+ All Categories
Home > Documents > Correction: A Member of a Family of Sulfate-Activating Enzymes Causes Murine Brachymorphism

Correction: A Member of a Family of Sulfate-Activating Enzymes Causes Murine Brachymorphism

Date post: 06-Jan-2017
Category:
Upload: doanthuy
View: 213 times
Download: 0 times
Share this document with a friend
2
Correction: A Member of a Family of Sulfate-Activating Enzymes Causes Murine Brachymorphism Source: Proceedings of the National Academy of Sciences of the United States of America, Vol. 95, No. 20 (Sep. 29, 1998), p. 12071 Published by: National Academy of Sciences Stable URL: http://www.jstor.org/stable/49318 . Accessed: 08/05/2014 15:32 Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at . http://www.jstor.org/page/info/about/policies/terms.jsp . JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact [email protected]. . National Academy of Sciences is collaborating with JSTOR to digitize, preserve and extend access to Proceedings of the National Academy of Sciences of the United States of America. http://www.jstor.org This content downloaded from 169.229.32.137 on Thu, 8 May 2014 15:32:28 PM All use subject to JSTOR Terms and Conditions
Transcript
Page 1: Correction: A Member of a Family of Sulfate-Activating Enzymes Causes Murine Brachymorphism

Correction: A Member of a Family of Sulfate-Activating Enzymes Causes MurineBrachymorphismSource: Proceedings of the National Academy of Sciences of the United States of America,Vol. 95, No. 20 (Sep. 29, 1998), p. 12071Published by: National Academy of SciencesStable URL: http://www.jstor.org/stable/49318 .

Accessed: 08/05/2014 15:32

Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .http://www.jstor.org/page/info/about/policies/terms.jsp

.JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range ofcontent in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new formsof scholarship. For more information about JSTOR, please contact [email protected].

.

National Academy of Sciences is collaborating with JSTOR to digitize, preserve and extend access toProceedings of the National Academy of Sciences of the United States of America.

http://www.jstor.org

This content downloaded from 169.229.32.137 on Thu, 8 May 2014 15:32:28 PMAll use subject to JSTOR Terms and Conditions

Page 2: Correction: A Member of a Family of Sulfate-Activating Enzymes Causes Murine Brachymorphism

Corrections Proc. Natl. Acad. Sci. USA 95 (1998) 12071

Genetics. In the article, "A member of a family of sulfate- activating enzymes causes murine brachymorphism," by Kiyoto Kurima, Matthew L. Warman, Srinivasan Krishnan, Miriam Domowicz, Richard C. Krueger, Jr., Andrea Deyrup, and Nancy B. Schwartz, which appeared in number 15, July 21, 1998, of Proc. Natl. Acad. Sci. USA (95, 8681-

8685), the following correction should be noted. An early version of Fig. 2 containing several errors was printed. The corrected figure and its legend are reproduced below. This version contains sequence data identical to that which was deposited in the GenBank database (accession no. AF052453) on March 4, 1998.

A 1 * 190 227 619

APS Kinase Linker ATP Sulfurylase B

-130 CTCACaG&CCTCAC&GaCTCTC -105 GCTCATTC&T CCCC&ATGGCCAGC&AAGCCAGTlGTAGCCGAGTATTCTCnCA?CAGATATCAIGTCvrGGAs GAGTTACCTAAACTCTGAGAAATTATC

TJ e-- 3*M

SEAN.ZEKK Z.1E3Q ES? ?# WV I 5 a its VSE *4 ZR 0 Q V V 35

106S S f f;;i Ct @

42142

0 T.GO .10 Cl.V V ?778 Zr V L A 0 i T. 7 1 1 F A L(I K'? V V $ T. 210

oil T7C& T 0CCCACAWTt9CAUi00MCA00llCcfrCaflG IO.AM0ACIM

Un 1.= . _. OOAC. G0Q ?&K

0T. in 1 T V 1. V ZTC.TS TV n 2 A0BIK0 15 2100

l945 CGTIOAGQGnOWCMAn?uCmnwCCGtCA AmeCTTtAOWTlLCc?SR4WCIawAtGGOAn02MAG&0A0GTATC?U

1951

O~~~~~~~~~M AS Rh USAMCT1Wl!tSCC0rWGA1CABVIC.GA$CACMTC.

506 t C _Alt? 9.LI g tt n fl 5$ DAV Ii t *.L ft V 420 IG. 251 SequentAMoWISK2. (A) SOchematicAdiagram of ATPecsulfurylase/APSkinasMe.Approximatelocationofjthe mutatin0inbmS20

12Tc .nn1. a minoDatq ar s.Thmtatio found i s ins &c &IGAOUAO0WEOPAAUQAIWAPMCO0Z 1 '0$isVfWttf'3(. atvzta" 9

1376~~~~~~~~~~~~~~~~~~~~~~~~~~~~~1

2295~~~~~~~~~~~~~~~~~~~~~~~~~~~~9 FI.21Sqec o K. A cemtcdiga f T uluyae/P ins.Aprxmtelctono hemttoni m I siniae

byIG. (B) ThS DNequence oSK2(And Sceaits deducedaminof Acid seqfuenceareAP shonas. The romutatio foundtion bm SIC muaisncircled.isinicte

This content downloaded from 169.229.32.137 on Thu, 8 May 2014 15:32:28 PMAll use subject to JSTOR Terms and Conditions


Recommended