Date post: | 04-Jan-2016 |
Category: |
Documents |
Upload: | amos-douglas |
View: | 215 times |
Download: | 0 times |
CS 461b/661b: Bioinformatics Tools and Applications
Software
Algorithm
Mathematical Models
Biology Experiments and Data
• Bin Ma
• Title: Associate Professor
• Research area: Bioinformatics
• Office hours: Tuesday 4-5pm, Wednesday 4-5pm.
• Office: MC362
Bioinformatics
Bioinformatics
Class Time
• Monday, MC320, 2:30-4:30pm
• Wednesday, MC320/MC325, 3:30-4:30pm
• Jan. 7. An overview session.
• Jan. 14 (Monday), 16 (Wednesday) will be lectured by Mark Daley.
Evaluation
• Two assignments (10 marks each)
• One project (30 marks)
• One final exam (50 marks)
• TA: ??.
Topic: Whole Genome Shotgun Sequencing
• Sequencing machines are used to read small fragments. Then the “reads” are assembled together.
• How to cut and clone.• How sequencing machines
work.• How to assemble.• DIY: assemble a small
genome.
Topic: PCR and Primer Design
• How to select a region of DNA and make millions of copies rapidly.• How to design the “primers”.• Use it to identify the criminals by FBI and polices.
• DIY: design a primer
Topic: Gene prediction
Gene prediction
• How translation is done
• Gene structures• How to find genes, the
most interesting parts on a genome.
• DIY: find a gene using software.
Topic: NCBI Entrez
• Where to get biological data.
• Use Entrez as a comprehensive data source.
• DIY: download and compare sequences of the same protein in 20 different mammals.
GCNTACACGTCACCATCTGTGCCACCACNCATGTCTCTAGTGATCCCTCATAAGTTCCAACAAAGTTTGC|| ||||| | ||| |||| || |||||||||||||||||| | |||||||| | | |||||GCCTACACACCGCCAGTTGTG-TTCCTGCTATGTCTCTAGTGATCCCTGAAAAGTTCCAGCGTATTTTGC
GAGTACTCAACACCAACATTGATGGGCAATGGAAAATAGCCTTCGCCATCACACCATTAAGGGTGA----|| ||||||||| |||||| | ||||| |||||||| ||| |||||||| | | | || GAATACTCAACAGCAACATCAACGGGCAGCAGAAAATAGGCTTTGCCATCACTGCCATTAAGGATGTGGG
------------------TGTTGAGGAAAGCAGACATTGACCTCACCGAGAGGGCAGGCGAGCTCAGGTA ||||||||||||| ||| ||||||||||| || ||||||| || |||| |TTGACAGTACACTCATAGTGTTGAGGAAAGCTGACGTTGACCTCACCAAGTGGGCAGGAGAACTCACTGA
GGATGAGGTGGAGCATATGATCACCATCATACAGAACTCAC-------CAAGATTCCAGACTGGTTCTTG||||||| |||| | | |||| ||||| || ||||| || |||||| |||||||||||||||GGATGAGATGGAACGTGTGATGACCATTATGCAGAATCCATGCCAGTACAAGATCCCAGACTGGTTCTTG
Topic: BLAST and PatternHunter
sequence alignment
Homology Search
• Use NCBI BLAST as a tool to find similarities.• Spaced seeds.• How to implement the spaced seeds as computer
programs.• DIY: Experiment the sensitivity comparison
between spaced seeds and BLAST seed.
Mass Spectrometry
• Genomics Proteomics• Proteins are more directly related to the functions of cells• Many diseases are closely related to abnormal proteins• Knowing which proteins are present in different cells under
different conditions is useful• Protein ID becomes an essential task in proteomics
Tandem mass spectrometry
• Tandem mass spectrometry (MS/MS, tandem MS) is the standard way for protein identification.
LSIMQDK
peptide tandem mass spectrometer MS/MS spectrum
Mass Spectrometry
• Principles of instruments• Noises and complications in the data• De novo sequencing• SPIDER (de novo sequencing + homology search)• DIY:
– Use a mass spec to identify a protein
– Use PEAKS software to determine a peptide
– Use SPIDER software to identify a protein
High Performance Liquid Chromatography (HPLC)
liquid (water etc.)
to ESI MS/MS
after 20 minutes or so
• DIY: predict the retention time of a few peptides.
Protein Quantitation
• Several different methods for quantitation using mass spec.• DIY: use a spectrum to determine the relative quantity of
two proteins.
Next Generation Sequencing
• How to sequence an individual human’s whole genome (3G bps) in one day, using less than 1000 dollars.
• Huge impact on personalized medicine.