Copyright 2007 John Sayles DNA Fingerprinting A Primer for Future Jurors (or Criminals)

Copyright 2007 John Sayles

DNA Fingerprinting

A Primer for Future Jurors

(or Criminals)


Genetic Background

Only about 10% of our DNA is found in genes

Other 90% is “junk” DNADNA that doesn’t code for protein

productionThis is the stuff that makes us unique


Uses of DNA Fingerprinting

Forensic cases -- matching suspect with evidence

Paternity testing -- identifying father Historical investigations Missing persons investigations Mass disasters – matching tissue to

known DNA to identify victims Military DNA “dog tag” Convicted felon DNA databases (CODIS)


Sources of DNA Evidence(anything containing cells)

Blood Semen Saliva Urine Hair Teeth Bone Tissue (skin, muscle)


RFLP Profiling

Restriction Fragment Length Polymorphisms

Older technology, but still used

Requires larger sample

Used in OJ, Clinton cases


RFLP (“rif-lip”)

Restriction Enzymes are used to cut DNA at specific places RE’s recognize certain base (ATGC)

sequences and snip at that location The fragments are then separated using

Electrophoresis Light chunks move faster

The fragments are exposed to radioactive probes that attach to repeating base sequences only a small % of RFLP’s are “lit up”


Example of a RFLP

A Restriction Enzyme:

RFLP, w/probe:


Tandem Repeats

The probed chunks of DNA contain tandem repeats … GACTGACTGACTGACTGACT… = [GACT]5

The commonness of these tandem repeats is known a TR might occur in 10% of the population

By looking for several known TR’s we can narrow likelihood of that combination Multiply % commonness of each TR


An Electrophoresis Gel

Each sample contains many DNA fragments, but only the RFLP’s exposed tothe radioactive probes of repeating TR’s will show up as stripes on the exposed electrophoresis gel.

Negatively charged DNA fragments are attracted to the positive charge onthe right side of the gel. Shorter, lighter DNA fragments travel faster.


Probability Analogy

Blood type O was found at a crime scene The suspect is type O, but so is 50% of the population Suspect is not excluded, but not proven guilty either

Bruno Magli shoe prints were found at the crime scene The suspect owns Bruno Magli’s, like 2% of the

population The Bruno Magli’s are size 12’s

The suspect is size 12, like 10% of the population The % of the population with all three is

50% x 2% x 10% = 0.1% of population = 1 of 1,000

Calculating TR possible matches in population

3 different TR identified in sampleX = 10% in populationY = 5% in populationZ = 25% in population

To determine the chance of someone else in population that has this combination of TR just change % into decimal then multiply all together

Calculating TR possible matches in population

X = 10% = .10 Y = 5% = .05 Z = 25% = .25

(.10)(.05)(.25) = .00125 = .125% chance

Or 1 person in 1000 would match TR


Gel Used in CourtIn a rape case, DNA was tested from: semen removed from the victim (EVIDENCE #2); semen left on the victim's clothing (EVIDENCE #1); the DNA of the victim herself (VICTIM) to be sure that

the DNA didn't come from her cells; DNA from two suspects (SUSPECT #1, SUSPECT

#2); a set of DNA fragments of known and decreasing

length (MARKER). They provide a built-in ruler for measuring the exact distance that each fragment travels.

the cells of a previously-tested person to be sure the probes are performing properly (CONTROL).

Who’s guilty? Who’s not guilty? (ie, who’s excluded?) Who’s not excluded? What more would you need to convict suspect 1?


RFLP Review

Restriction Enzymes are used to cut DNA at specific places RE’s recognize certain base (ATGC)

sequences and snip at that location The fragments are then raced using

Electrophoresis Light chunks move faster

The fragments are exposed to radioactive probes that attach to repeating base sequences


The Clinton Case

A sample from the “blue dress” was compared to a DNA sample collected from President Clinton

7 different RFLP’s were examinedno expense was spared

The odds of that combination of RFLP’s was 1 in 7.8 trillionie, 1 person on 1,000 Earths had that

combination. (see text, page 322)


7 RFLP “markers” examined

The Restriction Enzyme used

“K” = Known sample

“Q” = Questioned sample#3243 is the Blue Dress

1 in 7.87 trillion Caucasians has this combination of markers

Document from www.thesmokinggun.com


The Simpson Case

The Unlucky Sock Found in OJ’s house Who’s blood is it? Who’s blood isn’t it? Would you convict on

this alone? How much more

evidence would you need?

DNA Evidence in the O. J. Simpson Trial


PCR DNA Analysis

Polymerase Chain Reaction Uses DNA polymerase enzyme to

amplify DNA in small samplesCan start with a nanogram sample

Can double DNA every two minutesBillion-fold increase in 1 hourFully automated, inexpensive


STR DNA Analysis

Short Tandem Repeats Same idea as RFLP analysis, but with

shorter DNA segments Better than RFLP

works with much smaller sample less susceptible to damage or decomposition

effects FBI’s CODIS use 13 STR loci as basis for

its analysis technique

Date post:	16-Jan-2016
Category:	Documents
Upload:	elvin-lawson
View:	215 times
Download:	0 times

Copyright 2007 John Sayles DNA Fingerprinting A Primer for Future Jurors (or Criminals)

Documents