+ All Categories
Home > Documents > CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology...

CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology...

Date post: 04-Jan-2016
Category:
Upload: amos-douglas
View: 215 times
Download: 0 times
Share this document with a friend
20
CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data
Transcript
Page 1: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

CS 461b/661b: Bioinformatics Tools and Applications

Software

Algorithm

Mathematical Models

Biology Experiments and Data

Page 2: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

• Bin Ma

• Title: Associate Professor

• Research area: Bioinformatics

• Office hours: Tuesday 4-5pm, Wednesday 4-5pm.

• Office: MC362

Page 3: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Bioinformatics

Bioinformatics

Page 4: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Class Time

• Monday, MC320, 2:30-4:30pm

• Wednesday, MC320/MC325, 3:30-4:30pm

• Jan. 7. An overview session.

• Jan. 14 (Monday), 16 (Wednesday) will be lectured by Mark Daley.

Page 5: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Evaluation

• Two assignments (10 marks each)

• One project (30 marks)

• One final exam (50 marks)

Page 6: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

• TA: ??.

Page 7: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Topic: Whole Genome Shotgun Sequencing

• Sequencing machines are used to read small fragments. Then the “reads” are assembled together.

• How to cut and clone.• How sequencing machines

work.• How to assemble.• DIY: assemble a small

genome.

Page 8: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Topic: PCR and Primer Design

• How to select a region of DNA and make millions of copies rapidly.• How to design the “primers”.• Use it to identify the criminals by FBI and polices.

• DIY: design a primer

Page 9: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Topic: Gene prediction

Page 10: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Gene prediction

• How translation is done

• Gene structures• How to find genes, the

most interesting parts on a genome.

• DIY: find a gene using software.

Page 11: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Topic: NCBI Entrez

• Where to get biological data.

• Use Entrez as a comprehensive data source.

• DIY: download and compare sequences of the same protein in 20 different mammals.

Page 12: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

GCNTACACGTCACCATCTGTGCCACCACNCATGTCTCTAGTGATCCCTCATAAGTTCCAACAAAGTTTGC|| ||||| | ||| |||| || |||||||||||||||||| | |||||||| | | |||||GCCTACACACCGCCAGTTGTG-TTCCTGCTATGTCTCTAGTGATCCCTGAAAAGTTCCAGCGTATTTTGC

GAGTACTCAACACCAACATTGATGGGCAATGGAAAATAGCCTTCGCCATCACACCATTAAGGGTGA----|| ||||||||| |||||| | ||||| |||||||| ||| |||||||| | | | || GAATACTCAACAGCAACATCAACGGGCAGCAGAAAATAGGCTTTGCCATCACTGCCATTAAGGATGTGGG

------------------TGTTGAGGAAAGCAGACATTGACCTCACCGAGAGGGCAGGCGAGCTCAGGTA ||||||||||||| ||| ||||||||||| || ||||||| || |||| |TTGACAGTACACTCATAGTGTTGAGGAAAGCTGACGTTGACCTCACCAAGTGGGCAGGAGAACTCACTGA

GGATGAGGTGGAGCATATGATCACCATCATACAGAACTCAC-------CAAGATTCCAGACTGGTTCTTG||||||| |||| | | |||| ||||| || ||||| || |||||| |||||||||||||||GGATGAGATGGAACGTGTGATGACCATTATGCAGAATCCATGCCAGTACAAGATCCCAGACTGGTTCTTG

Topic: BLAST and PatternHunter

sequence alignment

Page 13: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Homology Search

• Use NCBI BLAST as a tool to find similarities.• Spaced seeds.• How to implement the spaced seeds as computer

programs.• DIY: Experiment the sensitivity comparison

between spaced seeds and BLAST seed.

Page 14: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Mass Spectrometry

• Genomics Proteomics• Proteins are more directly related to the functions of cells• Many diseases are closely related to abnormal proteins• Knowing which proteins are present in different cells under

different conditions is useful• Protein ID becomes an essential task in proteomics

Page 15: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Tandem mass spectrometry

• Tandem mass spectrometry (MS/MS, tandem MS) is the standard way for protein identification.

LSIMQDK

peptide tandem mass spectrometer MS/MS spectrum

Page 16: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Mass Spectrometry

• Principles of instruments• Noises and complications in the data• De novo sequencing• SPIDER (de novo sequencing + homology search)• DIY:

– Use a mass spec to identify a protein

– Use PEAKS software to determine a peptide

– Use SPIDER software to identify a protein

Page 17: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

High Performance Liquid Chromatography (HPLC)

liquid (water etc.)

to ESI MS/MS

after 20 minutes or so

Page 18: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

• DIY: predict the retention time of a few peptides.

Page 19: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Protein Quantitation

• Several different methods for quantitation using mass spec.• DIY: use a spectrum to determine the relative quantity of

two proteins.

Page 20: CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Next Generation Sequencing

• How to sequence an individual human’s whole genome (3G bps) in one day, using less than 1000 dollars.

• Huge impact on personalized medicine.


Recommended