Cell Host & Microbe

Article

Cytomegalovirus miRNAs Target Secretory PathwayGenes to Facilitate Formation of the VirionAssemblyCompartmentandReduceCytokineSecretionLauren M. Hook,1 Finn Grey,1,5 Robert Grabski,4 Rebecca Tirabassi,1,2 Tracy Doyle,2 Meaghan Hancock,1 Igor Landais,1

Sophia Jeng,3 Shannon McWeeney,3 William Britt,4 and Jay A. Nelson1,*1Vaccine and Gene Therapy Institute, Oregon Health and Science University, Beaverton, OR 97006, USA2Department of Medical Microbiology and Immunology, University of Wisconsin–Madison, Madison, WI 53706, USA3Knight Cancer Institute, Oregon Health and Science University, Portland, OR 97239, USA4Department of Pediatrics, University of Alabama, Birmingham, AL 35294, USA5Division of Infection and Immunity, The Roslin Institute, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, UK

*Correspondence: nelsonj@ohsu.eduhttp://dx.doi.org/10.1016/j.chom.2014.02.004

SUMMARY

Herpesviruses, including human cytomegalovirus(HCMV), encodemultiple microRNAs (miRNA) whosetargets are just being uncovered. Moreover, miRNAfunction during the virus life cycle is relativelyunknown. We find that HCMV miRs UL112-1,US5-1, and US5-2 target multiple components ofthe host secretory pathway, including VAMP3,RAB5C, RAB11A, SNAP23, and CDC42. A HCMVmiR UL112-1, US5-1, and US5-2 triple mutantdisplayed aberrant morphogenesis of the virion as-sembly compartment (VAC), increased secretion ofnoninfectious particles, and increased IL-6 releasefrom infected cells. Ectopic expression of miRsUL112-1, US5-1, and US5-2 or siRNAs directedagainst RAB5C, RAB11A, SNAP23, and CDC42caused the loss of Golgi stacks with reorganizationinto structures that resemble the VAC and a decreasein cytokine release. These observations indicate thatmultiple HCMV miRNAs coordinately regulate reor-ganization of the secretory pathway to control cyto-kine secretion and facilitate formation of the VACfor efficient infectious virus production.

INTRODUCTION

Human cytomegalovirus (HCMV) is a b-herpesvirus that encodes

multiple microRNAs (miRNAs) (Grey et al., 2005; Pfeffer et al.,

2004; Stark et al., 2012). miRNAs are small noncoding RNAs

(19–22 nucleotides) that posttranscriptionally regulate gene

expression. In general, miRNAs target the 30 untranslated region

(30 UTR) of mRNAs through the RNA-induced silencing complex

(RISC) that leads to translational repression and degradation of

the targeted mRNA (Lim et al., 2003). The miRNA targets of

herpesvirus miRNAs are slowly emerging and include both viral

transcriptional activators and cellular genes involved in immune

evasion, signaling, and apoptosis (Abend et al., 2010; Grey et al.,

2007; Lei et al., 2010; Stern-Ginossar et al., 2007; Umbach et al.,

Cell Ho

2008; Samols et al., 2007; Ziegelbauer et al., 2009; Kim et al.,

2012). HCMVmiRNA targets include viral genes such as the virus

major immediate-early gene product IE72 and US7, as well

as cellular genes involved in immune defense such as the cellular

major histocompatibility complex class I-related chain B (MICB),

a stress-induced ligand of the natural killer (NK) cell activating

receptor NKG2D, and RANTES (Grey et al., 2007; Stern-Ginos-

sar et al., 2007; Tirabassi et al., 2011; Kim et al., 2012).

miRNAs may converge on related pathways and even exhibit

redundant roles in targeting genes such as cellular miR-1 and

miR-133, regulating skeletal muscle proliferation and differentia-

tion (Chen et al., 2006). The first indication that viral miRNAs

target functionally related genes in a cellular pathway was the

observation that the targets of HCMV miR-US25-1 regulate

multiple genes involved in cell-cycle regulation, tumor progres-

sion, and chromatin remodeling (Grey et al., 2010). Additional

evidence derives from the identification of the Kaposi’s sar-

coma-associated herpesvirus (KSHV) and Epstein-Barr virus

(EBV) miRNA cellular targetomes using photoactivatable-ribonu-

cleoside enhanced crosslinking (PAR-CLIP) with RISC immuno-

precipitation biochemical analyses. In these studies, KSHV

and EBV miRNAs in latently infected transformed cells were

observed to target multiple genes involved in transcriptional

regulation, signal transduction, innate immunity, vesicular traf-

ficking, and the regulation of cell cycle and apoptosis (Gottwein

et al., 2011; Skalsky et al., 2012).

IL-6 and TNF-a are inflammatory cytokines that are induced

by HCMV early in infection through the activation of nuclear

factor kB (NF-kB) (Kowalik et al., 1993; Yurochko et al., 1997a;

Yurochko et al., 1997b). IL-6 and TNF-a play important roles in

stimulating cellular innate immunity, and HCMV has developed

multiple mechanisms to block the antiviral effects of these in-

flammatory cytokines. These strategies include downregulation

of the TNFR1 from the plasmamembrane, transcriptional repres-

sion of both IL-6 and TNF-a, and posttranscriptional repression

of IL-6 through destabilization of mRNA (Baillie et al., 2003; Jar-

vis et al., 2006; Gealy et al., 2005). IL-6 and TNF-a are released

from the cell through vesicles in the secretory pathway utilizing

a number of endocytic proteins including VAMP3, RAB11A,

and SNAP23 during the process. Both EBV and KSHV encode

miRNAs that regulate vesicular trafficking; thus, miRNA targeting

of key endocytic proteins to limit the release of inflammatory

st & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevier Inc. 363

0

20

40

60

80

100

120

VAMP3 VAMP3 mt

% C

ontr

ol

Neg miR-UL112-1

0

20

40

60

80

100

120

RAB5C RAB5C mt

% C

ontr

ol

Neg miR-UL112-1

0 20 40 60 80

100 120

0.00

0.

02

0.04

0.

08

0.16

0.

32

0.64

1.

28

% C

ontr

ol

pmol/well

Neg miR-UL112-1

VAMP3 miR-UL112-1 RAB5C miR-UL112-1

15kD

35kD

0 0.5 1.0 2.0 4.0 8.0 pmol/well VAMP3

gapdh

0 0.5 1.0 2.0 4.0 8.0 25kD

35kD

pmol/well RAB5C

gapdh

0 20 40 60 80

100 120

0.00

0.

02

0.04

0.

08

0.16

0.

32

0.64

1.

28

% C

ontr

ol

pmol/well

Neg miR-UL112-1

A

B

C

D

0 20 40 60 80

100 120

Neg

US5-1

UL112

-1

UL148

D-1 5p

% C

ontr

ol

VAMP3

0 20 40 60 80

100 120 140

Neg

US5-1

UL112

-1

UL148

D-1 5p

RAB5C E

0 20 40 60 80

100 120

Neg

US5-1

UL112

-1

UL148

D-1 3p

RAB11A

0 20 40 60 80

100 120

Neg

US5-1

US5-2

UL112

-1

UL148

D-1 5P

SNAP23

0 20 40 60 80

100 120

Neg

US5-2

CDC42

F VAMP3

RAB5C

RAB11A

SNAP23

CDC42

gapdh

gapdh

gapdh

gapdh

gapdh

15kD

25kD

25kD

25kD

25kD

35kD

35kD

35kD

35kD

35kD

Neg 5-1 112 Co siRNA

Neg 5-1 112 Co siRNA

Neg 5-1 112 Co siRNA

Neg 5-1 112 Co siRNA5-2

Neg siRNA 5-2

H

RAB5C

RAB11A

SNAP23

gapdh

* * * * * * * * ** * * * *

**

* * * **

** * *

GGA CUA A GUGGCAGUGAUC C G A

AUCUAGAUGUAAUGUUGUCACUA5'

3'

3'

5'

VAMP3miR-UL112-1

AAGCTT

UAGAGU CAGUGAAUCGGACC

AGUCUUAAGUCACUU5'

3'

3'

5'

Rab5CmiR-UL112-1

AAGCTT

GG

MO

CK 24hr 48hr 72hr

WT Mut WT Mut WT Mut

1.0

1.0

1.0

0.2

0.9

0.6

1.4

1.0

0.4

1.4 2.3 2.11.4

1.8 2.3 2.7 3.5

0.5 1.0 0.9 1.1

25kD

25kD

25kD40kD

1.00 0.92 0.24 0.19 0.03 0.02 1.00 0.88 0.71 0.70 0.70 0.50

1.00 0.95 0.55 0.38 0.00

1.00 0.55 0.37 0.27 0.00

1.00 0.93 0.72 0.55 0.03

1.00 0.43 0.59 0.54 0.37 0.01

1.00 0.17 0.47

15kDa

35kDagapdh

Neg 5-1 112 Co siRNAVAMP3

25kDa

35kDa

RAB5C

gapdh

Neg 5-1 112 Co siRNA

25kDa

35kDagapdh

Neg 5-1 112 Co siRNA

RAB11A

25kDa

35kDa

SNAP23

gapdh

Neg 5-1 5-2 112 Co siRNA

1.00 0.80 0.38 0.32 0.02

1.00 0.46 0.22 0.06 0.01

1.00 0.45 0.85 0.37 0.17 0.04

CDC42

gapdh35kD

35kD

Neg siRNA5-2gg

1.00 0.31 0.26

1.00 0.61 0.52 0.34 0.23

G

Figure 1. HCMV miR-US5-1, miR-US5-2, and miR-UL112-1 Target Components of the Endocytic Compartment

(A) The 30 UTRs of VAMP3 and RAB5C each contain one potential target site for miR-UL112-1. The black boxes represent the open reading frames, white boxes

the UTRs. The position of the target site within the 30 UTR is indicated (gray), as well as the predicted binding between miR-UL112-1 and target sites within each

transcript.

(B) Reporter constructs containing the 30 UTRs of VAMP3 (left panel) or RAB5C (right panel) cloned downstream of renilla were cotransfected into 293 cells with

increasing concentrations of double-stranded miR-UL112-1 mimic or negative control (Neg). At 16 hr posttransfection cell lysates were harvested, and the

relative renilla activity was determined by normalizing to firefly activity and then calculated as percentage of the negative control (% Control).

(C) The predicted miR-UL112-1 target sites (A) were mutated by site-directed mutagenesis to the sequences indicated above the arrows and evaluated in

luciferase assays.

(D) 293 cells were transfected with the miR-UL112-1 concentrations indicated. VAMP3 and RAB5C proteins levels at 48 hr post transfection were evaluated by

western blot analysis. Relative band intensity was determined by dividing the intensity of the band by GAPDH followed by normalization to the untransfected

control.

(E) The 30 UTR reporter constructs were transfected into 293 cells with double-strandedmimics or negative control and relative renilla activity was determine 16 hr

posttransfection by dual-luciferase assay and displayed at percent control (% Control).

(legend continued on next page)

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

364 Cell Host & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevier Inc.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

cytokines would provide an attractive mechanism of evading the

innate immune response triggered by IL-6 and TNF-a.

The secretory pathway plays an essential role in HCMV as-

sembly and egress from the cell. Following encapsidation and

partial tegumentation of the HCMV genome in the nucleus, cap-

sids are transported to the virion assembly compartment (VAC)

in the cytoplasm for additional tegumentation and final virion

envelopment. Subsequently, enveloped viral particles egress

from the cell using components of the secretory pathway,

although this process is poorly understood (Alwine, 2012; Das

and Pellett, 2011; Das et al., 2007). The secretory pathway is

composed of the endoplasmic reticulum (ER), Golgi complex,

and trafficking vesicles. These compartments are defined by

their intracellular location, morphology, membrane protein com-

ponents, and lipid composition. Although the site of virion envel-

opment is unknown, multiple secretory organelle markers for the

Golgi, the late and early endosomes, and the endocytic recycling

compartment (ERC) have been associated with the VAC (Buch-

kovich et al., 2009; Cepeda et al., 2010; Krzyzaniak et al.,

2009). Additionally, the morphology of the Golgi appears altered

in HCMV-infected cells with the accumulation of Golgi, ER, and

endosomal proteins with viral glycoproteins and tegument

proteins in the VAC adjacent to the nucleus (Alwine, 2012;

Sanchez et al., 2000a, 2000b). The mechanism through which

HCMV remodels the secretory compartment is unknown but

has been attributed to viral proteins (Alwine, 2012).

In this report we show that multiple HCMV-encoded miRNAs

target several endocytic pathway genes, which serves two

purposes for the virus. The first is to interfere with the trafficking

and release of proinflammatory cytokines providing the virus

with a unique immune evasion strategy. The second is to restruc-

ture components of the secretory pathway, including the Golgi

and endocytic compartment, to form the VAC, leading to

increased efficiency of infectious particle production.

RESULTS

HCMV miRNAs Target Multiple Members of theEndocytic PathwayIn order to identify cellularmRNA targets of HCMVmiR-UL112-1,

RISC immunoprecipitation followed by DNA microarray analysis

(RIP-CHIP) was performed in HEK293T cells expressing myc-

tagged Ago2 a component of the RISC complex (Grey et al.,

2010; Karginov et al., 2007). Among the top ten mRNAs enriched

in these experiments were vesicle-associated membrane pro-

tein 3 (VAMP3) and RAS-related protein 5C (RAB5C), which are

essential components of the secretory/endocytic pathway (see

Table S1 available online). RAB5C is a small GTPase that func-

tions to ensure the fidelity of vesicle transport and docking to

the acceptor compartment (Zerial and McBride, 2001). VAMP3

is themain component of a protein complex that includes synap-

tosomal-associated proteins that are involved in docking or

(F and G) Western blot analyses were performed on 293Ts (F) or NHDFs (G) trans

posttransfection. Relative band intensity was determined by dividing the intensity o

(H) NHDFs were infected with the AD169 wild-type (WT) or the AD169 miR-US5-1

SNAP23 were analyzed 24, 48, and 72 hpi by western blot analysis. Relative ba

followed by normalization with the mock-infected control (MOCK). *p < 0.05 by tw

experimental replicates. Figure 1, related to Figures S1 and S2.

Cell Ho

fusion of vesicles with the presynaptic or plasma membrane

(Bernstein and Whiteheart, 1999). These mRNAs were also

enriched in RIP-CHIP experiments in human fibroblast cells

infected with HCMV strain TR (Table S2). Analysis of the

VAMP3 and RAB5C sequences indicated that both 30 UTRs

encoded potential target sites for miR-UL112-1 (Figure 1A).

Both of the VAMP3 and RAB5C miR-UL112-1 target sites were

functional, since transfection of HEK293T cells with increasing

concentrations of a miR-UL112-1 double-stranded mimic re-

duced expression of luciferase reporters containing the

VAMP3 and RAB5C 30 UTRs (Figure 1B). In addition, mutation

of the miR-UL112-1 target sites in the luciferase reporters

restored wild-type (WT) activity (Figure 1C). Lastly, both

VAMP3 and RAB5C protein levels were reduced in HEK293T

cells transfected with increasing concentrations of miR-UL112-

1 (Figure 1D). Together these data indicate that a single HCMV

miRNA targets two important members of the secretory/endo-

cytic pathway for reduced expression.

To determine whether other HCMV miRNAs target the

endocytic pathway, we examined whether the 30 UTRs of

VAMP3 andRAB5C, aswell as those of other pathwaymembers,

contained HCMV miRNA seed target sites. We observed that, in

addition to miR-UL112-1 targets sites, VAMP3 and RAB5C

also contained potential target sites for HCMV miR-US5-1 and

that transfection of the miR-US5-1 with luciferase reporters con-

taining the 30 UTRs of these genes also reduced expression (Fig-

ures S1A, S1B, and 1E). Mutation of the miR-US5-1 target sites

in the luciferase reporters restored WT activity (Figures S1A and

S1B). Interestingly, both VAMP3 and RAB5C were coordinately

downregulated by miRs UL112-1 and US5-1 when cotrans-

fected into HEK293Ts or NHDFs (Figures 1F and 1G).

RAS-related protein 11A (RAB11A) and synaptosomal-

associated protein 23 (SNAP23) are also members of the secre-

tory pathway, while the cell division control protein 42 (CDC42) is

critical for actin nucleation and retrograde transport of recycling

endosomes within the secretory pathway. Examination of the 30

UTRs of these genes revealed that each contained potential

seed target sites for one or more HCMV miRNAs (Figures

S1C–S1E). These observations were confirmed using reporter

assays combined with site-directed mutagenesis to confirm

the target sites and indicated that miR-UL112-1 and miR-US5-

1 downregulated expression of the RAB11A and SNAP23, while

miR-US5-2 reduced expression of the SNAP23 and CDC42 (Fig-

ures 1E and S1C–S1E). Similar to VAMP3 and RAB5C, cotrans-

fection of the HCMV miRNAs that were predicted to target

RAB11A or SNAP23 cooperatively downregulated protein

expression (Figures 1F and 1G). Transfection of miR-US5-2

alone reduced CDC42 protein expression (Figures 1F and 1G).

These observations indicate that not only are the HCMVmiRNAs

cooperatively targeting several members of a single cellular

pathway but that they also act together to downregulate single

genes within the pathway.

fected with the double-stranded miRNA mimics or negative control (Neg) 48 hr

f the band byGAPDH followed by normalization to the neg-transfected control.

, -US5-2, -UL112-1 mutant virus (Mut), and the levels of RAB5C, RAB11A, and

nd intensity was determined by dividing the intensity of the band by GAPDH

o-tailed Student’s t test. Data represent the mean ± SD of a minimum of three

st & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevier Inc. 365

0

100

200

300

400

500

600

700

800

900

Neg miRNAs siRNAs

IL-6

pg/

mL

Transfection group

MOCK

WT

Mut

0

100

200

300

400

Neg

miRNAs

siRNAs

TNF

pg/m

l

0 100 200 300 400 500

Moc

k LP

S

TNF

pg/m

L

0 25 50 75

100 125

Moc

k LP

S

IL-6

pg/

mL

0 25 50 75

100 125

Neg

miRNAs

siRNAs

IL-6

pg/

mL

0

200

400

600

800

1000

0 24 48 72

IL-6

pg/

mL

hpi

WTMut

E

A

B

C

D

SNAP23

RAB11A

gadph

Neg

miRNAs s

ANRis

40kD

35kD

25kD25kD

RAB5C25kD

VAMP315kD

Figure 2. HCMV-Encoded miRNAs Down-

regulate VAMP3, RAB5C, RAB11A, and

SNAP23 Protein Levels, Limiting the

Release of Proinflammatory Cytokines

TNF-a and IL-6

For each panel, one representative experiment is

shown of at least three performed.

(A) (Left panels) TPA-treated THP-1 cells trans-

fected with a negative control siRNA were treated

with LPS or mock treated to induce production

and release of TNF-a and IL-6. Supernatants were

collected 8 hr posttreatment and analyzed for

TNF-a and IL-6 release by ELISA. (Right panels)

TPA-treated THP-1 cells were transfected with a

combination of HCMVmiRNAs that were shown to

target components involved in cytokine release

(miRNAs), a combination of siRNAs against those

same transcripts (siRNAs), or a nontargeting

negative control siRNA (Neg) (final concentration

of RNA combined was 50 nM). At 72 hr post-

transfection, cells were treated with LPS to induce

production and release of TNF-a and IL-6. Su-

pernatants were collected 8 hr posttreatment and

analyzed for TNF-a and IL-6 release by ELISA.

(B) Western blot analysis on TPA-treated THP-1

cells in (A) (right panel) using the indicated anti-

bodies.

(C) NHDFs were infected with either the AD169

wild-type virus (WT) or the AD169 miR-US5-1,

-US5-2, -UL112-1 triple mutant virus (Mut), and

the level of IL-6 present in the supernatant 24, 48,

and 72 hpi was determined by ELISA.

(D) NHDFswere transfectedwith HCMVmiRNAs (miRs UL112-1, US5-1, and US5-2), siRNAs (VAMP3, RAB5C, RAB11A, and SNAP23), or negative control siRNA

(Neg) (final concentration of RNA combined was 30 nM) and at 48 hpt were infected with the WT or Mut virus. Supernatants were collected at 24 hr intervals and

tested for IL-6 release; shown is 48 hpi.

(E) Western blot analysis on uninfected NHDFs in (D) using the indicated antibodies. Data are represented as mean ± SD.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

Next we generated a miR-UL112-1, miR-US5-1, and miR-

US5-2 AD169 mutant virus to determine if the HCMV miRNAs

downregulate expression of endocytic proteins during viral

infection. miR-UL112-1 is located directly antisense to the

UL114 uracil DNA glycosylase (UDG) gene. To inactivate

miR-UL112-1 function without affecting UDG, seven silent point

mutations were introduced in UDG that disrupted the secondary

structure of the miRNA (Figures S2A and S2B). Analysis of the

mutant demonstrated WT levels of expression of UDG, lack of

miR-UL112-1 expression, and WT viral growth kinetics (Figures

S3A–S3C). To inactivate expression of miR-US5-1 and miR-

US5-2 in the miR-UL112-1 mutant, a 190 nucleotide deletion

was made in the noncoding region between US6 and US7

as previously described (Figure S2C; Tirabassi et al., 2011).

HCMV with mutation of miR-US5-1 and miR-US5-2 alone as

confirmed by stem-loop RT-PCR for miRNAs did not exhibit

altered viral growth in cells (Figures S3D and S3E). Sequence

analysis of the HCMV miRNA triple mutant virus indicated that

the only differences between the mutant and WT virus were

the mutations introduced into the miRNAs, and real-time

PCR confirmed that miR-UL112-1, miR-US5-1, and miR-US5-2

were no longer expressed during infection (Figure S4A). Western

blot analysis of HCMV-infected NHDFs revealed an increase in

expression of RAB5C, RAB11A, and SNAP23 in cells infected

with the HCMV miRNA triple mutant in comparison to cells

infected with the WT virus (Figure 1H). The increase in protein

366 Cell Host & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevie

expression correlates with lack of HCMV miRNA expression

and together with the above results indicates that these proteins

are targets of miR-UL112-1, miR-US5-1, and miR-US5-2.

HCMV miRNA Targeting of the Secretory/EndocyticPathway Limits the Release of TNF-a and IL-6Since VAMP3, RAB5C, RAB11A, and SNAP23 play a critical role

in the trafficking and release of TNF-a and IL-6 through the

secretory pathway, we examined the effect of the HCMV

miRNAs that target the endocytic pathway on cytokine release

(Murray et al., 2005; Stow et al., 2006). THP-1 cells were used

in these studies, since neither lipopolysaccharide (LPS) nor

HCMV infection induces significant production or release of

TNF-a in fibroblasts. In these experiments THP-1 cells were

transfected with miR-UL112-1, miR-US5-1, and miR-US5-2 or

siRNAs that target VAMP3, RAB5C, RAB11A, and SNAP23 for

72 hr followed by treatment with or without LPS. The levels of

TNF-a and IL-6 in the supernatants for each were assayed 8 hr

post-LPS treatment. Transfection of cells with either the HCMV

miRNAs or siRNAs reduced secretion of TNF-a by 8-fold and

IL-6 by approximately 2-fold (Figure 2A). Western analysis of

transfected cells for SNAP23, RAB5C, and RAB11A indicated

a 3- to 5-fold reduction of protein (Figure 2B). Subsequently,

we examined the ability of the HCMV miRNA triple mutant to

induce secretion of IL-6 in virus-infected HF cells. As shown in

Figure 2C, mutation of the HCMV miRNAs increased cellular

r Inc.

Figure 3. The HCMV miRNAs Facilitate

Formation of the Viral Assembly Compart-

ment

(A) NHDFs were infected with either the AD169

wild-type (WT) or the AD169 miR-US5-1, -US5-2,

-UL112-1 triple mutant virus (Mut) or mock in-

fected (Mock) and analyzed by immunofluores-

cence with the markers indicated as described in

the Experimental Procedures.

(B–E) HeLa cells were transfected with a combi-

nation of HCMVmiRs US5-1, US5-2, and UL112-1

(B); combinations of pathway-specific siRNAs

SNAP23, RAB5C, RAB11A, and CDC42 (C);

SNAP23, RAB5C, and RAB11A (D); or non-

targeting negative control siRNA (E), and the Golgi

complex was evaluated by immunofluorescence

4 days posttransfection for the cis-Golgi marker

GM130 in red and the trans-Golgi marker Gol-

gin245 in green as described in the Experimental

Procedures. This figure is related to Figure S5.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

secretion of IL-6 by 6- to 10-fold in comparison to WT infection,

indicating that the viral miRNAs significantly inhibit cellular

release of the inflammatory cytokine, possibly through altered

function of the secretory pathway. The increased secretion of

IL-6 induced by the HCMV triple miRNA mutant was reduced

to WT levels by either transfection of miR-UL112-1, miR-US5-

1, and US5-2 mimics or combinations of siRNAs targeting

VAMP3, RAB5C, RAB11A, and SNAP23 (Figure 2D). Western

analysis of transfected cells confirmed specific knockdown of

these cellular proteins (Figure 2E). These observations indicate

that HCMV has developed a unique mechanism to prevent cyto-

kine release regardless of the virus-induced innate immune acti-

vation events triggered in the cell.

Cell Host & Microbe 15, 363–37

HCMV miRNA Targeting of theSecretory/Endocytic PathwayMediates Formation of the VirionAssembly CompartmentFormation of the VAC occurs during the

late phase of HCMV infection when

HCMV miRNAs are at the highest

concentrations in the cell (Grey et al.,

2005). Since miR-UL112-1, miR-US5-1,

and miR-US5-2 target genes involved

in vesicular transport and membrane

fusion, we examined cells infected with

the HCMV triple miRNA mutant to deter-

mine if viral protein localization in the

VAC was altered during infection. Exami-

nation of HCMV WT infected cells re-

vealed the characteristic accumulation

of the viral glycoprotein gM in the VAC

adjacent to the nucleus that costained

with the Golgi marker TGN46 (Figure 3A).

However, the morphology of the ER was

unaltered, as determined by staining

with an antibody to calreticulin (Fig-

ure S5). In contrast, infection of NHDFs

with the HCMV miRNA triple mutant

resulted in the disruption of the VAC into discrete structures

staining with TGN46 and HCMV gM throughout the cell. In order

to determine whether the HCMV miRNAs were sufficient to alter

the morphology of the Golgi, cells were transfected with

miR-UL112-1, miR-US5-1, and US5-2 mimics or combinations

of siRNAs targeting RAB5C, RAB11A, SNAP23, and CDC42.

As shown in Figures 3B–3D, transfection of either the HCMV

miRNAs or the pool of siRNAs disrupted the normal morphology

of the Golgi ribbons and in some cells resulted in the formation of

spherically shaped juxtanuclear structures that were similar in

the morphology of the Golgi during WT HCMV infection. This

phenotype was in sharp contrast to the normal positioning and

morphology of the Golgi in control-transfected cells (Figure 3E).

3, March 12, 2014 ª2014 Elsevier Inc. 367

0.0

2.0

4.0

6.0

0 2 4 6 8 10 day post infection

Cell-associated virus

0.0 2.0 4.0 6.0 8.0

0 2 4 6 8 10

day post infection

Supernatant virus

0.0 2.0 4.0 6.0 8.0

0 1 2 3 4 5 Tite

r PFU

/mL

(log1

0)

day post infection

Supernatant virus

0.0 2.0 4.0 6.0 8.0

0 1 2 3 4 5 Tite

r PFU

/mL

(log1

0)

day post infection

Cell-associated virus

Single-step Multi-step

WT

Mut

0

20

40

60

80

100

120

WT Mut

Rel

ativ

e pl

aque

siz

e

A

B C

*

Figure 4. Mutation of the HCMV miRNAs

Results in Reduced Virus Yield and Small

Plaque Phenotype

(A) NHDFs were infected with the AD169 wild-type

virus (WT-black diamonds) or the AD169 miR-

US5-1, -US5-2, -UL112-1 mutant virus (Mut-gray

squares) (moi = 3, single step; moi = 0.05, multi-

step), and cell-associated and supernatant virus

were harvested at the dpi indicated. Titers were

determined by plaque assay.

(B) Plaque phenotype of the WT and Mut virus

72 hpi on NHDFs. White bar, 0.1 mm.

(C) Relative plaque size of the WT-black bar

compared with the Mut-gray bar. Mean area was

determined 72 hpi on NHDFs and normalized to

WT. *p < 0.05 by two-tailed Student’s t test. Data

are represented as mean ± SD. This figure is

related to Figures S2–S4.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

Transfection of a subset of the siRNAs to SNAP23, RAB11A,

and RAB5C also resulted in altered morphology of the Golgi

(Figure 3D).

Analysis of the growth kinetics of the HCMV miRNA triple

mutant revealeda2-loggrowthdefect inNHDFsandsmall plaque

phenotype without noticeable defects in immediate-early, early,

and late gene expression; viral genome replication; or incorpora-

tion of major envelope or late tegument proteins into the virion

(Figures 4A–4C and S4B–S4E). This reduction in viral production

by the HCMV mutant may be due to inefficient and/or aberrant

assembly of virus secondary to the disruption of the VAC. There-

fore theplaque-formingunit (PFU) togenomecopynumber (GCN)

ratiowas analyzed forWTandmiRNA triplemutant virus obtained

368 Cell Host & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevier Inc.

from infected cell supernatants. Com-

parison of WT and miRNA mutant virus

secreted into the supernatant revealed a

400-fold and 100-fold increase in the pro-

duction of noninfectious particles for the

mutant virus at 72 and 96 hr postinfection

(Table 1). A 5-fold increase in PFU:GCN

ratio was detected in cells infected with

the HCMV miRNA triple mutant virus that

were transfected with siRNAs targeting

RAB5C, RAB11A, SNAP23, and CDC42

(Table 2). These results indicate that

HCMVmiRNA targeting of endocytic pro-

teins to restructure the Golgi to form the

VAC is essential for efficient production

of infectious virus.

HCMV miRNA Targeting of theSecretory/Endocytic PathwayResults in Accumulation ofTransferrin in the EndocyticRecycling CompartmentPrevious studies of the origins of the VAC

indicated that virion glycoproteins accu-

mulated in a membranous compartment

that could be labeled with markers of

the ERC (Krzyzaniak et al., 2009). In this

earlier study, we demonstrated that accumulation of the major

envelope glycoprotein of HCMV, gM, was dependent on inter-

action of this protein with Rab11 effector protein, Fip4, and

that these proteins along with endocytosed transferrin accumu-

late in the ERC (Krzyzaniak et al., 2009). The targeting of several

components of the endocytic pathway by HCMVmiRNAs raised

the possibility that these miRNAs could impact either endocy-

tosis or endocytic recycling in virus-infected cells. We explored

this possibility by utilizing fluorochrome-conjugated transferrin

in an assay of endocytosis and recycling of endocytosed trans-

ferrin in cells infected with the WT virus expressing the miRNAs

and the viral miRNA mutant. After depletion of endogenous

transferrin, fluorochrome-labeled transferrin was allowed to

Table 1. Mutation of the HCMV miRNAs Results in Altered Virion Fitness

Supernatant Virus

Genome Copy/mL PFU/mL PFU:Genome Copy

72 hpi 96 hpi 72 hpi 96 hpi 72 hpi 96 hpi

WT 630,538 1,683,477 65,000 110,000 1:10 1:15

Mut 221,094 653,125 5 60 1:44,219 1:10,885

NHDFswere infected with either the AD169 wild-type (WT) or the AD169miR-US5-1, -US5-2, -UL112-1 triple mutant virus (Mut) (moi = 3, 2 hr) followed

by acid wash to remove extracellular virus. At 72 and 96 hpi, supernatant virus was harvested and the PFU/genome copy was determined by virus

titration on NHDFs and real-time PCR.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

internalize into infected cells at 37�C followed by a chase with

unlabeled transferrin to analyze the recycling of this protein. As

can be seen in Figure 5, cells infected with WT and mutant virus

bound and internalized transferrin similarly. Interestingly, after a

60 min chase period, similar amounts of transferrin were present

in a juxtanuclear site of cells infected with the WT virus, whereas

minimal to undetectable amounts of transferrin were present in

cells infected with the mutant virus and in uninfected adjacent

cells (Figure 5). These findings support the hypothesis that the

miRNA targeting the components of the secretory/endocytic

pathway alters the kinetics of transferrin recycling, favoring

accumulation of the protein in the ERC. This result is consistent

with previous observations demonstrating the localization of

transferrin in the VAC of WT HCMV-infected cells (Krzyzaniak

et al., 2009).

DISCUSSION

In summary, our studies indicate that multiple members of

the endocytic pathway, including VAMP3, RAB5C, RAB11A,

SNAP23, and CDC42, are targeted by the HCMV miRs

UL112-1, US5-1, and US5-2. Mutation of these miRNAs resulted

in significant consequences for virus infectivity, including

increased release of proinflammatory cytokines, and major

impacts on viral phenotypes including malformation of the

VAC, reduction of supernatant virus, and increased production

of defective particles. We show that the targeting of the endo-

cytic pathway genes by multiple HCMV-encoded miRNAs

serves at least two purposes for the virus. The first is to interfere

with the trafficking and release of proinflammatory cytokines

providing the virus with a unique immune evasion strategy, while

the second is to restructure components of the secretory

pathway, including the Golgi and endocytic compartment, to

form the VAC, leading to increased production of infectious

particles.

Both IL-6 and TNF-a are proinflammatory cytokines that play

important roles in both innate and acquired immunity. IL-6 is

the predominant inducer of the acute-phase response, while

TNF-a plays a key role in controlling viral infections, exemplified

by experiments using TNF-a inhibitors that result in both

increased viral replication and pathogenicity in vivo (Yerkovich

et al., 1997). The importance of these cytokines in controlling

viral infections is underscored by the fact that multiple viruses,

including HCMV, have evolved strategies to interfere with IL-6

and TNF-a production and release or that mitigate their effects.

These strategies include downregulating cytokine receptors,

interfering with recruitment of adaptor proteins and subsequent

downstream signaling events, and neutralizing newly released

cytokines (Rahman andMcFadden, 2006). Additionally, viral pro-

Cell Ho

teins have been reported to interfere with release of cytokines

from infected cells. For example, the HIV-encoded protein nef

interferes with delivery of TNF-a to the plasma membrane in

HIV-infected macrophages by preventing recruitment of AP1

(Mazzolini et al., 2010). By reducing or preventing cytokine

release from infected cells, HCMV creates an environment

more favorable for virus replication and spread. Unlike previously

identified mechanisms which rely on the expression of exo-

genous proteins that likely elicit an immune response, HCMV

accomplishes this using multiple viral miRNAs that are not

immunogenic.

Over the past two decades a significant amount of effort has

been devoted to characterizing the formation and composition

of the HCMV VAC. The final stages of HCMV particle formation

occur in the VAC, where final tegumentation and acquisition of

envelope proteins occurs followed by egress from the cell using

the secretory machinery. The mature VAC is most readily de-

tected late during the virus replication cycle when HCMVmiRNA

expression peaks. VAC formation also occurs at an interval when

altered distribution of secretory pathway proteins is observed in

infected cells. Analysis of the VAC for components of the secre-

tory pathway indicated the presence of markers for the ER-to-

Golgi intermediate compartment, trans-Golgi network (TGN),

and early and recycling endosomes (Das and Pellett, 2007,

2011; Sanchez et al., 2000a, 2000b). While HCMV proteins are

considered to regulate the formation of the VAC, the obser-

vations in this study indicate that viral miRNAs that downregulate

key components of the secretory pathway also contribute to the

remodeling of the secretory pathway during infection. The reor-

ganization of the secretory pathway that facilitates VAC forma-

tion may be related to the membrane remodeling that occurs

during induction of either cell death or cytokinesis (Grant and

Donaldson, 2009; Landry et al., 2009). In each case, a significant

amount of the plasmamembrane is ingested into the cell through

the endosomal compartment by temporarily blocking endoso-

mal recycling while allowing endocytosis to proceed (Grant

and Donaldson, 2009; Landry et al., 2009; Boucrot and Kirch-

hausen, 2007). This event leads to loss of plasma membrane

area and accumulation of membrane in the endosomal system.

Endosomal recycling depends upon many proteins including

RAB5, RAB7, RAB11, CDC42, and actin (Grant and Donaldson,

2009). Interfering with these proteins can inhibit recycling as well

as alter position of the endosomal recycling compartment within

the cell (Grant and Donaldson, 2009; Tomas et al., 2010; Hehnly

et al., 2010). Our findings that demonstrate an inhibition of

transferrin recycling in WT HCMV but not in mutant HCMV-

infected cells are consistent with these previous studies and

suggest that formation of the VACmay require inhibition of anter-

ograde trafficking in more distal compartments of the secretory

st & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevier Inc. 369

Table 2. Transfection with siRNAs against Endocytic Compartment Genes Restores the PFU:GCN Ratio

Transfection Group

Genome Copy/mL PFU/mL PFU:Genome Copy

Neg

RAB5C, RAB11A,

SNAP23, CDC42 Neg

RAB5C, RAB11A,

SNAP23, CDC42 Neg

RAB5C, RAB11A,

SNAP23, CDC42

72 hpi WT 1,707,942 1,099,182 165,000 350,000 1:10 1:3

Mut 161,927 222,080 250 1,800 1:648 1:123

96 hpi WT 755,499 518,324 650,000 550,000 1:1 1:1

Mut 816,361 1,337,559 1,550 11,100 1:527 1:121

NHDFs were transfected with siRNAs targeting RAB5C, RAB11A, SNAP23, and CDC42 or negative control and were then infected with either the

AD169 wild-type (WT) or the AD169 miR-US5-1, -US5-2, -UL112-1 triple mutant virus (Mut) (moi = 3, 2 hr). At 72 and 96 hpi, supernatant virus was

harvested and the PFU/genome copy determined by virus titration on NHDFs and real-time PCR.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

pathways, including the endocytic recycling pathway leading to

the accumulation of viral proteins in proximity of the ERC. Finally,

it is noteworthy that both decreased secretion of TNF-a and IL-6

and inhibition of transferrin recycling represent functional pheno-

types of cells infected with viruses expressing these viral

miRNAs, an observation that further supports the role of these

miRNAs in remodeling the secretory pathway to optimize virus

assembly and replication.

The ultimate effect of HCMVmiRNA-mediated reduction of the

RAB proteins, SNAP23, and CDC42 is the condensation and

reorganization of the Golgi, TGN, and endosomes into the VAC

adjacent to the nucleus. Transfection of a pool of either the

HCMV miRNAs or siRNAs targeting the endocytic proteins was

sufficient to disrupt the morphology of the Golgi and to generate

structures that resemble the VAC. These results, in combination

with the observation that infection of cells with the HCMVmiRNA

mutant results in lack of VAC formation and normal formation of

Golgi stacks in the cell, indicate that the viral miRNAs are respon-

sible for VAC formation. Lastly, the observation that mutation of

the miRNAs in the virus resulted in up to a 3-log increase in

noninfectious particles is consistent with the role of the VAC in

the concentration of viral proteins into a single structure within

the secretory machinery, which in turn can lead to more efficient

infectious particle formation (Sanchez et al., 2000a, 2000b). An

important question raised by these results is how particles that

mature in the VAC egress from the cell with the loss of the secre-

tory pathway machinery. Do recycling endosomal vesicles with

infectious virion cargo traffic between the VAC and the plasma

membrane for particle release? And if so, how does this occur

with the loss of docking molecules? The ability to genetically

regulate formation of the VAC will provide us with a tool to

dissect these and other mechanisms involved in viral assembly

and egress from the cell.

Rescuing the HCMV triple mutant with the viral miRNAs is

complicated by the fact that each individual miRNA has the

potential to target greater than 100 genes. Therefore using the

viral miRNAs mutated in the virus to rescue the HCMV mutant

would not conclusively demonstrate that the downregulation of

the secretory genes by the miRNAs is solely responsible for

the phenotype. In addition, since miR-UL112-1 also targets the

viral transcriptional activator IE72 and UL112/113, which are

involved in viral DNA replication, as well as UL120/121 that has

an unknown function (Grey et al., 2007), using this miRNA to

rescue the mutant viral phenotype would be complicated by

370 Cell Host & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevie

the miRNA off-target effects. An additional complicating factor

is that miRs US5-1 and US5-2 target US7, which is an HCMV

gene with unknown function. Therefore, to rule out off-target

effects of the HCMV miRNAs, we utilized siRNAs targeting

RAB5C, RAB11A, SNAP23, and CDC42 to rescue the HCMV

miRNA triple mutant. Using this approach we were able to re-

constitute WT HCMV VAC formation as well as reduce pro-

duction of noninfectious particles. Similarly, siRNAs directed

against the secretory genes also rescued the ability of the

HCMV triple miRNA mutant to reduce the release of proinflam-

matory cytokines. Importantly, we observed that transfection

of the viral miRNAs or siRNAs to the secretory gene targets is

sufficient to form the VAC or decrease secretion of proinflamma-

tory cytokines in the absence of virus infection, indicating that

the phenotype is solely dependent on the viral miRNAs targeting

the secretory pathway genes.

These results indicate that multiple viral miRNAs coordinately

target multiple genes in a single cellular pathway that are an

essential part of the viral replication process and provide a

mechanistic explanation for formation of the VAC. These results

also indicate that viral miRNAs are a critical part of the virus lytic

life cycle and that the full extent of viral mutant phenotypes can

only be observed following mutation of multiple miRNA in the

virus that coordinately regulate pathways. The future identifica-

tion of cellular pathways targeted by HCMV miRNAs will allow

the targeted mutation of these regulatory RNAs to explore the

importance of these pathways in viral replication and latency.

EXPERIMENTAL PROCEDURES

Cells and Viruses

HEK293T cells (293T), normal human dermal fibroblasts (NHDFs), and HeLa

cells were grown in Dulbecco’s modified Eagle’s medium supplemented

with 10% heat-inactivated fetal bovine serum (FBS), 1.0 unit/mL penicillin,

1.0 ug/mL streptomycin, and 292 ng/mL L-glutamine (PSG) (Life Technolo-

gies). HEK293T cells that stably express a c-myc-tagged Argonaute 2 protein

(A2) were grown in the medium above supplemented with 300 ug/mL genta-

micin (Invitrogen) (Karginov et al., 2007). A human monocyte-derived cell line

(THP-1) was grown in RPMI-1640 supplemented with 10% heat-inactivated

FBS and PSG. Monocytic differentiation was induced by adding 10 ng/mL

12-O-tetradecanoylphorbol-13-acetate (TPA) to the medium. Stocks of

HCMV were grown and titered in NHDFs using standard techniques. For viral

growth curves, NHDFs were infected in duplicate at an moi of 3 for single step

or moi 0.05 for multistep for 2 hr. Cells were then washed extensively, and both

cell-associated and supernatant viruseswere harvested atmultiple time points

postinfection. Titers were determined by plaque assay on NHDFs. In some

r Inc.

WT Mut WT Mut

Tran

sfer

rin-A

488

Tran

sfer

rin-A

488

EEA

1

EEA

1

Mer

ge/p

p65

Mer

ge/p

p65

Chase T=0 Chase T=60 Figure 5. HCMV miRNAs Inhibit Transferrin

Recycling

NHDFs were infected with the AD169 wild-type

(WT) or the AD169 miR-US5-1, -US5-2, -UL112-1

mutant virus (Mut) (moi = 0.8). At 72 hpi NHDFs

were labeled with transferrin conjugated with

Alexa Fluor 488 for 30 min. Following a 0 and

60 min chase in unlabeled media containing 10%

FBS, the cells were imaged for transferrin (green),

the early endosome marker EEA1 (blue), HCMV

pp65 (red), and DAPI. While bar, 10 mM; asterisk

indicates infected cells. White arrow indicates WT

infected cell with mature VAC.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

cases, average plaque size was determined 72 hpi on NHDFs and normalized

to WT. PFU/GCN was determined by isolating supernatant virus at 72 and

96 hpi, followed by virus titration on NHDFs and real-time PCR to detect

GCN. In some cases, NHDFs were transfected with pools of miRNAs,

siRNAs, or negative controls 48 hr prior to infection using Lipofectamine

2000 (Invitrogen) according to the manufacturer’s instructions with the modi-

fication that cells were plated and maintained in DMEM supplemented with

1%FBS for the length of the experiment. For experiments evaluating knock-

down of VAMP3 in 293T cells, a vector containing the VAMP3 full-length

cDNA clone was transfected into cells using Lipofectamine 2000 along with

the small RNAs (OriGene Technologies).

RIP-CHIP

RIP-CHIP was performed as previously described (Grey et al., 2010). Briefly,

A2 cells were transfected with a pSIREN expression plasmid encoding the

HCMV miR-UL112-1 pre-miR hairpin or a negative control using Fugene

according to the manufacturer’s instructions (Roche). At 72 hpt, cell lysates

were harvested, and mRNA associated with the RISC complex was isolated

with anti-c-myc agarose beads (Sigma). RNA was isolated from both total

and immunoprecipitated cellular lysates using Trizol (Invitrogen) and analyzed

for quality using an Agilent Bioanalyzer. mRNA transcript levels were deter-

mined using the Illumina HumanRef-8 platform and analyzed using Gene Sifter

software. To identify cellular mRNA transcripts specifically enriched within

RISC complex containing miR-UL112-1, the enrichment profile in miR-

UL112-1 transfected cells was compared to cells transfected with the negative

control vector such that the enrichment value of any given mRNA transcript =

(IP112/Total112)/(IPNeg/TotNeg) (Grey et al., 2010). mRNA transcripts were then

ranked according to level of enrichment, with the highest enriched transcripts

considered potential targets of miR-UL112-1. Two independent experiments

were performed to increase confidence in the identified targets. Predicted

binding sites between miRNAs and potential targets were determined by look-

ing for seed sequence matches or by using the online software RNAhybrid

(Grey et al., 2010; Tirabassi et al., 2011). For analysis of HCMV miRNA targets

during infection, NHDFswere infectedwith HCMV strain TR (moi = 3). At 72 hpi,

cells were lysed, samples were taken for total RNA, and miRNA in complex

with endogenous Ago2 was immunoprecipitated using an anti-Ago2 antibody

followed by streptavidin bead pull-down. RNA was isolated using Trizol and

analyzed for quality using an Agilent Bioanalyzer and transcript levels deter-

mined on the Illumina HumanRef-8 platform. Microarray data were analyzed

using Gene Sifter software. Enrichment of specific transcripts, through asso-

ciation with miRNP complexes, was determined by dividing the immunopre-

Cell Host & Microbe 15, 363–37

cipitated levels of transcripts by the total levels.

Transcripts were then ranked according to the

level of enrichment, with the highest enriched

transcripts considered potential targets of HCMV

miRNAs.

Reagents

Double-stranded miRNA mimics for the HCMV-

encoded miRNAs were designed using the pub-

lished miRNA sequences (http://www.mirbase.

org) as described previously (Grey et al., 2010; Tirabassi et al., 2011).

VAMP3, RAB5C, RAB11A, SNAP23, CDC42, and negative control siRNAs

were purchased from Ambion (http://www.ambion.com).

Cloning and Site-Directed Mutagenesis

The 30 UTRs of VAMP3, RAB5C, RAB11A, SNAP23, and CDC42 were PCR

amplified from 293T cDNA and cloned downstream of the renilla luciferase

gene in a psiCHECK-2 dual reporter construct (Promega). A PCR-based

site-directed mutagenesis protocol was used to introduce mutations into

potential miRNA binding sites.

Luciferase Assay

293T cells were cotransfected with the 30 UTR dual-luciferase reporter con-

structs and miRNA mimics using Lipofectamine 2000 (Invitrogen) according

to themanufacturer’s instructions. Cells were harvested 16 hr posttransfection

and renilla, and luciferase levels weremeasured using Promega’s dual reporter

assay.

Northern Blot Analysis for miRNAs

NHDFs were infected at moi 3, and total RNA was harvested and subjected

to northern blot analysis using probes specific for predicted viral miRNA

sequences.

RT-PCR Analysis

Total RNA was harvested using Trizol and reverse transcribed using either

random hexamers or specific RT primers for miRNA RT-PCR. Gene specific

primer-probe sets (Taqman, ABI) were then used for real-time amplification.

Western Blot Analysis

Extracts were run on an 8%–12% SDS-PAGE, transferred to Immobilon-P

Transfer Membranes (Milipore Corp.), and visualized with antibodies specific

for VAMP3 (SySy), RAB5C (Sigma), RAB11A (Cell Signaling), SNAP23

(SySy), CDC42 (Sigma), Flag (Sigma), and GAPDH (Abcam).

ELISA

THP-1 cells were seeded at a density of 2.5 3 105 cells/well in 24-well plates

and treated with TPA to induce monocytic differentiation. Twenty-four hours

later, cells were transfected with HCMV miRNAs; siRNAs directed against

VAMP3, RAB5C, RAB11A, and SNAP23; or negative control siRNA using

Lipofectamine 2000. At 72 hpt, cells were treated with LPS to induce TNF-a

and IL-6 secretion. Supernatants were collected 8 hr posttreatment,

3, March 12, 2014 ª2014 Elsevier Inc. 371

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

centrifuged to remove cell debris, and analyzed for TNF-a and IL-6 by ELISA

according the manufacturer’s instructions (BD OptEIA). In experiments

comparing IL-6 release from WT and AD169 miR-US5-1, -US5-2, -UL112-1

triple mutant virus infected cells, NHDFs were infected at moi 3 as described

above, and IL-6 release was determined by ELISA.

Immunofluorescence

Localization of viral and cellular proteins was determined by indirect immuno-

fluorescence. NHDFs grown on 13 mm glass coverslips were infected with the

AD169 WT or AD169 miR-US5-1, -US5-2, -UL112-1 triple mutant virus at moi

0.1. At 6 dpi, coverslips were washed with DPBS and fixed in DPBS containing

4% paraformaldehyde. Cells were permeabilized with 0.1% Triton X-100, and

blocked with 10%–50% normal goat serum (Invitrogen). The coverslips were

then incubated with primary antibody including anti-calreticulin, anti-

golgin245, anti-gm130, anti-TGN46, anti-HCMV IE-1 (mab p63-27), anti-gM

(mab IMP), and anti-gM/gN (mab 14-16A). Cells were then washed and incu-

bated with the appropriate fluorophore-conjugated secondary antibody

(Southern Biotech). In some experiments, HeLa cells were electroporated

with siRNAs using the basic nucleofector kit (Amaxa Bioscience) prior to

immunostaining. In experiments evaluating transferrin internalization and recy-

cling, NHDFs were infected with the WT or Mut virus (moi = 0.8, 72 hr), starved

2 hr in serum-free media, and then labeled with transferrin conjugated with

Alexa Fluor 488 for 30 min at 37�C. The coverslips were then washed three

times with cold PBS; placed in complete media for 0, 10, 20, 30, 45, and

60 min chase periods at 37�C; and imaged for transferrin, EEA1, DAPI, and

HCMV pp65 (mab 28-19). Fluorescence was visualized using an Olympus

Fluoview 1000 confocal microscope utilizing identical laser and gain settings

for comparative studies.

Statistical Analysis

The Student’s t test (Microsoft Excel software) was used to determine p values.

Results were considered significant at a probability (p) < 0.05.

SUPPLEMENTAL INFORMATION

Supplemental Information includes five figures and two tables and can be

found with this article at http://dx.doi.org/10.1016/j.chom.2014.02.004.

ACKNOWLEDGMENTS

We wish to thank Drs. Richard Goodman, Louis Picker, Klaus Frueh, and

Patrizia Caposio for their helpful comments on this paper, and Andrew Town-

send for help with graphics. We thank Renee Espinoza-Najera, Chantel Pelton,

and Helen Hewitt for technical assistance. This research was supported by

grants AI21640 (J.A.N.), AI50189 (W.B.), and AI035602 (W.B.) from the National

Institutes of Health.

Received: August 9, 2013

Revised: November 26, 2013

Accepted: February 12, 2014

Published: March 12, 2014

REFERENCES

Abend, J.R., Uldrick, T., and Ziegelbauer, J.M. (2010). Regulation of tumor

necrosis factor-like weak inducer of apoptosis receptor protein (TWEAKR)

expression by Kaposi’s sarcoma-associated herpesvirus microRNA prevents

TWEAK-induced apoptosis and inflammatory cytokine expression. J. Virol. 84,

12139–12151.

Alwine, J.C. (2012). The human cytomegalovirus assembly compartment: a

masterpiece of viral manipulation of cellular processes that facilitates assem-

bly and egress. PLoS Pathog. 8, e1002878.

Baillie, J., Sahlender, D.A., and Sinclair, J.H. (2003). Human cytomegalovirus

infection inhibits tumor necrosis factor alpha (TNF-alpha) signaling by targeting

the 55-kilodalton TNF-alpha receptor. J. Virol. 77, 7007–7016.

372 Cell Host & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevie

Bernstein, A.M., and Whiteheart, S.W. (1999). Identification of a cellubrevin/

vesicle associated membrane protein 3 homologue in human platelets.

Blood 93, 571–579.

Boucrot, E., and Kirchhausen, T. (2007). Endosomal recycling controls plasma

membrane area during mitosis. Proc. Natl. Acad. Sci. USA 104, 7939–7944.

Buchkovich, N.J., Maguire, T.G., Paton, A.W., Paton, J.C., and Alwine, J.C.

(2009). The endoplasmic reticulum chaperone BiP/GRP78 is important in the

structure and function of the human cytomegalovirus assembly compartment.

J. Virol. 83, 11421–11428.

Cepeda, V., Esteban, M., and Fraile-Ramos, A. (2010). Human cytomegalo-

virus final envelopment on membranes containing both trans-Golgi network

and endosomal markers. Cell. Microbiol. 12, 386–404.

Chen, J.F., Mandel, E.M., Thomson, J.M., Wu, Q., Callis, T.E., Hammond,

S.M., Conlon, F.L., and Wang, D.Z. (2006). The role of microRNA-1 and

microRNA-133 in skeletal muscle proliferation and differentiation. Nat.

Genet. 38, 228–233.

Das, S., and Pellett, P.E. (2007). Members of the HCMV US12 family of

predicted heptaspanning membrane proteins have unique intracellular distri-

butions, including association with the cytoplasmic virion assembly complex.

Virology 361, 263–273.

Das, S., and Pellett, P.E. (2011). Spatial relationships between markers for

secretory and endosomal machinery in human cytomegalovirus-infected cells

versus those in uninfected cells. J. Virol. 85, 5864–5879.

Das, S., Vasanji, A., and Pellett, P.E. (2007). Three-dimensional structure of the

human cytomegalovirus cytoplasmic virion assembly complex includes a reor-

iented secretory apparatus. J. Virol. 81, 11861–11869.

Gealy, C., Denson, M., Humphreys, C., McSharry, B., Wilkinson, G., and

Caswell, R. (2005). Posttranscriptional suppression of interleukin-6 production

by human cytomegalovirus. J. Virol. 79, 472–485.

Gottwein, E., Corcoran, D.L., Mukherjee, N., Skalsky, R.L., Hafner, M.,

Nusbaum, J.D., Shamulailatpam, P., Love, C.L., Dave, S.S., Tuschl, T., et al.

(2011). Viral microRNA targetome of KSHV-infected primary effusion

lymphoma cell lines. Cell Host Microbe 10, 515–526.

Grant, B.D., and Donaldson, J.G. (2009). Pathways and mechanisms of endo-

cytic recycling. Nat. Rev. Mol. Cell Biol. 10, 597–608.

Grey, F., Antoniewicz, A., Allen, E., Saugstad, J., McShea, A., Carrington, J.C.,

and Nelson, J. (2005). Identification and characterization of human cytomega-

lovirus-encoded microRNAs. J. Virol. 79, 12095–12099.

Grey, F., Meyers, H., White, E.A., Spector, D.H., and Nelson, J. (2007). A

human cytomegalovirus-encoded microRNA regulates expression of multiple

viral genes involved in replication. PLoS Pathog. 3, e163.

Grey, F., Tirabassi, R., Meyers, H., Wu, G., McWeeney, S., Hook, L., and

Nelson, J.A. (2010). A viral microRNA down-regulates multiple cell cycle genes

through mRNA 5’UTRs. PLoS Pathog. 6, e1000967.

Hehnly, H., Xu, W., Chen, J.L., and Stamnes, M. (2010). Cdc42 regulates

microtubule-dependent Golgi positioning. Traffic 11, 1067–1078.

Jarvis, M.A., Borton, J.A., Keech, A.M., Wong, J., Britt, W.J., Magun, B.E., and

Nelson, J.A. (2006). Human cytomegalovirus attenuates interleukin-1beta and

tumor necrosis factor alpha proinflammatory signaling by inhibition of

NF-kappaB activation. J. Virol. 80, 5588–5598.

Karginov, F.V., Conaco, C., Xuan, Z., Schmidt, B.H., Parker, J.S., Mandel, G.,

and Hannon, G.J. (2007). A biochemical approach to identifying microRNA

targets. Proc. Natl. Acad. Sci. USA 104, 19291–19296.

Kim, Y., Lee, S., Kim, S., Kim, D., Ahn, J.H., and Ahn, K. (2012). Human cyto-

megalovirus clinical strain-specific microRNA miR-UL148D targets the human

chemokine RANTES during infection. PLoS Pathog. 8, e1002577.

Kowalik, T.F., Wing, B., Haskill, J.S., Azizkhan, J.C., Baldwin, A.S., Jr., and

Huang, E.S. (1993). Multiple mechanisms are implicated in the regulation of

NF-kappa B activity during human cytomegalovirus infection. Proc. Natl.

Acad. Sci. USA 90, 1107–1111.

Krzyzaniak, M.A., Mach, M., and Britt, W.J. (2009). HCMV-encoded glycopro-

tein M (UL100) interacts with Rab11 effector protein FIP4. Traffic 10, 1439–

1457.

r Inc.

Cell Host & Microbe

HCMV miRNAs Restructure the Secretory Compartment

Landry, M.C., Sicotte, A., Champagne, C., and Lavoie, J.N. (2009). Regulation

of cell death by recycling endosomes and golgi membrane dynamics via a

pathway involving Src-family kinases, Cdc42 and Rab11a. Mol. Biol. Cell 20,

4091–4106.

Lei, X., Bai, Z., Ye, F., Xie, J., Kim, C.G., Huang, Y., and Gao, S.J. (2010).

Regulation of NF-kappaB inhibitor IkappaBalpha and viral replication by a

KSHV microRNA. Nat. Cell Biol. 12, 193–199.

Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades,

M.W., Burge, C.B., and Bartel, D.P. (2003). The microRNAs of

Caenorhabditis elegans. Genes Dev. 17, 991–1008.

Mazzolini, J., Herit, F., Bouchet, J., Benmerah, A., Benichou, S., and

Niedergang, F. (2010). Inhibition of phagocytosis in HIV-1-infected macro-

phages relies on Nef-dependent alteration of focal delivery of recycling

compartments. Blood 115, 4226–4236.

Murray, R.Z., Kay, J.G., Sangermani, D.G., and Stow, J.L. (2005). A role for the

phagosome in cytokine secretion. Science 310, 1492–1495.

Pfeffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John, B.,

Enright, A.J., Marks, D., Sander, C., and Tuschl, T. (2004). Identification of

virus-encoded microRNAs. Science 304, 734–736.

Rahman, M.M., andMcFadden, G. (2006). Modulation of tumor necrosis factor

by microbial pathogens. PLoS Pathog. 2, e4.

Samols, M.A., Skalsky, R.L., Maldonado, A.M., Riva, A., Lopez, M.C., Baker,

H.V., and Renne, R. (2007). Identification of cellular genes targeted by

KSHV-encoded microRNAs. PLoS Pathog. 3, e65.

Sanchez, V., Greis, K.D., Sztul, E., and Britt, W.J. (2000a). Accumulation of

virion tegument and envelope proteins in a stable cytoplasmic compartment

during human cytomegalovirus replication: characterization of a potential

site of virus assembly. J. Virol. 74, 975–986.

Sanchez, V., Sztul, E., and Britt, W.J. (2000b). Human cytomegalovirus pp28

(UL99) localizes to a cytoplasmic compartment which overlaps the endo-

plasmic reticulum-golgi-intermediate compartment. J. Virol. 74, 3842–3851.

Skalsky, R.L., Corcoran, D.L., Gottwein, E., Frank, C.L., Kang, D., Hafner, M.,

Nusbaum, J.D., Feederle, R., Delecluse, H.J., Luftig, M.A., et al. (2012). The

viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS

Pathog. 8, e1002484.

Cell Ho

Stark, T.J., Arnold, J.D., Spector, D.H., and Yeo, G.W. (2012). High-resolution

profiling and analysis of viral and host small RNAs during human cytomegalo-

virus infection. J. Virol. 86, 226–235.

Stern-Ginossar, N., Elefant, N., Zimmermann, A., Wolf, D.G., Saleh, N., Biton,

M., Horwitz, E., Prokocimer, Z., Prichard, M., Hahn, G., et al. (2007). Host

immune system gene targeting by a viral miRNA. Science 317, 376–381.

Stow, J.L., Manderson, A.P., andMurray, R.Z. (2006). SNAREing immunity: the

role of SNAREs in the immune system. Nat. Rev. Immunol. 6, 919–929.

Tirabassi, R., Hook, L., Landais, I., Grey, F., Meyers, H., Hewitt, H., andNelson,

J. (2011). Human cytomegalovirus US7 is regulated synergistically by two

virally encoded microRNAs and by two distinct mechanisms. J. Virol. 85,

11938–11944.

Tomas, M.I., Kuci�c, N., Mahmutefendi�c, H., Blagojevi�c, G., and Lucin, P.

(2010). Murine cytomegalovirus perturbs endosomal trafficking of major histo-

compatibility complex class I molecules in the early phase of infection. J. Virol.

84, 11101–11112.

Umbach, J.L., Kramer, M.F., Jurak, I., Karnowski, H.W., Coen, D.M., and

Cullen, B.R. (2008). MicroRNAs expressed by herpes simplex virus 1 during

latent infection regulate viral mRNAs. Nature 454, 780–783.

Yerkovich, S.T., Olver, S.D., Lenzo, J.C., Peacock, C.D., and Price, P. (1997).

The roles of tumour necrosis factor-alpha, interleukin-1 and interleukin-12 in

murine cytomegalovirus infection. Immunology 91, 45–52.

Yurochko, A.D., Hwang, E.S., Rasmussen, L., Keay, S., Pereira, L., and Huang,

E.S. (1997a). The human cytomegalovirus UL55 (gB) and UL75 (gH) glycopro-

tein ligands initiate the rapid activation of Sp1 and NF-kappaB during infection.

J. Virol. 71, 5051–5059.

Yurochko, A.D., Mayo, M.W., Poma, E.E., Baldwin, A.S., Jr., and Huang, E.S.

(1997b). Induction of the transcription factor Sp1 during human cytomegalo-

virus infection mediates upregulation of the p65 and p105/p50 NF-kappaB

promoters. J. Virol. 71, 4638–4648.

Zerial, M., andMcBride, H. (2001). Rab proteins asmembrane organizers. Nat.

Rev. Mol. Cell Biol. 2, 107–117.

Ziegelbauer, J.M., Sullivan, C.S., and Ganem, D. (2009). Tandem array-based

expression screens identify host mRNA targets of virus-encoded microRNAs.

Nat. Genet. 41, 130–134.

st & Microbe 15, 363–373, March 12, 2014 ª2014 Elsevier Inc. 373