines the views expressed in the CRs regarding

constraints, opportunities and priorities related tothe development and utilization of biotechnologiesfor the management of farm animal geneticresources.

Methods

The findings presented in this paper are based onthe 148 CRs that were available by July 2005 (thecompletion date for each CR is shown inAppendix 1). The countries had been offeredguidelines for the preparation of the reports, onesection of which was to be devoted to reviewing thestate of national capacities, and assessing futurecapacity building requirements (FAO, 2001). TheCRs, thus, offered a useful resource on which tobase an assessment of the current global state ofcapacity and utilization of biotechnologies across awide range of production systems, and in thecontext of ongoing changes to the livestock sector.

Reports were classified on the basis of theregional classification established by FAO for thepurposes of preparing the First Report on the Stateof the World’s Animal Genetic Resources (a total ofseven regions). The study considered 42 reportsfrom Africa, 25 from Asia, 39 from Europe, 22 fromLatin America and the Caribbean, 7 from the Nearand Middle East, 2 from North America and 11 fromthe Southwest Pacific. The distribution of thecountries covered in this paper, by region is shownin Appendix 1.

The numbers of countries within each regionreporting a particular activity is presented. Datarelating to the species and type of breeds to whichthe biotechnologies are applied, and the types ofinstitutions involved in the provision andutilization of the biotechnologies, are analysedwhere available. As the data was not obtained onthe basis of formal sampling or a standardquestionnaire, no statistical analysis was carriedout, and the results are presented descriptively. Asit was not always clear from the CRs whether aparticular technology was being used or not, thenumber of reports providing the relevantinformation is presented for each set of results. Thenames of individual countries are not mentioned inthe presentation of the quantitative information.However, where illustrative examples are offered,the relevant CR(s) are cited. Also, where a smallnumber of countries depart markedly from thegeneral pattern of the region, this is indicated.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

3

Animal Genetic Resources Information, No. 40, 2007

Pilling et al.

Tab

le 1

. Rep

orte

d us

e of

bio

tech

nolo

gies

by

regi

on.

Art

ific

ial i

nsem

inat

ion

Em

bryo

tran

sfer

M

olec

ula

r ge

neti

c te

chno

logi

es

Reg

ion

No.

of

CR

s N

o. p

rovi

din

g in

fo.

Rep

orti

ng u

se o

f th

e te

chno

logy

N

o. p

rovi

din

g in

fo.

Rep

orti

ng u

se o

f th

e te

chno

logy

N

o. p

rovi

din

g in

fo.

Rep

orti

ng u

se o

f th

e te

chno

logy

A

fric

a 42

42

74%

30

17

%

29

14%

A

sia

2522

86

%

17

47%

16

50

%

Eu

rop

e 39

39

97%

25

64

%

29

83%

L

atin

Am

eric

a an

d th

e C

arib

bean

22

22

95

%

14

86%

15

73

%

Nea

r an

d

Mid

dle

Eas

t 7

6 10

0%

3 33

%

5 40

%

Nor

th A

mer

ica

2

2 10

0%

2 10

0%

2 10

0%

Sou

thw

est

Pac

ific

11

11

55

%

10

10%

9

11%

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Tab

le 2

. Rep

orte

d us

e of

bio

tech

nolo

gies

by

spec

ies.

Art

ific

ial i

nsem

inat

ion

Em

bryo

tran

sfer

M

olec

ula

r ge

neti

c te

chno

logi

es

Rep

orti

ng u

se o

f th

e te

chno

logy

: R

epor

ting

use

of

the

tech

nolo

gy:

Rep

orti

ng u

se o

f th

e te

chno

logy

:

Reg

ion

No.

wit

h in

fo

on s

pec

ies

In c

attl

e In

oth

er

spec

ies

No.

wit

h in

fo o

n sp

ecie

s In

cat

tle

In o

ther

sp

ecie

s N

o. w

ith

info

on

spec

ies

In c

attl

e In

oth

er

spec

ies

Afr

ica

31

10

0%

10%

4

100%

0%

3

100%

33

%

Asi

a

18

94%

56

%

6 10

0%

50%

7

86%

10

0%

Eu

rop

e

38

100%

66

%

11

100%

36

%

18

89%

10

0%

Lat

in A

mer

ica

and

the

Car

ibbe

an

21

100%

71

%

12

100%

33

%

9 78

%

89%

Nea

r an

d M

idd

le E

ast

6 10

0%

33%

1

0%

100%

2

0%

100%

Nor

th A

mer

ica

2

100%

50

%

0 -

- 1

100%

10

0%

Sou

thw

est P

acif

ic

5 10

0%

80%

2

100%

0%

0

- -

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

5


Pilling et al.

Results

Table 1 presents a region-by-region overview of theproportion of countries reporting the use of differentclasses of biotechnology. It can be seen that AI is byfar the most widely used biotechnology, butparticularly in the Africa and Southwest Pacificregions, there are many countries where it isunavailable. In the case of ET and moleculartechniques the gap between the developed anddeveloping regions is even greater. Table 2 gives anindication of the bias in favour of cattle in theapplication of biotechnologies. The table shows agreater bias with respect to ET, but it can also beseen that in most regions the use of AI is alsodominated by the cattle sector. In the Africa regionin particular, few countries have extended the use ofAI to other species. The evidence for such a speciesbias is rather less in the case of molecular genetictechnologies. The number of countries reporting theuse of such technologies is quite low. However,among these a relatively high number report studiesof molecular characteristics in at least one speciesother than cattle. Nonetheless, cattle remain thesingle dominant species in most regions;particularly so where commercial applications ofthe technologies are concerned. Further details ofthe distribution of biotechnology use and of thespecies to which they are applied are included inthe following regional descriptions.

Africa

The CRs indicate that AI is the biotechnology mostcommonly used in the management of animalgenetic resources in Africa. The CRs generallyexpress an aspiration for greater use of thetechnology in the management of genetic resources,notably in facilitating breeding programmes and theintroduction of exotic germplasm. This aspirationcorresponds to the overall objective expressed inmost African CRs, of promoting food securitythrough increased livestock productivity. In manycases, the desire for more widespread use of AI istempered by concern regarding the implications ofits inappropriate or uncontrolled use for geneticdiversity and the availability of livestock welladapted to the local production conditions. Anumber of CRs also mention the potential use ofAI facilities for purposes of cryoconservation.

Thirty-one out of 42 countries report the use ofAI. A few other countries report that AI has beencarried out experimentally in the past, but neverapplied routinely, or that former AI programmes

have been abandoned through lack of financialresources or other constraints. AI use in Africa ispredominantly concerned with cattle. All 31 CRsreporting the use of AI mentioned that thetechnology is used in cattle. Two countries reportthe use of AI in sheep, 1 in goats, 1 in horses and1 in pigs. The semen used for AI tends to be fromexotic breeds rather than local breeds. Nineteencountries indicate that AI was performed usingsemen from exotic cattle breeds, 2 report usingsemen from local breeds and 6 report use of bothlocal and exotic semen. Where details ofprogrammes are provided, the objective is often theupgrading of indigenous livestock using semenfrom exotic breeds, most frequently of dairy cattle.Exotic beef cattle semen is also utilized in a numberof countries.

Some CRs from West Africa mention the use ofexotic semen for cross-breeding withtrypanotolerant cattle breeds (Guinea CR; Côted’Ivoire CR). A limited number of AI programmesutilizing semen from indigenous animals arereported, including in one country the use of semenfrom trypanotolerant cattle (Côte d’Ivoire CR). TheMadagascar CR notes the use of AI in in situconservation programmes for the endangeredRenitilo cattle breed. However, even in countrieswhere indigenous breeds are included in AIprogrammes, the balance appears to favour exotics.One report indicates that 94.1 percent of AI serviceswere carried out using the semen of exotic breeds(Botswana CR). One report notes considerable useof AI to introduce exotic germplasm into thebreeding of race horses (Senegal CR). The use of AIby smallholders is largely restricted to dairyproducers and is concentrated in peri-urban areas.A small number of CRs mention efforts to promote awider diffusion of the technology, including lesseasily accessible areas.

There is considerable variation from country tocountry in terms of the development of facilities andhuman resources for the implementation of AIprogrammes, in terms of the availability of servicesto the farmer, and in terms of the providers involvedin service delivery. The public sector is the mostfrequently reported provider of AI services. Amongthe 27 reports providing information on serviceproviders, 26 mention the public sector and12 mention private companies. NGOs arementioned as providers of AI services by 8 CRs,while breeders’ organizations are mentioned in2 reports (Burkina Faso and Madagascar). TheCR from Niger mentions collaboration between twoItalian universities, a local university and a localresearch station in establishing an AI programme

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


for cattle. The CR from Zambia indicates thatindividual private farmers have imported exoticsemen for the purposes of improving their cattleherds.

Several countries report that problems with thefinancing of government services are a constraint tothe provision of AI. Increased involvement by theprivate sector is noted as an objective in severalCRs. A few countries are able to report significantprogress in this direction (for example, Kenya CR,Zambia CR). The CR from Zambia notes that theprivate sector has taken the lead in providingimported semen, while the government trains andsupervises A.I. technicians. However, as the abovefigures indicate the role of the private sector appearsto be limited or absent in most countries. FewCRs discuss constraints to the involvement of theprivate sector in any detail. However, the CR fromCôte d’Ivoire reports that the single private operatorin the country had ceased activities as a result offinancial difficulties.

Five countries (Côte d’Ivoire, Kenya,Madagascar, Zambia, and Zimbabwe) report theuse of embryo transfer (ET) technologies. Use of thetechnology appears to be limited. In one country, thetechnology is reported only to have been used onHolstein-Friesian cattle on a single private farm(Madagascar CR). The CR from Côte d’Ivoire notesthat some individual cattle owners have introducedBrazilian Zebu genetic material through the importof frozen embryos. In Zimbabwe, the technology isavailable through two private breeding companies(Zimbabwe CR). Several CRs state that theintroduction of ET is an objective. However, thespecific role that the technology could be expectedto play in the management of genetic resources inthe local production systems is rarely elucidated.There is a lack of discussion of how it could beintegrated within organized breeding programmes.The potential use of the technology for purposes ofcryoconservation is, however, noted in several CRs.Very few countries report the use of otherbiotechnologies. Molecular genetic evaluation anddistancing studies in cattle are each mentioned intwo CRs.

Asia

Among the Asian CRs 19 out of 22 countriesproviding information indicate the use of AI. From18 countries providing details of the speciesinseminated, 17 mention cattle, 8 pigs, 5 buffaloes,4 sheep, 3 chickens, 2 goats, 2 horses, and 1 camelsand 1 ducks. Details of the breeds used as the

source of semen are limited. However, in the case ofcattle 8 CRs indicate the use of semen from bothlocal and exotic breeds, 4 mention only exoticbreeds, and 2 mention only local breeds. Provisionof AI services appears to be dominated by the publicsector. Of 17 reports giving details of serviceproviders, all 17 mention the public sector, with6 mentioning the private sector, 5 breeders’organizations 4 NGOs and 1 universities. There ismuch variation from country to country in theextent to which AI is used. In an industrializedcountry such as Japan, almost all cattle breeding(99.4 percent in dairy herds and 97.8 percent in beefherds) is carried out using AI (Japan CR). In mostother Asian countries, services are much morelimited and tend to be focused on the dairy sectorand peri-urban production systems. Several reportsindicate that service coverage is limited by financialand technical constraints. Indeed, a few reportsindicate a decline in the use of the technology.

The desire to establish or to increase theavailability of AI services is expressed as anobjective in many reports. In a number of countriesAI has served as a means of introducing exoticgermplasm for the purposes of cross-breeding withlocal breeds. The technology has been used in thedevelopment of synthetic breeds incorporating bothexotic and indigenous genes, an example being theJermasia goat (Malaysia CR). In some cases, AI hasalso been used to upgrade cross-breeds back toindigenous breeds through back-crossing topromote hardiness. This approach has beenapplied, for example, using Kedah-Kelantan semenin cattle herds introduced to tree plantations(Malaysia CR). In some cases, AI services supplysemen from indigenous breeds, for example Sahiwalcattle (Pakistan CR). However, the same CRindicates that the collection of semen from someother indigenous cattle breeds was discontinuedbecause of a lack of demand.

Eight out of 17 Asian countries providinginformation on the matter indicate some use ofET technology. Among the 6 countries providingdetails of the species in which the technology isimplemented, 6 mention cattle, 2 buffaloes, 1 horsesand 1 goats. The breeds involved are rarely detailed,but one report mentions the transfer of embryosfrom indigenous cattle breeds and one mentionsexotic breeds. In most countries ET is used on a verylimited scale and is often largely confined toresearch. One CR indicates that although capacityto use the technology was previously developed ithas now been abandoned. ET technology was usedin the development of the Mafriwal cattle breed(Malaysia CR). The potential role of the technology

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

7


Pilling et al.

in cryoconservation programmes is noted in severalCRs.

Eight out of 16 Asian countries providinginformation on the matter report the use ofmolecular genetic technologies. Among thesecountries, 6 specify genetic distancing studies, and2 mention marker assisted selection. Among the7 countries providing details of the species involvedin molecular evaluation studies, 6 mention cattle,5 chickens, 4 sheep, 4 goats, 4 pigs, 3 buffaloes,2 ducks, 2 horses, 1 camels, 1 deer, 1 quail and1 guinea fowl. In the case of distancing studies,among the 5 countries providing details of thespecies involved, 4 mention chickens, 3 cattle,3 sheep, 3 goats, 2 pigs, 2 buffaloes, 2 horses,1 ducks, and 1 deer. With regard to the breedsinvolved in molecular genetic studies, systemizedstudies on Asian breeds are being conducted by theSociety for Research on Native Livestock in Japan,including analysis based of genetic relationshipsbased on mitochondrial DNA polymorphisms andother DNA markers (Japan CR). Native Japanesebreeds covered by the studies include Mishimacattle and Kuchinoshima feral cattle (ibid.).

Other biotechnologies are very largely restrictedto the most industrialized countries in the region.The use of in vitro fertilization is mentioned in twoCRs. The Japan CR indicates that a number of otherreproductive biotechnologies with potential for usein the propagation of rare breeds, as well ascommercial applications, have been utilized at anexperimental level. The technologies include spermmicroinjection to fertilize eggs – applied in pigs;primordial germ cell (PGC) and chimera germlinetechniques – applied in chickens; and cloningtechnologies used in cattle, pigs and goats (ibid.).

Europe

Thirty eight of 39 European countries report the useof AI. All 38 mention the use of the technology incattle, 23 in pigs, 16 in sheep, 9 in horses, 8 in goats,2 in rabbits, and in 1 chickens. Most countrieswhich give details report using semen from bothlocal and imported breeds of cattle, pigs and sheep.While most countries are able to report the existenceof some AI provision, there is great variationbetween countries in the extent to which thetechnology is utilized. In many countries,particularly in western Europe, AI is widelyavailable and used throughout the livestock sector,most notably in dairy cattle. However, a number ofCRs from eastern Europe and the Caucasus, wherethe livestock sector has often faced considerableproblems and declining populations, indicate that

capacity to provide AI services is severely limited asa result of the disintegration of formerly existinginfrastructure.

A range of providers are involved in the deliveryof AI services. Of the 32 countries giving details ofproviders, 24 mention the private sector, 20 thepublic sector, 19 breeders’ organizations and3 universities. In eastern Europe and the Caucasus,services where they are available, are more likely tobe provided by the public sector. Conversely,elsewhere in the region, the private sector andfarmers’ organizations are the most frequentlymentioned service providers, although in manycountries there is still considerable involvement orsupport from the public sector. Transfer of servicesto the private sector has not always been withoutproblems; the CR from Romania reports thatreogranization and greater independence of AIinstitutes, along with the introduction of servicecharges, led to a decline in uptake.

In some countries, AI using imported semen hasbeen widely used to increase the productivity oflocal breeds. However, some concerns are raised inthe CRs. Attempts to upgrade local livestock usingexotic semen have sometimes failed because theresulting cross-bred animals have proved to bepoorly adapted to the local conditions. There is alsoa potential threat to genetic resource diversity.According to the CR from Greece, inappropriate andunplanned use of AI contributed markedly to theloss of some indigenous breeds.

Sixteen of the 25 countries providinginformation on the matter report the use of ET. Ofthe 11 countries providing details of the speciesinvolved, all 11 mention cattle, 3 sheep, 2 goats,1 pigs, 1 horses and 1 rabbits. Where specified, ET iscarried out using embryos from both imported andlocal breeds of cattle. Again, it is the dairy industrywhich is the main user of the ET. The technologyhas contributed significantly to increasing the rateat which increased productivity has been achievedthrough selective breeding. However, as a result ofthe costs involved in the utilization of thetechnology it is less widely used than AI, and insome countries ET programmes have ceased as aresult of the high costs. In the case of ET, out of8 countries providing details of service providers,4 mention the private sector, 4 the public sector,4 breeders’ organizations and 3 universities. Otherreproductive technologies such as embryo sexing,cloning and transgenetics are mentioned in a veryfew CRs as subjects for research.

Twenty-four out of 29 CRs providinginformation on the matter indicate the use ofmolecular genetic technologies. Marker assisted

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


selection, for example, is used in commercial animalproduction in a number of European countries. Thetechnology can be applied to eliminate a number ofundesirable traits related to health or fertility fromlivestock populations and to assist selectivebreeding for greater productivity. The importance ofensuring that information on such newtechnologies, including their economic benefits, aremade available to farmers and breeders’organizations is noted in one report (Hungary CR).Another report highlights the prospect thatmolecular biological methods will facilitate thediscovery of genes for economically important traitsin locally adapted breeds, thereby enhancing theirvalue in breeding programmes (Germany CR).However, the same report raises the concern that theuse of molecular technologies in the context ofmarket-driven attempts to increase productivitycould exacerbate a trend towards inbreeding andloss of genetic diversity within livestockpopulations. Similar apprehensions are expressedin a small number of other reports. Geneticdistancing studies are considered important fromthe point of view of planning and prioritizingconservation efforts. One CR, however, notes thatprogress to this end has been limited as interest inthe subject is largely restricted to universities, andfunding is limited (Belgium CR). Another reportputs forward a potential commercial role for suchtechniques in relation to the development of nicheproducts and the marketing of livestock breeds onthe grounds of their close association with aparticular geographical location (France CR).

Among the CRs providing details of the use ofmolecular technologies, 11 specify theimplementation of molecular genetic distancingstudies and 7 mention the use of marker assistedselection. Out of 17 countries providing informationon the species involved in molecularcharacterization studies, 14 mention cattle,13 sheep, 11 pigs, 8 horses, 5 goats, 3 chickens,1 donkeys, 1 turkeys and 1 geese. Out of12 countries providing information on the speciesinvolved in distancing studies, 11 mention sheep,9 cattle, 5 horses, 4 pigs, 3 chickens, 3 goats, 2 geese,1duck, 1 donkeys, 1 rabbits, and 1 deer. Out of4 countries providing information on the species onwhich marker assisted selection is practised,4 mention cattle, 4 pigs, 1 chickens and 1 horses.Details of the specific breeds to which technologieshave been applied are quite limited in the CRs.Among the local breeds for which molecularcharacterization or distancing studies arementioned in the CRs are the Turoplje and BlackSlavonian pigs, Ruda sheep, sheep of the islands of

Rab, Pag and KrK (Croatia CR); Wallachian andSumava sheep, Brown goats and White goats(Czech Republic CR) and the Karakachanska sheep(Former Yugoslav Republic of Macedonia CR).

Latin America and the Caribbean

AI is widely practised in the countries of this region.Twenty-one out of 22 countries indicate the use of thetechnology. All 21 countries report the use of AI incattle, 13 mention pigs, 8 sheep, 8 goats, 5 horses, 1rabbits, 1 buffaloes, 1 donkeys 1 llamas, 1 alpacasand 1 turkeys. With regard to the cattle breedsproviding the semen used for AI, 13 reports mentiononly exotic breeds, while 4 mention both local andexotic. In the cases of sheep, 5 reports mention exoticbreeds and 1 mentions both exotic and local; and inthe case of pigs, 9 CRs mention only exotic breedswhile one mentions both local and exotic. It is clearthat the predominant objective is to increase the geneticmerit of livestock populations using semen from exoticbreeds. In many countries, semen is imported fromoverseas. Use of the technology is most common inthe dairy sector. In some countries it is also quitewidely used by commercial producers of beef cattle,pigs and small ruminants. However, there is markedvariation between countries and between productionsystems in terms of the extent to which AI is used. Inmany small-scale or low external input systems, useof the technology is very limited. A number ofcountries indicate that improving the provision of AIservices is an important objective. A small number ofreports, however, mention concerns regarding thedecrease of genetic diversity arising as a result of theinappropriate use of AI. With regard to the providersinvolved in the delivery of AI services, the private sectorplays an important role in this region. Of 17 reportsgiving details of service providers, 11 mention thepublic sector, 9 mention the private sector, and5 breeders’ organizations.

ET technology is increasingly being used bycommercial livestock producers in several countriesof the region. Twelve reports, out of 14 providinginformation, report the use of ET. All 12 mention theuse of the technology in cattle, 3 in horses, 2 ingoats, 2 in sheep, 1 in llamas, 1 in alpacas and 1 indonkeys. Transplanted embryos largely come fromexotic breeds – the six countries that provideddetails of the cattle breeds involved indicate the useof embryos only from exotic breeds. As in the case ofAI, though on a more limited scale, use of ETtechnology is dominated by the dairy industry, withrestricted use in other types of commercial livestockproduction. Some CRs indicate the importation ofembryos from overseas. Information on the

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

9


Pilling et al.

providers of ET services is limited. However, twoCRs (Brazil and Chile) mention private sectororganizations involved in the provision of thetechnology. Additionally, two CRs indicate somecommercial use of in vitro fertilization, while onementions the development of embryo sexing andcloning technologies.

Eleven countries, out of 15 providinginformation, indicate some use of molecular genetictechnologies. With regard to molecularcharacterization studies, out of 9 countriesproviding information on the species involved,7 mention cattle, 3 sheep, 3 pigs, 2 chickens,2 horses, 1 goats, 1 buffaloes, 1 llamas, 1 alpacas,1 vicuñas, 1 guanacos and 2 unspecified camelids.Several countries indicate that locally adaptedbreeds have been included in such studies. TheCR from Peru mentions molecular investigations ofthe genetic distances between South Americancamelid species. Few reports, however, indicate thatmolecular technologies have been incorporated inbreeding programmes. The Colombia CR notes thepotential significance of marker assisted selectionprogrammes utilizing the genes of the BlancoOrejinegro cattle breed, which is reported to showresistance to brucellosis, and which has been theobject of molecular characterization studies.

Near and Middle East

In this region all six countries providinginformation on the matter report the use of AI. Withregard to the species involved, all 6 mention cattle,1 camels and 1 rabbits. One CR mentions the use ofET in camels (Oman CR). The semen used in AIprogrammes is largely obtained from exotic breeds,either from local populations or imported. Anumber of CRs note that the use of AI has had anadverse effect on genetic diversity and contributedto the decline of local livestock breeds. OneCR indicates some use of semen from a local cattlebreed (Syrian Arab Republic CR). SomeCRs indicate that the development of AIprogrammes for local breeds of sheep, goats and/orbuffaloes is a priority. The CR from the Syrian ArabRepublic, for example, notes that the local Awassisheep and Shami goats are much sought after inneighbouring countries for breeding, and that plansare in hand to develop AI and ET programmes tomeet the demand. Among 6 countries givinginformation on service providers, 5 mention thepublic sector, 4 the private sector and 2 breeders’organizations. Some reports, however, indicateconstraints to the provision of AI, such as a lack oftrained personnel. Several reports note the potential

use of AI and ET technologies in cryoconservation.The use of other biotechnologies is limited. Onereport (Jordan CR) indicates molecularcharacterization and genetic distancing studies inindigenous goats, while another (Egypt CR) notesthat molecular genetic studies of buffalo, sheep andgoats have recently been initiated with the aid ofregional and international organizations.

North America

In the United States of America and Canadareproductive biotechnologies are readily available.AI is widespread in the dairy and pig industries,and is used to a lesser extent in other sectors suchas beef cattle and small ruminants. Concern isexpressed at the role of AI in contributing to areduction in the effective population size of somedairy cattle breeds. Details of the utilization of otherbiotechnologies are limited in the CRs from thisregion. In the United States, molecularcharacterization studies have been carried out, bythe industry and public sector institutions, for themost widely kept breeds of dairy cattle and pigs,and also in a number of beef cattle breeds (UnitedStates CR). Molecular markers are particularly usedfor the identification of recessive defects in bullsused for AI. Molecular studies, providing measuresof within and between breed genetic diversity, arealso used by the National Animal GermplasmProgram (NAGP) in the planning of conservationprogrammes for livestock genetic resources (ibid.).

Southwest Pacific

Biotechnologies are not widely used in this region.Six of the 11 CRs indicate the use of AI. Out of5 countries indicating the species involved inAI programmes, 5 mention cattle, 4 pigs, 1 sheepand 1 goats. With regard to AI service providers,2 reports mention the public sector, 2 the privatesector and 1 mentions an individual volunteer froma developed country. Several reports from smallisland countries note the potential of AI as a meansof introducing exotic germplasm, but the use of thetechnology appears to be limited. In some countriesa small number of private livestock producers areinvolved in the import of semen for the purposes ofAI in their herds. Two countries (Australia andVanuatu) indicate the use of ET technology, bothreports referring to cattle. Additionally, the CR fromSamoa notes the use of the technology for theintroduction of the Piedmontese breed during the1980s. Capacity for the use of biotechnologies is

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


well developed in Australia, which is the onlycountry from the region reporting the use ofmolecular genetic techniques to underpincharacterization and selection efforts(Australia CR).

Discussion

The information provided by theCRs unsurprisingly indicates that there is a largegap between developed and developing countries interms of their capacity to make use ofbiotechnologies in the management anddevelopment of livestock genetic resources. Somelivestock production systems in a number of SouthAmerican countries are, however, relatively wellable to access biotechnologies as compared to otherdeveloping-country systems.

In the developing countries, AI is the mostcommon technology used. A probable reason is thatAI has the most favourable cost-benefit ratio of thereproductive biotechnologies (Thibier et al., 2004)and also requires comparatively less technical skilland equipment. However, in Africa and in theSouthwest Pacific even AI is not practised in allcountries. Constraints to the development andutilization of biotechnologies in general include alack of financial, human and technical resources.Moreover, the provision of services such as AI oftenhas to overcome difficulties relating to access,affordability, farmer awareness and knowledge,and the need to tailor services to the needs oflivestock keepers within diverse local productionsystems. In the case of more complex technologiessuch as ET the constraints are magnified to an evengreater extent. The use of reproductivebiotechnologies is most widespread in cattle. Thelow natural reproductive rate of cattle increasesmotivation to develop and utilize technologieswhich allow the rate of genetic improvement to beincreased (FAO, 1996). Moreover, the high value ofthe animals makes expenditure on AI or ET moreeconomically attractive. The technical ease ofdeep-freezing semen and embryos is also highest incattle (Hiemstra et al., 2005). However, the findingmay also reflect the general pro-cattle bias whichhas been observed in livestock development efforts(FAO, 1993). With regard to the breeds involved,there are only a limited number of examples in theCRs of programmes which make use ofbiotechnologies to facilitate the development,utilization or conservation of locally adaptedbreeds.

While the expansion of the use ofbiotechnologies is clearly considered to be animportant objective, many CRs express concernregarding the inappropriate use of AI. Concernslargely relate to the unplanned use of thetechnology to introduce exotic germplasm, whichmay threaten the existence of indigenous geneticresources. With regard to productive breeds keptunder high external input conditions, someconcerns are also expressed with regard to anarrowing of the genetic resource base. As such,there is a need for careful attention to be given toidentifying appropriate policies, programmes andregulatory frameworks for the use ofbiotechnologies in the management of livestockbreeding and reproduction. Such deliberationsrequire good knowledge of the characteristics of therelevant genetic resources, an understanding of theproduction systems in question, and considerationof the above-mentioned constraints to servicedelivery.

Molecular genetic studies offer a potentiallyimportant tool for the characterization of livestockgenetic resources. However, the use of moleculartechniques to evaluate genetic resources, to plan ofconservation efforts, or to facilitate the achievementof desired breeding objectives is limited or absent inmost developing countries. A desire to developgreater capacity to conduct molecular geneticstudies is expressed as a priority in many CRs.However, the successful application of technologiessuch as marker assisted selection necessitates ahigh level of expenditure in terms of establishmentand maintenance costs, and requires skilled humanresources, equipment, laboratories and supportiveinfrastructure (FAO, 2005). As such, the cost-effectiveness of strategies based on the use of thetechnologies has to be carefully evaluated.

The desire to make greater use of biotechnologiesto raise livestock productivity and increase thesupply of livestock products is widely expressed inthe CRs from developing countries. In a number ofregions, there is increasing diversity in terms of thestakeholders providing services, with greaterinvolvement of the private sector andbreeders’ organizations. However, the extent towhich such developments will overcome theconstraints to the utilization of biotechnologies indeveloping countries is not clear. It is evident fromthe CRs that in this respect, progress is often verylimited. A widespread use of biotechnology ishindered by the gaps in infrastructure, markets,breeding capacity, input delivery systems andextension services, which hinder all efforts topromote livestock development in poor, remote

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

11


Pilling et al.

areas (FAO, 2004). As such, many of those mostdependent on livestock to support their livelihoodsare denied the option of utilizing biotechnologies asa means of developing animal genetic resources tomeet their needs. However, there is also concernthat the potential of biotechnology to make asubstantial contribution to poverty reduction isoverrated in relation to livestock production (Bayer,2005).

In contrast to the research that drove the GreenRevolution, the majority of agriculturalbiotechnology research and commercialization isbeing carried out by private firms based inindustrialized countries (FAO, 2004). This isevident in the production of genetically modifiedcrops but also in the concentration of the market inthe hands of a small number of breeding companiesin the poultry sector, a development which seems tobe followed in the pig industry. The dominance ofthe private sector in the “gene revolution” raisesconcerns that farmers in developing countries,particularly poor farmers may not benefit, or indeedmay lose out, either because innovations are notaccessible, are too expensive, or are inappropriate totheir needs.

Conclusions

It is evident that there are numerous constraints andpitfalls to be overcome if reproductivebiotechnologies are to make a significant positivecontribution to the management of animal geneticresources in developing countries. Investment ininfrastructure, and human and technical capacitybuilding is required; and this desire is clearlyexpressed in many CRs. However, it is alsoessential that increased utilization of thetechnologies is well planned, has clear objectivesand takes account of local conditions. To this end,improved characterization of breeds andproduction environments is required. Betterunderstanding is vital to ensure that the more rapidgenetic change made possible by biotechnologies isactually beneficial to livestock keepers and society,and that threats to genetic diversity are minimized.Biotechnologies will contribute little to geneticimprovement unless calls for their introduction areaccompanied by a vision of how they can beincorporated within targeted breed developmentprogrammes. Few programmes capable ofincorporating the more advanced biotechnologiesinto livestock genetic improvement activities exist indeveloping countries at present. The situation isunlikely to change without significant public aswell as private sector investment.

Constraints to the delivery, uptake andsuccessful application of biotechnologies indeveloping-country conditions need to beaddressed. Consideration should be given to anyaccompanying improvements to animal health,nutrition and management which may be necessaryto achieve the desired outcomes. As well asconsidering impacts on genetic diversity, the shortand long-term socio-economic implications ofpromoting the increased use of biotechnologies bysmall-scale producers also need to be assessed.Potentialities, constraints and problems related tothe roles of alternative service providers requireinvestigation. Livestock keepers, their associations,and relevant NGOs should be involved in theprocess of setting priorities for biotechnology use,the organization of breed development programmes,and in resolving problems associated with theprovision of biotechnology services.

List of References

Bayer, W. 2005. Poverty and biotechnology -putting things in perspective. In 4th All AfricaConference on Animal Agriculture and 31st AnnualMeeting of the Tanzania Society for AnimalProduction. (Plenary Session 1: Biotech inagriculture – challenges and opportunities),Arusha, Tanzania, September 20-24, 2005, pp. 1.

Cardellino, R., I. Hoffmann &K.A Tempelman. 2005. First Report on the State ofthe World’s Animal Genetic Resources. In Makar,H.P.S., & G.S. Viljoen, (Eds). Applications ofGene-Based Technologies for Improving AnimalProduction and Health in Developing Countries,Springer, Dordrecht, pp. 89-98.

Delgado, C., M. Rosegrant, H. Steinfeld,S. Ehui & C. Courbois. 1999. Livestock to 2020: Thenext food revolution. Food Agriculture and theEnvironment. Discussion Paper No. 228.International Food Policy Research Institute (IFPRI),Washington.

FAO. 1993. Investment for sustainablelivestock development in developing countries, byM.J. Walshe In S. Mack (Ed.). Strategies forsustainable animal agriculture in developingcountries, Proceedings of the FAO Expert

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Consultation held in Rome, Italy 10-14 December1990, Animal Production and Health Paper,No. 107. FAO, Rome.

FAO. 1996. Biotechnology options forimproving livestock production in developingcountries, with special reference to sub-SaharanAfrica, by J.E.O. Rege, In S.H.B. Lebbie & E. Kagwini,(Eds). Small Ruminant Research and Developmentin Africa, Proceedings of the Third BiennialConference of the African Small Ruminant ResearchNetwork UICC, Kampala, Uganda, 5-9 December1994. FAO, Rome.

FAO. 2001. Preparation of the first report onthe state of the world’s animal genetic resources.Guidelines for the preparation of CRs. FAO, Rome.

FAO. 2004. The State of Food and Agriculture2003–04. Agricultural Biotechnology - meeting theneeds of the poor? FAO, Rome.

FAO. 2005. Biotechnology potential insupport of rural development: pros & cons. Paperprepared for the Twenty-Eighth FAO RegionalConference for the Near East, Sana’a, Republic ofYemen, 12–16 March, 2006. FAO, Rome.

Hiemstra, S.J., T. van der Lende &H. Woelders. 2005. The potential ofcryopreservation and reproductive technologies foranimal genetic resources conservation strategies. InThe role of biotechnology for the characterisationand conservation of crop, forestry, animal andfishery genetic resources. Proceedings of aworkshop (FAO, EAAP, ASPA, ECONOGENE),Turin, Italy, 5-7 March 2005. FAO, Rome. pp. 25-35,www.fao.org/biotech/docs/hiemstra.pdf .

Thibier, M., P. Humbolt & B. Guerin. 2004.Role of reproductive biotechnologies: globalperspective, current methods and success rates, InG. Simm, B. Villanueva, K.D. Sinclair & S.Townsend (Eds), Farm Animal Genetic Resources.British Society for Animal Science, Publication 30,Nottingham University Press, Nottingham, UnitedKingdom, pp. 171-189.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

13


Pilling et al.

Appendix 1. Distribution of countries by region (and dates whencountry reports were completed)

Africa: Algeria (October 2003), Angola (May 2004), Benin (July 2003), Botswana (November 2003), BurkinaFaso (May 2003), Burundi (December 2003), Cameroon (February 2003), Cape Verde (January 2003), CentralAfrican Republic (June 2003), Chad (April 2003), Comoros (March 2005), Congo (April 2003), DemocraticRepublic of the Congo (January 2005), Côte d'Ivoire (March 2003), Equatorial Guinea (May 2003), Eritrea(July 2003), Ethiopia (July 2004), Gabon (March 2003), Gambia (January 2003), Ghana (October 2003), Guinea(April 2003), Guinea-Bissau (July 2002), Kenya (June 2004), Lesotho (April 2005), Madagascar (March 2003),Malawi (April 2004), Mali (September 2002), Mauritania (February 2004), Mauritius (August 2004),Mozambique (March 2004), Niger (May 2003), Nigeria (March 2004), Rwanda (May 2004), Sao Tome andPrincipe (May 2003), Senegal (April 2003), Swaziland (December 2004), Togo (March 2003), Tunisia(December 2003), Uganda (February 2004), United Republic of Tanzania (October 2004), Zambia(November 2003), Zimbabwe (May 2004).

Asia: Bangladesh (June 2004), Bhutan (September 2002), Cambodia (August 2003), China (June 2003), India(December 2004), Indonesia (August 2003), Iran (Islamic Republic of) (July 2004), Japan (April 2003),Kazakhstan (December 2003), Kyrgyzstan (November 2003), Laos (May 2005), Malaysia (August 2003),Maldives (September 2004), Mongolia (September 2002), Myanmar (March 2004), Nepal (January 2004),Pakistan (March 2003), Papua New Guinea (November 2004), Philippines (August 2004), Republic of Korea(March 2004), Sri Lanka (August 2002), Tajikistan (December 2003), Turkmenistan (August 2004), Uzbekistan(August 2003), Viet Nam (April 2003).

Europe: Albania (December 2002), Armenia (June 2003), Azerbaijan (December 2003), Belarus (2003), Belgium(January 2005), Bosnia and Herzegovina (2003), Bulgaria (March 2004), Croatia (July 2003), Cyprus(October 2003), Czech Republic (July 2003), Denmark (April 2004), Estonia (March 2004), Finland(January 2004), France (June 2004), Georgia (February 2004), Germany (June 2003), Greece (February 2004),Hungary (June 2003), Iceland (December 2003), Ireland (July 2003), Latvia (December 2003), Lithuania(November 2003), Netherlands (November 2002), Norway (December 2002), Poland (October 2002), Portugal(June 2004), Moldova (December 2004), Romania (December 2003), Russian Federation (December 2003),Serbia and Montenegro (March 2003), Slovakia (June 2003), Slovenia (June 2003), Spain (June 2004), Sweden(September 2002), Switzerland (December 2002), The Former Yugoslav Republic of Macedonia(November 2003), Turkey (August 2004), Ukraine (February 2004), United Kingdom (November 2002).

Latin America and the Caribbean: Argentina (September 2003), Barbados (January 2005), Bolivia(January 2004), Brazil (February 2004), Chile (December 2003), Colombia (October 2003), Costa Rica (June 2004),Cuba (March 2003), Dominican Republic (March 2004), Ecuador (December 2003), El Salvador(December 2003), Guatemala (April 2004), Haiti (October 2004), Honduras, Jamaica, Mexico (July 2002),Nicaragua (August 2004), Paraguay (June 2004), Peru (May 2004), Trinidad and Tobago (May 2005), Uruguay(December 2003), Venezuela (Bolivarian Republic of) (December 2003).

Near and Middle East: Egypt (June 2003), Iraq (January 2003), Jordan (March 2003), Oman (March 2004),Sudan (January 2004), Syrian Arab Republic (May 2003), Yemen (November 2003).

North America: Canada (February 2004), United States of America (December 2003).

Southwest Pacific: Australia (November 2004), Cook Islands (October 2003), Fiji (March 2004), Kiribati(March 2004), Northern Mariana Islands (February 2004), Palau (2003), Samoa (March 2004), Solomon Islands(February 2004), Tonga (January 2005), Tuvalu (January 2005), Vanuatu (December 2003).

asdg

15

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 15-32

Summary

On-farm surveys and characterisation of sixindigenous north Ethiopian cattle breeds (Afar,Arado, Begait, Fogera, Medenes and Raya) wascarried out with the objective of determining thecurrent status of these breeds. Information from astructured questionnaire distributed to 450 farmers,37 group discussions, field measurements of heartgirth and height on 25 males and 25 females fromeach breed and secondary information were used tocarry out the study. Population size of the Aradobreed increased by more than three fold between1992 and 1999, while the Raya, Fogera and Begaitpopulation decreased by 57, 27 and 67%; between1981 and 1999 respectively. Three distinctive typeswere identified within the Afar and Begait breedswith different adaptation and threat levels inrelation to changes to the bio-physical and socialenvironment. Overall production and reproductionperformance of the breeds in the pastoralproduction system (Afar and Begait) was higherthan the Raya and Medenes, and Arado and Fogerabreeds of the agro-pastoral and mixedcrop/livestock production systems respectively.Extinction probability for most of the breeds washigh, the highest (0.67) being for the Begait breed.On the other hand, except for the initiative taken toevaluate, improve and conserve the Fogera breed atthe Metekel and Andasa cattle breeding ranches,there are no institutionalized attempts towardsimproving and/or conserving the other breeds.

Resumen

Se llevó a cabo una serie de encuestas sobre elterreno sobre caracterización de seis razas bovinasindígenas del norte de Etiopía (Afar, Arado, Begait,Fogera, Medenes y Raya) con el objetivo dedeterminar la situación actual de estas razas. Seutilizó la información proveniente de uncuestionario estructurado distribuido a450 ganaderos, 37 grupos de discusión, medidas

The status of cattle genetic resources in North Ethiopia: On-farmcharacterization of six major cattle breeds

M. Zerabruk, O. Vangen & M. Haile

Department of Animal and Aquacultural Sciences, Norwegian University of Life Sciences,P.O.Box 5003, 1432 Aas, Norway

tomadas sobre el terreno de circunferencia torácicay altura de 25 machos y 25 hembras de cada razaasí como información secundaria utilizada para elestudio. El tamaño de la población de la raza Aradose incrementó por más de tres veces entre 1992 y1999, mientras que las razas Raya, Fogera y Begaitdisminuyeron de 57, 27 y 67%, respectivamente,entre 1981 y 1999. Se identificaron tres tiposdiversos entre las razas Afar y Begait con diferenteadaptación y niveles en relación a los cambiosbiofísicos y de entorno social. La producción globaly rendimiento de reproducción de las razas Afar yBegait en el sistema pastoral fue superior al de lasrazas Raya y Medenes, y de las razas Arado yFogera en sistema agropastoral y mixto en sistemasde agricultura/ganadería. La probabilidad deextinción para muchas de las razas fue elevada, lamayor (0,67) correspondía a la raza Begait. Por otraparte, salvo por las iniciativas tomadas para laevaluación, mejora y conservación de la raza Fogeraen la zona de Metekel y Andasa, no existen intentosinstitucionalizados con el objetivo de mejorar y/oconservar las demás razas.

Keywords: Cattle, Genetic resource, On-farm,characterization, Ethiopia, Extinction, Afar, Arado,Begait, Fogera, Medenes, Raya.

Introduction

Cattle production has been a crucial part of theproduction and livelihood systems of the northEthiopian population as providers of food, draughtpower and as important hedge during crop failureand drought periods, accumulation of assets andother socio-cultural functions. The north Ethiopianregion has been a centre of some of the longest civilwars in Africa and this has led among other things,to the accelerated destruction of eco-systems andnatural resource degradation resulting in recurrentdrought and famine.

There have been little or no efforts exerted tostudy the animal genetic resources in general and

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

16Characterization of six cattle breeds in North Ethiopia

cattle breeds in particular that have been utilised inthe different production systems of the region,which are believed to have close to 50% of thegenetic diversity in the country. Due to the fact thatthere have been major socio-political (civil wars andurbanization) and environmental (drought anddestruction of ecosystems) changes in the last25 years, useful information such as populationsizes on most of the cattle breeds is not availableand unfortunately most studies seem to have usedbreed population data that are too old to describethe current status of animal genetic resources in theregion.

A recent estimate of extinction probability for49 African breeds (Reist-Marti et al., 2003) showedthat half of the cattle diversity in Africa will be lostin the next 20-50 years if no conservation efforts aremade.

The objective of this paper was therefore toprovide information on the current status, threat ofextinction and on-farm characterisation of the Afar,Raya, Arado, Begait, Medenes and Fogera breedsfound in north Ethiopia based on an on-farmcharacterisation and field measurement.

Materials and Methods

Study area and data collection

The present survey was carried out in six majorbreeding areas of the six breeds studied: thenorthern part of the Afar region for the Afar breed;central, southern and western zones of Tigrayregion for the Arado, Raya, Medenes and Begaitbreeds respectively; Bahirdar Zuria zone, Andasaand Metekele cattle breeding centres of the Amhararegion for the Fogera breed (Figure 1).

The survey was conducted in four villages of theAlamata district of south Tigray (Kelkala,Selienwuha, Fatcha and Gerjele), four villages of theAhferom district in central Tigray (Igella,Gerhusernay, Semhal and Irdijeganu), three villagesof Tahtayadiabo district in west Tigray (Aditsetser,Adiaser, Maykuhli and Gemhalo), four villages ofthe Abala district, North Afar region (Kala,Weqrigubi, Irebti and Irkudi) and three villages inthe Bahirdar Zuria district Amhara region(Kidisthana, Wagtera and Shada) and two cattlebreeding centres (Andasa and Metekel).

Afar Raya Arado Begait &Medenes Fogera

Figure 1. Geographical location of the study and major breeding areas

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

17


Zerabruk et al.

Villages for this study were selected based oninformation from the respective regional offices ofthe Ministry of Agriculture, while cattle owners inthose villages were selected randomly. Two cattlebreeding centres (Andasa and Metekel) were alsoincluded.

An average of 75 cattle owners from each breedwere interviewed based on a structuredquestionnaire designed to collect data for each ofthe six breeds studied and formal groupdiscussions were conducted. The questionnaire wasdesigned to collect data on the origin of the breeds,physical descriptors, their main purpose,productive and reproductive performance,management and breeding practices, populationtrends, uniqueness (special traits),farmers’ preference and opinions on comparisons ofthese breeds with other breeds known to the cattleowners. The Arado breed was compared withBegait and Medenes, the Afar breed with Raya andthe Fogera breed was compared with highland zebucattle for 15 traits of economic and adaptiveimportance. The formal group discussions focussedon general issues such as:1. status of the breed;2. breeding management and goals;3. awareness of diversity;4. population trends and major threats to the breed.

Three group discussions with 7-10 farmers ineach group, were conducted in each village.Information on the bio-physical conditions andproduction environment (Table 1) and size of breedpopulation (Table 2) was compiled from reports ofearlier surveys (BoNAR, 1999; FAO DAD-IS, Haileand Kebede, 1996; Tekleab, 2000; Rege, 1999; Regeand Tawa, 1999; Woldu, 1999). A questionnairedeveloped for an on-farm characterization of otherbreeds (Zerabruk and Vangen, 2005) was used inthe present study.

Height at withers and heart girth measurementsof 25 males and 25 females of each breed wererecorded and pictures were taken fromrepresentative animals. Adult body weight wasestimated from heart girth measurements (Daltonssupplies Ltd).

Cattle breeds

Six major breeds found in north Ethiopia - the Afar,Arado, Raya, Begait, Medenese and Fogera - havebeen included in the present study. The Afar andBegait, Raya and Medenes, and Arado and Fogeraare reared in the pastoral, agro-pastoral and mixedcrop/livestock production systems respectively(Table 3).

The Afar breed is mainly found in the north-eastern lowlands of the Afar and adjacent regions ofEthiopia. It is adapted to the arid and semiaridrange land conditions and to the pastoraland/or agro-pastoral way of life of the Afar people.The breed is mainly reared for its milk production(Albero and Hailemariam, 1982; Rege, 1999).

The Raya breed is found in the south-easternlowlands and adjacent part of Tigray region,Ethiopia. It is believed to be a variety of the Afarbreed adapted to the crop/livestock productionsystem of the area. The breed is popular and rearedfor its draught power and meat. The Afar and Rayabreeds belong to the East African sanga breedscluster and are further grouped with the Abyssiniansanga breeds (Rege, 1999).

The Arado breed is found widely distributed inthe northern highlands of Ethiopia and adjacentareas in Eritrea. It is mainly reared for draughtpower. The breed subsists mainly on crop residuesand is well adapted to seasonal feed shortagesassociated with the mixed crop/livestockproduction system in the area (Rege, 1999; Tekleab,2000).The Fogrea breed is found in the surrounding areaof the Lake Tana region and mainly distributedalong the vast area of the Fogera plain, in thenorth-west highlands of Ethiopia. The breed ispopular for its adaptation to seasonal flooding andthe swampy conditions of the area. It is reared for itsdraught and dairy production abilities. The Aradoand Fogera breeds belong to the Zenga group(Zebu-sanga cross-bred) (Albero and Hailemariam,1982; Rege, 1999).

The Medenes breed is a relatively new breed anda result of cross breeding between the Arado andBegait breeds. It is found in the western highlandsof Tigray and is bred for both milk and draughtpurposes (Tekleab, 2000).

The Begait (also known as Barka) breed is foundin the western lowlands of Eritrea and north-west ofEthiopia. Animals of this breed are popularly bredfor milk production and play an important role inthe livelihood of the pastoral and agro-pastoralpeople in the area. The Begait breed belongs to thecluster of the north Sudan Zebu breeds (Albero andHailemariam, 1982; Rege, 1999; Tekleab, 2000).

Extinction probability

Extinction probability for the six cattle breedswithin the next 20-50 years was calculated using amethod described by Reist-Marti et al. (2003) as:

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Tab

le 1

. Cha

ract

eris

tics

of t

he m

ajor

pro

duct

ion

envi

ronm

ent

of s

ix in

dige

nous

cat

tle

bree

ds o

f nor

th E

thio

pia1 .

Bre

ed

Agr

o ec

olog

ical

zon

es

Alt

itud

e m

.a.s

.l M

ajor

veg

etat

ion

type

s D

omin

ant s

oil t

ypes

Pr

oduc

tion

sys

tem

A

far

Hot

to w

arm

ari

d lo

wla

nd p

lain

s <1

400

Bus

hlan

d, r

iver

ine

acac

ia

Solo

ncha

cks/

Fl

uvis

ols

Past

oral

ism

Ara

do

Tep

id to

coo

l sem

i-ar

id m

id

high

land

s 15

00-2

500

Bus

hlan

d a

nd c

ulti

vati

on

Cam

biso

ls/

Lep

tiso

ls

Cro

p/L

ives

tock

Beg

ait

Hot

to w

arm

sem

i-ar

id lo

wla

nds

500-

1500

B

ushl

and

&

gras

slan

d.Ba

llani

tes,

Z

ezip

hus,

Bos

wel

lia, r

iver

ine

Ver

tiso

ls

Past

oral

ism

Foge

ra

Tep

id to

coo

l moi

st m

id-h

ighl

and

s 15

00-2

500

Bus

hlan

d a

nd c

ulti

vati

on

Ver

tiso

ls/L

uvi

sols

/ Fl

uvis

ols

Seas

onal

ly fl

ood

ed

Cro

p/L

ives

tock

Ray

a H

ot to

war

m s

ub-

moi

st lo

wla

nds

500-

1500

B

ushl

and

& c

ulti

vati

on.

Aca

cia,

Bal

lani

tes,

Zez

iphu

s an

d ca

ctus

Ver

tiso

ls/

Flu

viso

ls/

Lep

tiso

ls

Agr

o-pa

stor

alis

m,

Cro

p/L

ives

tock

Med

enes

H

ot to

war

m s

emi-

arid

low

land

s 50

0-20

00

Bus

hlan

d a

nd c

ulti

vati

on

Ver

tiso

ls, C

ambi

sols

A

gro-

past

oral

ism

, C

rop

/Liv

esto

ck

1 Sou

rces

: Hai

le, a

nd K

ebed

e (1

996)

, Wol

du

(199

9).

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

19


Zerabruk et al.

Table 2. Distribution and population size of six indigenous cattle breeds of north Ethiopia.

Breed Village Population size1 Population size2

Raya • Rayaazebo • Alamata • Wajerat • Others

111 019 67 684 23 266 23 709

Total 225 678 521 000 (1992) Arado

Total 1 426 644 440 000 (1992) Begait • Tahtayadiabo

• Kaftahumera • Welqait • Asgedetsimbla • Others

32 132 13 755 10 698

7 328 12 793

Total 76 706 Medenes • Tahtayadiabo

• Asgedetsimbla • Tselemti • Welqite • Tsegede

29 042 23 946

3 838 3 835 3 232

Total 63 893 Begait(Begait and Medenes) N/A 850 000 (1981) Afar N/A 680 590 (1992) Fogera N/A 868 000 (1992)

636 000 (1998) 1(BoNAR, 1999). 2(FAO DAD-IS).

iz = 2.18.0 * 1.0

10

1

+∑=a

iaz

Where is the extinction probability of breed icomputed as the sum of the value of ten variablesrescaled to a value between 0.1 and 0.9.This method compared to other risk assessmentmethods (Rege, 1999; Scherf, 2000), uses a schemewith ten breed specific variables consideredimportant to evaluate the threat of extinction of agiven breed (Table 5). However, one out of the tenvariables used to derive extinction probability(political situation of the country) was modified toreflect the direct impact of war and conflicts onanimal genetic resources rather than the one(“security information for travellers”) used byReist-Marti et al. (2003). Two of the ten variables(population size and population size change) werederived from population size information of alivestock census (BoNAR, 1999) and from theFAO DAD-IS data base. The remaining variableswere derived from information collected in thepresent study.

Result and discussion

Population size and description

Population size and distribution of the breedsstudied are given in table 2. Population data for theRaya, Arado, Begait, and Medenese were obtainedfrom the Tigray regional livestock census report(BoNAR, 1999). Data from the global data base(DAD-IS) was used for the Afar and Fogera breedsfor lack of recent information for comparativepurposes.

Except for the Arado, Medenes and Afar breeds,all interviewed farmers indicated a dramaticdecrease in population size over the past20-30 years. The Raya and Fogera breed populationsizes have decreased by 57% and 27% respectivelybetween 1992-1999, (Table 2).

The situation with the Begait breed is even morealarming. Even if we combine the Begait andMedenes populations in Ethiopia and assume thereis about the same size in Eritrea, the population sizehas decreased by 67% between 1981 and 1999 dueto two major famines in the area in 1984/1985 and

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


1995/1997. According to Sanford and Yohannes(2000) a 72, 60 and 78% decline in cattle populationwas reported for the Afar region during the1972/1974 famine, the 1984/85 famine in theBorena area of south Ethiopia and the 1995/1997famine in Somali and Borena regions respectively. Amore than 70% reduction in population size wasrecorded between May 1999 and May 2000 in thesouthern Somali and Borena regions (Devereux,2000). Currently, the populations of most of thebreeds studied and other small ruminant breeds areunder extreme pressure as a result of increaseddemand for meat from the presence of a hugenumber of army personnel in the northern part ofthe country since the 1998 border war betweenEthiopia and Eritrea.

Afar

Most of the interviewed pastoralists (89%) indicatedthat the Afar breed is native to the region while theremaining 11% believed the breed migrated frompresent day Yemen across the Red Sea. According toresults from group discussions, three distinct typesof the Afar breed namely Bedaeru, Igahiboda and anintermediate between the two have been identified.

The Bedaeru type is described as a relativelysmall sized animal with short horns, higher milkproduction, a tolerance for drought and feedshortages and adaptation to the hot, flat dry landareas of the Bada and Afdera plains of the region.They have mostly a grey or white smooth and shinycoat colour. The population size of this type is small

and is decreasing, according to interviewedpastoralists.

The Igahiboda is a large sized animal with largelyre shaped horns, suited for both the dry lowlandsand adjacent highlands. This type is found inAbala, Megale, Irebti and Berahle of the Afar regionand Raya and Wajerat of the Tigray region. Thistype is phenotypically similar to the Raya breed(Figure 2 and 3).

The intermediate type is medium sized, mostlywith a red coat colour and is found mainly in theDalol and Kuneba areas of north Afar.Nearly all information from interviewedpastoralists and results from the group discussionsindicated that the overall population size of thebreed is increasing due to the availability ofvaccinations against major cattle diseases such asreinderpest, CBPP and anthrax, regardless of thechronic droughts in the area. Moreover, change inthe rangeland condition has favoured cattle rearingcompared to camel and goat production which usedto dominate the pastoral production system (Diress,et al.2003). This change has led cattle breederstowards the development and utilization ofconventional breeding practices (identification,selection, controlled breeding).

Raya

The Raya breed is believed to have originatedmainly in the adjacent parts of the Afar region.93, 5 and 2% of respondents believed the origin tobe from the Afar, the result of introduction following

Table 3. Mean and standard deviation for production, reproduction, body weight1 and height measurement traits in six indigenous cattle breeds of north Ethiopia.

Trait

Afar n (100)

X ± S.D

Raya n (100)

X ± S.D

Arado n (100)

X ± S.D

Medenes n (75)

X ± S.D

Begait n (75)

X ± S.D

Fogera n (100)

X ± S.D Milk yield/day (kg) 4±1 3±1 1.8±0.4 2.5±1 5±0.5 2±0.7 Lactation length (days) 271±22 210±17 242±20 162±29 205±32 159±24 Age at 1st calving (mo) 37±11 41±10 50±7 42±8 38±5 44±6 Calving interval (mo) 14±2 15±3 22±3 19±5 16±2 20±4 Adult body weight (kg)

• Male • Female

298±43 224±17

281±41 219±26

254±46 201±39

260±23 248±21

333±51 278±41

301±28 265±20

Adult height (cm) • Male • Female

124±4 115±4

122±4 113±4

114±3 108±4

117±3 115±2

131±4 125±4

137±9 118±4

1Body weight is estimated from heart girth measurements.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

21


Zerabruk et al.

Table 4. Comparisons by farmers among six indigenous cattle breeds of north Ethiopia for some traits of importance.

Trait Comparison Arado vs

Begait Arado vs Medenes

Begait vs Medenes

Raya vs Arado

Afar vs Raya

Fogera vs Highland

Body size Smaller Comparable Larger

100 --

8713

-

-7

93

--

100

-8

92

--

100Age at first calving Younger

Comparable Older

31978

163143

21 32 47

68 19 13

8416

-

7525

-Calving interval Shorter

Comparable Longer

-2773

61183

386 11

86 12 2

964-

423820

Milk yield Higher Comparable Lower

--

100

27

91

93 7-

100 --

100--

973-

Lactation length Longer Comparable Shorter

394219

136918

96 4-

100 --

100--

100--

Milk fat percentage Higher Comparable Lower

682418

2671

3

28 64

8

29 45 26

8911

-

9163

Draught power (speed & length of working hours)

Better Comparable Worse

-1189

562915

13 72 15

100 --

-1783

973-

Disease resistance Better Comparable Worse

7228

-

6925

6

-17 83

12 77 11

6926

5

-1684

Tick resistance Better Comparable Worse

6329

8

8811

1

924 67

-95 5

92665

1288

-Feed shortage Better

Comparable Worse

100 --

100--

-2

98

-39 61

373231

176716

Watering frequency Better Comparable Worse

-9

91

354916

95 5-

88 84

982-

2179

-Grazing Better

Comparable Worse

73756

22177

99 1-

93 7-

100--

7822

-Meat quality Better

Comparable Worse

8314

3

631918

-11 89

-6

94

-5644

62371

Hide quality Better Comparable Worse

964-

8116

3

-3

97

-11 89

-1981

29

89Market value of live animals

Better Comparable Worse

-2

98

-3763

57 43

-

97 3-

167113

473815

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figure 2. Afar cow (Igahiboda type) Mayshiguala river, Abala, Afar, Ethiopia.

Figure 3. Afar bull (Igahiboda type) Abala, Afar, Ethiopia.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

23


Zerabruk et al.

the Oromo migration of the 16th to 17th century andindigenous to the area respectively (Figure 4).

Begait

In the case of the Begait breed, 91 and 9% ofrespondents indicated the place of origin of thisbreed to be the Sudan and the lowlands of Eritrea,respectively. Two distinct types of the breed havebeen identified according to the group discussions.

The Dohin, is a tall and slender type with shortears, a straight nose, a narrow long neck and longthin legs, a long tail, a less developed dewlap and asmaller udder (Figure 5). Milk production is lowerthan in the other type. Both males and females havethin and medium horns, with black or brown coatcolour. The most important traits of this type are itsaggressive behaviour towards intruders which is anadvantage in areas where cattle rustling is a bigproblem, and the capacity to travel long distancesand graze in the vast range lands.

The Begait type is the largest and most docilewith a well developed udder, long teats and ahigher milk yield. Small and stumpy horns arecommon in both males and females of this type. TheBegait is very vulnerable to food shortage. Grey,

brown and black and white coat colours are mostcommon (Figure 5, 6 and 7).

Medenes

The Medenes is a crossbred of the Begait and Aradobreeds (almost always a cross between Arado cowwith Begait bull). They are medium sized with largeears, and are mostly black and white in varyingpatterns, other colours being rare (Figure 8). Thistype is tolerant to food shortage but milk productionis lower than the Begait and is comparable with theDohin type.

Arado

The origin of this breed is less well known. Sixtyseven percent of interviewed farmers do not knowthe origin of this breed, 12 and 21 % of therespondents indicated that the breed is indigenousand as a result of introduction from the lowlandsrespectively. The breed is characterised as smalland hardy with red and black coat colours inabundance. Females have medium, thin hornswhile males have thicker and shorter horns and acervicothoracic hump (Figure 9 and 10). This breed

Figure 4. Raya cow, Alamata, Tigray, Ethiopia.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figure 5. Begait cow (Dohin type), Adiremets, Tigray, Ethiopia.

Figure 6. Begait cow (Begait type), Tekeze river, Adiremets, Tigray, Ethiopia.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

25


Zerabruk et al.

is the most abundant and heterogeneous breed ofcattle in the highlands and most influenced by suchfactors as introduction of bulls from the lowlandbreeds, and bull and AI services introduced bydifferent projects.

Fogera

All interviewed farmers believe that this breed isindigenous to the area. The breed is characterised asmedium to large in size with short or stumpy horns,a well developed dewlap, a navel flap and udder infemales and a small to medium thoracic hump inmales and females. Black with small spots of whiteis the most dominant coat colour (Figure 11 and 12).

Production and Reproduction

The production and reproduction performanceinformation from the questionnaire and groupdiscussions, and body weight and heightmeasurements are summarised in table 4. Malesand females of the Begait breed were heavier andtaller than the other breeds. Body weights andheights for Begait and Afar in the present studywere smaller and marked differences between thesexes in the Afar breed were observed compared to

earlier reports (FAODAD-IS). The average daily milkproduction for Begait was higher than all breeds,while the lactation length was shorter than theArado, Afar and Raya breeds. The age at firstcalving for the Afar and Begait were 10, 26, 12 and16% shorter than the Raya, Arado, Medenes andFogera respectively; the calving interval for the Afarwas 7, 36, 26, 14 and 30% shorter than Raya, Arado,Begait, Medenes and Fogera breeds respectively.Overall productivity of breeds from the pastoralproduction system (Afar and Begait) seems to behigher than the breeds from the agro-pastoralsystem (Raya and Medenes) and the crop/livestockproduction system (Arado and Fogera).

According to results from the group discussions,two outstanding factors - relative abundance of feedin the range lands and the knowledge and practiceof selective and controlled breeding in pastoralcommunities - were identified to have contributed tothe differences in the performance of the breeds withrespect to the production system.

Breeding and genetic resourcemanagement

Except for the initiative taken to improve andconserve the Fogera breed, there are no known

Figure 7. Begait bull (Begait type), Sheraro, Tigray, Ethiopia

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


institutionalised activities for the benefit of the otherbreeds. The farmers and pastoralist are doing theirbest to manage their resources albeit underextremely difficult circumstances with no technicalor other forms of support.

There was a marked difference in the generalawareness of genetic resources management andutilization of inter and intra breed genetic variationbetween the pastoral and agro-pastoralcommunities in the lowlands, and the farmers in thehighlands.

One hundred, 78 and 91 percent of theinterviewed farmers/ pastoralists indicated thatthey use traditional methods of animalidentification, controlled breeding and cullingunwanted males before sexual maturity based onfamily information for the Afar, Raya and Begaitbreeds respectively. Only 7, 38 and 21% ofinterviewed farmers indicated the use of traditionalmethods to improve their animals for the Arado,Medenes and Fogera breeds respectively.Intra-breed selection and controlled breeding arefavoured as methods for genetic improvement byAfar, Raya and Begait breeders, while crossbreedingis considered to be the best method in the case ofArado, Medenes and Fogera breeders.

It was further observed in the group discussionsthat there is the presence of a collective sense of

breed ownership and awareness in the Afar, Begaitand (to a lesser extent) Raya breeders, wherebytraditional mechanisms are used to protect andmaintain their genetic resource from the effects ofmigration from adjacent breed populations. Suchtraditional systems were generally absent in thecase of Arado and Fogera breeders.

Traits of adaptive and economicimportance

According to interviewed farmers/pastoralists, thecattle breeds studied have traits of adaptiveimportance for their respective production systems.A very important observation in this study ispastoralists’ and farmers’ utilization of intra-breedgenetic variation in their breeding systems todevelop distinct types (the Bedaeru and Igahibodatypes of the Afar breed, and the Dohin and Begaittypes of the Begit breed) within a breed that aresuitable for a range of environmental conditions.

This practice, however, in addition to the effectsof natural selection for fitness, tend to favour theintermediate types that can adapt well to broaderenvironmental and farming system conditions asopposed to types with specific merits or highperformers in a given niche.

Figure 8. Medenes cow, Aditseser, Tigray, Ethiopia.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

27


Zerabruk et al.

Figure 10. Arado bull, Gerhusernay, Tigray, Ethiopia.

Figure 9. Arado cow, Enticho, Tigray, Ethiopia.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Table 5. Variables and criteria for the estimation of the extinction probability of African cattle breeds. (Reist-Marti et al. 2003).

Variable (abbreviation) Criterion and value Total population size (POS) 0.3 < 1 000

0.2 = 1 001-10 000 0.1 = 10 001-100 000 0.0 > 100 000 0.1 = missing value

Change of total population size over the last 10 years (CHA)

0.1 = decreasing (>20%) 0.0 = increasing or stable

Distribution of the breeds (DIS) 0.1 = localized (in 1 or more countries) 0.05 = spread within 1 country 0.0 = widespread over several countries 0.0 5 = missing value

Degree or risk of indiscriminate crossing (CRO) 0.1 = high 0.0 = marginal 0.1 = missing value

Organization of farmers (ORG) 0.1 = no 0.0 = yes (e.g., herd book) 0.1 = missing value

Established conservation scheme (CON) 0.1 = none 0.05 = partial 0.0 = yes

Political situation of the country(-ies) (POL)1 0.1 = general advice against travel (war) 0.05 = some objections (conflict) 0.0 = no objection (no conflict)

Special traits (SPE) 0.1 = none 0.0 = yes (e.g., trypanotolerance, adaptation to the environment) 0.1 = missing value

Social importance (CUL) 0.1 = none or can easily be replaced by other breeds 0.05 = some sociocultural value 0.0 = yes (e.g., religion, traditional custom) 0.05 = missing value

Reliability of the information (REL) 0.1 = not reliable 0.0 = reliable 0.1 = missing value

1For the present study, the variable political situation of the country/ies (POL) is modified to reflect direct threats such as war and conflicts in the immediate vicinity of the breeds instead of “security information for travellers”. The criteria and value were: war =0.1, conflict= 0.05 and no conflict= 0.0.

The creation of the Medenes breed in the last50 or so years is an indication that farmers andagro-pastoralists are changing their breeding goalsfrom high yielding to more adaptive types byexploiting inter-breed genetic diversity. As suchanimals have adaptive advantages they arereplacing the pure breeds.

The adaptation of the Fogara breed to surviveseveral months in flooded areas, adaptation of theArado and Medenes breeds to extreme feed shortagein the dry season and the adaptation of the Afar

and Begait to arid and semi-arid conditions areparticularly important and unique.

Threats of extinction and geneticconservation

The overall average extinction probabilities withinthe next 20-50 years for all breeds in the presentstudy was 0.49±0.09, slightly higher than earlierreports (0.48±0.11) for 49 African breeds includingsome of the breeds in this study (Reist-Marti et al.,

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

29


Zerabruk et al.

Tab

le 6

. Est

imat

ed e

xtin

ctio

n pr

obab

iliti

es (z

) of

eig

ht in

dige

nous

cat

tle

bree

ds o

f nor

th E

thio

pia.

Var

iabl

e1

Bre

ed

Bre

ed g

rou

p2

PO

S C

HA

D

IS

CR

O

OR

G

CO

N

PO

L

SPE

C

UL

R

EL

z

Afa

r Sa

ngaa

0.

00

0.00

0.

00

0.00

0.

10

0.10

0.

10

0.10

0.

05

0.10

0.

47

Ray

a Sa

ngaa

0.

00

0.10

0.

05

0.00

0.

10

0.10

0.

05

0.10

0.

05

0.00

0.

47

Foge

ra

Zen

gaa

0.00

0.

10

0.05

0.

00

0.10

0.

00

0.00

0.

10

0.05

0.

10

0.43

A

berg

elle

Z

enga

b 0.

10

0.10

0.

10

0.00

0.

10

0.10

0.

00

0.10

0.

05

0.00

0.

53

Ara

do

Zen

gaa

0.00

0.

00

0.00

0.

10

0.10

0.

10

0.05

0.

00

0.05

0.

00

0.37

Ir

ob

Zen

gab

0.10

0.

10

0.00

0.

10

0.10

0.

10

0.05

0.

10

0.05

0.

00

0.57

M

eden

es

Zen

gac

0.10

0.

00

0.10

0.

00

0.10

0.

10

0.05

0.

00

0.05

0.

00

0.43

B

egai

t Z

ebu

a 0.

10

0.10

0.

10

0.00

0.

10

0.10

0.

10

0.10

0.

05

0.10

0.

67

Sang

a Z

enga

Z

ebu

A

ll

Ave

rage

z

0.47

0.

47

0.67

0.

49 ±

0.0

9 1 V

aria

bles

and

cri

teri

a fo

r th

e es

tim

atio

n of

the

ext

inct

ion

pro

babi

lity

of A

fric

an c

attl

e br

eed

s (R

eist

et

al.

2003

), re

fer

tabl

e 5

for

det

aile

d d

escr

ipti

on.

2 Bre

ed g

roup

cla

ssif

icat

ion

acco

rdin

g to

a (R

ege,

199

9); b

(Zer

abru

k &

Van

gen,

200

5); c

(Tek

leab

, 200

0).

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figure 12. Fogera bull, Kidisthana, Amhara region, Ethiopia.

Figure 11. Fogera cow, Andasa cattle breeding centre, Amhara region, Ethiopia.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

31


Zerabruk et al.

2003). Extinction probabilities ranged from 0.37 forthe Arado to 0.67 for the Begait breed (Table 6).

On the other hand, according to the informationin the FAO DAD-IS and the global criteria fordetermining domestic animals at risk, none of thebreeds studied is considered to be at risk (Scherf,2000).

While the overall approach of estimatingextinction probabilities by this method can berelatively effective, as it includes more variables instudying threat levels of breeds, its accuracydepends mainly on the availability of currentpopulation data and deriving variables and valuesthat directly influence the threat level of each of thebreeds studied in their respective productionenvironment (Table 5).

Population size has dramatically changed in thelast 20-30 years for most of the breeds studied andin many cases the same population data was usedto estimate extinction probability and risk ofextinction. Although the average overall extinctionprobability for all breeds in the present study is veryclose to earlier estimates (Table 6), the extinctionprobability of the Raya breed was higher and that ofArado was lower than reported (Reist-Marti et al.,2003). Hence, extinction probability and expectedloss of diversity should be updated based on themost recent information and using relevantvariables to ensure successful monitoring of animalgenetic resources.

However, the more than threefold increase in thepopulation size of the Arado, while most of theother breeds had marked reductions during thesame period, indicates more productive breeds suchas the Begait and Raya and more productive typeswithin breeds such as the Igahiboda type of the Afarbreed are declining in numbers and being replacedby less productive breeds and types.

The high overall extinction probability for mostof the breeds in this study indicates the need forurgent intervention in terms of breed conservationefforts. The only effort so far is the in-situconservation program for the Fogera breed at theAndassa and Metekel cattle breeding ranches.Upgrading the recording system and the use ofcryopreservation of semen and/or embryos could bean alternative method of conservation for the longterm.

On the other hand, the fate of the rest of thebreeds is in the hands of their owners. The Afar,Begait and to a lesser extent the Raya are protectedby the traditional indigenous animal geneticresources management systems of the pastoralists.As a result, the biggest threat to these breeds is notcross breeding or replacement, but natural and man

made disasters such as famine and war. The Aradoand to a lesser extent the Fogera are threatened bynatural and man made factors, a lack of indigenousanimal genetic resource management by farmersand indiscriminate cross breeding projects.

Lack of resources for farmers and governmentinstitutions forced both to focus on avertingpressing short term food shortages rather than along term effort on conservation and utilization ofgenetic resources.

Conclusions

Overall production and reproduction performancesof cattle breeds in the pastoral and agro-pastoralproduction systems (Afar, Raya, Begait) were highercompared to breeds from the mixed crop/livestockproduction system. The six cattle breeds evaluatedin the present study were found to have adaptiveadvantages and unique traits suited to theirrespective production systems. While traditionalanimal genetic resources management practices arepart of the pastoral and agro-pastoral cattle ownersapproach to farming and continue to playconsiderable role, farmers in the mixedcrop/livestock production system are less aware ofsimilar practices. Traditional animal breeding in theform of sire and dam selection, culling and animalidentification are used in genetic improvement inthe pastoral and agro pastoral communities. Suchpractices in general are absent in the mixedcrop/livestock production system and the preferredmethod of improvement there is cross breeding. Thiscan partly be explained by the fact that fewernumbers of cattle are owned by farmers ascompared to pastoralists, with which to undertakeany meaningful selection.

Except for the Arado breed, all the breeds havegone through significant population size reductionsas a result of famine and man made problems in thepast 20-30 years. Famine, conflict, poverty anduncontrolled breeding (especially in the mixedcrop/livestock production system) were identifiedas the most important threats to the cattle breedsstudied.

The higher risk of extinction of the breedsespecially the Begait breed (the only breed in thezebu group) calls for immediate action to save thebreed.

Even though farming communities in northernEthiopia have been the guardians for a number ofplant and animal genetic resources with theirindigenous knowledge, they are currently facedwith problems that are complex and demand an

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


urgent intervention that combines modernapproaches (in-situ /ex-situ conservation) and theutilisation of the traditional knowledge of farmersand pastoralists. Educating farmers and pastoralcommunities and other stake holders as well aslearning from them about the challenges andopportunities of animal genetic resources should bea vital part of the battle against the extinction or lossof these valuable breeds.

Acknowledgements

The present work was funded by the MekelleUniversity/NORAD cooperation project. We thankall the farmers and pastoralists who contributed tothis study. The contribution of the followinginstitutions and persons was crucial: Desta Amare,Koronso Redae, G. Her Hagos, Jemal Ahmed,H.Mariam W.gebriel and the late Luel Tesfay,Tigray region Bureau of Agriculture; Ali Hamfere,Haji Yasin, Kelil Mohamed and Dires Tsegaye, Afarregion Bureau of Agriculture and DHP; AmhaSebsebie, Gebeyehu Goshu, Yitay Alemayehu andBirhane Mekete, Amhara region Bureau ofAgriculture.

List of References

Albero, M. & S. Haile-Mariam. 1982. Theindigenous cattle of Ethiopia. Part I. World AnimalReview. 41, 2-10.

Albero, M. & S. Haile-Mariam. 1982. Theindigenous cattle of Ethiopia. Part II. World AnimalReview. 42, 27-34.

BoNAR. 1999. Livestock Census. RegionalState of Tigray, Bureau of Agriculture and NaturalResources. Mekelle, Ethiopia. Vol. 1. Daltonssupplies Ltd. Cattle and Pig weighing Tape.

Devereux, S. 2000. Food Insecurity inEthiopia: Discussion paper. DIFID, Sussex.

Diress, T.A., H. Mitiku, Y. Fikru &T. Lulseged. 2003. Assessment of rangelandcondition and livestock mobility pattern in Aba’alawereda, North Afar: field survey and application ofgeographic information systems (GIS). In:Allsopp, A.R. et al. (Eds), Proceedings of the7th International Rangeland Congress,26 July-1 August 2003, Durban, South Africa.

FAO. 2003. Domestic Animal DiversityInformation System. (www.fao.org/dad-is/) FAO,Rome. (Date of access, January, 2006).

Haile, M. & K. Kebede. 1996. Soil andmoisture conservation in the semi-arid areas ofEthiopia. Proceeding of the 3rd Conference ofEthiopian Soil Society, Addis Ababa, Ethiopia.60-76.

Rege, J.E.O. 1999. The state of African cattlegenetic resources I. Classification framework andidentification of threatened and extinct breeds.Animal Genetic Resources Information Bulletin, 25:1-25.

Rege, J.E.O & C.L. Tawa.1999. The state ofAfrican cattle genetic resources II. Geographicaldistribution, characteristics and uses of present-daybreeds and strains. Animal Genetic ResourcesInformation Bulletin, 26: 1-25.

Reist-Marti, S.B, H. Simianer, J. Gibson,O. Hanotte & J.E.O. Rege, 2003. Weizman’sApproach and Conservation of Breed Diversity: anApplication to African cattle Breeds. ConservationBiology, 17: 1299-1311.

Sandford, S. & H. Yohannes. 2000.Emergency response interventions in pastoral areasof Ethiopia: report of the pastoral appraisal team.DIFID, London.

Scherf, B.D. 2000. World Watch List forDomestic Animal Diversity. 3rd edition, FAO, Rome.

Tekleab, T. 2000. The livestock resourcediversity assessment (study) in Tigray. Bureau ofAgriculture and natural resources development.Mekelle, Ethiopia.

Zerabruk, M. & O. Vangen. 2005. TheAbergelle and Irob cattle breeds of North Ethiopia:description and on-farm characterization. AnimalGenetic Resources Information Bulletin, 36: 7-20.

Woldu, Z. 1999. Forests in the vegetationtypes of Ethiopia and their status in thegeographical context. In Edwards, S., AbebeDemissie, Taye Bekele & Haase, G. (Eds) Forestgenetic resources conservation: principles,strategies and actions. IBCR & GTZ, Addis Ababa,pp. 1-38.

33

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 33-42

Acciones para la caracterización y conservacióndel bovino criollo Peruano (Bos taurus)

E. Rivas 1, E. Veli 1,Y. Aquino 1, V. Rivas 1, S. Pastor 2 & R. Estrada 1

1Instituto Nacional de Investigación y Extensión Agraria, INIEA,Av. La Molina no. 1981, La Molina, Lima 12, Perú

2Asociación Civil Pro Uso DIVERSITAS,Av. Esteban Campodónico 194, La Victoria, Lima 13, Perú

Resumen

Se describen las actividades de conservación ycaracterización del bovino criollo peruano en elInstituto Nacional de Investigación y extensiónAgraria (INIEA), las mismas que se handesarrollado con la activa interacción con lascomunidades rurales de las regiones peruanas deAncash, Apurímac, Ayacucho, Junín y Puno,dedicadas a la crianza de ganado criollo; en lascomunidades también se llevaron a cabo trabajo decampo y charlas participativas sobre laconservación de sus morfotipos locales. Lasactividades desarrolladas incluyen lacaracterización morfológica y molecular empleandomicrosatélites y RFLP para detectar genotipos deproteínas lácteas (variantes de kappa caseínas ybeta lactoglobulinas). Esta información será deutilidad para los programas de mejoramiento delbovino criollo peruano en las comunidades rurales.

Summary

The article describes the activities relating to theconservation and characterisation of PeruvianCriollo cattle at the Instituto Nacional deInvestigación y Extensión Agraria (INIEA). Theseactivities were developed in consultation with ruralcommunities in the Peruvian regions of Ancash,Apurímac, Ayacucho, Junín and Puno, that arededicated to breeding Criollo cattle. Fieldwork andparticipative lectures about the conservation of theirlocal breeds are also taking place in thesecommunities. The activities include morphometricand molecular characterisation usingmicrosatellites and RFLP to detect milk proteingenotypes (kappa caseins and beta lactoglobulins

variants). This information will be used by breedingprograms for the Peruvian Criollo cattle in ruralcommunities.

Palabras clave: Criollo Cattle, Conservation,Characterisation, Peruvian Regions.

Introducción

El bovino criollo en el Perú se originó a partir de loscruces de razas bovinas introducidas por CristóbalColon en América en su segundo viaje, en 1493(Primo, 1992); en la actualidad los bovinos criollosen nuestro país son un conjunto de poblacionesmuy heterogéneas, con numerosos morfotipos yadaptaciones locales escasamente estudiadas.Actualmente, el Perú cuenta con una enormepoblación no censada de bovinos criollos quehabitan en zonas donde el medio ambiente presentacaracterísticas difíciles, como el Altiplano o enregiones aisladas geográficamente en los vallesinterandinos; según Rosemberg (2002), el 85.8% delos 4 495 263 bovinos existentes en nuestroterritorio, corresponden a animales sin razadefinida, entre los cuales se encuentran el bovinocriollo.

Estos animales, también denominados “chuscos”,cumplen un rol importante en la vida de lascomunidades campesinas: son fuente de proteínas(carne, leche, queso), de fuerza de trabajo, de ahorro(cotidianamente venden el queso que se producecon la leche o en casos de emergencia o necesidadde liquidez, venden a los animales mismos),fertilizantes, cuero, entre otros. Los diversosecosistemas a los cuales se han adaptado, los hacende gran valor potencial como fuente de genes útiles(genes de resistencia a enfermedades, de

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

34Caracterización del bovino criollo Peruano

rendimiento productivo y reproductivo, etc.); yservicios ambientales (contribuyen al manejoapropiado de hábitats seminaturales) (Rege yGibson, 2003).

En los sistemas tradicionales de producción ymejoramiento genético existe un prejuicio por losanimales criollos, considerándolos como un recursomarginal que debe ser sustituido por especies yrazas exóticas mejoradas (Perú, 2004). La políticanacional de desarrollo ganadero, propone elincremento de la productividad a partir de laimportación de reproductores con una alta tasaproductiva pero con poca o ninguna adaptación alas condiciones extremas de los Andes del Perú;también se comercializa semen importado de EEUUde toros de las razas Holstein, Brown Swiss,Aberdeen Angus, Jersey, entre otros (Perú, 2004).Ello estaría provocando procesos de erosióngenética con la probable pérdida de genes deresistencia y/o adaptación y reemplazados porotros seleccionados para sistemas de produccióncon una elevada relación consumo/producción.Además se deja de aprovechar la condición de razaprimaria del bovino criollo peruano; en ausencia deprogramas de selección y mejora, se pierde elpotencial que significa las adaptaciones locales y sufacilidad para aprovechar mejor los recursos de sudifícil ambiente. Esta problemática es agraviada porlos pocos trabajos de investigación encaracterización y estudios de diversidad que se hanrealizado en los bovinos criollos en el país.

El Instituto Nacional de Investigación yExtensión Agraria (INIEA), tiene la misión deconservar y proteger los recursos genéticos encondiciones in-situ y ex-situ. Desde el año 2003 sevienen desarrollando actividades relacionadas conla conservación, caracterización e identificación decaracteres utilitarios de los recursos zoogenéticos(Rivas et al., 2004), con énfasis en especiesdomésticas como los bovinos criollos, habiéndoseidentificado poblaciones en las regiones de Ancash,Ayacucho, Apurímac, Junín y Puno (sierra norte,centro y sur del Perú). En colaboración con lasComunidades Campesinas, se viene desarrollandoactividades de caracterización morfométrica,productiva (parámetros lecheros), bioquímica ymolecular (empleando marcadores microsatélites yRFLPs), a fin de establecer la existencia de uno omás morfotipos definidos que podrían constituir labase de nuevas razas bovinas en el Perú.

Materiales y Métodos

Trabajo de campo

1. Identificación de comunidades dedicadas a lacrianza de bovinos criollos. Se están evaluandolos bovinos que se manejan en 12 comunidadescampesinas en las regiones de Ancash,Ayacucho, Apurímac, Junín y Puno(151 familias campesinas); se abarca la sierranorte, centro y sur del Perú (Figura 1). Tambiénse llevan a cabo talleres participativos con loscriadores sobre la importancia de laconservación del bovino criollo.

2. Muestreo de sangre - Se han realizado tomas demuestras de sangre entera de 529 bovinoscriollos de las diferentes Regiones del Perú, paralos trabajos de caracterización. Cada animal hasido identificado con un código que le ha sidocolocado en un arete para poder localizarlo confacilidad en cualquier momento.

3. Mediciones morfométricas - Se ha elaborado unaficha morfométrica (Figura 2) tomando comoreferencia los parámetros de caracterizaciónmorfométrica descritos en otras especiesdomésticas (Folch y Jordana, 1997; Rodríguez, etal., 2001; Méndez Mendoza, et al., 2002), la cualademás incluye un registro fotográfico de cadaanimal así como información del propietario y laubicación geográfica del lugar (con informaciónde GPS). Se han registrado las medicionescorporales de la región cefálica, tronco yextremidades (alzadas, longitudes, diámetros,perímetros, etc.), empleando un bastónzoométrico y una cinta métrica extensible. Apartir de los valores de la ficha morfométrica seestimarán 12 índices corporales, los quepermitirán determinar la variabilidad fenotípicade los bovinos criollos de las diferentescomunidades y el establecimiento de un patrónfenotípico de caracterización.

4. Control de la producción lechera - Regularmentese monitorea la producción lechera individual ydel rebaño registrándose información sobreproducción de vacas con genotipo conocido deproteínas lácteas conocido. Asimismo, se tomauna muestra para realizar el análisis bioquímicode la leche (contenido de sólidos totales, grasa yproteínas etc.); para tener una visión detalladadel manejo productivo individual y del rebaño yrelacionarlo con el genotipo de proteínas lácteasen los individuos.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

35


Rivas et al.

de ADN amplificado (PCR-RFLP). Estos análisisestán basados en los protocolos descritos porPoli y Medrano (1997) utilizando los primers JK5y JK3 y la endonucleasa de restricción Hinf Ipara el diagnóstico de los alelos A y B de laskappa caseínas; y los primers BLGP3 , BLGP4 yla endonucleasa de restricción Hae III para losalelos A y B de beta lactoglobulinas.

Resultados y Discusión

La domesticación de animales de granja se inicióhace 12 000 años cuando el hombre comenzó amantener animales como fuerza de trabajo,alimento, fibra y otros usos pecuarios (FAO, 1998).Antes de la domesticación actuaba solo la selecciónnatural; posteriormente a la acción consciente ydirecta del hombre a través de una reproduccióndirigida en base a una selección fenotípica sobredeterminados caracteres morfológicos yproductivos, se fueron singularizando diversos

Trabajo de laboratorio

1. Extracción de ADN - El ADN es extraído a partirde muestras de sangre entera, para ello se aislanlos linfocitos por lavados sucesivos con BufferTris EDTA 20:5 v/v, pH 8,0; la extracción serealiza empleando el protocolo de Sambrook yRussell (2001) modificado en el Laboratorio deBiología Molecular del INIEA.

2. Caracterización molecular de morfotiposcandidatos a raza - La caracterización molecularde morfotipos de bovinos criollos se vienedesarrollando por análisis de polimorfismos demicrosatélites de ADN amplificado (PCR-SSR);se están empleando 10 iniciadores para bovinosrecomendados por la Internacional Society ofAnimal Genetics y FAO (FAO, 2004; tabla 1). Lascondiciones de PCR estandarizadas para losiniciadores son variables, en algunos casos serealizan amplificaciones múltiplex.

3. Genotipado de proteínas lácteas - Laidentificación de genes de proteínas lácteas serealiza por análisis de fragmentos de restricción

Tabla 1. Iniciadores seleccionados para las actividades de caracterización molecular mediante microsatélites en los bovinos criollos.

Iniciadores Secuencia (5´-3´) ETH225 (D9S1) GATCACCTTGCCACTATTTCCT

ACATGACAGCCAGCTGCTACT

ETH152 (D5S1) TACTCGTAGGGCAGGCTGCCTG GAGACCTCAGGGTTGGTGATCAG

ILSTS005 (D10S25) GGAAGCAATGAAATCTATAGCC TGTTCTGTGAGTTTGTAAGC

ILSTS006 (D7S8) TGTCTGTATTTCTGCTGTGG ACACGGAAGCGATCTAAACG

HEL5 (D21S15) GCAGGATCACTTGTTAGGGA AGACGTTAGTGTACATTAAC

HEL1 (D15S10) CAACAGCTATTTAACAAGGA AGGCTACAGTCCATGGGATT

HEL13 (D11S15) TAAGGACTTGAGATAAGGAG CCATCTACCTCCATCTTAAC

BM2113(D2S26) GCTGCCTTCTACCAAATACCC CTTAGACAACAGGGGTTTGG

BM1818 (D23S21) AGCTGGGAATATAACCAAAGG AGTGCTTTCAAGGTCCATGC

BM1824 (D1S34) GAGCAAGGTGTTTTTCCAATC CATTCTCCAACTGCTTCCTTG

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


grupos de cada especie en cada región,conduciendo a la aparición y consolidación derazas concretas (Sierra, 2001).

Actualmente la mayor parte de la producciónpecuaria deriva solo de 14 especies que abarcanunas 5 000 razas. Muchas razas de animalesdomésticos están en peligro de desaparición, siendola causa principal la erosión genética producidapor la introducción de germoplasma exótico, asícomo las pobres políticas agropecuarias, restricciónal desarrollo de sólo unas cuantas razas, cambiosen los requerimientos de mercado, degradación deecosistemas, desastres naturales, entre otras causas(FAO, 1998).

En el caso del bovino criollo peruano, ésteproviene del cruzamiento indiscriminado de razasde bovinos introducidas desde el segundo viaje deColon a América. Desde hace 500 años estosanimales vienen experimentando un proceso deadaptación a las condiciones medioambientalesprincipalmente de la sierra del Perú. Su producciónse localiza en valles interandinos y puna altoandina, donde razas mejoradas no puedendesarrollarse. Su crianza está arraigada en lamayoría de comunidades campesinas y pequeñosproductores que lo utilizan no sólo como animalproductivo (carne, leche y fuerza de trabajo) sinocomo mecanismo de ahorro. No obstante, a pesar deesfuerzos aislados, poco se ha hecho paracaracterizar genética y productivamente a laspoblaciones de bovinos criollos del Perú. Nocontamos con razas caracterizadas de bovinoscriollos, a diferencia de nuestros vecinos de losotros países sudamericanos como Colombia, Boliviay Brasil, entre otros. Asimismo, persiste la ideaequivocada de que el mejoramiento del bovinocriollo debe ser realizado a través del cruzamientocon razas exóticas y no a través de la selección ymejora de los criollos.

Las actividades de caracterización del bovinocriollo en el INIEA se iniciaron en el 2003 yculminarán en 2007; estos trabajos son realizadospor el área de recursos genéticos de la institución(Sub Dirección Nacional de Recursos Genéticos yBiotecnología). Para finales del quinquenio seespera conseguir al menos 3 poblaciones de bovinoscriollos con variabilidad conocida para los genes dekappa-caseínas y beta lactoglobulinas, y al menos2 ecotipos de bovinos criollos candidatos a razas.La caracterización deberá incluir el fenotipo(marcadores morfológicos, bioquímicos y registrosde producción) y genotipo (marcadoresmoleculares).

El conocimiento que se está generando a travésde estas actividades en su conjunto, benefician a las

familias campesinas asociadas a la crianza delbovino criollo en las regiones de Junín, Ancash,Huancavelica, Ayacucho, Apurímac y Puno. En lafigura 1 se muestra la ubicación geográfica de estascomunidades campesinas.

En la tabla 2 se muestra la relación decomunidades campesinas (CC) de la Regiones deAncash, Ayacucho, Junín y Puno, así como losCentros de Investigación Pecuaria (CIPs) y lasEstaciones Experimentales Agrarias (EEAs) delInstituto Nacional de Investigación y ExtensiónAgraria (INIEA), indicando el lugar, el número debovinos criollos identificados y las actividades deinvestigación enmarcadas en la caracterización deeste recurso zoogenético.

Los criadores de bovinos criollos de estascomunidades están tomando conciencia de lavaloración de sus morfotipos locales, así como de laimportancia que tiene la identificación decualidades deseables en estos animales, para suaplicación a corto plazo en la obtención de sistemas

Figura 1. Ubicación geográfica (medida con GPS) de lasregiones donde se han identificado bovinos criollos.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

37


Rivas et al.

de producción sostenibles a diferencia de las razasexóticas que requieren una mayor cantidad deinsumos para lograr su nivel óptimo de producción,llegando a ser muy frágiles en las condicionesdonde los criollos se desempeñan adecuadamente.

En los últimos 100 años se ha producido unaumento en la tasa de extinción de razas yvariedades, representando una dramática perdidade variabilidad genética dentro del pool global deanimales domésticos. Los cambios en laspreferencias por ciertas razas de bovinos, se debengeneralmente a influencias socio-económicas, quesurgen debido a una pobre política agropecuaria,que lo que hace es promover la fijación rápida de loque no es sostenible a largo plazo o cambios segúnlos requerimientos existentes en el mercado deproductos (FAO, 1998).

Actualmente contamos con 302 registros debovinos criollos con medidas morfométricas. Cada

registro incluye los datos del propietario,localización geográfica (unidades GPS), unconjunto de medidas zoométricas (cabeza, tronco yextremidades) y el registro fotográfico del animal(Figura 2). Los datos morfométricos representan loscaracteres fenotípicos que se convertirán una vezfinalizado el trabajo en importantes descriptores delos morfotipos, con los que se obtendrán índicescorporales característicos. En la figura 3 se muestrala variabilidad fenotípica de los bovinos criollos delPerú.

La descripción de morfotipos en lascomunidades de las diferentes regiones constituyeun paso fundamental para implementarmecanismos de propiedad intelectual, como la“Denominación de Origen”. En España las“Denominaciones de Origen” y las “IndicacionesGeográficas” forman parte del sistema utilizadopara el reconocimiento de una calidad superior de

Tabla 2. Relación de comunidades campesinas e instituciones con las que se está desarrollando las actividades de conservación y caracterización del bovino criollo peruano. CCs = Comunidades campesinas; CIP = Centro de Investigación Pecuaria; EEAs = Estaciones Experimentales Agrarias (EEAs) del Instituto Nacional de Investigación y Extensión Agraria (INIEA).

Actividad de investigación

Comunidad campesina y/o Institución Lugar - Región

Numero bovinos criollos

identificados

Genotipado de proteínas lácteas por PCR - RFLP

Caracterización molecular por

PCR- SSR EEA Santa Ana Huancayo, Junín 17 X CC Panti Huancayo, Junín 30 X CC Occoro Huancayo, Junín 30 X CC Huasapa Huancayo, Junín 36 X CIP Chuquimbambilla, Universidad Nacional del Altiplano

Ayaviri, Puno 53 X

CC Lampa Grande Chuchito, Puno 22 X X CC Huacani Chucuito, Puno 18 X X EEA Illpa Puno, Puno 15 X X CC Huashcao Yungay, Ancash 22 X CC Ticllos Bolognesi,

Ancash 31 X

CC Mesapampa Bolognesi, Ancash

29 X

CC Pampa de Lampas Bolognesi, Ancash

27 X

CC Qochapunco Huamanga, Ayacucho

99 X X

CC Santa Elena Andahuaylas-Apurímac

50 X X

CC Ampi Andahuaylas-Apurímac

50 X X

Total de bovinos criollos identificados 529

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figura 2. Ficha morfométrica de bovinos criollos conteniendo el registro fotográfico, datos del propietario y medidasmorfométricas de la cabeza, tronco y extremidades.

un producto agrícola o un producto alimenticio (porejemplo, el vino Rioja, jamón serrano Pata Negra,queso Manchego, etc.) originario de dicha región,que surge como consecuencia de característicaspropias y diferenciales, debidas al medio geográficoen el que se producen las materias primas, seelaboran los productos, y a la influencia del factorhumano que participa en las mismas.

En cuanto al estudio e identificación degenotipos de proteínas lácteas, se sabe que lascaseínas y proteínas del suero presentan diversasvariantes genéticas que son determinantes en laspropiedades fisicoquímicas de la leche (López yVásquez, 2004); es así que en otras razas bovinas seha reportado que los genotipos BB de kappacaseínas se asocian con una capacidad lecherasuperior debido a que la leche de vacas que tieneneste alelo producen mezclas de menor tamaño, enlas cuales se retienen mas sólidos en el momento dela coagulación para la producción de quesos,originando coágulos que contienen mas grasa ymenos agua y por tanto son mas firmes y adecuadospara un rendimiento quesero superior (Sherbon etal., 1967; Ng-Kwai-Hang et al., 1984). En estesentido, el conocimiento de genotipos de proteínaslácteas en los bovinos criollos podrá aplicarse enlas comunidades campesinas con fines de seleccióny mejora para el carácter rendimiento quesero.

Todas estas particularidades junto a lanecesidad de mantener y valorar nuestros recursos

genéticos animales para su aprovechamientoproductivo y como reserva de genes con vistas alfuturo, justifican su conservación y caracterización.De esta manera, estos marcadores moleculares paraproteínas lácteas constituyen una herramienta paraesa diferenciación racial. Así, consideramos que elestudio del bovino criollo peruano constituye unaporte, mediante la caracterización genética eidentificación de caracteres útiles, a la revaloracióny al fortalecimiento de la conservación in-situ yex-situ de nuestra diversidad genética animal, lacual realizan principalmente las comunidadescampesinas y algunas instituciones públicas yprivadas a nivel nacional.

En la tabla 3 se muestran resultadospreliminares de las frecuencias genotípicas yalélicas encontradas y esperadas para laspoblaciones de bovinos criollos de las comunidadesde Huaschao y Ticllos (Región Ancash). Al analizarlos genotipos entre poblaciones se observa que haypresencia del alelo B de kappa caseínas, reportadocomo favorable para el rendimiento quesero. Portanto, estas poblaciones cuentan potencialmentecon base genética como para hacer selección yeventualmente mejoramiento. Se continuará con elgenotipado de proteínas lácteas en otrascomunidades y se comenzará a implementar elcontrol de producción lechera, el registro y controlde parentesco, así como la determinación de

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

39


Rivas et al.

Criollo callejón negro o “yana pillco” de la comunidadcampesina de Panti – Pariahuanca Región Junín.

Criollo negro o “yana” de la comunidad campesina deOccoro – Pariahuanca Región Junín.

Figura 3. Variabilidad de morfotipos de bovinos criollos de la región Ancash, Ayacucho, Apurímac, Junín y Puno.

Criollo rubio colorado o “puka” de la comunidadcampesina de Qochapunco – Vinchos Región Ayacucho.

Criollo moro de la comunidad campesina de Ticllos –Bolognesi Región Ancash.

Criollo pinto de la comunidad campesina de Huacani –Chuchito Región Puno.

Criollo moro de la comunidad campesina de Ticllos –Bolognesi Región Ancash.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Tabla 3. Frecuencias genotípicas y alélicas del gen κ-caseína observadas y esperadas en bovinos criollos de las comunidades de Huashcao y Ticllos (Región Ancash).

Huashcao Ticllos Observado Esperado Observado Esperado Genotipo No. % N° % No. % No. % AA 11 0.50 9 0.41 7 0.23 8 0.25 AB 6 0.27 10 0.46 17 0.55 16 0.50 BB 5 0.23 (ns) 3 0.13 7 0.23(ns) 8 0.25 Alelos % % A 0.64 (ns) 0.50 (ns) B 0.36 (ns) 0.50 (ns) Heterocigocidad 27.27% 54.83%

Criollo callejón rojo o “puka pillco” de la comunidadcampesina de Ampi – Pacucha Región Apurímac.

Criollo barroso de la comunidad campesina de Ticllos –Bolognesi, Región Ancash.

Criollo rubio colorado o “puka” comunidadcampesina de Ampi – Pariahuanca Región Junín.

Figura 3. Sigue desde la pagina anterior.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

41


Rivas et al.

relaciones de parentesco en los morfotipos debovinos criollos.

Conclusiones

Los bovinos criollos en el Perú, denominados“chuscos”, cumplen un rol importante en la vida delas comunidades campesinas; su adaptación adiversos ecosistemas, los hace de gran valorpotencial como fuente de genes útiles y serviciosambientales. A pesar de ello, son consideradoscomo un recurso marginal que debe ser sustituidopor especies y razas exóticas mejoradas. La políticanacional de desarrollo ganadero propone elincremento de la productividad a partir de laimportación de reproductores con una alta tasaproductiva pero con poca o ninguna adaptación alas condiciones extremas de los Andes del Perú.Ello estaría provocando procesos de erosióngenética debido al reemplazo de bovinos criollospor razas exóticas que responden a sistemas deproducción con una elevada relaciónconsumo/producción. Como consecuencia, se dejade aprovechar la condición de raza primaria delbovino criollo peruano, perdiéndose el potencialque significa las adaptaciones locales y su facilidadpara aprovechar mejor los recursos de su difícilambiente. En el marco de las actividades decaracterización de las poblaciones de bovinoscriollos del Perú, se ha identificado la presencia delalelos de proteínas lácteas favorables para elrendimiento quesero, lo que los hace potencialmentevaliosos por contar con base genética para hacerselección y eventualmente mejoramiento hacia unmayor rendimiento quesero; asimismo, se estátrabajando en la caracterización molecular de losdiferentes morfotipos con microsatélites y en lacaracterización morfométrica.

Bibliografía

FAO. 1998. Management of smallpopulations at risk. In: Secondary Guidelines forDevelopment of National Farm Animal GeneticResources Management Plans.

FAO. 2004. Measurement of DomesticAnimal Diversity (MoDAD). Recommendedmicrosatellite markers. In: Secondary Guidelines forDevelopment of National Farm Animal GeneticResources Management Plans.

Folch, P. & J. Jordana. 1997.Characterization, reference ranges and the influenceof gender on morphological parameters of theendangered Catalonian donkey breed. Journal ofEquine Veterinary Science 17(2): 102.

López, E. & N. Vásquez. 2004.Determinación del sexo y genotipificación del genK-caseína en embriones bovinos. Rev. Col. Cienc.Pec. 17(3): 231-240.

Méndez Mendoza, M., J. Serrano Palapa,R. Avila Benitez, M. Rosas Garcia & N. MéndezPalacios. 2002. Caracterización Morfométrica delBovino Criollo Mixteco. Arch. Zootec. 51: 217-221.

Ng-Kwai-Hang K.F., J.F Hayes, J.E. Moxley& H.G. Monardes. 1984. Association of geneticvariants of casein and milk serum proteins withmilk, fat and protein production by diary cattle. JDiary Sci. 67: 835-840

Poli, M. & J.F. Medrano. 1997. Informe finaldel Proyecto Desarrollo de un rodeo AA y otro BBpara kappa-caseína y beta-lactoglobulina de vacaslecheras, para mejorar la calidad de la leche para laproducción de quesos. Department of AnimalScience. University of California, Davis. USA.

Primer Informe Nacional sobre la situaciónde los Recursos Zoogenéticos. 2004. ComisiónNacional de Recursos Zoogenéticos. Lima, Perú,pp. 66.

Primo, A.T. 1992. El ganado bovino Ibéricoen las Américas: 500 años después. Arch. Zootec. 41(extra): 421-432.

Rege, J.E.O. & J.P. Gibson. 2003. Animalgenetic resources and economic development:issues en relation to economic valuation. EcologialEconomics 45: 319-330.

Rivas Palma, V.E., E.R.G. Rivas Seoane,E.A. Veli Rivera, G. Gutiérrez Reynoso &S.H. Pastor Soplín. 2004. Proyecto caracterizaciónde recursos Zoogenéticos en función a caracteresutilitarios de la Direccion Nacional de Investigaciónde Recursos Genéticos del INIEA. In: Memorias delV Simposio Iberoamericano sobre la conservación yutilización de Recursos Zoogenéticos, pp. 193-196.

Rodríguez, M., G. Fernández, C. Silveira,J.V. Delgado. 2001. Estudio Étnico de los bovinoscriollos del Uruguay: I. Análisis Biométrico. Arch.Zootec. 50: 113-118.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Rosemberg, M. 2002. Variabilidad genéticade vacunos criollos y de doble propósito. Artículosy resúmenes del I Congreso Peruano de GenéticaAnimal. Lima, Perú.

Sambrook, D.W. & J. Russell. 2001.Molecular cloning a laboratory manual. Vol 3. ColdSpring Harbor Laboratory Eds.

Sherbon I.W., R.A. Ledford, I. Regesntein &M.P. Thompson. 1967. Variants of milk proteinsand their possible relation to milk properties. J.Anim. Sci. 50: 951-964.

Sierra, I. 2001. El concepto de raza: evolucióny realidad. Arch. Zootec. 50:547-564.

43

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 43-53

Caractérisation phénotypique des bovins àviande (Bos taurus et Bos indicus) au centre (Bouaké)

et au nord (Korhogo) de la Côte d’Ivoire

D.P. Sokouri 1,2, N.E. Loukou 1,2, C.V. Yapi-Gnaoré 1, F. Mondeil 2 & F. Gnangbe 2

1Centre National de Recherche Agronomique (CNRA), 01 B.P. 1740 Abidjan 01, Côte d’Ivoire2Université de Cocody, Laboratoire de Génétique, UFR Biosciences, 22 B.P. 582 Abidjan 22, Côte d’Ivoire

Résumé

Une enquête a été menée dans les régions de Bouakéet de Korhogo pour inventorier et caractériser lesdifférents types de bovins à viande. Des mesuresbarymétriques ont été enregistrées sur 511 animauxà Bouaké et 929 à Korhogo pour lesquels leséleveurs ont été invités à indiquer le nom du typephénotypique. L'inventaire des élevages a permisd'identifier 5 types phénotypiques de bovins quesont le N'Dama, le Baoulé, le Zébu, le Méré et le"Métis". Les descripteurs qui permettent d'identifierau mieux ces différents types de bovins sont laprésence/absence de bosse, la couleur de la robe, lepérimètre thoracique et la hauteur au garrot. Malgréle métissage qui s'exerce sur elles, les races taurines(N'Dama et Baoulé) présentent des populationshomogènes et stables. Le Méré présente unepopulation homogène dans la région de Korhogo etsemble être un type phénotypique bien fixé avec83% d'animaux bien classés. Le pourcentage moyend'animaux bien classés dans les régions de Bouakéet Korhogo est respectivement de 79 et 68%; ce quidénote une très bonne connaissance des animauxpar les éleveurs. Les caractères déterminantsidentifiés à partir de cette analyse peuvent servir àdéfinir les standards des races concernées.

Summary

A survey was conducted in the Bouaké andKorhogo regions in order to take an inventory ofand characterize the different types of meat cattleraised in the regions. Barymetric data was collectedfrom 511 animals in Bouaké and 929 in Korhogoand the cattle owners were invited to indicate thename of each of the phenotypes identified. Fivephenotypic types, including N'Dama, Baoulé, Zebu,Méré and Métis were identified. Discriminantanalysis revealed that the presence or absence of ahump, coat colour, heart gird and height at withers

were the most important descriptors whichdifferentiated the five phenotypic types. Despite theimpact of inbreeding exerted upon them, theN'Dama and Baoulé breeds presented homogenousand stable populations. The Méré breed presents ahomogenous population in the region of Korhogoand seems to be a well established phenotypic typewith 83.8% of animals well classified in that region.The average percentage of well classified animals inBouaké and Korhogo regions were 79 and 68%,respectively. This result shows that cattleowners identification of their animals was quiteaccurate. The identified determinant charactersstemming from this analysis can be used to definebreed standards for the breeds concerned.

Mots clés: Bovins à viande, Caractérisationphénotypique, Variables discriminantes, Classement desanimaux.

Introduction

La Côte d’Ivoire, pays plutôt de tradition agricoleque pastorale, compte dans son patrimoinegénétique animal trois races locales de taurins: larace N’Dama, la race Baoulé et la race Lagune. Cesraces, très bien adaptées aux conditions climatiquestropicales locales, sont par ailleurs résistantes auxnombreuses parasitoses, et trypanotolérantes(Domingo, 1976). Malheureusement leur utilitévis-à-vis de l’homme et leurs contributions àl’agriculture durable sont encore mal reconnues.Ceci a pour conséquence la menace voirel’extinction des ressources génétiques animales. Laconservation de la diversité génétique des animauxdomestiques a pour fondement l’identification et lacaractérisation des ressources génétiques commel’atteste la ligne des recommandations duProgramme Action 21 de la Convention sur labiodiversité (FAO/UNEP, 2000).

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

44Caractérisation des bovins de la Côte d’Ivoire

L’ethnologie, l’écologie et l’étude de larépartition géographique des racestrypanotolérantes de Côte d’Ivoire a fait l’objet denombreux écrits (Doutressoule, 1949; Tidori et al.,1975; CIPEA, 1979; Landais, 1983; Yapi-Gnaoré etal., 1996). La descriptions de ces races est souventlimitée et n’a pas la précision de celle des races desrégions tempérées où la sélection a uniformisé lescaractéristiques esthétiques et économiques (Quévalet Petit, 1982). En effet, la recherche par les éleveursivoiriens d’animaux de grand format etl’introduction en Côte d’Ivoire sous trypanocide deZébus transhumants du Sahel chassés par lasécheresse, ont entraîné des opérations de métissageintenses et anarchiques des races locales. Les raceslocales impliquées dans ce métissage sontprincipalement les races Baoulé et N’Dama. Pour larace Baoulé, Landais (1983) estimait à plus de 50%le nombre de reproductrices métissées.

Par ailleurs plusieurs croisements sont issus del’utilisation de races exotiques avec la N’Dama,notamment la Fleckvieh, l’Abondance et la Jersiais.Ces croisements sont généralement faits par lespaysans situés à proximité des grandes villes. Ilsrépondent aux besoins particuliersd’approvisionnement en lait de ces villes. Ainsi lamultiplicité des races bovines rencontrées dans lesfermes est-elle liée à la diversité des modèlesd’élevage et de leurs objectifs (Planchenault etBoutonnet, 1997). Par conséquent les taurins locaux,mieux adaptés aux conditions locales d’élevage queles Zébus et les races exotiques, se trouventmenacés. La présente étude se propose:1. D’inventorier les différents types de bovins à

viande élevés dans le centre et le nord de la Côted’Ivoire, notamment dans les régions de Bouakéet de Korhogo.

2. De caractériser ces types de bovins et de mettreen évidence les caractères discriminants à partirdu savoir des éleveurs.

Matériel et Méthodes

Echantillonnage

L’étude a porté sur 1 440 animaux mâles et femellesdont 511 échantillonés à Bouaké et 929 à Korhogoau cours des années 2001 et 2002. Ces animauxproviennent de grandes exploitations privées et desélevages ruraux (9 à Bouaké et 28 à Korhogo) situésdans un rayon de 35 km autour de ces deux villes.L’enquête réalisée sur les fermes a porté surl’identification de la ferme, sa localisation, les typesde bovins élevés, l’origine des animaux, leur

utilisation et leurs effectifs. Le choix des fermesdans lesquelles les animaux ont été caractériséss’est fait, essentiellement, sur la base de ladisponibilité des éleveurs et de la présence, dans laferme, de parcs munis de couloirs de contention. Leséleveurs ont été invités à indiquer le nom attribué àchaque type phénotypique rencontré dans leursélevages.

Descripteurs phénotypiques

Une fois le type phénotypique d’un animal a étéindiqué par l’éleveur, les enquêteurs décrivent lephénotype de l’animal. Les éléments phénotypiquespris en compte sont les descripteurs définis par laFAO (1986). Ces descripteurs concernent: la couleur(robe, peau, tête, museau, corne, sabots, visage); lescaractères linéaires (hauteur au garrot, longueur[corne, tête, oreille, corps, tronc], largeur de la tête,circonférence à la base de la corne, espaceintercorné, périmètre thoracique); la forme (corne,bosse, tête, oreille, profil de la tête); le sexe; le poidset l’âge.

Le poids a été estimé à l’aide d’un rubanbarymétrique, sur la base de sa corrélation avec lepérimètre thoracique. L’âge des animaux a étécalculé à partir de la date de naissance ou estimé àpartir de la dentition.

Analyse statistique

Les descripteurs phénotypiques ont été analyséspar la méthode de l’analyse discriminante dulogiciel SPSS 7.5, afin de déterminer les descripteurspermettant de décrire au mieux les typesphénotypiques. Les caractères «poids» et «âge» ontété introduits dans l’analyse comme des covariablespour pouvoir corriger leur effet sur les caractèreslinéaires.

Résultats

Types phénotypiques rencontrés

L’enquête dans les fermes des régions de Bouaké etde Korhogo, a permis d’identifier 5 typesphénotypiques de bovins que sont le N’Dama, leBaoulé, le Zébu, le Méré et le Métis (Tableau 1). Ladénomination "Métis" a été donné à tous lesanimaux reconnus comme des croisés par leséleveurs, mais dont les races parentales sontinconnues.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

45


Sokouri et al.

contribution de 0,948. La couleur de la peau (PO), seprésente comme la variable la plus importante del’axe F2 avec une contribution de 0,542.

Classement des animaux

L’analyse discriminante a révélé que les bovins deces deux régions sont bien classés en moyenne à79% pour Bouaké et 68% pour Korhogo selon lesdescriptions fournies par les éleveurs. Les racesN’Dama et Baoulé constituent des populationshomogènes dans les deux régions. L’échantillon dela race N’Dama renferme 95,7% d’animauxcorrectement classés à Bouaké et 80,9% à Korhogo(Tableaux 3 et 4). En ce qui concerne Le Zébu, lepourcentage d’animaux correctement classés est de75.7% pour la région de Bouaké et de 51,4% pour larégion de Korhogo. Quant au type Méré, alors qu’ilsemble très instable dans la région de Bouaké(12,5% d’animaux correctement classés), il présenteune population homogène dans la région deKorhogo (83,8% d’animaux correctement classés).Le type Métis constitué de 31,0% d’animauxcorrectement classés à Bouaké et de 18,3% àKorhogo ne peut pas être considéré comme une racede bovins dans les deux régions. Les éleveursenglobent sous le vocal "Métis" tous les produits decroisements dont ils ignorent les races parentales.Le Métis se caractérise par une grande variabilitéphénotypique. Son phénotype se trouve dispersé auniveau des Zébu, N’Dama, Baoulé et Méré(Figure 1a et 1b). Les figures 1a et 1b indiquent ladistribution des cinq types phénotypiques enfonction des axes F1 et F2 dans les deux régions. ABouaké les Zébu, Méré et Métis formentpratiquement un même groupe; tandis qu’àKorhogo, les Méré se détachent des Zébus et Métis.

Détermination des variablesdiscriminantes

La détermination des variables discriminantes a étéeffectuée à partir de 4 axes dont le principal (F1)décrit 61,4% de la variabilité totale dans la région deBouaké et 86,6% dans la région de Korhogo. Ledeuxième axe important (F2) décrit 35,5% de lavariabilité totale dans la région de Bouaké et 7,1%dans la région de Korhogo. Ces deux axes F1 etF2 décrivant à eux seuls 96,9% de la variabilité totaledans la région de Bouaké et 95,7% dans la région deKorhogo, suffisent à classer les 5 typesphénotypiques.

Dans la région de Bouaké, sur 20 variablesintroduites dans l’analyse, seules 9 ont été jugéescomme celles pouvant distinguer au mieux les5 types phénotypiques. Ce sont la couleur de lapeau, la couleur de la robe, la couleur des sabots, laforme des cornes, la hauteur au garrot, la longueurde la corne, la longueur de la tête, le périmètrethoracique, la présence de tâches sur la robe(Tableau 2). L’axe F1 est essentiellement défini parlecaractère couleur de la peau (PO) avec une fortecontribution de 0,939. L’axe F2 est défini par lahauteur au garrot, variable la plus discriminantepour cet axe avec une contribution de 1,309. Auregard des coefficients affectés aux variablesdiscriminantes, l’axe F1 se définit comme l’axe descouleurs et F2 comme l’axe des caractères linéaires.

Dans la région de Korhogo, ce sont 26 variablesqui ont été introduites dans l’analyse. Onze (11)d’entre elles ont été identifiées comme cellespermettant de mieux caractériser les populationsbovines. Ce sont la présence/absence de bosse, lacouleur de la peau, la couleur de la robe, la hauteurau garrot, la longueur du corps, la taille de la bosse,la couleur du museau, la forme des cornes,l’orientation des cornes, la longueur des oreilles etle profile de la tête. L’axe F1 est défini par le caractèreprésence/absence de bosse (BOSS) avec une

Tableau 1. Effectif des types phénotypiques de bovins à viande identifiés dans les régions de Bouaké et de Korhogo.

Bouaké Korhogo Types phénotypiques Mâles Femelles Mâles Femelles Total N’Dama 20 166 7 40 233 Baoulé 39 110 37 198 384 Zébu 26 89 59 122 296 Métis 2 27 28 136 193 Méré 1 31 71 231 334 Total 511 929 1 440

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Tab

leau

2. C

ontr

ibut

ion

des

vari

able

s di

scri

min

ante

s au

x ax

es F

1et

F2

pour

les

régi

ons

de B

ouak

é et

de

Kor

hogo

.

Bou

aké

L

gT

PO

SA

BO

Fo

rco

HG

L

gC

PT

R

OB

E

Tac

he

Age

F1

0.19

5 0.

939

-0.2

43

0.20

0 0.

269

-0.4

92

-0.2

42

0.21

1 0.

183

0.06

5

F2

0.28

3 0.

055

-0.0

02

-0.4

36

1.30

9 0.

433

-0.6

44

0.01

4 0.

082

-0.5

74

K

orho

go

BO

SS

PO

O

RC

Fo

rco

HG

M

USO

P

FIL

R

OB

E

LgO

r T

.BO

S L

gA

F10.

948

0.00

7 0.

104

0.06

5 -0

.031

0.

045

-0.0

07

-0.0

21

0.10

6 -0

.098

-0

.130

F2

-0.3

20

0.54

2 0.

289

-0.1

68

-0.3

74

0.26

8 -0

.081

0.

423

-0.1

09

-0.2

37

-0.0

36

PO =

Cou

leur

de

la p

eau;

RO

BE

= C

oule

ur d

e la

rob

e; S

AB

O =

Cou

leur

des

sab

ots;

For

co =

For

me

des

cor

nes;

HG

= H

aute

ur

au g

arro

t;L

gC =

Lon

gueu

r d

e la

cor

ne;

LgT

= L

ongu

eur

de

la t

ête;

PT

= P

érim

ètre

tho

raci

que;

Tâc

he =

Pré

senc

e/ab

senc

e d

e T

âche

sur

la

robe

;B

OSS

= P

rése

nce/

Abs

ence

d

e bo

sse;

L

gOr

= L

ongu

eur

de

l’ore

ille;

O

RC

=

Ori

enta

tion

d

es

corn

es;

MU

SO =

Cou

leu

r d

u

mus

eau

; PF

IL =

Pro

fil d

e la

tête

; T.B

OS

= T

aille

de

la b

osse

; LgA

= L

ongu

eur

du c

orp

s.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

47


Sokouri et al.

Tableau 3. Pourcentage d’animaux correctement ou incorrectement classés (Région de Bouaké).

Groupes prédits Race N’Dama Baoulé Zébu Métis Méré Total

Nombre d’animaux

N’Dama 95.7 2.2 1.6 0 0.5 100% 186 Baoulé 4.7 85.2 6.7 2.7 0.7 100% 149 Zébu 11.3 4.3 75.7 7.8 0.9 100% 115 Métis 10.3 24.1 34.5 31.0 0 100% 29 Méré 21.9 31.3 31.3 3.1 12.5 100% 32

NB: Le pourcentage d’animaux correctement classés se lit au niveau de la première diagonale.

Tableau 4. Pourcentage d’animaux correctement ou incorrectement classés (Région de Korhogo).

Groupes prédits Race N’Dama Baoulé Zébu Métis Méré Total Nombre d’animaux N’Dama 80.9 19.1 0.0 0.0 0.0 100% 47 Baoulé 4.7 95.3 0.0 0.0 0.0 100% 235 Zébu 0.0 0.0 51.4 9.4 39.2 100% 181 Métis 4.9 17.1 14.6 18.3 48.2 100% 164 Méré 0.0 0.0 10.3 6.0 83.8 100% 302

NB: Le pourcentage d’animaux correctement classés se lit au niveau de la première diagonale.

Discussion

Description phénotypique des types debovins suivant les caractèresdéterminants

Les résultats montrent que les cinq (5) types debovins à viande peuvent être identifiés avec lesdescriptions phénotypiques suivantes.

N’dama

Le bovin N’Dama présente en général une robefauve ou fauve-pie (Figure 2). C’est un animal detaille moyenne dont la hauteur au garrot a varié de108 à 117 cm pour des animaux d’âge compris entre4 et 8 ans. Ces mensurations sont comparables àcelles obtenues par Coulomb (1976) qui a évalué lamoyenne de la hauteur au garrot, à l’âge de 4 ans, à116,4 cm pour le mâle et 113,6 cm pour les femelles.Par contre, les mensurations obtenues par Choquel(1969) sont nettement inférieures; 104 cm pour lafemelle et 110 cm pour le mâle. Le périmètrethoracique varie de 140 à 170 cm. La race N’Damaprésente une tête au profil droit avec un museaurose ou fauve. Ses cornes sont portées en croissantou en coupe chez les sujets mâles. Les femelles ont

de longues cornes en lyre effilées aux extrémités.Cette forme a été déjà observée et décrite parplusieurs auteurs (Aillerie, 1926; Doutressoule,1946; Coulomb, 1976; Landais, 1983).

Baoulé

Le bovin Baoulé présente une robe de couleurvariable; blanche, noire, pie-noire, noire-pie, pierouge, rouge-pie et quelques fois rouge noire(Figure 3). Yapi-Gnaoré et al. (1996) ont égalementnoté cette variabilité de la couleur de la robe et ontestimé qu’elle ne pouvait être un élément decaractérisation de cette race. Le bovin Baoulé est unanimal de petit format; la hauteur au garrot a variéde 92 à 113 cm et le périmètre thoracique de 129 à161 cm pour des animaux de plus de 4 ans. Tidori etal. (1975) ont observé une taille variant de 95 à110 cm et un périmètre thoracique qui variait entre128,4 et 140 cm sur des bovins Baoulé au CRZ deMinankro (Bouaké). La race Baoulé présente unetête au profil droit, avec un museau noir ou blanc.Les cornes sont généralement en forme de croissantlunaire très ouvert vers le haut. L’on rencontrequelques fois des bovins Baoulé avec des cornesdirigées vers le bas. Chez les mâles, les cornesforment un ‘’ U ‘’ très évasé s’orientant latéralement.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figure 1. Répartition des animaux dans le plan principal F1 - F2.a) Région de Bouaké;b) Région de Korhogo.

En général, les cornes en croissant sont orientéesvers l’avant.

Zébu

Le nom Zébu est attribué de façon générique auxbovins à bosse (Figure 4). La couleur de la robe dubovin Zébu est très variable; une multitude decouleur a été observé allant du blanc au noir enpassant par toutes les nuances de fauve et denoir. C’est un animal haut sur pattes; la hauteur augarrot variait de 118 à 130 cm pour des animaux deplus de 4 ans. Le périmètre thoracique variait de143 à 172 cm. La tête est longue et fine avec un profildroit. Mais l’on rencontre des animaux au chanfreinlong et légèrement convexe. Le museau estgénéralement noir, blanc ou fauve. La bosse a unetaille très variable. La moyenne observée est de17 cm. Chez les sujets mâles adultes, la bosse peutmesurer plus de 40 cm occupant tout le garrot etcouchée latéralement. Cette caractéristique de labosse est comparable à celle observée par IEMVT(1978) comme étant prononcée chez le taureau, etréduite chez la vache. Les cornes sont en forme delyre haute, quelques fois spiralées. Elles sont

orientées vers l’avant ou dressées vers le haut enforme de ‘’U’’ très évasé.

Méré

Le Méré est en passe de devenir un typephénotypique fixé dans la région Nord de la Côted’Ivoire. Il constitue une population homogène debovins reconnue comme telle par les éleveurs decette région. Il est le produit de croisements entremâles Zébu et femelles Baoulé. Cependant, il estimportant de souligner que le Méré est un animal detaille moyenne (116±7,21 cm pour la hauteur augarrot; 155±13 cm pour la longueur de l’animal;139±11 cm pour le périmètre thoracique). Sa robe estdominée par la fréquence de la couleur noire-pie. Ilest caractérisé par une tête au profil droit, avec unmuseau noir, blanc ou fauve. La bosse du Méré(11±3 cm) est moins développée que pour les Zébu.Ses cornes, de taille moyenne (26 cm), sont courbéesou droites, formant généralement des croissants. Ilest possible de rencontrer des cornes fixéeslatéralement ou des cornes en lyre courte.L’orientation de ces cornes est soit en avant, soitintérieure formant des coupes (Figure 5a, b).

F1

43210-1-2-3-4

F2

6

4

2

0

-2

-4

-6

Race

Barycentre

Méré

Métis

Zébu

Baoulé

N'Dama

54

3

2

1

Baoulé

Zébu

N’Dama

Méré

F2

F1

543210-1-2-3-4

4

3

2

1

0

-1

-2

-3

-4

Types génétiques

Barycentres

Méré

Métis

Zébu

Baoulé

N'Dama

5

43

2

1

Baoulé

N’Dama

Méré

Zébu

Figure 1bFigure 1a

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

49


Sokouri et al.

Figure 2. Bovins N'Dama a) Taurillons et veaux; b) Taureau N'Dama.

a)

b)

Métis

Ces animaux sont le produit de croisements nonspécifiques. Il n’est pas possible de les décrire avecprécision à partir des caractères retenus.Cependant, il faut noter qu’à l’intérieur de cegroupe, on rencontre aussi bien des animaux àbosse que des animaux sans bosse. Le format estidentique à celui du Méré. La robe de ces animauxprésente toutes les nuances de couleur.

Classification des types phénotypiques

La race N’Dama avec un pourcentage de 95,7%d’animaux correctement classés dans la région deBouaké et 80,9% dans la région de Korhogo,apparaît comme une race très homogène et stable.Ceci pourrait s’expliquer par le fait qu’elle est moinsconcernée par les métissages anarchiques. Lescroisements dans lesquels elle est impliquée sontdes croisements raisonnés, soit avec les Zébus, soitavec des races exotiques (Yapi-Gnaoré et al.,1996).

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figure 3. Bovin Baoulé a) Une femelle Baoulé à la robe pie-noire;b) Taureau Baoulé de la Station de Recherche en Elevage à Bouaké.

Les bovins N’Dama reclassés dans la raceBaoulé (2,2% à Bouaké et 19,1% à Korhogo) et les4,7% de bovins Baoulé reclassés dans la raceN’Dama (aussi bien à Bouaké qu’à Korhogo)pourraient représenter des croisés N’Dama- Baoulé.En effet ces croisés sont souvent difficiles àdistinguer des types purs; ce qui amène les éleveursà les classer, selon leur phénotype, avec les typesparentaux. Il faut également noter que les croisésN’Dama - Baoulé de première génération sontphénotypiquement plus proche du N’Dama quimarque fortement sa descendance (Landais, 1983).

La classification a révélé que malgré la pressionde métissage qui s’exerce sur la race Baoulé, elle

demeure homogène et stable; 95,3% d’animauxcorrectement classés dans la région de Korhogo et852% dans la région de Bouaké. Les animauxBaoulé présentent des caractéristiques qui leur sontpropres: petite taille, petit format, la robe pie-noireou noire et des cornes courtes. Ces résultats sontsimilaires à ceux de Yapi-Gnaoré et al. (1996). Ceciconfirme leur appartenance à la race taurine àcourtes cornes.

Avec 75,7% et 51,4% d’animaux correctementclassés à Bouaké et Korhogo, respectivement, leZébu paraît moins stable que le N’Dama et leBaoulé. Cela s’explique aussi par les croisementsanarchiques dans lesquels ce type de bovin est

a)

b)

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

51


Sokouri et al.

Figure 4. Bovin Zébu (une femelle et son veau).

Figure 5. Méré dans une ferme villageoise a) et en zone urbaine b).

a)

b)

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


impliqué. En effet autant le petit format du bovinBaoulé l’expose aux croisements anarchiques avecles Zébus, autant la trypanosensibilité du bovinZébu l’expose aux croisements avec les taurinslocaux trypanotolérants. En effet, à Korhogo, 9,4%des Zébu sont supposés appartenir au type Métis et39,2% au type Méré.

Dans la région de Bouaké, les élevages sontmarqués par la présence constante de taureauxZébu dans des troupeaux où on trouve à la fois desvaches Zébu, Baoulé et N’Dama. 90% des fermesvisitées maintiennent toutes des géniteurs mâlesZébu. Ce constat a été fait également à Korhogo oùles éleveurs s’adonnent au métissage de leurstroupeaux composés en majorité d’animaux Baoulé.La raison d’une telle pratique réside dansl’amélioration du format des Baoulé qui diffèresignificativement du Méré; produit du croiséZébu-Baoulé. Ce produit est très utilisé commeanimal de traction et donc très bien vendu (Landais,1983). Selon les éleveurs, la vente du Méré rapportedeux fois plus que le Baoulé. Par conséquent, unmétissage continu et non contrôlé peut mettre endanger la race locale Baoulé au profit des Méré. Eneffet, dans la région de Korhogo, le type Méréprésente une population homogène avec 83,8%d’animaux correctement classés. La situation duMéré est différente dans la région de Bouaké, avecseulement 12,5% d’animaux correctement classés.Les animaux de ce type ont été reclassés au niveaudu Zébu et du Baoulé dans les mêmes proportions(31,3%). Ceci constitue la preuve que le Méré est leproduit du croisement entre le Zébu et le Baoulé.Cependant les 21,9% d’animaux classés chez leN’Dama laissent suggérer que dans ce cas précis leN’Dama n’est pas étranger à la constitution du typeMéré ou que les éleveurs de Bouaké n’ont les mêmesdéfinition du Méré. Ceci confirme aussil’appellation de Méré souvent attribuée auxanimaux issus de croisements N’Dama - Baoulé. Ensomme, le Méré n’est peut- être pas seulement issudu croisement Zébu - Baoulé, mais également ducroisement N’Dama - Baoulé.

En ce qui concerne le Métis, l’hétérogénéité de lapopulation de ce type s’explique aisément par ladiversité des croisements dont sont issus les bovinsMétis.

Conclusion

L’inventaire des élevages dans les régions deBouaké et Korhogo a permis d’identifier 5 types debovins à viande selon les éleveurs. Ces types sont leN’Dama, le Baoulé, le Zébu, le ‘’Métis’’ et le Méré.

L’analyse discriminante a révélé que lesdescripteurs qui permettent d’identifier au mieuxces différents types de bovins sont la présence/absence de bosse, la couleur de la robe, le périmètrethoracique et la hauteur au garrot.

S’il est facile de distinguer phénotypiquement,de façon nette, un bovin Baoulé d’un bovin N’Damaou d’un bovin Zébu, ce n’est pas le cas lorsqu’ils’agit de faire une distinction entre les Zébus, lesMéré et les Métis. Le Méré, produit de croisementsZébu-Baoulé, présente une population trèshétérogène à Bouaké. Par contre à Korhogo lapopulation de Méré semble bien fixée et homogène.Les éleveurs semblent bien connaître les typesphénotypiques élevés sur leurs fermes. Lesinformations fournies par chaque éleveur compiléeset analysées ont montré qu’en moyenne 79% et 68%des animaux correspondaient aux typesphénotypiques indiqués par les éleveurs, bien quela plupart des élevages se caractérisent par laprésence de bovins Zébu, Baoulé, N’Dama, Méré etMétis dans le même troupeau. Il faut égalementnoter l’émergence du phénotype Méré dans lecheptel bovin de la Côte d’Ivoire dont lescaractéristiques sont bien connues par les éleveursdu nord du pays. Y-a-t-il besoin de s’inquiéter desconséquences du métissage opéré par leséleveurs sur la population de taurins ? Ou plutôtfaut-il les impliquer dans la conservation desressources génétiques animales dont ils semblentbien maîtriser l’utilisation? La caractérisationmoléculaire de ces bovins à viande pourra indiqueravec précision le status des taurins en Côte d’Ivoire.

Remerciement

Remerciement au Programme Concerté deRecherche – Développement sur l’Elevage enAfrique de l’Ouest (Procordel) pour l’appuifinancier.

Références

Aillerie, R.E. 1926. L’élevage en Côte d’Ivoire.Thèse Doct. Vét. E.N.V.A, pp. 70.

Choquel, P. 1969. Intérêt et utilisation desbovins trypanotolérants, pp. 170.

CIPEA. 1979. Le bétail typanotolérantd’Afrique Occidentale et Centrale. Monographie.Tome 2. Situations nationales, pp. 311.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

53


Sokouri et al.

Coulomb, J. 1976. La race N’Dama. Quelquescaractéristiques zootechniques. Rev. Elev. Méd. Vét.Pays Trop. 29 (4): 367-380.

Doutressoule, G. 1946. Zootechnie etindustries animales en Afrique occidentalefrançaise. Ec. Afric. Méd. Vét., Bamako, Mali,pp. 142.

FAO. 1986. Animal Genetic Resources DataBank: Desciptor Lists for Cattle, Buffalo, Pigs, Sheepand Goat. FAO, Rome Italy, pp. 150.

FAO/UNEP. 2000. World Watch List forDomestic Animal Diversity. B.D. Scherf (Ed.),3rd Edition. FAO, Rome, Italy, pp. 746.

IEMVT. 1978. Enquête sur les ressourcesgénétiques bovines au Mali (méthodologie).République française; Ministère de la Coopération(Fonds d’aide à la Coopération); 20, rue Monsieur757000 Paris. République du Mali; Institutd’Economie Rurale (Bamako) Fev. 1978, pp. 110.

Landais, E. 1983. Analyse des systèmesd’élevage bovin sédentaire du Nord de la Côted’Ivoire. Thèse Doct. Etat. IEMVT, Maisons-Alfort,France. 2 vol., pp. 759.

Lhoste, P. 1977. Réflexions sur les essaisd’embouche menés dans le centre de la Côted’Ivoire. Premier colloque international desrecherches sur l’élevage bovin en zone tropicalehumide. Tome 2. RCI, Bouaké 18-22 Avril 1977:683-690.

Planchenault, D. & J.P. Boutonnet. 1997.Conservation de la biodiversité des ressourcesgénétiques animales dans les pays d’Afriquefrancophones sub-saharienne. Animal GeneticResources Information, 21: 1-22.

Queval, R. & J.P. Petit. 1982. Polymorphismebiochimique de populations bovinestrypanosensibles, trypanotolérantes et leurcroisement dans l’Ouest africain. Revue Elev. Méd.Vét. Pays Trop., 35 (2): 137-146.

Tidori, E., H. Serres, D. Richard &J. Ajuziogu. 1975. Etude d’une population taurinede race Baoulé en Côte d’Ivoire. Rev. Elev. Méd.Pays Trop. 28 (4): 499-511.

Yapi-Gnaore, C.V., B.A. Oya &Ouattara Zana. 1996. Revue de la situation desraces d’animaux domestiques de Côte d’Ivoire.Animal Genetic Resources Information. 19: 99-118.

asdg

55

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 55-64

On-farm characterization and present status ofNorth Bengal Grey (NBG) cattle in Bangladesh

M. Al-Amin 1, A. Nahar 2, A.K.F.H. Bhuiyan 1 & M.O. Faruque 1

1Department of Animal Breeding and Genetics, Bangladesh Agricultural University,Mymensingh-2202, Bangladesh

2Department of Dairy Science, Bangladesh Agricultural University,Mymensingh-2202, Bangladesh

Summary

North Bengal Grey (NBG) cattle are an importantindigenous cattle genetic resource found mainly inthe northern part of Bangladesh. The study wasundertaken at Bogra Sadar, Shibgonj and KahaluUpazila (sub-district) in the Bogra district. Thephysical and morphological characteristics, and theproductive and reproductive performances of NBGcattle were studied. The coat colour of these animalsis deep grey to white. The coat colour of the neckregion in adult bulls was found to be generally ashywith a range of shades.

The body is small, compact and less fleshy. Earlength and ear width were 18.0±0.17 and11.0±0.21 cm, respectively. The head length averagewas 38.0±0.56 cm, the head width 16.0±0.17 cm, theforeleg length average 65.0±0.64 cm, the hind leglength 71.0±0.64 cm, the tail length average71.0±0.67 cm, the horn length average 9.0±0.39 cm,the horn diameter 10.0±0.37 cm, the average teatlength 5.0±0.18 cm, the teat diameter 6.0±0.22 cm,the distance between the front teats 7.0±0.13 cm andthe distance between the rear teats 7.0±0.13 cm.Body length, height at wither and heart girth inadult cows were 105.0±1.20, 94.0±1.12 and127.0±1.52 cm, respectively.

The recorded highest peak milk production perday was 3.5±0.18 kg, lactation length was219±6.1 days, and the dry period was 180±6.8 days.The average birth weight of calves was 18.4±0.52 kgand mature live weight of cows 241.0±4.0 kg. Theage at first heat was 869±29.6 days, age at firstcalving 1191±19.7 days, gestation length281±1.3 days, calving interval 442±7.4 days,postpartum heat period 110±4.2 days and thenumber of services per conception 1.4±0.6. About54% of total cattle population was NBG cattle in thesurveyed area of Bangladesh. The results indicatedthat the productive and reproductive performanceof NBG cattle was better than other non-descript

indigenous cattle of Bangladesh. The study furtherrevealed an obvious need for more in-depth andobjective information on wider samples of this typeof indigenous cattle in order to assess the futureneed for conservation and improvement programsto be undertaken.

Resumen

La raza bovina North Bengal Grey (NBG) es unaraza indígena de importante recurso genético que seencuentra en la zona norte de Bangladesh. Elestudio se inició en Bogra Sadar, Shibgonj y KahaluUpazila (Sub-distrito) en la región de Bogra. Seestudiaron las características físicas y morfológicasy los rendimientos productivos y reproductivos dela NBG. El color del manto de estos animales va delgris oscuro al blanco. El color en la zona del cuelloen los machos adultos suelen presentar variacionesde gris.

Es un animal de cuerpo pequeño, compacto ypoco carnoso. El tamaño de las orejas ycircunferencia es de 18,0±0,17 y 11,0±0,21 cm,respectivamente. La medida de la cabeza es de unamedia de 38,0±0,56 cm, la circunferencia de16,0±0,17 cm, la largura de las patas delanteras de65,0±0,64 cm, la parte trasera 71,0±0,64 cm, la colatiene una longitud de 71,0±0,67 cm, los cuernos9,0±0,39 cm, diámetro de los cuernos 10,0±0,37 cm,las tetillas 5,0±0,18 cm, circunferencia de las tetillas6,0±0,22 cm, distancia entre tetillas 7,0±0,13 cm, ydistancia entre tetillas traseras 7,0±0,13 cm. Lalongitud corporal, altura a la cruz y circunferenciatorácica en los adultos fue de 105,0±1,20; 94,0±1,12;y 127,0±1,52 cm, respectivamente.

El pico máximo de producción de leche por díafue de 3,5±0,18 kg, la duración de la lactación fue de210±6,1 días, y el período seco fue de 180±6,8 días.La media de peso al nacimiento fue de 18,4±0,52 kgy el peso a la edad madura de las vacas de

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

56North Bengal Grey cattle in Bangladesh

241,0±4,0 kg. La edad al primer celo fue de869±29,6 días, edad al primer parto 1.191±19,7 días,duración de la gestación 281,0±1,3 días, intervaloentre partos 442,0±7,4 días, periodo de celopost-parto 110,0±4,2 días y número de servicios porconcepción 1,4±0,5. Alrededor del 54% del total dela población de NBG en el cuestionario provenía dela zona de Bengladesh. El estudio revelóposteriormente la necesidad obvia de una mayorinformación sobre amplias muestras de este tipo deraza indígena para poder establecer un programafuturo de conservación y mejora de la raza.

Keywords: Genetic resource, Physical characteristics,North Bengal Grey cattle, Production, Reproduction,Measurements.

Introduction

Bangladesh is an agricultural country. Livestock,being one of the major components of agriculturaloutput (crops, livestock, fisheries and forestry) playsa vital role in national economy, contributing about6.5% of Gross Domestic Product (GDP) and 13% oftotal foreign exchange earning (DLS, 1994). Thetotal ruminant livestock population of Bangladeshis composed of 24.0 million cattle, 34.4 milliongoats, 0.83 million buffalos and 1.14 million sheep(FAO, 2002).

Bangladesh has high density cattle population.The relative density of the cattle population is wellabove the averages found in many other countries ofthe world. It ranks 12th in cattle populations in theworld, and third among Asian countries (Alam etal., 1994). Despite such a highly dense cattlepopulation, the country has been deficient in milk,meat and draught power for quite some time.The cattle resources of Bangladesh are mostly of theindigenous type (Bos indicus) with a substantialnumber of Sindhi, Sahiwal, Jersey andHolstein-Friesian crossbreeds. Indigenous cattleexperience late maturity, short lactation length, longcalving interval and poor production of milk anddraught power but are more disease resistant andcapable of thriving in harsh conditions (Majid et al.,1992).

In the developing world, the indiscriminate useof exotic animal genetic resources and poorlydesigned breeding schemes are the major reasonsfor the loss of animal genetic resources. The loss oflocally adapted breeds will have long term negativeimplications, and in most instances, will reducefood security rather than ensure it. Cattle are aninseparable and integrated part of the agricultural

operation. There are a few improved varieties ofcattle such as Red Chittagong (RC), Pabna MilkingCow (PMC) and North Bengal Grey (NBG) localizedin some areas of the country. These so called‘varieties’ of cattle have neither been identified(either by phenotypic and genetic characterization)nor has any objective study been made on theirconformation or productive and reproductiveperformance with larger sample sizes in-situ.

The North Bengal Grey (NBG) cattle may be onesuch promising variety of domestic animal geneticresource. The history of the development of thisvariety is not clear. The productive andreproductive performance of NBG cattle has not yetbeen well evaluated. The documented scientificinformation on various traits of these cattle is atpresent lacking, therefore the present study wasundertaken to evaluate and characterize the NorthBengal Grey (NBG) cattle of Bangladesh with thefollowing objectives:1. To study the probable distribution pattern of

North Bengal Grey (NBG) cattle.2. To morphologically characterize the North

Bengal Grey (NBG) cattle.3. To assess their productive and reproductive

performances.

Location and Temperature

The study area is located between 24º 30´ and25º 10´ latitude, and between 89º 00´ and89º 40´ longitude. The mean annual temperature isabout 26 º C. Mean monthly temperature rangesbetween about 18 ºC in January and 30 ºC inApril-May. Extreme temperatures range betweenabout 4 ºC and 43 ºC, except on the coast. Groundfrost is occasionally experienced in exposed parts ofthe hill areas but not on the plains.


The three Upazilas (sub-districts) namely BograSadar, Shibgonj and Kahalu under Bogra districtwere selected as the study area. These three selectedUpazilas are situated on the Northern side of theBogra district in Bangladesh. These areas were alsochosen for the reason that most of the NBG cattle arefound in that area, therefore the area wasconsidered suitable to conduct field survey. Thequestionnaire was carefully designed keeping thepurposes of the study in mind. The questionnairecontained both open and closed form questions.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

57


Al-Amin et al.

management. In general, most farmers are not usedto keeping any written information (records) ontheir livestock, so the researchers had to depend onthe memory of the respondent for obtaininginformation. The information gathered in relation tothe farmer himself was age, education, family size,occupation, and farm size. The livestock populationreferred to the total number of livestock, mainlycattle, reared by the farmer such as numbers ofmilking cows, pregnant cows, bulls, heifers,bullocks and calves of either sex. The genetic statusof the livestock was determined on the basis ofinformation provided by the farmers. The geneticstatus was mainly that of indigenous cattle,NBG Cattle and crossbred cattle.

Birth weights were taken directly with a balance.Adult body weight measurements were takenindirectly using Shaffer’s method with the help of ameasuring tape, i.e., body weight inkg = (L × G2 × 2.2)/300, where L is length (inch)from shoulder point to buttock and G is heartgirth (inch).

Results and Discussion

Origin and distribution of NBG

The distribution of the target NBG cattle ispresented in table 1. The graphical representation ofNBG cattle is given in figure 1. Most of theinterviewed farmers responded that the NBG cattlevariety originated from the crossbreeding of localcattle with those imported from Bihar and UttarPradesh in India, in pre-independence days over along period of time. This variety of cattle has goodmarket value as a cart bullock in the Northern partsof the country and elsewhere (Nasim, 1965). TheNBG cattle are available in the Northern regions ofBangladesh and although they are very rare in otherregions, due to migration or trading it is notunusual to see NBG elsewhere in the country.

Feeding and management

The feeding and management system of NBG cattlein Bogra Sadar, Shibgonj and Kahalu area remainedalmost unchanged throughout the year. Stallfeeding was mainly practiced although grazing wassometimes practiced, for example after harvestingcrops in the field. Cattle mainly lived on rice strawand green grass. Most of the animals were notprovided with any concentrate feeds.

Most easy, simple and direct questions were used toobtain information from the respondent farmers.

The questionnaire was pre-tested in order tojudge its suitability for the respondents thenfinalized, necessary modifications having beenmade. Simple and direct questions were included inthe questionnaire for the purposes of collectinginformation relating to the farmers such as age,education, occupation, family size, farm size, andfor information relating to the cattle such as feedingmanagement, production potential, reproductivecharacteristics, disease incidence, control measuresand management of North Bengal Grey cattle. Inthis study, a total number of 100 animals wereselected from three Upazilas, 40 from Shibgonj,30 from Bogra Sadar and 30 from Kahalu. Animalswere selected randomly as milking cows, dry cows,heifers, bulls, bullocks and calves

In order to collect relevant information aninterview technique was used focusing on issuessuch as the farmers’ socio-economic status,livestock population and genetic status, feedingregime, production potential, reproductiveperformance, physical characteristics,morphometric characteristics, disease control and

Figure 1. Geographic location of Bogra District inBangladesh

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Morphometric characteristics

Morphometric measurements (body length, heightat wither and heart girth) were taken from 100 NBGcattle of different categories and are given in table 2.In all categories of the animals, heart girth washighest followed by height at wither and bodylength giving the appearance of a small, compactbody. Males had greater body measurements whencompared to females. Habib et al., (2003) observedthat the body length, body height and heart girth ofadult Red Chittagon females were 114.38±1.56 cm,107.71±0.93 cm and 139.85±1.63 cm respectively.For adult male the same measurements were 134,125 and 168 cm, respectively. The mean

morphometric measurements are presented intable 3.

Physical characteristics

The coat colour of NBG cattle was mostly deep greyto white with differing shades. The neck regions ofadult bulls were an ashy shade, which is prominentand increases with age. The head was small and thecolour of the muzzles, eyelids and hooves wasblack. Figures 2 to 5 show the distinct features ofNBG cattle. Skin colour was predominantly blackbut in some of the animals was brown. The tail

Table 1. Distribution of NBG cattle in Bogra Sadar, Shibgonj and Kahalu Upazila of Bogra district in Interviewed Farmers.

Category NBG (%) Local (%) Crossbred (%) Milking cows 29.0 24.0 3.0 Pregnant cows 23.0 16.0 2.0 Bulls (Breeding) 22.0 24.0 2.0 Bulls (not used in breeding) 4.0 9.0 - Heifers 29.0 9.0 4.0 Bullocks 4.5 4.0 1.0 Calves (Male) 9.0 8.0 - Calves (Female) 8.0 4.0 1.0 Overall 54.0 41.0 5

Figure 2. A North Bengal Grey bull.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

59


Al-Amin et al.

Table 2. Body measurements of NBG cattle.

Traits Category Number Minimum Maximum Mean S.D. Cow 49 79 110 94 7.9 Heifer 29 58 102 84 7.9 Bull 17 67 105 93 9.7

Height at wither (cm)

Overall 100 50 110 91 10.4 Cow 49 67 120 105 8.5 Heifer 29 61 115 88 13.9 Bull 17 61 120 100 14.3

Body length at shoulder (cm) Overall 100 61 120 99 13.8

Cow 49 103 154 127 10.7 Heifer 29 73 145 101 16.2 Bull 17 69 156 122 19.3

Heart girth (cm)

Overall 100 69 156 117.8 18.5

Figure 3. A North Bengal Grey bull.

switch was white in all animals. The horns weresmall to medium and curved inward with pointedtips (Figure 2 and Figure 3). The ears were smalland erect with a sideways orientation and hadpointed tips. The face was small and narrow with aflat forehead. The body was small, compact and lessfleshy. The skin was tight, the dewlap was mediumand the hump was small in females and developedin males (Figure 4 and Figure 5). The tail was longand reached to below the hock. Cows had smalludders, teats and milk veins. The animals of thisbreed were usually quiet but adult males were of

aggressive temperament. Figure 6 shows a NBGcalf.

Production traits

Birth weight

Information on the birth weights of NBG cattle wasgathered from 20 calves (Table 4). Habib et al. (2003)reported that the birth weight of RC calves was17.24±0.68 kg in male and 16.0±0.66 kg in female

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Table 3. Morphometric measurements of NBG cattle.

Characteristics Number Minimum Maximum Mean S.D. Ear length (cm) 100 13 22 18 1.7 Ear width (cm) 100 8 20 11 2.1 Head length (cm) 100 23 50 38 5.7 Head width (cm) 100 11 20 16 1.8 Fore leg length (cm) 100 46 78 65 6.5 Hind leg length (cm) 100 54 88 71 6.4 Tail length (cm) 100 43 90 71 6.7 Horn length (cm) 57 3 16 9 3.9 Horn diameter (cm) 57 4 16 10 2.8 Teat length (cm) 53 3 10 5 1.3 Teat diameter (cm) 53 3 10 6 1.7 Distance between fore teats (cm) 53 5 10 7 1.0 Distance between rear teats (cm) 53 5 10 7 1.0

with an average of 16.7±0.48 kg, which was lowerthan the results from NBG calves in the presentstudy. Khan et al. (2000) observed the birth weight ofRC calves in farm and rural condition to be17.3±0.76 and 16.0±1.52 kg respectively which wasvery similar to the findings of Habib et al. (2003).

Body weight of mature cattle

The average body weight of mature NBG cows isshown in table 4. The mature live weight data wascollected from 40 NBG cows. Khan et al. (2000)

found the mature body weight of RC cows underfarm and rural conditions to be 234.28 kg and206.50 kg respectively, which is very similar to theresults obtained in the present study.

Peak milk yield

The average peak milk yield observed in29 NBG cows is presented in table 4. This estimatecame from a sample of NBG cows at various stagesof lactation, and should therefore fairly representthe daily milk yield in the NBG cow. Habib et al.

Figure 4. A North Bengal Grey cattle with calf.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

61


Al-Amin et al.

Table 4. Production performance of NBG cattle.

Characteristic Number Minimum Maximum Mean S.D. Birth weight (kg) 20 15 24 18.4 2.35 Mature body weight of cow (kg)

40 206 307 241.0 13.1

Peak milk yield (kg) 29 1 8 3.5 1.2 Lactation length (days)

39 150 365 219.0 38.2

Dry period (days) 39 60 240 180.0 42.4

Table 5. Reproductive performance of NBG cattle.

Traits Number Minimum Maximum Mean S.D. Age at first heat (days) 36 710 1460 869 177.3 Age at first calving (days) 36 1090 1460 1191 118.1 Gestation length (days) 36 269 300 281 7.9 Calving interval (days) 36 365 520 442 44.5 Postpartum heat period (days) 36 60 180 110 14.9 Services per conception 44 1 3 1.4 0.6

(2003) found the milk yield/d of RCC to be2.55±0.11 litres. Khan et al. (2000) observed anaverage daily milk yield under farm and ruralconditions to be 2.0±0.65 kg and 1.80±0.87 kgrespectively which is lower than the results in thepresent study. Bhuiyan and Faruque (1993)analyzed the daily milk yield of 340 local cows andfound it to be 1.63±0.72 kg which is also lower than

that of the present findings. In another experimentBhuiyan et al. (1992) found the average daily milkyield of local cows to be 3.00 kg. Jabbar and Ali(1988) found the milk production of local cowsaveraged 2.42±0.40 kg. From available studies awide variation in milk yields in indigenous cowshas been noticed and hints at an opportunity forselection among indigenous cattle resources in

Figure 5. A North Bengal Grey cattle.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figure 6. A North Bengal Grey calf.

order to increase milk yield in Bangladesh.Differences in genetic architecture, feeding systems,quality and quantity of rations, milker and time ofmilking may be affecting the daily milk yield ofindigenous cows.

Lactation length (LL)

The mean lactation length (LL) along with SD ofNBG cows is presented in table 4. Habib et al. (2003)reported a mean LL in RC cows of261.08±14.51 days. Khan et al. (2002) studied theLL of RC cows and found it to be 222.85±16.03 daysunder farm conditions and 214.7±21.68 days underrural conditions. These results are close to that ofthe present study on NBG cows. Ahmed and Islam(1987) summarized the performance of local cattlefor LL and found an average of 270 days, which is alittle higher than the results of present study. Hoqueet al. (1999) and Khan and Khatun (1998) studiedthe performance of PMC and found that LL rangedfrom 198.9±11.52 to 208.75±18.15 days whichpartially agrees with the findings of the presentstudy.

Reproductive traits

Age at first heat

The mean age at first heat (AFH) along with SD forNBG cattle is presented in table 5. Rahman et al.

(1987) investigated the AFH of local cows andfound it to be 1283.19±41.93 days which is higherthan the result of present study. Ashraf (1998)concluded that AFH of indigenous cows was31.0±3.29 months. Ali (1994) showed that theAFH of local cattle was 42.40 months, which ishigher than the result of present study. Fluctuationsin age at puberty of various genetic groups of cowsmight be due to the effect of environment, variedmanagement practices and heredity.

Age at first calving (AFC)

The mean age at first calving (AFC) along withSD for the NBG cattle is presented in table 5. Jabbarand Green (1983) reported the AFC of local cows tobe 3.82, 3.85 and 5.45 years for non-draught,draught-1 and draught-2 cattle respectively, whichis close to those in present study. Ghose et al. (1977)found that AFC was 1246.08±121.66 days for RCcattle. This result is very close to the results of thepresent study. Genetic and management factorsespecially feeding systems and methods of caremight have influenced this trait.

Number of services per conception

The mean number of services required perconception (SPC) along with SD for the NBG cattleis presented in table 5. SPC information was

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

63


Al-Amin et al.

available on 36 cows only. Khan et al. (1999) studiedthe performance of RCC and PMC cattle andreported that SPC were 1.61±0.09 and 1.57±0.07,respectively. Habib et al. (2003) observed the averagenumber of services required per conception for theRCC was 1.25±0.12.

Gestation length (GL)

The mean gestation length along with SD ofNBG cows is presented in table 5. The overallgestation length for NBG cows was 281±1.3 days.Ahmed and Islam (1987) and Majid et al. (1999)found the GL of RCC cows to be 281.30±1.43 and281.0±2.94 days, respectively – results which arevery close to the results in the present study.Hossain and Routledge (1982), Khan and Khatun(1998) and Khan et al. (1999) reported the GL ofPMC were 281.0, 283.61±8.23 and 279.10±1.04 days,respectively. These results are much closer to thevalues observed in the present study.

Calving interval (CI)

The mean calving interval (CI) along with SD forNBG cows is presented in table 5. Khan et al. (1999),Ahmed and Islam (1987) and Hasnath (1974)studied CI on RCC and their findings were479.50±16.94, 458.40±71.82 and 485.0 days,respectively. These results are slightly higher thanthe findings of the present study. Habib et al. (2003)found the CI of RCC cattle was 409.9±17.8 dayswhich is shorter than those in the present study.Halim (1992) studied local dairy cows and foundthey had an average CI of 445.0 days, which is veryclose to that found in the present study.

Postpartum heat period (PPHP)

The mean, SD, highest and lowest values of thepostpartum heat period are shown in table 5.Information was gathered from 36 NBG cows only.Similar results had been shown by Nahar et al.(1989). They reported that in different breed groupsPPHP ranged from 150.71±4.42 to 113.33±5.45 days.

Recommendations

The findings of the present study on the NBG cattlerevealed that more systematic studies are needed tocompare the production and reproductiveperformance of this variety of cattle with that of

other indigenous cattle in Bangladesh. It isobserved, however, that the NBG cattle variety is atrisk both from man made and natural disasters,poverty and lack of awareness and/or interest byGO and NGOs operating in the country. Therefore,stakeholders of this cattle variety must devise andimplement plans for concurrent conservation andsustainable development programs that are bothpractical and scientifically sound. Further,molecular characterization of NBG cattle todetermine their genetic constitution is essential.

Acknowledgements

The authors wish to express sincere thanks to allfarmers who provided the necessary data andinformation to carry out this study.

List of References

Alam, J., M. Akteruzzaman, A. Rahman, &Z. Ahmed. 1994. Comparative performance of localand cross-bred cows inBangladesh. Indian J. DairyScience. 47(2): 112-117.

Ahmed, Z. & T.S. Islam. 1987. Cattlebreeding program through Artificial Inseminationin Bangladesh. AI Extension Project Report CCBS,Dhaka.

Ashraf, A. 1998. A study on some economictraits of indigenous and graded cattle in Khulnaregion. M.S. Thesis, Dept. of Animal Breeding andGenetics, BAU, Mymensingh

Ali, M. 1994. Evaluation of LivestockResources and performance of indigenous lactatingcows on rice straw-based ration in Bangladesh. APh.D. Thesis. Faculty of the Graduate School,University of the Philippines at Los Banos,Philippines.

Bhuiyan, A.K.F.H. & M.O. Faruque. 1993.Yield and variability of milk production in the localcattle of Bangladesh. Proceedings of the BAURESworkshop. 13 June 1993, Bangladesh AgriculturalUniversity Mymensingh, pp. 12-17.

Bhuiyan, A.K.F.H., M.A. Matin &M.O. Faruque. 1992. Performance of purebred andcrossbred dairy cattle in Bangladesh. Proceedings ofthe 6th AAAP Animal Science Congress. IIIA. AHAT(Animal Husbandry Association of Thailand).Bangkok, Thailand, pp. 182.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


DLS. 1994. Annual Report of Directorate ofLivestock Services, Ministry of Livestock andFisheries, Dhaka, Bangladesh.

FAO. 2002. FAO production yearbook (2002).Rome, Italy, 51: 25.

Ghose, S.C., M. Haque, M. Rahman, &M. Saadullah. 1977. A comparative study of age atfirst calving, gestation period and calving intervalof different breeds of cattle, Bangladesh Vet. Journal.11(1-4): 9-14.

Habib, M.A., A.K.F.H. Bhuiyan,M.S.A. Bhuiyan, & A.A. Khan. 2003. Performanceof Red Chittagong cattle in Bangladesh AgriculturalUniversity Dairy Farm. Bang. J. Anim. Sci. 2003,32(1-2): 101-108.

Hossain, M.A. & S.F. Routledge. 1982.Performance of crossbred and local cattle undervillage conditions in Pabna district of Bangladesh.Proceeding of ‘Maximum Livestock Production fromminimum land’ seminar paper. BLRI, Dhaka,pp. 161-167

Hasnath, M.A. 1974. Studies on crossbredcattle, Research Bulletin. Department of AnimalBreeding and Genetics, BAU, Mymensingh.

Halim, A. 1992. Comparative EconomicAnalysis of local and crossbred dairy cows in aselected area of Dhaka district, Bangladesh. M.S.Thesis. Dept. of Agril. Economics, BAU,Mymensingh.

Hoque, M.A., M.R. Amin, & M.S. Hussen.1999. Dairy potential of Pabna cows andcrossbreeds with Sahiwal and Friesian and withinand between breed sire effect. Asian Aust. J. Anim.Sci., 12(2): 161-164.

Jabbar, M.A. & D.A.G. Green. 1983. Thestatus and potential of livestock within the contextof Agricultural Development Policy in Bangladesh.MS Thesis. Dept. of Agril. Economics. TheUniversity College of Wales, Aberystyth, UK.

Jabbar, M.A. & S.Z. Ali. 1988. The limitationof crossbreeding for improvement of cattle inBangladesh. Oxford Agrarian Study, Vol. 19.

Khan, M.K.I., K.S. Haque, A.G. Miah, &M.J. Khatun. 2000 study on the performance of RedChittagong cows under different production system.Pak. J. Bio. Sci. 3(2): 318-319.

Khan, M.K.I. & M.J. Khatun. 1998.Performance of F1 crossbred cows at Baghabarighatmilk shed area. Bangladesh Journal of AnimalScience, 27(1 and 2): 183-186.

Khan, A.A., A. Ali, S.S. Hussain &A.K.F.H. Bhuiyan. 1999. Reproductive performanceof different genetic group of cows under farmcondition. Bang. J. Anim. Sci. 28(1-2): 59-64.

Majid, M.A.,T.N. Nahar & M.A. Jalil. 1992.Breeding for cattle improvement in Bangladesh.Proceeding fourth national conference, BangladeshAnimal Husbandry Association, pp. 169-181.

Mason, I.L. 1988. A world dictionary oflivestock breeds, types and varieties Third edn.CAB. International, Oxford Shire.

Nasim, M. 1965. A thought on cattle breedingpolicy for East Pakistan, Proc. of seminar on EastPakistan Livestock, Dhaka. 21-34.

Nahar, N., K.G. Mostafa, & M.R. Amin.1989. A comparative study on the performance of F1crossbred cows. Bang. J. Anim. Sci. 18 (1-2): 55-62.

Rahman, M.F., N. Ahmed & A.R. Ahmed.1987. A comparative study on some productive andreproductive performances of Dairy Cows at SavarDairy and Cattle Improvement Farm. BangladeshVeterinary Journal. 21(1-10): 55-31.

65

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 65-69

The N’Dama cattle genetic improvement programme: a review

N.A. Bosso 1,2, N. Corr 1, M. Njie 1, A. Fall 1, E.H. van der Waaij 2,3, J.A.M. van Arendonk 2,J. Jaitner 5, L. Dempfle 4 & K. Agyemang 1

1International Trypanotolerance Centre, PMB 14 Banjul, The Gambia2Wageningen Institute of Animal Sciences, PO Box 338, 6700 AH Wageningen, The Netherlands

3Department of Farm Animal Health, Veterinary Faculty, University of Utrecht,P.O. Box 80151, 3508 TD, Utrecht, The Netherlands

4Technical University Munich, Department of Animal Science, D-85350 Freising-Weihenstephan, Germany5 United Data Systems for Animal Production (VIT), Heideweg 1, D-27283 Verden, Germany

Summary

This paper reviews the successful N’Dama cattlegenetic improvement programme implemented in alow input production system at the InternationalTrypanotolerance Centre (ITC) in 1994, in TheGambia. The first part of the paper presents thegenetic improvement programme. The second partdeals with the analysis of the genetic improvementprogramme. The success of the genetic improvementprogramme expressed through genetic progress andthe benefits for the farmers is encouraging.Recommendations to strengthen theimplementation process in the field are made.

Résumé

Cet article se donne pour objectif de passer en revuele programme d’amélioration génétique du bétailtrypanotolérant N’Dama. La première partie del’article fait découvrir le programme d’amélioration.La seconde partie traite particulièrement del’analyse du programme, cette analyse se base sur leprogrès génétique obtenu et les bénéfices quepeuvent en tirer les éleveurs. Pour conclure,certaines recommandations pour le renforcement duprogramme d’amélioration génétique sontproposées.

Keywords: N’Dama, Improvement programme, Lowinput system.

Introduction

The ability of some local breeds to resisttrypanosome infection has been recognised,allowing use of trypanotolerant stock to beconsidered one of the major methods by which

sustainable animal production can be developed intsetse-infested regions.

Open Nucleus Breeding Systems (ONBS) havebeen recommended in developing countries (Smith,1988). Reports show that among the improvementprogrammes implemented, few are well designed,and are facing the bottlenecks of long-termsustainability and involvement of local farmers(Kosgey et al., 2003).

This paper reviews aspects of the N’Dama cattlegenetic improvement programme implemented atthe International Trypanotolerance Centre (ITC), inThe Gambia.

Programme Implementation

The breeding goal

The goal was discussed and agreed upon with theNational Agricultural Research Services andrepresentatives of the target groups. In 1990, a Foodand Agriculture Organization (FAO) consultancymission was conducted at ITC. The report revealedthe importance of traits like disease tolerance, milkproduction, meat production and ability for traction(Dempfle, 1990).

A Participatory Rural Appraisal (PRA) studywas carried out in 1996 (Bennison et al., 1997).Based on the results, a bio-economic model wasadapted utilising all known biological andeconomic relationships (Dempfle, 1986). Thiseconomic model was used to obtain an economicdefinition of the overall breeding goal. Afterreviewing the literature and the local productionsystem, it was agreed in 1998 that the improvementprogramme should aim to increase milk and meatproduction without the loss of trypanotoleranceand other adaptive traits.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

66N’Dama cattle genetic improvement: a review

The breeding strategy

The strategy follows that of an ONBS, with selectionbased on individual performance and theperformance of relatives. It is a three-tier schemeincluding the nucleus (ITC), multipliers andcommercial farmers.

The following two activities can bedistinguished:1. generation of genetic progress; and2. dissemination of genetic progress (Van

Arendonk and Bijma, 2003).To ensure that farmers use the genetic material,

promotion of the improvement programme throughcommunication with farmers and the governmentwas very important. It involved a series ofworkshops, training, open days, farm visits, filmsand livestock shows, which demonstrated thebenefits for the production of the N’Dama cattlebreed.

Other programmes or activities also contributedsignificantly to the programme. Besides thetechnical aspects, socio-economic aspects have alsobeen undertaken.

Selection criteria

Animals in the improvement programme aremaintained under a low input management system

and details on the production system have beendescribed by Agyemang et al. (1988). Animals areselected according to an index containinginformation on daily weight gain (between15 months and 36 months in a high tsetse challengearea) and the 0–100 day milk yields of all lactations.The index integrates information on the animalitself and all relatives using animal modelBLUP methodology.

Selection candidates are located at theITC’s stations at Bansang (a high tsetse challengearea). The station located at Keneba maintains thebreeding herd of five sires and 400 cows. Each year,approximately 400 cows are mated to produce100 male and 100 female calves. These calves aremaintained at Keneba until weaning after which95 males and 90 females are moved to Bansang. Atany one time, approximately 230 males and225 female weaners are present at Bansang. At theend of the testing period (at 36 months of age),84 male and 80 female animals are available forselection.

Each year one to two males are selected out of84 candidates for replacement of the breedingmales. The second best males (around 10) aredesignated for use in the multiplication tier,whereas all others are sold to butchers to beslaughtered. From the 80 female selectioncandidates, 75 are selected and mated after which55 animals are retained based on their first lactationperformance.

Table 1. Overview of the chronological development of the N’Dama cattle genetic improvement programme.

Event Period Inception of ITC 1984Food and Agriculture Organization (FAO) consultancy mission conducted at ITC 1990 Need for a coherent and comprehensive improvement programme expressed 1993 Proposal to support the organisation of the herd into an open nucleus herd 1993 BMZ agreed to financially support the proposal 1993 Launch of the programme 1994 Records on performance 1995 Workshop organized for breeding goal 1996 Purchase of replacement discussing animals (screening) 1996/1999 Breeding goal agreed 1998 Introduction of an animal model BLUP evaluation 1998 Introduction of mechanism to disseminate genetic progress 2001 Project PROCORDEL: enhance dissemination 2000 OPEC-FID: screening operation 2002 Establishment of two livestock multiplier associations 2002 Survey of farmer acceptance 2003

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

67


Bosso et al.

Training and dissemination of geneticprogress

Training was the starting point for strengtheningthe activities of the improvement programme. Theoverall objective is to enhance the ability toimplement genetic improvement programmes, todeal with the issues and problems faced in themanagement of local indigenous breeds and to copewith new technical developments for thesustainable use of local animal genetic resources.

The cattle dissemination programme started in2001 (Table 1). As of February 2004, 44 improvedbulls have been distributed to individualmultipliers in 26 villages. In February 2004,169 offspring were registered in these multiplierherds.

For the genetic improvement programme to havean appreciable impact, two livestock multiplierassociations, Gambian Indigenous LivestockMultiplier Associations (GILMA-Saloum andFulladu), were established.

Opportunities for Improvementand Evaluation of the Scheme

The evaluation is essentially based on two maininteracting criteria: the genetic gain achieved duringthe development of the genetic improvementprogramme and the uptake of results by farmers. Wealso want to address the question of the extent towhich farmers and farming communities in Gambiaand the West African region benefit from changesbrought about by the genetic improvementprogramme.

Genetic gain

Collection of performance data over 10 years haspermitted the estimation of genetic parameters aswell as the genetic trends for growth traits(Figure 1). The estimated heritabilities for growthtraits recorded in the scheme were moderate to high(Bosso et al., 2002), ranging from 0.28 for weight at36 months to 0.48 for weight at 15 months. The

Figure 1. Figure 1. Genetic trend from 1994 to 2004 for body weight traits, showing the correlatedselection responses per year for EBV of W36 (weight at 36 months of age), BW (birth weight) andW12 (weight at 12 months of age).

0

1

2

3

4

5

6

7

1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004

Years

BV

E's

(kg

)

BW W12 W36 Linear ( BW) Linear ( W12) Linear ( W36)

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

68N’Dama cattle genetic improvement: a review

genetic correlation between weaning weight andweight at 36 months was high (0.69). Genetic andphenotypic parameter estimates are scarce in purebred indigenous N’Dama cattle populations(Figure 2) and coupled with the results of theheritability factors, they support the promise ofgenetic improvement with respect to growth rates.

Average estimated breeding values (EBV’s) ofanimals were calculated. The estimated increase inbreeding value for W36, from 1994 to 2004,fluctuated between 0 to 6.32 kg.

W36 exhibited the largest genetic gain with aresponse of 0.40 kg per year. The other weight traitsalso exhibited positive, although smaller, amountsof genetic gain.

Support to farmers’ associations

The newly formed associations remain fragile andmore work is needed to strengthen them to improvetheir access to innovations, markets and servicesthat enhance farm productivity and income. It isalso essential to make the members of theassociations aware that these associations are firstand foremost instruments for them and respond toprecise needs.

Interaction with farmers

A survey was conducted in 2003 in The Gambia.The objective was to assess the adoption of thegenetic improvement programme. One of the mostimportant benefits to farmers is the savingsgenerated by the utilization of improved males; thecost of trypanocide drugs to control trypanosomosisand other diseases is drastically reduced (50%).This is very encouraging and is likely to translate inthe future into higher mature live weight of animalsand therefore higher sale prices.

Utilization of Indigenous Breeds

Given the encouraging results of the N’Damagenetic improvement programme in The Gambia, ithas been shown to play an important role in theconservation and utilisation of N’Dama cattle. Theprogramme has significantly influenced theutilisation and development of the N’Dama breed.

Figure 2. N’Dama cattle in its environment.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

69


Bosso et al.

Benefits to farmers and cost of theimprovement programme

The programme meets the important characteristicsrequired for estimating incremental cost, because:1. it addresses national development goals;2. it is technically feasible;3. it is economically attractive, while remaining

broadly consistent with political and socialconstraints;

4. it is environmentally reasonable; and5. it is financially realistic.

It appears that the N’Dama cattle geneticimprovement programme will also benefit countriesother than The Gambia.

Conclusion andrecommendations

The N’Dama cattle improvement programmedemonstrates that genetic improvementprogrammes for a low input production system arefeasible. The success of the programme is expressedby the genetic progress achieved and this successhas been transmitted to the farmers through theinvolvement of farmers and farming communities.

Acknowledgments

The financial support of The NetherlandsFoundation for the Advancement of TropicalResearch and the Programme Concerté deRecherche-Développement sur L’Élevage en Afriquede L’Ouest for this study is gratefullyacknowledged.

List of References

Agyemang K., P. Jeannin, A.S. Grieve,M.L. Bah & R.H. Dwinger. 1988. Milk extraction forhuman consumption from N’Dama cattle undervillage management conditions in The Gambia. In:Proceedings of a meeting on livestock production intsetse affected areas of Africa. ILCA/ILRAD,pp. 231-245.

Bennison, J.J., D. Barton & J. Jaitner. 1997.The production objectives and feeding strategies ofruminant livestock owners in The Gambia:implications for policy makers. AgriculturalSystems 55, 425-444.

Bosso, N.A., E.H. van der Waaij,J.A.M. van Arendonk. 2002. Genetic parameters forgrowth traits in a pure N’Dama breed in theGambia. In: Proceedings of the 7th World Congresson Genetics Applied to Livestock Production,Montpellier, France, 19–23 August 2002, Session 25,Developing sustainable breeding strategies inmedium- to low-input systems. Volume 33,communication no. 25-30, 429–432.

Dempfle, L. 1986. Increasing the efficiency ofthe dairy cow with regard to body size. ResearchBulletin No. 4. Livestock Improvement Co., NZDairy Board, Hamilton, New Zealand.

Dempfle, L. 1990. Report on breeding andgenetics (genetic improvement) of trypanotolerantlivestock in West and Central Africa. ITCunpublished, pp. 45.

Kosgey, I.S., R.L. Baker, H.M.J. Udo &J.A.M. van Arendonk. 2003. Successes and failuresof small ruminant breeding programmes in thetropics: a review. Small Ruminant Research(in press).

Smith, C. 1988. Genetic improvement oflivestock, using nucleus breeding units. WorldAnimal Review 65, 2–10.

Van Arendonk, J.A. & P. Bijma. 2003.Factors affecting commercial application of embryotechnologies in dairy cattle in Europe – a modellingapproach. Theriogenology 59(2), 635–649.

asdg

71

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 71-78

The Poltava chicken breed of Ukraine:its history, characterization and conservation

I.G. Moiseyeva 1, M.N. Romanov 2, A.T. Kovalenko 3, T.V. Mosyakina 3,Yu.V. Bondarenko 3, P.I. Kutnyuk 3, A.P. Podstreshny 3 & A.A. Nikiforov 1

1N.I. Vavilov Institute of General Genetics (RAS), Moscow 119991, Russia2Conservation and Research for Endangered Species, Zoological Society of San Diego, Arnold and Mabel Beckman

Center for Conservation Research, 15600 San Pasqual Valley Road, Escondido, CA 92027-7000, USA3Poultry Research Institute (UAAS), Borky, Zmiiv District, Kharkiv Region 63421, Ukraine

Dedication: The authors dedicate this paper to thememory of their senior colleague and teacherVera Dmitrievna Lukyanova (1927-2006), the formerDirector of the Poultry Research Institute (UAAS),Borky, who contributed to the breeding and selectionimprovement of the Poltava Clay chickens in the1960s-1990s.

Summary

Poltava chickens are native to Ukraine, with aremarkable history, genetics and economic traits.They include three varieties: Clay, Cuckoo andBlack. The Poltava Clay variety exemplifies whatcan be achieved by thorough selection intransforming a local, low production chickenpopulation into an established breed with highperformance characteristics and selected linestructure. Two other varieties, the Cuckoo andBlack, are extinct but plans for their restoration areunderway.

Resumen

Las aves Poltava son originarias de Ucrania yposeen unos rasgos genéticos y económicos y unahistoria importante. Incluyen tres líneas: Clay,Cuckoo y Black. La línea Poltava Clay es un ejemplode lo que se puede conseguir a través de la seleccióntransformando una población local de aves de bajaproducción en una línea estable con característicasde alto rendimiento y estructura selecta. Las otrasdos variedades, Cuckoo y Black, se han extinguidopero existen planes actualmente para surecuperación.

Keywords: Characterization, Chicken, Conservation,History, Poltava, Ukraine.

Introduction

The name of the Poltava chickens of Ukraine isderived from the name of Poltava city and region.This is one of the central, long-established regions

of Ukraine, which retains the old traditions oflivestock breeding and farming. The breed used toinclude three varieties: the Clay, Cuckoo, and Black.They were registered as local populations during anexpeditionary poultry survey in the 1920’s(Ferdinandov, 1948), however, breed founders hadalready been exhibited at a poultry exhibition inPoltava in 1895. The selection of Poltava chickensfor improved performance and reproduction wasinitiated in 1912 at the Poltava Experiment Station.At that time, their yearly egg production was 70,average egg weight was 50 g, and body weight2.1 to 4 kg (Ivanova and Kovalenko, 2003;Mosyakina et al., 2005).

At the first and second all-Ukrainian eggproduction competitions in 1928-1929, the Poltavachickens demonstrated an extraordinaryproduction of 100 eggs per hen, with the best layershaving produced 164-169 eggs in the 259 days ofthe test (Romanov and Bondarenko, 1994).However, in the following years (1930-1941) mostcollective farms switched to breeding WhiteLeghorns and other standard breeds. During WorldWar II and the post-war years, changes inagriculture policies induced by the deleteriousinnovations of the Lysenko and Khrushchevparties, the transition to industrial poultryproduction and other state measures resulted in thecontinued decline of native breeds. To propagateand preserve native chicken populations, eggs of

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

72

The Poltava chicken breed

Poltava chickens were imported to the UkrainianPoultry Experiment Station (now the PoultryResearch Institute, PRI) in Borky, Kharkiv Region,from the Poltava Region in 1948-1949. Before 1953,this core breeding flock was subject to massselection coupled with individual selection. Lateron, more intense selection was undertaken toimprove the Poltava breed including all threevarieties (Clay, Black and Cuckoo), which wassupported by a special decree by the UkraineMinistry of Agriculture (Len’, 1959; Ivanova andKovalenko, 2003; Mosyakina et al., 2005).

Poltava Clay

The Clay variety is presumed to have been knownin Poltava Province from the mid 19th century. Itwas derived from local fowls crossed with BuffOrpingtons (Savelyev, 1953; Romanov andBondarenko, 1994) or other exotic breeds such asNew Hampshire, Wyandotte, etc. (Mosyakina et al.,2005). From 1951 an improvement of the Clayvariety was begun. In 1965, worthwhile strainswere chosen and selection, combined with progenytesting of sires, commenced. Since 1970, theseselected strains have been tested for general and

specific combining abilities (Lukyanova andKovalenko, 1979).

By January 1, 1985, there were 714 385 PoltavaClays at the collective and state farms of the formerUSSR. However, since 1991 there has been asignificant decline in livestock and poultryproduction and an overall gene pool loss, factorsthat also affected the state of the Poltava chickenbreed. By 1994, a total of 3 300 purebred Claychickens remained (Romanov and Bondarenko,1994). In 2003, the Borky farm as an accreditedPoltava Clay breeding centre and primary producerhad 6 000 individuals. In addition, five moreprimary and secondary producers supplied thisbreed to state and private farms in Ukraine (Ivanovaand Kovalenko, 2003; Mosyakina et al., 2005).Information about Poltava Clays was incorporatedinto the FAO DAD-IS Breeds Database (FAO, 1996)and the World Watch List for Domestic AnimalDiversity (Scherf, 1995, 2000).

Clay chickens are not particularly large birds,with a horizontal posture and legs of mediumlength and yellow colour (gene ID*ID) (Figure 1).Their comb is rose (R*R) or less frequently single(R*N). Their plumage colour ranges from buff todark buff (genes of wheaten colouration MC1R*WH,MC1R*Y, MH*MH, DI*DI, CB*CB, and of gold S*N),

Figure 1. A cock of the Poltava Clay variety.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

73


Moiseyeva et al.

and is of a “black-tailed” Columbian type (CO*CO).Clay chickens are somewhat larger than theCuckoos and Blacks (Len’, 1961).

The Poltava Clay has been subject tomorphotypological characterisation (Nikiforov et al.,1998) and assessment for blood groups(Podstreshny, 1980; Gintovt et al., 1984), and bloodserum and egg white proteins (Bondarenko, 1976;Moiseyeva et al., 1989). As a result of these studies,Poltava chickens were found to be closer to breedsof Asian origin including dual-purpose breeds fromRussia and China. Romanov and Weigend (2001)included two Poltava Clay strains, P6 and P14, in amicrosatellite diversity study of 20 populations.Both Poltava strains were clustered together withcommercial and other strains derived from RhodeIsland Reds and New Hampshires (Figure 2). In alarge-scale survey (AVIANDIV, 2001), estimation ofpolymorphism degree for 25 microsatellite markersresulted in somewhat greater values in the Poltavabreed in comparison with the “world” gene pool.

Clay chickens are well adapted to localconditions, can forage effectively and areundemanding feeders. They have broodiness andan overall calm demeanour and can be reared bothon floors and in cage batteries of various types

including individual cages for artificialinsemination. The Poltava Clay is a dual-purposebreed, but some strains were selected with a biastowards egg or meat productivity. In strains selectedfor body weight, the cocks weigh up to 3.2 kg, andthe hens 2.2 kg. Strains selected for egg productionproduce 210-240 eggs in 72 weeks. The breed issubject to continuous selection for increasedviability, resistance to stress, neoplasms and Marekdisease. Eggshell colour is brown (Ivanova andKovalenko, 2003; Mosyakina et al., 2005). Chicks areearly feathering (gene K*N) and fast growing(Bondarenko, 1995). Clay fowls are more resistant toRous sarcoma virus and neoplasms as compared toWhite Leghorns and White Russians (Stolyarenko,1970; Kovalenko and Stolyarenko, 1982).

Poltava Clays are used as a dam strain incrossing with White Leghorns. Hybrids areresistant to oncoviruses, have brown eggshell,produce 222-243 eggs per hen housed and235-252 eggs per hen survived for 69 weeks of life.Synthetic lines (‘polycrosses’ of three to nine lines)were developed based on Poltava Clay chickensincluding two lines combining Poltava Clay andRhode Island Red strains (Lukyanova and

Figure 2. A hen of the Poltava Clay variety.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

74


Kovalenko, 1979; Romanov and Bondarenko, 1994;Ivanova and Kovalenko, 2003).

Poltava Cuckoo

The period of development of the Cuckoo variety ispresumed to be the 19th century. Original forms areunknown (Figure 3), although the relationship withBarred Plymouth Rocks is repudiated (Savelyev,1953). In 1954, the Cuckoo population was33.8 thousand birds. Currently, it is probably extinct(Mosyakina et al., 2005). The body constitution ofthe Cuckoo corresponds to that of egg type fowls(Figure 4 and 5). The comb is predominantly rose(gene R*R) or single (R*N), and earlobes are red. Inplumage colour, they resemble the Barred PlymouthRock (genes BARR*BARR, MC1R*E), but unlike thelatter are characterised by interchanging light greyand dark grey bars. Cocks are lighter than hens(Penionzhkevich, 1962).

Poltava Black

The variety is presumed to have been developed inthe 19th century. Its ancestors are unknown. In thepast, Black fowls were reared in Lubny District(Penionzhkevich, 1962). They numbered42.9 thousand birds in 1954 (Solodky, 1956) and8.5 thousand birds in 1964 (Iofe, 1968). At present,the variety is extinct (Mosyakina et al., 2005). Theirbody size is relatively small (Figure 6 and 7). Thechickens have a rose (gene R*R) or single (R*N)comb, and a short, black beak. The self-blackplumage colour (MC1R*E) is not glittering but dullin the females, and often glittering in the males(Len’, 1959; Romanov and Bondarenko, 1994;Romanov et al., 1996; Ivanova and Kovalenko, 2003;Mosyakina et al., 2005). Legs are slate (ID*N).

In 2005, a plan to restore the Cuckoo and Blackvarieties was developed at the PRI because they hadgood potential for performance and were quitenumerous and competitive.

98

40

4426

28

30

31

20

100

32

48

49

60

94

71

95

5420

Figure 2. Dendrogram of phylogenetic relationships among 20 chickenpopulations, using Nei's (1972) standard genetic distance and the NJ method,based on 14 microsatellite loci. Consensus tree: numbers at the nodes arepercentage bootstrap values from 1000 replications with resampled loci.Ukrainian populations: Ukrainian Bearded (UB), Poltava Clay (P6, P14),Yurlov Crower (YC), and Australorp Black (ABU). German populations: RedJungle Fowl (Gallus gallus; GG1, GG2, GG3), Bergische Kräher (BK1, BK2,BK3), Bergische Schlotterkämme (BS1, BS2, BS3), Ramelsloher White (RW),Westfälische Totleger (WT), Australorp Black (ABG1, ABG2), and commerciallayer lines (L1, L2) (from Romanov and Weigend, 2001).

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

75


Moiseyeva et al.

Figure 4. A cock of the restituted Poltava Cuckoo variety.

Figure 5. A hen of the restituted Poltava Cuckoo variety.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

76


Figure 6. A cock of the restituted Poltava Black variety.

Figure 7. A hen of the restituted Poltava Black variety.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

77


Moiseyeva et al.

List of References

AVIANDIV. 2001. Final Report.Development of Strategy and Application ofMolecular Tools to Asses Biodiversity in ChickenGenetic Resources (AVIANDIV). Contract numberBIO4-98-0342.

Bondarenko, Yu.V. 1976. GeneticPolymorphism of Egg White and Serum Proteins inChickens with Relation to Selection Direction andProductivity Level. Author’s Abstract of Candidateof Biological Sciences Thesis, Kharkov, USSR,(In Russian.)

Bondarenko, Yu.V. 1995. Genetic Basis ofBreeding and Utilisation of Autosexing Poultry.Author’s Abstract of D.Sc. in Biology Thesis,Kharkiv, Ukraine, (In Russian.)

Bozhko, P.Yu. & M.V. Dakhnovs’ky (Eds).1955. Poultry Farming. Derzhavne vydavnytstvosil’skogospodars’koy literatury, Kyiv, USSR.(In Ukrainian).

FAO. 1996. Domestic Animal DiversityInformation System, www.fao.org/dad-is/, FAO, Rome,Italy.

Ferdinandov, V.V. 1948. Thirty years of theSoviet poultry farming. In V.I. Korol’kov (Ed.),Transactions of Voronezh Zootechnical Institute,Voronezh, USSR, Vol. 11, 81-94. (In Russian).

Gintovt, V.E., K.K. Karimov, A.M. Mashurov,I.A. Paronyan & Z.I. Berendyaeva. 1984. A study ofthe gene pool of poultry by means of immunogeneticanalysis. II. Estimation of interbreed differences.Soviet Genetics 20, 274-280. (Translated fromGenetika 20, 337-344.)

Iofe, N. 1968. On conservation andutilization of poultry gene pool in the USSR.Ptitsevodstvo, No. 4, 31-33. (In Russian).

Ivanova, T. & G. Kovalenko. 2003. PoltavaClay chickens. Propozitsiya, No. 6, 74-75; no. 7,84-86. (In Ukrainian).

Kovalenko, A.T. & V.P. Stolyarenko. 1982.Resistance to neoplasms in Leghorns and PoltavaClay chickens. Ptakhivnytstvo, 33, 6-8. (In Russian).

Len’, T.S. 1959. Poltava chickens of theUkrainian Poultry Experiment Station. ScientificTransactions of Ukrainian Poultry ExperimentStation, Vol. 7, 114-123. (In Ukrainian).

Len’, T.S. 1961. Comparative study onPoltava chickens. Ptakhivnytstvo, 1, 22-29.(In Ukrainian).

Lukyanova, V.D. & A.T. Kovalenko. 1979.Prospects for gene pool utilisation in selection.Ptitsevodstvo, no. 10, 26-29, (In Russian).

Moiseyeva, I.G., S.K. Semyonova,N.S. Gorbacheva, I.A. Paronyan, V.A. Volokhovich,K.K. Karimov & N.I. Sakhatsky. 1989. Studies onchicken breeds at the USSR collection farms. InDubinin, N.P. (Ed.), Advances in Current Genetics,Vol. 16, 45-70. (In Russian).

Mosyakina, T.V., G.T. Kovalenko,Yu. O. Ryabokon’, I.A. Stepanenko,O.O. Katerinich, V.P. Nalivaiko & L.A. Lunina.2005. Poltava Clay Chickens (Recommendations forBreeding). Poultry Research Institute (UAAS), StateEnterprise ‘Experimental Farm Borky’, Borky,Ukraine. (In Ukrainian).

Nei, M. 1972. Genetic distances betweenpopulations. American Naturalist 106: 283-292.

Nikiforov, A.A., I.G. Moiseyeva &I.A. Zakharov. 1998. Position of Russian chickenbreeds in the diversity of Eurasian fowl. RussianJournal of Genetics 34, 702-703. (Translated fromGenetika 34, 850-851.)

Penionzhkevich, E.E. 1962. Exterior andbreeds of poultry. In Penionzhkevich, E.E. (Ed.),Poultry, Izdatel’stvo sel’skokhozyaystvennoyliteratury, zhurnalov i plakatov, Moscow, USSR,Vol. 1, 200-262. (In Russian).

Podstreshny, A.P. 1980. Study on BloodGroups in Laying Hens in Association with LineOrigin and Performance Level. Author’s Abstract ofCandidate of Biological Sciences Thesis, Institute ofGeneral Genetics, USSR Academy of Sciences,Moscow, USSR. (In Russian).

Romanov M.N. & S. Weigend. 2001.Analysis of genetic relationships between variouspopulations of domestic and jungle fowl usingmicrosatellite markers. Poultry Science 80,1057-1063.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

78


Romanov, M.N. & Yu.V. Bondarenko. 1994.Introducing the Ukrainian indigenous poultry - thePoltava chickens. Fancy Fowl 14, No. 2, 8-9.

Romanov, M.N., S. Wezyk, K. Cywa-Benko& N.I. Sakhatsky. 1996. Poultry genetic resources inthe countries of Eastern Europe - history andcurrent state. Poultry and Avian Biology Reviews 7,1-29.

Savelyev, I.K. 1953. Chicken Breeds.Sel’khozgiz, Moscow, USSR. (In Russian).

Scherf, B.D. (Ed.). 1995. World Watch List forDomestic Animal Diversity. 2nd Edition, FAO, Rome,Italy.

Scherf, B.D. (Ed.). 2000. World Watch List forDomestic Animal Diversity. 3rd Edition, FAO, Rome,Italy.

Solodky, M.M. 1956. Poltava chicken breedgroups. Ptitsevodstvo, No. 1, 27. (In Russian).

Stolyarneko, V.P. 1970. Comparativeestimation of chick embryo susceptibility to Roussarcoma virus in different lines and breeds. InCollection of Young Scientists’ Papers, All-UnionPoultry Research and Technological Institute,Zagorsk, USSR, no. 11, 497. (In Russian).

79

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 79-85

Pure line laying chickens at the Agassiz Research Centre

F.G. Silversides 1, D. McQ. Shaver 2 & Y. Song 1

1Agassiz Research Centre, P. O. Box 1000, Agassiz, British Columbia, Canada V0M 1A02Suite 901, 20 Berkley Road, Cambridge, Ontario, Canada N1S 4S8

Agriculture and Agri-Food Canada ContributionNumber 740

Summary

Six lines of laying chickens representinghigh-producing non-industrial lines chosen orproduced with consideration for characters ofproduction are being kept at the Agassiz ResearchCentre. The collection includes one BarredPlymouth Rock (Line 60), one Columbian PlymouthRock, one Rhode Island Red (Line 50), and threeWhite Leghorn lines (Blue, Black, and Burgundy).Before coming to the Agassiz Research Centre thesepure lines were subjected to mild selection for eggproduction and their egg production approachesthat of commercial hybrids. The lines are currentlymaintained as a genetic resource as livepopulations without selection and withpopulations large enough to minimize inbreeding.In addition, samples of DNA from these lines havebeen conserved for genetic studies, and samples ofembryonic cells are being kept cryogenically toallow the possibility of reconstitution of the linesthrough the production of germline chimeras.Techniques of ovarian transplantation are beingdeveloped which will allow more efficient cryogenicconservation and recuperation of the geneticmaterial into live populations.

Résumé

Six lignées de poules pondeuses représentant deslignées de hautes production mais non industrielleschoisies ou produites en considérant des caractèresde production sont gardées au centre de recherchesd’Agassiz. La collection inclut une lignée dePlymouth Rock Barrée (Lignée 60), une de PlymouthRock Colombienne, une de Rouge de Rhode Island(Lignée 50), et trois lignées Leghorn Blanches (Bleu,Noir, Bourgogne). Dans le passé, ces lignées ont étésoumises à la sélection pour les caractères deproduction et la production d’œufs des ces lignéespures s’approche à celle des lignées hybridescommerciales. Ces lignées sont actuellementmaintenues comme ressources génétiques commedes populations vivantes sans sélection avec despopulations suffisamment grandes pour minimiser

la consanguinité. En plus, des échantillons d’ADNdes ces lignées sont gardés pour les études degénétique et des échantillons des cellulesembryoniques sont gardés en congélation pourpermettre la reconstitution de ces lignées par moyendes chimères des lignées de cellules germe. Destechniques de transplantation ovarienne sousdéveloppement vont permettre la conservationcryogénique plus efficace avec récupération dumatériel génétique dans les populations vivantes.

Keywords: Laying chicken, Middle level poultry,Genetic conservation, Cryogenic storage.

Industrialization of ChickenBreeding in Canada

In 1946, 263 breeders of laying chickens wereentered in Canadian Record of Performanceprograms. At that time, there may have been another40 breeders of chickens, as many as 20 breeders ofturkeys and up to 18 breeders of waterfowl. By 1980,Crawford (1984a) was able to find only13 middle-level poultry breeders in Canada, defined(Crawford, 1984b) as breeders of those traditionalbreeds that were usually kept for both meat andeggs. These breeders kept a total of 20 stocks,including 11 strains of chickens, one of turkeys, andeight of waterfowl. Most of these lines have sincebeen lost.

At one time, poultry meat and eggs in Canadawere produced from middle-level lines. However, inthe 1950s and 1960s, some breeding companiesbegan to dominate the market not only in Canadabut around the world and produced stock that wasspecialized for production of either meat or eggs(Carter, 1964). Consolidation resulted in aprogressively smaller number of companies, now

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

80Pure line laying chickens

known as primary breeders, which maintainedbreeding populations, practiced selection forcommercial production, and sold hybridindividuals that would become the parents ofcommercial offspring.

Canada has been home to two of these primarypoultry breeders. According to Crawford (1984b),Hybrid Turkeys Ltd. was a family-owned companyin 1979, but was subsequently purchased by acorporation based in The Netherlands. The othermajor Canadian primary breeder was ShaverPoultry Breeding Farms Ltd., which sold both layerand broiler chickens but was a dominant force inthe international layer market. Crawford (1984b)reported that Shaver Poultry Breeding Farms Ltd.kept a large reserve of genetic resources. In 1985,D. McQ. Shaver retired as Chairman and ChiefExecutive Officer of the company and ShaverPoultry Breeding Farms Ltd. is now owned byHendrix Breeding Farms, one of only two majorprimary breeding companies of laying chickens inthe world.

In his retirement, D. McQ. Shaver becameinvolved in poultry breeding as a non-commercialhobby and acquired eight lines of laying chickenswhich he kept for a number of years. In 2003, six ofthe lines were transferred to the Agassiz ResearchCentre of Agriculture and Agri-Food Canada. Apolicy on the release of these lines to interestedparties is currently under development. This reportis a description of these six lines of laying chickens.

Background of the Agassiz Lines

The six layer lines kept at the Agassiz ResearchCentre include one Barred Plymouth Rock (Line 60),one Columbian Plymouth Rock, a Rhode Island Red(Line 50), and three White Leghorn lines (Blue,Black, and Burgundy). General descriptions of thesebreeds are provided by the American PoultryAssociation (1983). Before coming to the AgassizResearch Centre, the lines were maintained byproducing 425 females and 80 males in eachgeneration. Production of the females was recordedand the best 200 were chosen on the basis of eggproduction, early egg size, and egg shell quality,with minor selection for egg colour. Males from thebest 75 females were used for the next generation.This mating system should result in an effectivepopulation size of 218 and an increase ininbreeding of 0.229% per generation (followingFalconer, 1989).

The Barred Plymouth Rock (Line 60) originatedin the late 1950s from Harco stock, a well knownline from Massachusetts. Before coming to theAgassiz Research Centre, it had been maintained bypedigree matings for more than 50 generations. TheK gene has been maintained in Line 60 whichwould allow feather sexing if desired. This linecould be crossed (as the mother line) with the RhodeIsland Red (Line 50).

The Columbia Plymouth Rock Line wassynthesized in the early 1960s from several stockscarrying the silver gene, S, (Light Sussex, WhiteLeghorn) or others (Rhode Island Red) and thepopulation was closed in about 1972. Matingfemales of this line (S-) with Rhode Island Redmales (ss) allows the male and female offspring to beseparated on the basis of colour. This line isconsidered to be a very rustic line.

The Rhode Island Red (Line 50) is considered tobe from the long established Warren strain. The lineis known to cross well with Barred Plymouth Rocksand Columbian Plymouth Rocks, which wasconfirmed by testing both in-house and at theUniversity of Guelph. Before coming to the AgassizReseach Centre, Line 50 was reproduced for morethan 50 generations by pedigreed matings. It isknown for its rusticity and the ability to perform onsub-optimum nutrition levels. The slow featheringK gene is maintained in the line to allow feathersexing if needed.

The Blue White Leghorn Line was synthesizedin the late 1970s from commercial stocks that wereknown for high interior egg quality, to which theCornell K Line (Cole and Hutt, 1973) was added toincrease resistance to leukosis. The Blue Line hasbeen used as the mother of a hybrid, with theBurgundy line as father, which is used as themother of a cross to the Black line.

The Black White Leghorn Line was founded onTancred and Hollywood lines in the late 1920s andhas been maintained by pedigree matings from thenuntil it came to the Agassiz Research Centre. Thisline is known as a male line and has been crossed tothe Blue line either as a two-way cross or in athree-way cross including the Burgundy line.

The Burgundy White Leghorn Line wasdeveloped from three commercial lines. Thefast-feathering gene, k, has been eliminated and theinclusion of slow feathering, K, allows this line to becrossed to a fast-feathering line to produce afeather-sexable cross. The Burgundy line has beenused as the father of a mother line, with the hybridbeing crossed to the Black line.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

81


Silversides et al.

for five days per week and extrapolated to sevendays, and egg weights were recorded at 30, 40, 50,and 60 weeks. Data was recorded to 40 weeks of agefor the Black and Blue lines and to 60 weeks of agefor the other four lines.

Production Results andDiscussion

The general appearance of the hens is shown infigure 1. The three lines of White Leghorn have avery similar appearance and only one is shown torepresent all three. The feather colour and pattern ofeach of the lines is as described by the AmericanPoultry Association (1983). However, these lines

Management and DataCollection

Eggs are incubated artificially, chicks are reareduntil 16 weeks of age in groups of 30, and pulletsare subsequently caged in groups of three. Feed andclean water are provided to allow for ad libitumconsumption. Day length is kept at nine hours until18 weeks, when it is increased to 14 hours. Astandard vaccination program for the area is used.

Production data were recorded in the firstgeneration after the chicks arrived at the AgassizResearch Centre. Body weight was monitoredduring the rearing period and recorded forindividual birds at housing (16 wk) and at 20, 40,and 60 weeks of age. Egg production was measured

Figure 1. Barred Plymouth Rock (Line 60), Columbian Plymouth Rock, Rhode Island Red (Line 50), andWhite Leghorn (Black, Blue, Burgundy Lines) hens.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


have not been selected for exhibitions and thecolour and pattern demonstrate variation that theAmerican Poultry Association (1983) wouldconsider to be defects. These do not affectproduction characteristics.

The American Poultry Association (1983)provides standard body weights for cockerels andpullets, defined as male and female birds less than ayear old. At 40 weeks of age, body weights of thesesix lines (Table 1) are all lower than the cockereland pullet weights described by the AmericanPoultry Association for these breeds, except thatBlack line males are very close to the AmericanPoultry Association standard of 5 lbs (2 273 g).Lohman (2005a) expects their LSL-Lite hen to weigh1 593 g at 40 weeks which is very close to the Black,Blue, and Burgundy lines. The Lohman BrownClassic Guide (Lohman, 2005b) shows a range ofbody weights from 1 848 to 2 042 g at 40 weeks,which encompasses body weights for females of theBarred Plymouth Rock, Columbian Plymouth Rock,and Rhode Island Red females. Synthesis andselection of these lines for productioncharacteristics appears to have produced bodyweights nearer to commercial than fancierstandards.

Management guides (Lohman 2005a, 2005b)also give expected egg production of hybridcommercial hens. Peak production of LSL-Lite hensis expected to be 94.2 hen-day-percent at 31 weekswith greater than 90 % hen-day production for23 weeks, and that for Lohman Brown Classic hensshould be 93.0 hen-day-percent at 28 weeks withgreater than 90 % hen-day production for 14 weeks.Lohman expects their LSL-Lite hybrids to produce126.6 eggs to 280 days of age (247.3 eggs to420 days) and their Classic Brown hens to produce128.0 eggs to 280 days of age (243.3 eggs to420 days).

The egg production levels of the Agassiz purelines are less than that expected for commercialhybrids (Table 2). Only the Rhode Island Red linereached the same peak production as expected forLohman lines (93.0 hen-day-production), althoughpeak production for the Barred Plymouth Rock,Black, and Burgundy lines approached thatexpected from Lohman hybrids. Hen housed eggproduction of Black line hens to 40 weeks of agewas only 2 eggs lower than that expected ofLohman LSL-Lite hens and that of Blue line henswas only 4.5 eggs less. Fairful (1990) summarizedresearch showing that heterosis for egg productiontraits is consistent and substantial, with a rangeof -3 to 40 % but commonly above 10%. The eggproduction of the Agassiz pure lines shown in

table 2 suggests that hybrids produced by theselines could be expected to equal or exceed that ofcommon commercial hybrids.

The high egg production of these lines may havebeen obtained at the expense of egg weight (Table 3)because of the negative correlation between eggproduction and egg weight (Fairful and Gowe,1990). Weight of eggs from a commercial white-eggline (Lohman, 2005a) can be expected to be 59.2 g at31 weeks and 61.9 g at 41 weeks, which is clearlymore than that seen for the Agassiz White Leghornlines. Egg weight from the Agassiz Brown-egg lineswas also lower than expected for commercialhybrids (Lohman 2005b). Although early eggweight was low for both white and brown-egg lines,it increased more rapidly than expected fromcommercial lines over the production cycle. Eggs inNorth America are marketed on the basis of gradewhich is largely based on egg size, and the mostvaluable egg size is 56 to 60 g. Egg size of theAgassiz pure lines fell within this range for most ofthe production cycle.

Conservation Plans

At the Agassiz Research Centre, the six lines arekept as populations of at least 160 females (more ifspace allows) and 64 males per line which shouldresult in an effective population size of 183 and anincrease of inbreeding of 0.27 % per generation(following Falconer, 1989). Lines are reproducedyearly using artificial insemination. Semen fromgroups of eight males is mixed and used on20 females. No selection is practiced except againstobvious defects.

Samples of DNA were obtained from 15 malesand 15 females of each line of the originalpopulations that came to the Agassiz ResearchCentre. Following techniques from J. E. Fulton(Hy-Line International, personal communication),forty ml of packed RBCs were suspended in 3 μl oflysis buffer (10 mM Tris-HCl pH8.0, 400mM NaCl,2mM disodium EDTA), to which 200 μl 10% SDSwas subsequently added. The mixture was digestedwith 16 μl proteinase K (20 mg/ml) overnight at37°C with shaking, and the protein was removed byadding 2 ml of 5M NaCl to each sample, after whichthe DNA was precipitated by ethanol. Samples arestored at – 20°C.

Primordial germ cells, harvested from embryonicblood or the primitive gonad, can be cryopreservedand used to generate germline chimeras, allowingthe preservation of both male and femalegermplasm (Petitte, 2006). Creation of germline

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

83


Silversides et al.

Tab

le 2

. Egg

pro

duct

ion

of s

ix li

nes

of la

ying

hen

s.

P

eak

pro

du

ctio

n H

en h

ouse

d e

gg p

rod

uct

ion

(±SD

) L

ine

Hen

s ho

use

d1

% h

en d

ay

Age

(w

k)

Wee

ks a

bove

90%

he

n-d

ay p

rod

uct

ion

To

280

day

s of

age

T

o 42

0 d

ays

of a

ge

Bar

red

Ply

mou

th R

ock

270

91.6

24

5

117.

9±8.

1 22

3.2±

15.0

C

olu

mbi

an P

lym

outh

Roc

k 27

0 87

.9

24

0 11

6.7±

10.6

21

5.5±

24.4

R

hod

e Is

land

Red

27

3 93

.0

26

7 12

0.6±

10.6

22

8.8±

23.0

B

lue

312

90.0

25

2

122.

1±12

.4

- B

lack

31

2 92

.6

25

7 12

4.6±

10.8

-

Bu

rgu

ndy

273

92.4

27

6

120.

7±10

.6

228.

8±23

.5

1 Hou

sed

in c

ages

hol

din

g th

ree

hens

eac

h.

Tab

le 1

. Bod

y w

eigh

ts (

g ±

SD)

of m

ale

and

fem

ale

chic

kens

from

six

line

s.

M

ales

Fe

mal

es

Lin

e N

o.

16 w

k 20

wk

40 w

k 60

wk

n (>

20

wk)

16

wk

20 w

k 40

wk

60 w

k B

arre

d P

lym

outh

Roc

k 64

1

999±

174

2 34

9±22

3 2

736±

253

3 13

9±30

7 15

6 (1

35)

1 44

5±12

3 1

783±

159

1 99

7±20

1 2

109±

238

Col

um

bian

Ply

mou

th R

ock

64

1 84

8±16

6 2

032±

209

2 37

7±28

0 2

783±

343

156

(135

) 1

334±

137

1 66

6±17

8 1

878±

248

1 98

9±28

9 R

hod

e Is

land

Red

64

2

135±

178

2 36

0±20

6 2

737±

246

3 18

5±29

0 15

6 (1

34)

1 48

8±11

4 1

817±

157

2 04

5±23

8 2

164±

258

Blu

e 64

1

471±

102

1 71

2±12

3 2

063±

183

- 15

0 1

119±

102

1 39

4±12

2 1

516±

169

- B

lack

64

1

551±

115

1 88

8±15

1 2

311±

207

- 15

0 1

167±

99

1 49

7±12

7 1

666±

165

- B

urgu

ndy

64

1 62

5±14

5 1

773±

148

2 06

2±16

6 2

354±

195

156

(130

) 1

157±

93

1 45

0±12

3 1

630±

162

1 70

1±20

7

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Table 3. Weight of eggs from six lines of laying hens.

Line No. Week 31 Week 41 Week 51 Week 61 Barred Plymouth Rock 83 to 139 55.2±3.4 58.7±4.0 60.3±4.0 61.1±4.4 Columbian Plymouth Rock 72 to 127 54.1±4.5 57.5±4.7 58.4±5.0 58.9±5.6 Rhode Island Red 86 to 131 56.6±4.0 60.0±4.3 61.9±5.2 62.6±5.1 Blue 123 to 124 52.3±3.5 56.1±3.7 - - Black 126 to 138 52.5±3.3 57.2±3.9 - - Burgundy 80 to 140 55.0±4.2 59.0±4.7 61.0±5.1 62.2±5.2

chimeras from cyropreserved gonadal primordialgerm cells (Tajima et al., 1998; Song et al. 2005)requires approximately 10 pairs of gonads togenerate one germline chimera. Three hundredpairs of Stage 27 gonads from each of the six linesrepresenting 90 individual birds per line werecryopreserved (Tajima et al., 1998), which shouldallow recovery of 30 individual birds by productionof germline chimeras if needed.

A surgical technique for orthotopictransplantation of ovarian tissue in newly hatchedchickens has been developed (Song and Silversides,2006) and used to produce donor-derived offspringfrom the host hens (Song and Silversides, 2007).This provides an alternative approach forcryopreserving avian female germplasm, andresearch is underway to evaluate the efficiency ofusing cryopreserved ovaries to give rise todonor-derived offspring. Once this has beendemonstrated, ovaries from newly hatched chicksfrom each of six lines will be stored in liquidnitrogen.

List of References

American Poultry Association. 1983. TheAmerican Standard of Perfection. American PoultryAssociation, Inc., Troy, New York, USA, pp. 208.

Carter, T.C. 1964. Modern trends in animalhealth and husbandry: poultry breeding. BritishVeterinary Journal 120: 506-517.

Cole, R.K. & F.B. Hutt. 1973. Selection andheterosis in Cornell White Leghorns: a review, withspecial consideration of interstrain hybrids. AnimalBreeding Abstracts 41: 103-118.

Crawford, R.D. 1984a. Assessment andconservation of animal genetic resources in Canada.Canadian Journal of Animal Science 64: 235-251.

Crawford, R.D. 1984b. Domestic Fowl.Chapter 42. In: I.L. Mason (Ed.), Evolution ofDomestic Animals. Longman, New York, New York,USA, pp. 452.

Crawford, R.D. 1990. Poultry geneticresources: evolution, diversity, and concentration.Chapter 2. In: R.D. Crawford (Ed.), Poultry Breedingand Genetics. Elsevier, New York, New York, USA,pp. 1123.

Fairful, R.W. 1990. Heterosis. Chapter 37. In:R. D. Crawford (Ed.), Poultry Breeding andGenetics. Elsevier, New York, New York, USA,pp. 1123.

Fairful, R.W. & R.S. Gowe. 1990. Genetics ofegg production in chickens. Chapter 29. In:R.D. Crawford (Ed.), Poultry Breeding and Genetics.Elsevier, New York, New York, USA, pp. 1123.

Falconer, D.S. 1989. Introduction toQuantitative Genetics, 3rd edition. Longman , NewYork, New York, USA, pp. 438.

Lohman. 2005a. Layer Management Guide,Lohman LSL-Lite, North American Edition.Lohman Tierzucht, Cuxhaven, Germany, pp. 24.

Lohman. 2005b. Layer Management Guide,Lohman Brown-Classic. Lohman Tierzucht,Cuxhaven, Germany, pp 24.

Petitte, J.N. 2006. Avian germplasmpreservation: embryonic stem cells or primordialgerm cells? Poultry Science 85: 237-242.

Song, Y. & F.G. Silversides. 2006. Thetechnique of orthotopic ovarian transplantation inthe chicken. Poultry Science 85: 1104-1106.

Song, Y. & F.G. Silversides. 2007. Offspringderived from orthotopic ovarian transplants inchickens. Poultry Science 86: 107-111.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

85


Silversides et al.

Song, Y., S. D’Costa, S.L. Pardue &J.N. Petitte. 2005. Production of germline chimericchickens following the administration of a busulfanemulsion. Molecular Reproduction andDevelopment 70: 438-444.

Tajima, A., M. Naito, Y. Yasuda &T. Kuwana. 1998. Production of germ-line chimerasby transfer of cryopreserved gonadal primordialgerm cells (gPGCs) in chicken. Journal ofExperimental Zoology 280: 265-267.

asdg

87

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

AGRI 2007, 40: 87-101

Status and conservation of Mewari and Jaisalmeri camels in India

S.C. Mehta 1, B. Bhardwaj 2 & M.S. Sahani 1

National Research Centre on Camel, P.O. Box - 07, Bikaner 334001, India2Veterinary Polyclinic, Udaipur, Rajasthan, India

Summary

The Mewari and Jaisalmeri breeds of camel areamong the four major breeds of Indian camel. TheMewari breed is known for the production of milkand its adaptability to the hilly terrain of theAravali hills in south Rajasthan whereas theJaisalmeri breed is known for its riding and racepotential. A total of 320 camels from 16 herds ineight villages belonging to three districts of themajor breeding tract of the Mewari camel werecovered. The population of the Mewari camel wasestimated to be 16 221 heads with a 28% decline inthe last five years. The extent of cross breeding wasestimated to be 36%. The average adult Mewaricamel had a 193 cm height at wither, 194 cm heartgirth and 158 cm body length. Adult Mewari camelsproduce about 700 grams of hair per annum and thefemales produce 5-7 litres of milk per day. Anintegrated rotational grazing pasture developmentprogramme could be of great use in maintaining theMewari camels with diverse livestock species underoptimum production.

To define the status of the Jaisalmeri camel, aninvestigation encompassing 1 760 camel breedersbelonging to the 181 villages distributed over theentire strata of the tract was carried out. Thepopulation of the Jaisalmeri camel was estimated tobe 118 083 heads with a 31% decline in the last fiveyears. An adult Jaisalmeri camel had a 199 cmheight at wither, 211 cm heart girth and 156 cmbody length. Adult males and females weighed593 and 519 kg, respectively. Emphasis should beplaced on making the breedable males of the breedavailable throughout the strata and on improvingthe utility of the breed for in-situ maintenance ofgenetic diversity in the breed.

Resumen

Las razas de camello Mewari y Jaisalmeri seencuentran entre las cuatro más importantes de laIndia. La raza Mewari es conocida por suproducción de leche y su capacidad de adaptación

a las zonas de colina de Aravali en el sur deRajastán. Aquí, la raza Jaisalmeri es conocida porsu potencial en carreras. Se han estudiado320 camellos provenientes de 16 rebaños en ochopoblados de entre los tres distritos de mayorpoblación de esta raza Mewari. La población deMewari se ha estimado en 16.221 cabezas con undeclive del 28% en los pasados cinco años. Elimpacto de cruces se ha estimado en un 36%. Uncamello adulto Mewari posee una altura de 193 cm,194 cm de circunferencia torácica y 158 cm delargura corporal. Un camello adulto Mewariproduce 700 g de pelo por año y las hembrasproducen 5-7 litros de leche por día. Un programade desarrollo de pastos integrados en rotaciónpodría ser de gran interés para mantener loscamellos Mewari dentro de rebaños de diversasespecies con un óptimo de producción.

Para establecer la situación del camelloJaisalmeri se ha llevado a cabo una investigacióncon 1 760 ganaderos pertenecientes a 181 pobladosdistribuidos por toda la zona de origen. Lapoblación de Jaisalmeri se ha estimado en118 083 cabezas con un declive del 31% en lospasados cinco años. Un camello adulto deJaisalmeri mide 199 cm de altura, 211 cm decircunferencia torácica y 156 cm de longitudcorporal. Los machos y hembras adultos pesan593 y 519 kg, respectivamente. Es importante quelos machos reproductores de la raza esténdisponibles y mejorar su utilidad in-situmanteniendo la diversidad genética de la raza.

Keywords: Camel, Mewari, Jaisalmeri, Mewati,Characterization, Conservation.

Introduction

The camel, the beast of burden in the desert, hasdiversified uses ranging from its primary use as adraught animal to sports, national security and theproduction of commodities like hair, milk and meat.Despite its potential to thrive well on meagerresources under extreme climatic conditions, the

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

88Mewari and Jaisalmeri Camels in India

population of camels is decreasing at a significantrate. The world has 19.3 million camels. Somalia isthe country with the highest population of6.2 million camels (Somali Livestock Statistics,1989) followed by Sudan with 3.3 million,Mauritania with 1.3 million, Kenya with0.83 million, Pakistan with 0.8 million and Chadwith 0.74 million. India ranks seventh with apopulation of about 0.635 million camels(FAOSTAT data, 2005).

The camel population in India was around0.60 million in 1951 and increased until 1972 withan annual population growth ranging from + 2% to+ 6%. It remained static until 1977 followed by aperiod of marginal increase-decrease ranging from+ 0.6 to - 0.4% until 1992 and an annual decrease of2% and 6% respectively in the livestock censuscarried out in the years 1997 and 2003. The countryhas four major breeds of camel; the Bikaneri,Jaisalmeri, Kachchhi and Mewari. (Kaura, 1961;Rathore, 1986 and Report of the CamelDevelopment Committee, 1988). The status andconservation of the Mewari and Jaisalmeri breedsare discussed below.

The Mewari breed of camel is adapted to thehilly terrain of the Aravali hills of Mewar in southRajasthan which is considered to be the majorbreeding tract of the breed (Rathore, 1986;Kohler-Rollefson, 1992 and Khanna, 2004). Thisbreed has also spread to the adjoining areas ofMadhya Pradesh and Gujarat (Rathore, 1986). It hasalso been referred to as a mountain type or hillcamel in the literature (Leese, 1927), being a breedwhich could climb the hills and thrive on the treesthat grow in the hills and withstand more rainsthan other camels (Rathore, 1986). Camels in mostof the adverse geographical locations acted as amultipurpose animal where males were used fordraught and transport, females for milk and bothsexes for meat (Wilson, 1984 and 1997). The presentscenario however, shows milk production as thechief reason for its use in the Mewar area.

Mewari camels have strong hindquarters, heavylegs and hard, thick foot pads. Their body hairs arecoarse, and protect the animals from the bites andstings of wild bees and insects. The head is heavy,set on a thick neck. Mewari camels do not have awell marked depression above the eyes (stop), buttheir muzzles are loose. The ears are thick andshort, set well apart, and the tail is long and thick(Rathore, 1986).

Jaisalmeri camels are predominantly bred inJaisalmer, Barmer and part of the Jodhpur district ofRajasthan state and are well known for their ridingand race potential (Rathore, 1986 and Rai et al.,

1992). The camel type in the breeding tract has beentermed Pangal and the opportunity to ride a Pangalwas considered as an important criterion inachieving contentment in life (Rathore,1986). Leese(1927) and Kaura (1961) grouped the Jaisalmeri(Jessulmere) camels under the category of DesertType camels along with the Bikaneri camels.Rollefson (1992) was able to trace the royal familysponsored breeding of Jaisalmeri camels by theMaharajas of Jaisalmer, and their relatives inNachna village.

The quinquennial livestock census data forcamel are available for the years 1951 to 2003 andshow a severe decline in the camel population inthe last ten years. However, no efforts were made toenumerate the populations of camel breeds.Therefore, it was decided to investigate the presentstatus of the Mewari and Jaisalmeri breeds of camelin their breeding tracts and suggest suitablestrategies for the maintenance of adequate geneticvariation in the populations for optimum utilizationof their production potential before they areclassified as threatened breeds.


For Mewari camels, the study was conducted in theUdaipur, Rajsamand, Chittorgarh, Alwar andBharatpur districts of Rajasthan, the Banaskanthadistrict of Gujarat, the Neemuch district of MadhyaPradesh and the Agra and Mathura districts ofUttar Pradesh. Since camels in this area are rearedby a particular community termed ‘Rebari’, threevillages of Rebaris in Udaipur district, two villagesin Rajsamand district and three villages inChittorgarh district, having some sizable camelpopulations, were selected for the investigation. Inall, 320 camels from 16 herds in eight villagesbelonging to five tehsils (blocks) of three districtswere covered (Table 1). Individual animals of eachherd were meticulously judged for the typicalfeatures of the breed according to the describedbreed characteristics (Rathore, 1986). Bodymeasurements for seventeen body parameters wererecorded for 57 adult camels. Production andeconomic aspects were discussed with individualcamel herd owners (n = 16) and some other resourcepersons (n = 6).

The camel population data (Livestock Census,2003) was utilized to extrapolate the figures for theavailability of breedable males and females, as wellas total Mewari camels by percentage at districtlevel. The population of Mewari camels andbreedable males and females in the adjacent

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

89


Mehta et al.

Madhya Pradesh was extrapolated using theproportions of Chittorgarh district which is quitesimilar in topography and geographically adjacentto Madhya Pradesh throughout its eastern border.Male camels of less than 5 years of age (Khanna etal., 1993) and female camels of less than 4 years ofage (Khanna et al., 1990) were classified asbreedable.

As for the Jaisalmeri camel, the whole breedingtract was divided into 10 strata for the purposes ofcharacterisation and the preparation ofconservation strategies. The Jaisalmer and Barmerdistricts were divided into four strata each and theJodhpur district into two strata. Thirty field centreswere opened, of which nine were in Jaisalmerdistrict, 16 in Barmer district and five in the Jodhpurdistrict. In all 1760 camel keepers gave relevantinformation for the investigation, of which 627,1 034 and 99 were from Jaisalmer, Barmer andJodhpur district respectively. A total of 181 villageswere covered, of which 65, 85 and 31 were from theeleven tehsils (blocks) of the Jaisalmer, Barmer andJodhpur district respectively. For in-situcharacterization of the breed, physicalcharacteristics and biometry of 2 918 adult camelswas measured. Since the weighing of the camelswas not feasible in the tract itself and the Mewaribreed is not maintained at any organized farm inthis country, the body weight data recorded at theNational Research Centre on Camels, Bikaner, Indiafor the Jaisalmeri breed were analyzed for the period1977 to 2005. Due to similar reasons the exactreproductive performance data belonging to theCentre were analyzed for Jaisalmeri breed for lasteight years.

This investigation was carried out during theperiod 2001-2004. The population figures wereextrapolated at the district level and pooled forestimating total population of the breed in thehabitat. The latest livestock census conducted by thegovernment of India during the year 2003 was takenas the basis of extrapolation of the populationfigures.

Results

Habitat and distribution

The breeding tract of Mewari camel consists of thehills of the Aravali in the Mewar area. The majorbreeding tract of the breed encompasses theUdaipur, Chittorgarh, and Rajsamand districts andthe adjoining Neemuch and Mandsour districts ofMadhya Pradesh in India. The adjoiningBanaskantha district of Gujarat was also surveyedbut the camels found there now were more ofKachchhi x Bikaneri type than Mewari. The camelpopulation present in the Mewat area represented adifferent picture which is discussed separately.However, the major breeding tract extends east from73°02’ to 75°92’ longitude and north from 23°30’ to25°46’ latitude with fairly good vegetation andrainfall. Average height from main sea level is about575 metres.

The breeding tract of the Jaisalmeri breedencompasses the Jaisalmer, and Barmer districtsand part of the Jodhpur district in Rajasthan, India(Figure 1). The breeding tract extends east from69°30’ to 73°04’ longitude north from 24°37’ to28°15’ latitude. The average altitude of the tract

Figure 1. Breeding tract of Mewari and Jaisalmeri camels.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


from main sea level is about 250 metres. Sand dunesare the typical features of the tract. A few open wells(Figure 2), tube wells and branches of the IndiraGandhi Canal are the three chief sources ofdrinking water for the livestock in the breedingtract.

Physical features

Physical features are the primary indicators for anindividual to be classified in a particular breedinggroup. The Mewari breed of camel has beendescribed very briefly in the literature. Kaura (1961)described the hill camels of North Punjab. Thefeatures described by the author match thedescription of the Mewari camel. Rathore (1986)described the development of the Mewari camelfrom the hill camels of old Punjab state, thus thefindings are commensurate with one another.Kohler-Rollefson (1992) briefly discussed theMewari camels and could not trace evidence ofroyal family sponsored breeding in the ancientliterature. However, the exhaustive listing ofphysical features and analysis of the extent of

variation exhibited by the camels of the Mewaribreed within each phenotypic class was largelylacking. Henceforth, the physical features alongwith body measurements for seventeen parametersfor the two sexes were recorded (Figure 3 to 5). Thebody colour in Mewari camels generally varies fromlight brown to dark brown but some animals arealmost white (Figure 6), such variation in bodycolour is generally not seen in other breeds of camel.The milk vein is prominent and the udder is welldeveloped in females. The physical features havebeen summarized in table 2.

The Jaisalmeri camels are gracious, lightly built,slightly lean and thin in appearance. They are ofactive temperament and are quite tall with long,thin legs. They have a small head and mouth with anarrow muzzle. The head is well carried on a thinneck and the eyes are prominent. The forehead isnot dome shaped and is without any depressionabove eyes (stop). Also, there is no luxuriant growthof hairs on their eyebrows, eyelids and ears. Thebody colour is predominantly light brown. TheJaisalmeri camels have thin skin and short hairs ontheir body. The udder is mostly round in shape(Table 2 and Figures 7 and 8).

Figure 2. Open well in the breeding tract.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

91


Mehta et al.

Body parameters

Apart from characterizing a breed, body parametershave their own importance. The body length, heightat wither and heart girth have been shown to bepositively correlated with the draught potential ofthe camel (Annual Report: 1990-1991, NationalResearch Centre on Camel, Bikaner) whereas thesize of the hump is more related to the nutritionalstatus of the camels. Long and thin legs indicatebetter racing potential (Khanna and Rai, 1989).Long tails have been designated as a tool forprotection from wild honey bees (Rathore, 1986).Henceforth, seventeen body parameters of Mewariand Jaisalmeri camels were measured and theiraverage values were calculated. An adult Mewaricamel had a height up to wither of 193 cm, a heartgirth of 194 cm, a body length of 158 cm, a taillength of 58 cm, a neck length of 107 cm, a distancebetween the eyes of 18 cm, an ear length of 12 cm, adistance between the ears of 19 cm, a face length of45 cm, a hump circumference hump(horizontal/vertical) 103/51 cm, a fore leg length of144 cm, a hind leg length of 154 cm, a fore leg footpad (length/width) of 20/22 cm and a hind leg footpad (length/width) of 18/19 cm. On the other hand,an adult Jaisalmeri camel had height up to wither of199 cm, a heart girth of 211cm, a body length of156 cm, a tail length of 55 cm, a neck length of109 cm, a distance between the eyes of 22 cm, an earlength of 12 cm, a distance between the ears of19 cm, a face length of 53 cm, a hump circumference(H/V) of 100/ 45 cm, a fore leg length of 146 cm, ahind leg length of 154 cm, a fore leg foot pad(length/width) of 19/19 cm and a hind leg foot pad(length/width) of 17/17 cm.

Growth

The Jaisalmeri camels are lighter than the Bikanericamels as the camels of this breed were used for

long distance travel and accordingly selection forthis type of build might have been done (Rathore,1986). The average body weight in males andfemales was 37 and 37, 212 and 211, 277 and 278,359 and 339, 423 and 391 and 490 and 442 kgrespectively at birth, 12 , 24, 36, 48 and 60 months ofage. An adult male weighed on average 593 kg andan adult female 519 kg. Analysis of growth dataindicated that up to 24 months of age thesuperiority of the males over females fluctuated butafter 24 months of age the males were consistentlyheavier than the females. However, the effect of sexwas non significant (P>0.05) up to 36 months of ageand thereafter it was significant (P<0.05) at 48 and60 months weight and highly significant (P<0.01) inadult weights.

Production, Reproduction andHealth Aspects

Milk production

Female Mewari camels maintained on free grazingland without any supplementary feeding give5-7 litres of milk per day. The lactation length is14-16 months. According to present investigation,about 8 000 quintals of camel milk is being solddaily at Rs. 6-10 (1 INR = 0.0224517 US$) per kg forhuman consumption in Udaipur and adjoiningcities, such as Chittorgarh, Nimbahera, Neemuch,Ratlam, Jawara, Mandsour etc. The chief use of thismilk is in the preparation of tea and coffee.

The females of the Jaisalmeri breed are poor inmilk production. The average daily milk productionwas highest in two teat stripping (3.72±0.17 kg)followed by four teat stripping (2.17±0.16 kg) andmachine milking (2.02±0.19 kg). The lactationlength can continue up to 14 –16 months. The milkproduction data indicated an increasing trend up to

Table 1. Composition of camel herds in the breeding tract of Mewari camel.

Mewari

Districts Tehsils

(Blocks) Villages Resource persons Herds

Total camels

Total camels

Breedable males

Breedable females

Girva 2 8 5 89 49 1 29 Udaipur Kurabad 1 1 1 9 9 2 4

Rajsamand Nathdwara 2 7 5 61 61 7 27 Chittorgarh 1 3 2 141 70 0 30 Chittorgarh Bhadesar 2 3 3 20 20 3 10

Total 5 8 22 16 320 209 13 100

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Table 2. Physical features of Mewari and Jaisalmeri camels.

Mewari Jaisalmeri Physical characteristics Male Female Male Female 1. Body color

a. Very Light brown (%) 7 7 3 1 b. Light Brown (%) 43 44 54 55 c. Deep Brown (%) 50 49 43 44

2. Hair on ears and eye lid (Jheepra) a. Absent Yes Yes Yes Yes b. Present No No No No

3. Head I. Size

a. Small (%) 54 20 19 16 b. Medium (%) 43 77 70 77 c. Large (%) 3 3 11 7

II. Well marked depression above the eyes(stop) a. Absent Yes Yes Yes Yes b. Present No No No No

III. Fore head a. Normal Yes Yes Yes Yes b. Prominent No No No No

IV. Supra-orbital fossa a. Deep No No No No b. Normal Yes Yes Yes Yes

V. Muzzle a. Type Loose Loose Narrow Narrow b. Lips Droopy Droopy Normal Normal

4. Body size a. Small (%) 61 24 8 6 b. Medium (%) 25 56 81 86 c. Large (%) 14 20 11 8

5. Hump size a. Small (%) 71 41 15 13 b. Medium (%) 29 46 72 82 c. Large (%) 0 13 13 5

6. Udder a. Round (%) - 97 - 98 b. Pendulous (%) - 3 - 2

7. Milk vein a. Small (%) - 0 - 10 b. Medium (%) - 32 - 81 c. Large (%) - 68 - 9

8. Temperament a. Active (%) 91 88 91 88 b .Dull(%) 9 12 9 12

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

93


Mehta et al.

transportation of bricks and other rawmaterials over a short distance is doneto a very limited extent.The efficiency of Jaisalmeri camels in

racing has been judged to be better thanBikaneri and Kachchhi breeds of camelon the basis of duration of strides,strides per second and speeds at trotand gallop (Rai et al.,1992). TheJaisalmeri camels at 20% of their bodyweight as draught (111±5 kg) work for aperiod of 58±1.7 minutes, cover adistance of 3.30±0.00 km beforeexhaustion and generate1.46±0.10 horse power (Annual Report:1990-1991, National Research Centreon Camel, Bikaner). A good number ofcamel carts are being used throughoutthe breeding tract for transportation ofvarious goods (grains, fuel wood,fodder, construction materials, water,LPG cylinders, etc.) and a camel ownerearns on an average Rs. 150 to 200 perday depending upon the location.

Safari

Camel safaris are not a feature of thebreeding tract of Mewari camels.However, one or two camels may beavailable near some historicmonuments for short rides by childrenand tourists. In contrast to the above, itis a very important feature of theJaisalmeri breeding tract. The camels ofthis breed are preferred for safari. A

good number of safari operators are found inJaisalmer, Jodhpur, Bikaner and other cities. Theyorganize safaris for a distance of 80 to 300 km(variable) depending on the availability of touristsand time. About 15-30 (variable) tourists are sent ata time for such tours. About 300 camels (variable) ineach city are being used for this purpose. A camelowner earns Rs. 100-300 per day depending uponthe availability of tourists. Apart from this, theindividual camel owners are making a goodnumber of camels available for short rides atvarious locations in the breeding tract. The famoussand dunes of Sam and Khudi are located in thistract, where about 50-100 camels are generallyavailable at any time for such rides.

Figure 3. Mewari male adolescent.

the sixth month of lactation and thereafter adecreasing trend. Morning production was 10-27%higher than that in the evening and productionfrom rear teats was significantly higher than that offront teats (Sahani et al., 1998).

Draught

Mewari camels have a multipurpose utility butcamels of this breed are mainly classified as milkanimals and baggage type. Both males and femalescan climb with loads on hilly and stony land. Malesare good baggage animals on hard land. Camelcarts in this area are generally confined totransportation in the mining area. The

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


Figure 4. Adult Mewari male.

Figure 5. Adult Mewari female.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

95


Mehta et al.

Hair production and quality

An indirect source of income to the breeder is camelhair. Adult Mewari camels produce about700 grams of hair per annum. Fine quality hair fromcamel calves is utilized for blankets whereas coarsequality adult hair is used for carpets. Some weaversin the towns of Rajsamand and Jawara in theMewari breeding tract are engaged in theproduction of carpets and blankets but this is nottheir full time occupation (Figure 9). The charge foryarn production is Rs.15 per kg and for carpets andblankets Rs. 40 per kg. These carpets and blanketsare very cheap and durable. The life of a carpet isapproximately 50 years and that of a blanket15 years. Camel hairs are also used in makingropes, which are subsequently used for tying theanimals and in making cots.

The annual hair production of adult Jaisalmericamels has been recorded as 0.733±0.016 kg (Bhakatet al., 2003). The analysis of hair quality attributes ofJaisalmeri camels indicated a 6.16±0.24 cm staplelength, 35.52±0.59 μ hair diameter and thepercentage composition of different types of hairwas revealed to be 36.31±0.71% pure, 38.41±0.60%hetero, 36.31±0.71% hairy and 1.25±0.18% kempfibres (Bhakat et al., 2001). Calf hair is superior interms of hair diameter and the presence of pure typehairs with minimum kemps. Camel hair is being

used in village cottage industry by the camelkeepers and weavers for the production of blankets,ropes, carpets and other items of daily use.

Reproduction

The observations on the reproductive efficiency ofthe Mewari and Jaisalmeri camels indicated that thefemales show the symptoms of puberty at an age of4 to 4.5 years and first successful conception takesplace at an age of 4.5 to 5 years. The gestation lengthis 13 months. The males exhibit the symptoms of rutat an age of 5.5 to 6 years and can be used forregular breeding at the age of 6 to 6.5 years. Theanalysis of Centre’s data revealed that the averageage at first calving, calving interval and gestationlength in Jaisalmeri females was 2 089±70.8,740±11.8 and 390 ± 1.0 days respectively.

Health

The major clinical problem identified by the camelowners of the Mewari breeding tract was that oftrypanosomiasis. Almost all camel keepers favourprophylactic treatment of this disease. Mange wassecond cause of worry to the camel breeders.Indigestion, ectoparasitic infestation, diarrhoea and

Figure 6. Mewari calf.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


pneumonia were the other health problemsassociated with camels in the tract. On the otherhand, mange was the major health problemidentified by the camel keepers in the breeding tractof the Jaisalmeri camel. Digestive disorders were thesecond cause of worry. The digestive disordersincluded tympany, constipation, diarrhoea,abdominal pain and gastrointestinal obstruction.Trypanosomiasis and reproductive diseases werethe next most prevalent. Other health problemsincluded wounds and abrasions, saddle gall,cataracts, kumari (neuromuscular weakness of thehind legs), pneumonia, lameness, pica,ectoparasites excluding mange, tumours andpoisoning. In the Jaisalmeri breeding tract about52% camel keepers favour local treatments followedby allopathic treatment (41%) and herbal treatment(7%). The choice of line of treatment was observed todepend on the nature and severity of the diseaseand economic status of the farmer (Mehta, 2004).

Status in the breeding tracts

The population of Mewari camels in its naturalhabitat was estimated to be 16 221 heads with950 breedable males and 7 874 breedable femalesand a ratio of 1:8.3 (Table 3). The total population ofcamels in the breeding tract was 25 473 (LivestockCensus, 2003). The population of males and femalesof less than 3 years of age was 7 877 and11 983 with a ratio of 1:1.52. This clearly indicatedthat there was an apparent availability of4.45 crossbred studs for every Mewari studcompeting to breed with the female populationavailable in the tract. The conservation of theMewari camel is going to be a difficult task as thisbiased ratio was easily observable on the grounddue to the absence of Mewari studs from 50% of thecamel herds covered in the investigation. The herdstructure in the tract suggested the availability of

64% Mewari camels with 6% breedable males and48% breedable females (Figure 10). An average herdconsisted of about 20 camels (Table 1).Kohler-Rollefson (1992), while discussingmanagement aspects of camel husbandry undercontemporary production systems indicated thesmaller size (20-50 head) of the camel herds in theAravali hills. The extent of crossbreeding in thenative tract was estimated to be 36% (Figure 10).This crossbreeding was mainly with the Bikaneribreed. The major source of breeding males for thebreeders of Mewari camels was the Pushkar fairwhich is invariably attended by most of the camelkeepers of Rajasthan and the adjoining states. Thecamel breeders share the experience that the calvessired by Bikaneri males are ‘maru’ (‘maru’ meansgood-looking) but they face difficulty in climbingand walking across hilly terrains especially duringthe rainy season (personal discussion withBagdiram Rebari).

The male to female ratio in the entire breedingtract was 1:1.53 and approximately same ratio(1:1.52) was observed among the males and femalesof more than 3 years of age. Camels in this regionare chiefly maintained for the production of milkand camel slaughter for meat is exceptionally rarein the tract. On the basis of the above facts it couldbe logically assumed that the ratio among thepopulation of breedable males and females wouldbe 1:1.52. Accordingly for breeding of availablebreedable Mewari females, 5 180 Mewari studs wererequired as against the available 950, whichamounts to about only 18%. A straight comparisonbetween available males and females of more than3years of age and the estimated population ofbreedable males and breedable females revealedthat the breedable Mewari females constituted 66%of the females (more than 3 years of age) available inthe tract as against the Mewari males whichconstitited only 12% of the males more than 3 yearsof age. The above figures clearly indicated that the

Table 3. Population of Mewari camel in the breeding tract.

Mewari2

Breeding tract (districts) Total camel population1 Camels Breedable males Breedable females

Udaipur 9 125 5 400 279 3 072 Rajsamand 3 815 3 815 438 1 689 Chittorgarh 4 533 2 534 84 1 126 Adjoining Madhya Pradesh1 8 000 4 472 149 1 987 Total 25 473 16 221 950 7 874

12003 Livestock census figures. 2Extrapolated figures (see text).

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

97


Mehta et al.

population of crossbreds in the tract would furtherincrease at a much faster rate due to the acutedeficiency of available Mewari studs (Figure 11).The livestock census data indicated that there hasbeen 28% decline in the population of camels in thebreeding tract of Mewari camels (Livestock Census,2003). The above statistics show that the populationof Mewari camel could reduce significantly due tothe cumulative effects of crossbreeding anddeclining camel population in the country.

The population of the Jaisalmeri camel in thebreeding tract was estimated to be 118 083 headswith 32 899 breedable males and 41 349 breedablefemales. The entire tract had 126 984 camels(Table 4). One very important feature noticed when

surveying the camels was that the sex ratio was notvery much distorted; it was only slightly in favourof females (1:1.25). In most of the livestock species,very few breedable males are left as compared to thebreedable females. In camels this was mainly due tothe preference of the camel keepers to use the malecamels for almost all sorts of work. Females werenot preferred for cart pulling, ploughing etc.,however this thinking is also changing and somevillagers are now using females for draught workdue to their docile nature, especially during thebreeding season. A severe reduction in the numberof breedable males accounts for the inbreeding butin the Jaisalmeri breed, due to the availability of a

Table 4. Population of Jaisalmeri camel in the breeding tract.

Jaisalmeri camels Breedable

Districts Total camel population1 Total Male Female

Jaisalmer 36 952 35 129 10 560 11 275 Barmer 69 712 64 835 16 150 25 799 Jodhpur2 20 320 18 119 6 189 4 275 Total 126 984 118 083 32 899 41 349

1As per Livestock Census 2003. 2Part of Jodhpur district.

Figure 7. Adult Jaisalmeri male.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○


good number of breedable males, this problem is notlikely to play a major role in near future.

The latest livestock census indicated that therehas been a decline in the overall camel population.The magnitude of this decline is about 31% in thebreeding tract of the Jaisalmeri camel in last fiveyears (Livestock Census, 2003). This decline can beattributed to increased mechanization, a severereduction in the grazing land and vegetationtherein, deforestation and the diversion of moreland to agriculture due to the Indira Gandhi Canaletc. There has been about a 5% decline in thepermanent pastures and other grazing landavailable in the last decade in Rajasthan (StatisticalAbstract, Rajasthan - 2002). Due tocommercialization and population pressures theaverage herd size of camels reduced to 3.74 camelsper herd whereas the range was from 1 to200 (Table 5). An average herd had 7% crossbred

camels. This crossbreeding was mainly with theBikaneri breed of camel.

On an average about one stud was available in aherd but about 36% camel keepers were not keepingany males of the breed. The majority of them (75%)were keeping only one camel for work but about5% camel keepers were maintaining more than fivecamels and not having any breedable males of thebreed. This situation can not be considered asconducive to the conservation and propagation ofthe breed (Alderson,1981; Simak, 1990).

Mewari camels in Mewat area

The Mewat area refers to the Alwar, Bharatpur,Karauli and Sawaimadhopur districts of Rajasthan,the Agra and Mathura districts of Uttar Pradesh

Table 5. Availability of breedable males and females of Jaisalmeri breed in a herd.

Jaisalmeri camels in an average herd Breedable

Districts Average herd size

Jaisalmeri camels Males Females

Over all 3.74 3.49 0.97 1.23 Jaisalmer 4.20 3.99 1.20 1.28 Barmer 3.19 2.97 0.74 1.18 Jodhpur 6.43 5.74 1.96 1.35

Figure 8. Adult Jaisalmeri female.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

99


Mehta et al.

and the adjoining areas of the Mahendragarh,Rewari and Gurgaon districts of Haryana. Thisregion also has some camel populations. There wereabout 30-35 villages of the Rebari caste in the Alwarand Bharatpur districts. The camel breeders haveshifted to this area from Mewar due to theavailability of dense forest and green vegetation.Rebaris, the traditional camel breeders, in theMewat area prefer Mewari females as they are goodproducers of milk and are well adapted to the hillytracts (Rathore, 1986) whereas the Mev (Muslim)camel users prefer Bikaneri camels because they areengaged in the transportation of goods and theBikaneri camel has good draught potential (Rai etal., 1992). The above observation is commensuratewith Leese (1927) who mentioned that the camelsfound near Agra, Mathura, Delhi, Meerut and otherplaces are from semi-desert areas of Rajasthan andmany are crosses between Mewari and Bikanericamels.

Improvement and conservation

In the breeding tract of the Mewari breed, camelmilk was being sold for human consumption muchearlier than in the year 1978 when the first caseagainst a vendor selling camel milk was registeredin Udaipur. The case ended with the legalization of

Figure 9. Traditional carpet weavers showing a camel hair and cotton mixed handmade carpet.

the sale of camel milk for human consumption bythe Supreme Court of India in the year 2000. Still,the setting of standards for camel milk and theinclusion of camel milk in the Dairy Act are awaited(Rollefson, 2004 and Bagdi Ram Raika, 2004). Thereis a general sense of apathy and neglect regardingthe breed. If concrete measures to overcome theexisting declining trend in camel populations andthe problem of cross breeding in the Mewari tractare not taken, it is likely that the Mewari breedwould qualify to be considered as endangered inthe not too distant a future.

In view of the long lactation length (Sahani et al.,1998) and the increased consumption of camel milkby the human population in the breeding tract(Rollefson, 2004 and Bagdi Ram Raika, 2004) thereis a need for improvement in the milk productionpotential of the camels in this area. The traditionaluse of camel hair (Figure 9) and present day use ofcamel skin and bones for the manufacture of giftitems should be encouraged to ensure increasedutility of the breed and hence the in-situconservation of the breed. An integrated rotationalgrazing forest or silvi pasture developmentprogramme along with a disease control and breedimprovement programme could be of great use inmaintaining the Mewari camel with diverselivestock species under optimum productionconditions.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

100

Mewari and Jaisalmeri Camels in India

Figure 10. Status of Mewari camel in the breeding tract.

Mewari

Crossbred

Mewari

females

Mewari

studs

Figure 11 . Breedable population of Mewari camel in thebreeding tract.

The Jaisalmeri camels inhabit the Indian part ofthe Thar desert in Rajasthan state which has about78% of the camel population of this country. Lowfertility of soil, low rainfall and humidity, poorvegetation and scant water resources are the typicalfeatures of this tract. Due to the internationalIndo-Pak border, the road connectivity betweenimportant places has improved but there are stillseveral villages, which do not have proper roadconnectivity. Camels in this part of the country areused for safaris, riding, travel, the transportation ofgoods, ploughing etc. Due to various reasonsdiscussed earlier, the population of camels in thistract is declining very fast. In the last five years, i.e.from 1997 to 2003, a 31% decline in the populationof camels in the breeding tract has been noticed.Further, this rate of decline in the camel populationis expected to increase substantially in the nearfuture. The average size of herds has reduced toonly 3.74 camels per herd and a good number of

herds (5%) did not have a single stud ofthe Jaisalmeri breed despite the sizablefemale population. On the other hand,due to a continuous increase in the priceof fossil fuel, an increase in pollution,severe consecutive droughts, a reductionin underground water availability etc.,the community has been forced to makeuse of some eco-friendly alternatives i.e.animals in general and the camel inparticular in the desert region.

To sustain this breed in its breedingtract in-situ, there is a need to ensureimprovement, increase the utility of thebreed, ensure the availability of elitemales for breeding in all strata of thetract, increase public awareness of theneed for conservation and encourage theformation of breed societies. Under ex-situsituations, the National Research Centreon Camels, Bikaner is maintaining a herdof the breed with elite studs and hascryo-preserved the semen from certifiedcamels of the breed. This Centre is alsodistributing breedable males through thestate government for genetic improvementin the field and providing consultancyservices for conservation.

List of References

Alderson, L. 1981. Theconservation of animal genetic resourcesin U.K. Animal Production and Health

Paper 24, FAO, Rome, Italy, pp. 53-76.

Bagdi Ram (Rebari) Raika. 2004.Deliberations and recommendations from theNational Grazing Workshop. In Internationalconference on “Saving the camel and people’slivelihoods”. November, 2004, Pali, Rajasthan,India.

Bhakat, C., B. Yadav & M.S. Sahani. 2001.Effect of certain factors on hair quality attributes inIndian dromedary camel managed in an organizedfarm. Indian Journal of Animal Sciences 71,992-994.

Bhakat, C., S.C. Mehta & M.S. Sahani. 2003.Annual hair yield attribute in indigenous camelbreeds. The Indian Journal of Animal Sciences 73,1189-91.

950

7 877

11 983

7 874

Mewari Females

Females 3years

Mewari Males

Males 3years

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

101


Mehta et al.

Department of Agricultural Research andEducation: Livestock Census. 2003. 17th LivestockCensus, Department of Agricultural Research andEducation, Ministry of Agriculture, Government ofIndia.

FAOSTAT. 2005. http://faostat.fao.org/faostat/collections?subset=agriculture. Date of access:9 March 2006.

Kaura, R.L. 1961. Indian Breeds of Livestock(Including Pakistan Breeds). Prem Publishers,Lucknow, India, pp. 95-97.

Khanna, N.D. & A.K. Rai. 1989. Workperformance of camel. Indian Journal of AnimalSciences 59, 1172-1177.

Khanna, N.D., S.N. Tandon & A.K. Rai.1990. Breeding parameters of Indian camel, IndianJournal of Animal Sciences 60, 1347-1354.

Khanna, N.D., S.N. Tandon & A.K. Rai.1993. Reproductive status of Bikaneri camelsmanaged under farm conditions. In: Proceedings ofthe Workshop on: Is it possible to improve thereproductive performance of the camel ? September,1990, Paris. Published by CIRAD-EMVT, France,1993, 337-351.

Khanna, N.D., A.K. Rai & S.N. Tandon.2004. Camel breeds of India. Journal of CamelScience 1, 5-15.

Köhler-Rollefson, I. 1992. The camel breedsof India in social and historical perspective. AnimalGenetic Resource Information 10: 53-64.

Köhler-Rollefson, I. 2004. The camel inRajasthan: Agricultural biodiversity under threat. InInternational conference on: Saving the camel andpeople’s livelihoods. November, 2004, Pali,Rajasthan, India.

Leese, A.S. 1927. A treatise on theone-humped camel in health and disease. Stanford,UK, Haines and Sons Pub., pp. 51-53.

Mehta, S.C. 2004. Characterization andconservation of Jaisalmeri camel - a project report,National Research Centre on Camel, Bikaner,Rajasthan, India, pp. 31-32.

National Research Centre on Camel: AnnualReport 1990-1991. National Research Centre onCamel, Bikaner, India, pp. 7-26.

Rai, A.K., A.K. Roy & N.D. Khanna. 1992.Speed and strides of different breeds of camel.Indian Journal of Animal Sciences 62, 91-92.

Rathore, G.S. 1986. Camels and theirmanagement. Indian Council of AgriculturalResearch publication, New Delhi, pp. 10-18.

Report of the Camel DevelopmentCommittee. 1988. Ministry of Agriculture,Government of India, New Delhi, pp. 11-15.

Sahani, M.S., M. Rathinasabapathy,Gorakhmal & N.D. Khanna. 1998. Milkingtechnique and other factors affecting milkproduction potential in different breeds of camelsunder farm conditions. Indian Journal of AnimalSciences 68, 254-256.

Simak, E. 1990. The conservation of rarebreeds in West Germany. In L. Alderson (Ed.),Genetic conservation of domestic livestock. CABInternational, Wallingford, UK. pp. 65-69.

Somali Livestock Statistics. 1989. Cited byAbdi, A.O.H. and Cagnolatti, V. In The camel inSomalia - an overview., www. agrar. hu-berlin. De/nutztier/ntoe/Aktuell/works/Papers/09.pdf.

Statistical Abstract, Rajasthan. 2002.Directorate of Economics and Statistics,Government of Rajasthan, Jaipur, India.

Wilson, R.T. 1984. The camel. LongmanPublication, London, pp. 16-30.

Wilson, R.T. 1997. Types and breeds of theone-humped camel. Journal of Camel Practice andResearch 4, 111-117.

asdg

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

103


Utilisation and Conservation of Farm Animal Genetic ResourcesOldenbroek K. (Ed.)

Published by Wageningen Academic Publishers, The NetherlandsPublished in 2007, pp. 232

ISBN: 978-90-8686-032-6

The genetic diversity comprised in farm animalspecies and breeds is an important resource inlivestock systems. For several reasons, within thedifferent species used for food production only afew breeds are developed toward high-outputbreeds fitting in high input systems. In this processmany breeds are set aside from the food producinglivestock systems. These breeds will be faced withextinction unless new functions for these breeds arefound. This is real threat for the genetic diversitywithin species.

This book is intended to give insight into theissues of the utilisation and conservation of farmanimal genetic resources towards a broad group ofreaders interested in these subjects. The insight ispresented as applications of population, molecularand quantitative genetics that can be used to takeappropriate decisions in utilisation andconservation programmes. A previous edition ofthis book is a key resource in courses worldwideand cited in many scientific publications.

The first two chapters present the decisions to bemade in utilisation and conservation. Chapter 3surveys the different ways in which the diversity weobserve within a species can be characterised.Chapter 4 illustrates recent results using this theoryfor utilisation and conservation purposes.Chapters 5, 6 and 7 give theoretical backgroundsnecessary to make decisions and chapters 8 and9 present the operation and practical implicationsof selection and conservation schemes.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

104

Autochthnous Breeds of Domestic Animals in Serbia andMontenegro

S. Stojanovic & S. Dordevic-Milosevic & G.J. Viljoen (Eds)Katalogizacija u Publikaciji Narodna Biblioteka Srbije, Beograd

Published in 2003, pp. 250ISBN: 86-7650-007-X

This soft cover publication summarises the state ofthe art about the Serbian AnGR, theircharacterisation and conservation plansundertaken by the national Authorities. Theinternational agreements that define the necessity ofanimal conservation for global, scientific, practicalsignificance and ethical meanings are summarisedbefore the description of the national breeds.

The book presents cattle, sheep and goats,poultry, geese and duck local breeds. For eachbreed, clear tables summarise the taxonomy, thebreeding tract, essential information about theanimal population that reveal very useful forestablishing conservation programmes. A briefphysical description reported in the tables allow thereader to have a general idea about the aspect of thebreeds and clear pictures for each one complete theavailable information.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

105


Technical and Economic Analysis of the Sheep and GoatProduction Systems: Methodology and Appraisal for

Development and ProspectsMena Y., J. Castel & P. Morand-Fehr (Eds)

Options Mediterraneennes Serie A: Séminaires MéditerranéensPublished by CIHEAM, Apdo 202, 50080Zaragoza, Spain

Published in 2006, pp. 232ISSN: 1016-121-X; ISBN: 2-85352-350-0

The publication groups the paper that werepresented at a seminar that was held from 16 to18 June 2005, within the FAO-CIHEAMinterregional network of cooperative research onsheep and goats.

The seminar had a three-fold objective: first, toperform a critical analysis of all the work conductedin Andalusia and, if necessary, try to improve themethodology; then, to broaden the field ofevaluation of production systems attempting toincorporate other elements: pasture evaluation,estimation of the systems’ sustainability, quality ofsheep and goat products; finally, to reflect upon thismethodological approach, which is mainly appliedto dairy systems under intensive and semi intensiveconditions, so that it could also be applied to meatsystems and to more extensive systems.

The current issue of Options Méditerranéennes,includes all the work conducted in the seminar andmay be considered as the Proceedings, grouping thereports and most of the papers presented in Seville.Amongst the twenty-five articles that make up thisdocument, there are three which report on theactivities carried out by the Monitoring Body andtwo which propose widening the scope ofevaluation of the systems. Finally, the other articlespresent the results from the study of sheep and goatsystems in Algeria, Egypt, France, Italy, Lebanon,Morocco, Portugal and Spain, using the MonitoringBody methodology, modifying it, and using othermethodology, if needed.

This comprises a wide diversity of data andanalysis of specific cases which will improve theinformation and insight for readers involved in themanagement of sheep and goat production systemsand in decision-making within the framework ofagricultural policies.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

106

Options and Strategies for the Conservation of Farm AnimalGenetic Resources

Glbson J., S. Gamage, O. Hanotte, L. Iñiguez, J.C. Maillard, B. Rischkowshy;D. Semambo & J. Toll (Eds)

Report of an International Workshop held in Agropolis,Montpellier, France, 7-10 November 2005

Biodiversity International, Via dei Tre Denari 472/a, Rome, ItalyPublished in 2006, pp. 53

ISBN-13: 978-92-9043-712-3; ISBN-10: 92-9043-712-X

Farm animals play a crucial part in the livelihoodsystems and well-being of the poor in thedeveloping world, and thereby in helping to meetthe Millennium Development Goals. In addition tofood, clothing and other goods, livestock areimportant for income generation, wealthaccumulation, traction and nutrient cycling. Ofparticular significance is the contribution they maketo the livelihoods and wellbeing of smallholders inmarginal environments, especially women andchildren.

The need to reduce the degradation of farmanimal genetic resources and establish programmesfor their conservation and sustainable use is wellrecognized. It is embodied in the objectives of theConvention on Biological Diversity and in thedevelopment of the Global Strategy for theManagement of Farm Animal Genetic Resources,led by the Food and Agriculture Organization of theUnited Nations (FAO). Noting the need for a greaterunderstanding of the status of farm animal geneticresources and the measures necessary for theirconservation and sustainable use worldwide, in1999 the FAO Commission on Genetic Resources forFood and Agriculture initiated a country-drivenprocess to develop the first Report on the State of theWorld’s Animal Genetic Resources. The Report willbe finalized at the First International TechnicalConference on Animal Genetic Resources inSeptember 2007, hosted by the Government ofSwitzerland.

With the aim of assisting the internationalcommunity in developing a global framework forthe conservation of farm animal genetic resourcesand identifying priorities for action, theSystem-wide Genetic Resources Programme (SGRP)of the Consultative Group on InternationalAgricultural Research (CGIAR), in association withFAO, AGROPOLIS, France, and the DeutscheGesellschaft fur Technische Zusammenarbeit (GTZ)GmbH, Germany, convened an international

workshop on Options and Strategies for theConservation of Farm Animal Genetic Resources inNovember 2005, hosted by AGROPOLIS inMontpellier, France. The workshop brought together63 experts from 28 countries and from the CGIARcentres, FAO, the French scientific community,including the Institut national de la rechercheagronomique (INRA) and the Centre de cooperationinternationale en recherche agronomique pour ledéveloppement (CIRAD), and GTZ.

The workshop findings are presented in thisreport.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

107


Breeding, Production Recording, Health and the Evaluation ofFarm Animals

Kyntäjä J., K. Lampinen, A. Rosati & C. MosconiProceedings of the 35th ICAR Session, held in Kuopio, Finland, 6-10 June, 2006

EAAP Publication No. 121Wageningen Academic Publishers, The Netherlands

Published in 2007, pp. 370ISBN: 978-90-8686-030-2; ISSN: 0071-2477

This publication focuses on the various aspects ofdomestic animal recording, aimed at improving themanagement of herds and increasing theirproductivity. New strategies for recording areillustrated and the most updated technologies arepresented, on the basis of national experienceswhere such technologies are already adopted.Although cattle is the prominent species, two partsare dedicated to small ruminants recording and tobuffalo recording. Future challenges andopportunities for further development of ICAR andthe definition of the future scenarios in the animalrecording sector are also described.

A special section is dedicated to «Improving thehealth traits by recording and evaluation», wherethe past and future of animal recording and the useof animal recording data for genetic evaluation andbreeding are defined.

Another section deals with the "ICAR ReferenceLaboratory Network", where the reference systems,the principles and the practices for calibrationsystem for routine milk testing are presented.

The publication ends with the national statisticson the "Yearly enquiry on the situation of milkrecording in member countries" for the years 2003and 2004. A total of 45 pages describes themethodologies used at national level for milkrecording, the national data for milk production, thecosts of recording and the productivity andnumbers of recorded cattle at national level (dividedby species and by herdbook).

asdg

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

109

Editorial Policies andProcedures

The mission of the Animal Genetic ResourcesInformation Bulletin (AGRI) is the promotionof information on the better use of animalgenetic resources of interest to food andagriculture production, under the GlobalStrategy for the Management of Farm AnimalGenetic Resources. All aspects of thecharacterization, conservation and utilizationof these resources are included, in accordancewith the Convention on Biological Diversity.AGRI will highlight information on thegenetic, phenotypic and economic surveyingand comparative description, use,development and maintenance of animalgenetic resources; and on the development ofoperational strategies and procedures whichenable their more cost-effective management.In doing this AGRI will give special attentionto contributions dealing with breeds andprocedures capable of contributing to thesustainable intensification of the world’smedium to low input productionenvironments (agro-ecosystems), whichaccount for the substantial majority of theland area involved in livestock production;the total production of food and agriculturefrom livestock; and of our remaining farmanimal genetic resources.

Views expressed in the paper published inAGRI represent the opinions of the author(s)and do not necessarily reflect those of theinstitutions which the authors are affiliated,FAO or the Editors.

The suitability of manuscripts forpublication in AGRI is judged by the Editorsand reviewers.

Electronic publication

AGRI is available in full electronically on theInternet, in addition to being published inhard copy, at:<< http://www.fao.org/dad-is>>

Types of Articles

The following types of articles are publishedin AGRI.

Research articles

Findings of work on characterization,conservation and utilization of farm animalgenetic resources (AnGR) in well describedproduction environments, will be consideredfor publication in AGRI. Quality photographsof these genetic resources viewed in theprimary production environment to whichthey are adapted, accompanying themanuscripts are encouraged.

Review articles

Unsolicited articles reviewingagro-ecosystems, country-level, regional orglobal developments on one or more aspectsof the management of animal geneticresources, including state-of-the-art reviewarticles on specific fields in AnGR, will beconsidered for publication in AGRI.

Position papers

Solicited papers on topical issues will also bepublished as deemed required.

Other published material

This includes book reviews, news and notescovering relevant meetings, training coursesand major national, regional and internationalevents and conclusions and recommendationsassociated with the outcomes of these majorevents. Readers are encouraged to send suchitems to the editors.

Guidelines for Authors

Manuscript submission

Manuscripts prepared in English, French orSpanish with an English summary and

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

110

another summary in either French orSpanish, should be submitted to AGRIEditor, AGAP, FAO, Viale delle Terme diCaracalla, 00100 Rome, Italy. Additionallythe manuscript must be sent as a WinWordElectronic Mail attachment [email protected]. Photographs, colouredor black and white, and figures must bealways sent by mail.

Manuscripts should be typeddouble-spaced and with lines numbered inthe left margin. All pages, including those ofreferences, tables etc., must be consecutivelynumbered. The corresponding author isnotified of the receipt of a manuscript.

For manuscripts that are accepted afterrevision, authors are encouraged to submit alast version (3½” disc format) in Word 6.0 forWindows of their revised manuscript alongwith the printed copy.

Preparation of the manuscript

The first page of the manuscript must includethe running head (abbreviated title), title,names of authors, institutions, full addressesincluding postal codes and telephone numberand other communication details (fax, e-mail,etc.) of the corresponding author. Therunning head not exceeding 45 charactersplus spaces, should appear at the top of page1 of the manuscript entirely in capital letters.The title of the manuscript is typed in upperand lower case letters. The title should be asbrief as possible not exceeding 150 characters(including spaces) with species names whenapplicable. Authors, institutions andaddresses are in upper and lower case italics.There is one blank line between the title andthe authors. Addresses are typed as footnotesto the authors after leaving one blank line.Footnotes are designated numerically. Twolines are left below the footnotes.

Headings

Headings of sections, for example Summary,Introduction, etc., are left-justified. Leave twoblank lines between addresses footnotes andSummary and between the heading Summary

and its text. Summary should not exceed200 words . It should be an objectivesummary briefly describing the proceduresand findings and not simply stating that thestudy was carried on such and such andresults are presented, etc. Leave one linebetween the summary text and Keywordswhich is written in italics as well as thekeywords themselves. All headings ofsections (14 regular) and sub-sections(12 regular) are typed bold and precededand succeeded by one blank line and theirtext begins with no indention. The headingof a sub-subsection is written in italics, andends with a dot after which the text followson the same line. Keywords comeimmediately after the summaries. Theyshould be no more than six, with no “and”or “&”.

Tables and figures

Tables and figures must be enclosed with thepaper and attached at the end of the textaccording their citation in the document.Photos will not be returned

Tables

Tables, including footnotes, should bepreceded and succeeded by 2 blank lines.Table number and caption are written, abovethe table, in italics (12) followed by a dot, thenone blank line. For each column or line title orsub-title, only the 1st letter of the 1st word iscapitalized. Tables should be numberedconsecutively in Arabic numerals. Tables andcaptions should be left justified as is the text.Use horizontal or vertical lines only whennecessary. Do not use tabs or space-bar tocreate a table but only the appropriatecommands.

Figures

Figures including titles and legends should bepreceded and succeeded by two blank lines.Figure number and title are written, below thefigure, in italics (12) and end with a dot. Theterm figures includes photos, line drawings,

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

111

maps, diagrams etc.All the submitted diagrams, must be

accompanied with the original matrix of thedata used to create them. It is stronglyadvised to submit diagrams in Word 6.0 orExcel 5.0. Figures should be numberedconsecutively in Arabic numerals.

References

Every reference cited in the text should beincluded in the reference list and everyreference in the reference list should havebeen mentioned in the text at least once.References should be ordered firstlyalphabetically by the first author’s surnameand secondly by year.• Example for reference in a periodical is:

Köhler-Rollefson, I. 1992. The camelbreeds of India in social and historicalperspective. Animal Genetic ResourcesInformation 10, 53-64.

• When there are more than one author:Matos, C.A.P., D.L. Thomas, D. Gianola,R.J. Tempelman & L.D. Young. 1997.Genetic analysis of discrete reproductive

traits in sheep using linear and nonnlinearmodels: 1. Estimation of geneticparameters 75, 76-87.

• For a book or an ad hoc publication, e.g.,reports, theses, etc.:Cockrill, W.R. (Ed.). 1994. The Husbandryand Health of the Domestic Buffalo. FAO,Rome, Italy, pp 993.

• For an article in the proceedings of ameeting:Hammond, K. 1996. FAO’s programmefor the management of farm animalgenetic resources. In C. Devendra (Ed.),Proceedings of IGA/FAO Round Table onthe Global Management of SmallRuminant Genetic Resources, Beijing,May 1996, FAO, Bangkok, Thailand, 4-13.

• Where information included in the articlehas been obtained or derived from aWorld Wide Web site, then quote in thetext, e.g. “derived from FAO. 1996” andin the References quote the URL standardform:FAO. 1996. Domestic Animal DiversityInformation System, http://www.fao.org/dad-is/, FAO, Rome, Italy.

For all future manuscript dispatch and correspondence regardingAGRI, please use the following mailbox:

[email protected]

Thanks for the collaboration

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

112

Normes et règles éditoriales

L’objectif du Bulletin d’information sur lesressources génétiques animales (AGRI) est lavulgarisation de l’information disponible surla meilleure gestion des ressources génétiquesanimales d’intérêt pour la productionalimentaire et agricole, d’après lesrecommandation de la Stratégie mondialepour la gestion des ressources génétiques desanimaux domestiques. Tous les aspectsrelatifs à la caractérisation, la conservation etl’utilisation de ces ressources seront pris enconsidération, suivant les normes de laConvention pour la Biodiversité.

AGRI désire diffuser de l’information surla génétique, les enquêtes phénotypiques etéconomiques et les desciptions comparatives,l’utilisation et la conservation des ressourcesgénétiques animales, ainsi que touteinformation sur le développement destratégies opérationnelles et de normes quipuissent permettre une meilleure gestion dela relation coût/efficacité. C’est pour cela queAGRI prendra spécialement en considérationtoutes les contributions référées aux races etaux normes capables de permettre uneintensification durable des milieux(agroécosystèmes) à revenus moyens et basdans le monde; qui comprennent la majeurpartie des terres consacrées à l’élevage, à laproduction totale des aliments et l’agricultureprovenants de l’élevage; et tout ce qui restecomme ressources génétiques des animauxdomestiques.

Les opinions exprimées dans les articlespubliés dans AGRI appartiennent seulementaux auteurs et donc ne représentent pasnécessairement l’opinion des instituts pourlesquels ils travaillent, la FAO ou les éditeurs.

L’opportunité ou non de publier un articledans AGRI sera jugée par les éditeurs et lesréviseurs.

Publication électronique

En plus de sa version imprimée, la versiontotale de AGRI se trouve disponible surInternet, sur le site:http://www.fao.org/dad-is/

Types d’articles

Les articles suivants pourront être publiés surAGRI:

Articles de recherche

Seront prises en considération pour leurpublication sur AGRI les études sur lacaractérisation, la conservation et l’utilisationdes ressources génétiques des animauxdomestiques (AnGR) accompagnées d’unebonne description du milieu. On encourageles auteurs à envoyer des photographies debonne qualité qui montrent les races enquestion dans leur milieu naturel deproduction.

Révisions

Occasionnellement, des articles contenant unerévision des agroécosystèmes, au niveaunational, régional ou mondial, avec un ouplusieurs aspects se rapportant à la gestiondes ressources génétiques animales, ycompriss les mises à jour des différenteszones de AnGR, seront pris en considération.

Articles spécifiques

Ponctuellement, des articles sur des thèmesspécifiques pourront être demandés pour lapublication d’éditions spéciales.

Autre matériel pour publication

Ceci comprend la révision de livres, nouvelleset notes de réunions importantes, cours deformation et principaux évènementsnationaux, régionaux et internationaux; ainsique les conclusions et recommandation parrapport aux objectifs des ces principauxévènements. Les auteurs sont priés d’envoyerce genre de matériel aux éditeurs.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

113

Guide pour les auteurs

Présentation du manuscript

Les articles se présenteront en anglais,français ou espagnol, avec un résumé enanglais et sa traduction en français ou enespagnol; ils seront envoyés à l’éditeur deAGRI, AGAP, FAO, Viale delle Terme diCaracalla, 00100 Rome, Italie. En outre,l’article devra être envoyé par courrierélectronique comme document attaché enversion WinWord à [email protected]. Lesphotographies, en couleur ou en blanc etnoir, seront toujours envoyées par courriernormal.

Les manuscripts se présenteront à doubleinterligne et avec le numéro correspondant àchaque ligne sur la marge gauche. Toutes lespages seront numérotées, y compriss cellesavec les références bibliographiques, lestableaux, etc. L’auteur recevra une lettre luidonnant bonne réception de son document.

Lorsqu’un article, après sa révision, seraaccepté, on demandera à l’auteur d’envoyer laversion finale révisée sur disquette (format31/2”) en Word 6.0 x Windows, ainsi qu’unecopie sur papier.

Préparation du manuscript

Sur la première page du manuscript onindiquera le titre de l’article en abrégé, le titreet noms des auteurs, des institutions, lesadresses complètes (y compris code postal etnuméro de téléphone); ainsi que tout autremoyen de contact tel que télécopie, courriel,etc. avec l’auteur principal. Le titre abrégé nedevra pas dépasser 45 caractères, plus lesespaces nécessaires, et s’écrira sur la partiesupérieure de la page 1 du manuscript enmajuscules. Le titre en entier du manuscriptsera écrit en majuscules et minuscules; ildevra être aussi bref que possible, sansdépasser 150 caractères (y compris lesespaces nécessaires), et avec l’indication desnoms des espèces. Les noms des auteurs, desinstitutions et les adresses seront en italiqueet en lettres majuscules et minuscules. Onlaissera un espace en blanc entre le titre et les

noms des auteurs. Les adresses serontindiquées comme de bas à pied de page pourchacun des auteurs après avoir laissé unespace en blanc après les noms. Chaque notede bas de page sera numérotée. On laisseradeux espaces en blanc après les adresses.

Titres

Les titres de chaque chapitre, par exempleRésumé, Introduction, etc. seront alignés àgauche. Laisser deux espaces en blanc entreles notes de bas de page avec les adresses etle Résumé, et entre le titre Résumé et le textequi suit. Le résumé ne devra pas dépasser les200 mots. Il s’agira d’un résumé objectiffaisant une brève description des processusutilisés et des résultats obtenus, et non pasune simple présentation du travail réaliséavec une description générale des résultats.Laisser un espace en blanc entre la fin dutexte du résumé et les mots clés, qui serontécrits en italique ainsi que le titre Mots clés.Les mots clés seront au maximum six et il nedevra pas y avoir de et ou &. Tous les titresprincipaux de chapitre (14 regular) etsous-chapitre (12 regular) seront en gras avecun espace en blanc avant et après. Le textecommencera sans retrait. Un titre à l’intérieurd’un sous-chapitre s’écrira en italique, suivid’un point, avec le texte à continuation.

Tableaux et figures

Les tableaux et les figures iront à la fin dutexte en suivant l’ordre d’apparition dans letexte. Les photographies ne seront pasdévolues aux auteurs.

Tableaux

Les tableaux, y compris les notes de bas depage, devront avoir un espace en blanc avantet après. Le numéro du tableau et le titres’écriront sur la partie supérieure en italique(12) avec un point à la fin et un espace enblanc en dessous. Sur chaque colonne, titred’en-tête ou sous-titre, seulement la premièrelettre du premier mot sera en majuscule. Lestableaux et leur titre seront alignés à gauche,

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

114

ainsi que le texte. Les lignes verticales ethorizontales seront utilisées seulement sinécessaire. Ne pas utiliser les "tabs" ou labarre d'espacement pour créer un tableau.

Figures

Les figures, y compris les titres et leslégendes, seront précédés et suivis de deuxespaces en blanc. Le numéro de la figure et letitre s’écriront sur la partie supérieure enitalique (12) avec un point à la fin. Sous larubrique figure on trouvera lesphotographies, les graphiques, les cartes, lesdiagrammes, etc. Dans le cas desdiagrammes, la matrice originale avec lesdonnées utilisées pour son élaboration devraêtre envoyée. On recommande l’utilisation deWord 6.0 ou Excel 5.0 pour la présentationdes diagrammes.

Références

Toute référence présente dans le texte devraapparaître sur la liste des références, etchaque référence de la liste aura été citée aumoins une fois dans le texte. Les référencesiront en ordre alphabétique du nom del’auteur, suivi de l’année.• Exemple dans le cas d’une référence sur

une revue:Köhler-Rollefson, I. 1992. The camelbreeds of India in social and historicalperspective. Animal Genetic ResourcesInformation 10, 53-64.

• Lorsqu’il s’agit de plus d’un auteur:Matos, C.A.P., D.L. Thomas, D. Gianola,R.J. Tempelman & L.D. Young. 1997.Genetic analysis of discrete reproductivetraits in sheep using linear and nonnlinearmodels: 1. Estimation of geneticparameters 75, 76-87.

• Dans le cas d’un livre ou d’unepublication ad hoc, par example unrapport, une thèse, etc.:Cockrill, W.R. (Ed.). 1994. The Husbandryand Health of the Domestic Buffalo. FAO,Rome, Italy, pp 993.

• S’il s’agit d’un acte d’une réunion:Hammond, K. 1996. FAO’s programmefor the management of farm animalgenetic resources. In C. Devendra (Ed.),Proceedings of IGA/FAO Round Table onthe Global Management of SmallRuminant Genetic Resources, Beijing, May1996, FAO, Bangkok, Thailand, 4-13.

• Lorsque l’information contenue dansl’article ait été obtenue ou dérive d’un siteWorld Wide Web, il faudra mettre le texteentre guillemets; par example “tiré de laFAO. 1996” et indiquer dans lesRéférences la forme standard URL:FAO. 1996. Domestic Animal DiversityInformation System, http://www.fao.org/dad-is/, FAO, Rome, Italy.

Pour tout envoi de manuscripts ou correspondence au sujet d’AGRI, vous êtesprié d’utiliser l’adresse suivante:

[email protected]

Merci pour votre collaboration

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

115

Reglas y normas editoriales

El objetivo del Boletín de Información sobreRecursos Genéticos Animales (AGRI) es ladivulgación de la información sobre unamejor gestión de los recursos genéticosanimales de interés para la producciónalimentaria y agrícola, siguiendo la EstrategiaMundial para la Gestión de los RecursosGenéticos de los Animales Domésticos. Todoslos aspectos referidos a la caracterización, laconservación y el uso de estos recursos serántomados en consideración, de acuerdo con elConvenio sobre la diversidad biológica.

AGRI publicará información sobregenética, encuestas fenotípicas y económicasy descripciones comparativas, uso, desarrolloy conservación de los recursos genéticosanimales, así como sobre el desarrollo deestrategias operacionales y normas quepermitan una gestión más eficaz de la relacióncosto/eficacia. Por ello, AGRI prestaráespecial atención a las contribucionesreferidas a razas y normas capaces decontribuir a la intensificación sostenible de losmedios (agroecosistemas) con ingresosmedios y bajos en el mundo, quecomprenden casi la mayor parte de lastierras dedicadas a la producción ganadera;la producción total de alimentos yagricultura provenientes de la ganadería; yel resto de los recursos genéticos de animalesdomésticos.

Los puntos de vista expresados en losartículos publicados en AGRI son solamentelas opiniones de los autores y, por tanto, noreflejan necesariamente la opinión de lasinstituciones para las cuales trabajan dichosautores, de la FAO o de los editores.

La oportunidad o no de publicar unartículo en AGRI será juzgada por los editoresy revisores.

Publicación electrónica

Además de su publicación impresa, la versióníntegra de AGRI se encuentra disponibleelectrónicamente en Internet, en el sitio:www.fao.org/dad-is/

Tipos de artículos

Serán publicados en AGRI los siguientes tiposde artículos:

Artículos sobre investigación

Se tomarán en consideración para supublicación en AGRI los estudios sobre lacaracterización, conservación y uso de losrecursos genéticos de los animales domésticos(AnGR) con una buena descripción delentorno. Se agradecerá el envío de fotografíasde calidad que presenten a las razas encuestión en su ambiente natural deproducción.

Artículos de revisión

Se podrán tomar en consideraciónocasionalmente aquellos artículos quepresenten una revisión de losagroecosistemas, a nivel nacional, regional omundial, con el desarrollo de uno o másaspectos referidos a la gestión de los recursosgenéticos animales, incluidas las revisionessobre el estado actual de las distintas áreasde AnGR.

Artículos específicos

Se solicitarán puntualmente artículos sobretemas específicos para ediciones especiales.

Otro material para publicación

Incluye la revisión de libros, noticias y notasreferidas a reuniones importantes, cursos deformación y principales eventos nacionales,regionales e internacionales, así comoconclusiones y recomendaciones relacionadascon los objetivos de estos principales eventos.Se invita a los lectores a enviar este tipo dematerial a los editores.

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

116

Guía para los autores

Presentación del manuscrito

Los artículos se presentarán en inglés, francéso español, junto con un resumen en inglés ysu traducción en francés o español, y seenviarán al editor de AGRI, AGAP, FAO,Viale delle Terme di Caracalla, 00100 Roma,Italia. El artículo deberá ser enviado enversión WinWord en fichero adjunto porcorreo electrónico a [email protected] fotografías, color o en blanco y negro, seenviarán siempre por correo normal.

Los manuscritos se presentarán con dobleespacio y con el número correspondiente acada línea en el margen izquierdo. Todas laspáginas serán numeradas, incluidas las de lasreferencias bibliográficas, cuadros, etc. Elautor recibirá una notificación sobre larecepción de su documento.

En el caso de aceptación de un artículodespués de su revisión, se solicitará al autoruna versión final de su artículo revisado endisquete (formato 31/2”) en Word 6.0 xWindows, así como una copia impresa delmismo.

Preparación del manuscrito

En la primera página del manuscrito seindicará el título abreviado del artículo, títulosy nombres de los autores, instituciones,direcciones completas (incluido código postaly número de teléfono); así como otros mediosde contacto tales como fax, correoelectrónico, etc. del autor principal. El títuloabreviado no deberá sobrepasar los45 caracteres más los espacioscorrespondientes, y aparecerá en la partesuperior de la página 1 del manuscrito enmayúsculas. El título entero del manuscritose escibirá en mayúsculas y minúsculas.Dicho título debe ser lo más breve posible yno sobrepasar los 150 caracteres (incluidoslos espacios necesarios), con los nombres delas especies, si necesario. Los nombres de losautores, instituciones y direcciones seescribirán en cursiva y en letras mayúsculasy minúsculas. Se dejará una línea en blanco

entre el título y los nombres de los autores.Las direcciones se escribirán como notas depie de página de cada autor después de dejaruna línea en blanco entre los nombres yéstas. Cada nota de pie de página con ladirección será indicada numéricamente. Sedejarán dos líneas en blanco después de lasdirecciones.

Títulos

Los títulos de cada sección, por ejemploResumen, Introducción, etc., serán alineadosa la izquierda. Dejar dos líneas en blancoentre las notas de pie de página con lasdirecciones y el Resumen y entre el títuloResumen y el texto que sigue. El resumen nodeberá exceder de 200 palabras. Deberá serun resumen objetivo que describabrevemente los procesos y logros obtenidos, yno una presentación de cómo se ha llevado acabo el estudio y una descripción genérica delos resultados. Dejar una línea en blancoentre el final del texto del resumen y laspalabras clave, que se escribirán en cursivaasí como el titulo Palabras clave. No deberánser más de seis y no deberán contener “y” o“&”. Todos los títulos principales de capítulo(14 regular) y subcapítulo (12 regular) seránen negrita e irán precedidos y seguidos deuna línea en blanco. El texto correspondienteempezará sin sangrado. Un título dentro deun subcapítulo se escribirá en cursiva e iráseguido de un punto con a continuación eltexto correspondiente.

Cuadros y figuras

Los cuadros y las figuras se incluirán al finaldel texto siguiendo el orden de cita dentro delmismo. Las fotografías no serán devueltas asus autores.

Cuadros

Los cuadros, incluidas las notas de pie depágina, deberán ir precedidos y seguidos pordos líneas en blanco. El número del cuadro ysu título se escribirán en la parte superior encursiva (12) con un punto al final y seguido

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○

117

de una línea en blanco. En cada columna otítulo de encabezamiento o subtítulo, sólo laprimera letra de la primera palabra irá enmayúscula. Los cuadros irán numerados deforma consecutiva con números árabes. Loscuadros y sus títulos se alinearán a laizquierda, así como el texto. Se utilizaránlíneas horizontales o verticales sólo cuandosea necesario. No utilizar tabuladores o labarra espaciadora para crear un cuadro.

Figuras

Las figuras, incluidos los títulos y leyendas,irán precedidas y seguidas de dos líneas enblanco. El número de la figura y el título seescribirán en la parte superior en cursiva (12)con un punto al final. La palabra figuraincluye las fotografías, los gráficos, los mapas,los diagramas, etc. En el caso del diagrama seenviará la matriz original con los datosutilizados para crearlo. Se recomiendaencarecidamente la utilización de Word 6.0 oExcel 5.0 para la presentación de losdiagramas.

Referencias

Toda referencia presente en el texto deberáaparecer en la lista de referencias y, de lamisma manera, cada referencia de la listadeberá haber sido citada por lo menos unavez en el texto. Las referencias deben ir enorden alfabético del apellido del autor,seguido por el año.

• Ejemplo en el caso de una referencia deuna revista:Köhler-Rollefson, I. 1992. The camelbreeds of India in social and historicalperspective. Animal Genetic ResourcesInformation 10, 53-64.

• Cuando se trate de más de un autor:Matos, C.A.P., D.L. Thomas, D. Gianola,R.J. Tempelman & L.D. Young. 1997.Genetic analysis of discrete reproductivetraits in sheep using linear and nonnlinearmodels: 1. Estimation of geneticparameters 75, 76-87.

• En el caso de un libro o de unapublicación ad hoc, por ejemplo informes,tesis, etc.:Cockrill, W.R. (Ed.). 1994. The Husbandryand Health of the Domestic Buffalo. FAO,Rome, Italy, pp 993.

• Cuando se trate de un artículo dentro delas actas de una reunión:Hammond, K. 1996. FAO’s programmefor the management of farm animalgenetic resources. In C. Devendra (Ed.),Proceedings of IGA/FAO Round Table onthe Global Management of SmallRuminant Genetic Resources, Beijing,May 1996, FAO, Bangkok, Thailand, 4-13.

• Cuando la información contenida en elartículo haya sido obtenida o derive de unsitio World Wide Web, poner el texto entrecomillas; por ejemplo “sacado de la FAO.1996” e indicar en las Referencias laforma estándar URL:FAO. 1996. Domestic Animal DiversityInformation System, http://www.fao.org/dad-is/, FAO, Rome, Italy.

Se ruega enviar los manuscritos o la correspondencia relativa a AGRI a ladirección siguiente:

[email protected]

Gracias por su colaboración

COPERTINA 1128 T 27-06-2007 9:08 Pagina 1

Date post:	29-Mar-2020
Category:	Documents
Upload:	others
View:	0 times
Download:	0 times

COPERTINA 1128 T 27-06-2007 9:08 Pagina 1Editors - Editeurs - Editores: S. Galal & J. Boyazoglu...

Documents