Delineation of Three Different Thyroid Hormone-response Elements ...

Tm JOURNAL OF B I O ~ I C A L CHEMISTRY 0 1994 hy The American Society for Biochemistry and Molecular Biology, Inc.

VOl. 269, No. 17, Issue of April 29, PP. 13021-13029, 1994 Printed in U.S.A.

Delineation of Three Different Thyroid Hormone-response Elements in Promoter of Rat Sarcoplasmic Reticulum Ca2+ATPase Gene DEMONSTRATION THAT RETINOID X RECEPTOR BINDS 5’ TO THYROID HORMONE RECEPTOR IN RESPONSE ELEMENT 1*

(Received for publication, June 21, and in revised form, December 21, 1993)

Ron HartongSB, Naishu WangS, Riki KurokawaS, Mitchell k Lazarll, Christopher K. GlassSII, James W. Apriletti**, and Wolfgang H. DillmannS From the $Llivision of Endocrinology and Metabolism, Department of Medicine, University of California, Sun Diego, California 92103, the %Endocrine Division, Department of Medicine, and Department of Genetics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, and the **Metabolic Research Unit, University of California, Sun Francisco, California 94143

Thyroid hormone (3,6,3’-triiodothyronine) positively regulates transcription of the sarcoplasmic reticulum Ca2+ATPase gene in rat heart, and sequences within 659 nucleotides upstream from the transcription start site confer thyroid hormone responsiveness upon a reporter gene. In the present study, three thyroid hormone-response elements (TREs) are identified between nucleotides -486 and -190. Each TRE is active in transient transfection assays and specifically binds 3,5,3‘-triiodothyronine receptors (TRs) a 1 and P l alone and in combination with retinoid X receptors (RXRs) a and p. TRE 1 is a direct repeat of two half-sites separated by four nucleotides; TREs 2 and 3 are inverted palindromes of two half-sites separated by four and six nucleotides, respectively. Methylation interference analysis of TRE 1 showed binding of a TRal monomer to the 3’ half-site, whereas the heterodimer contacts both half-sites. Sub- sequent studies employed TRP and RXRa mutants in which their P-boxes were replaced with the P-box of the glucocorticoid receptor. Bandshifts of wild type and mutant proteins with either wild type TRE 1 or a mutant version, in which the 5’ half-site was converted to a glucocorticoid response element half-site, demonstrated preferential binding of RXR to the 5’ half-site and of TR to the 3’ half-site of TRE 1.

Contraction and relaxation of the heart is regulated by the concentration of Ca2+ around the contractile elements (myofi- brils) in the cardiac myocytes (for recent reviews, see Refs. 1 and 2). After contraction, relaxation is brought about by low- ering cytoplasmic Ca2+ levels; a significant contribution to this process is made by an ATP-dependent Ca2+ pump, which pumps cytoplasmic Ca2+ into the lumen of the sarcoplasmic reticulum. At present, five distinct isoforms of the sarcoplasmic/ endoplasmic reticulum Ca2+ATPase (SERCA)’ are known, en-

* This work was supported in part by National Institutes of Health Grants HL 25022 and DK 43806, NCI Grant R 0 1 CA52599, and the Lucille P. Markey Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must

U.S.C. Section 1734 solely to indicate this fact. therefore be hereby marked “advertisement” in accordance with 18

8 To whom correspondence should be addressed: UCSD Medical Cen- ter, 200 W. Arbor Dr. (8412), San Diego, CA 92103. Tel.: 619-543-5912; Fax: 619-543-3306.

11 A Lucille P. Markey Fellow. The abbreviations used are: SERCA, sarcoplasmidendoplasmic re-

ticulum Ca2+ATPase; nt, nucleotide(s); CAT, chloramphenicol acetyltransferase; T,, 3,5,3’-triiodothyronine; TR, thyroid hormone receptor; RXR, retinoid X receptor; TRE, thyroid hormone-response element;

coded by three different genes; in the heart, the SERCA 2a isoform is predominantly expressed (3-7). The effects of thyroid hormone (T,) on cardiac contraction and relaxation have been known for a long time, and we (7) and others (6,W have shown that T, exerts at least part of its effect on cardiac relaxation by increasing the expression of the SERCA 2 gene at a pretrans- lational level. More recently, we demonstrated that the effect of T, is transcriptional and that sequences located within 559 nucleotides (nt) upstream from the start site of transcription of the SERCA 2 gene are able to confer T, responsiveness upon a reporter gene in transient transfection assays (9).

Transcriptional effects of T, are mediated by nuclear T, receptors (TRs), which are members of a superfamily of ligand- activated transcription factors including glucocorticoid receptors, vitamin D, receptors, and receptors for all-trans-retinoic acid and 9-cis-retinoic acid (RXR) (10-14). TRs are encoded by two separate genes termed a and p (11,15,16), and differential splicing of both gene transcripts gives rise to a l , a2, pl, and p2 isoforms (17-20). al, pl, and p2 are functional receptors, whereas a2 is an isoform that does not bind hormone and has a dominant negative effect on the function of the other receptor isoforms (21, 22). In the rat heart, TRP2 mRNA is not detectable (201, and approximately equal levels of TRal and TRpl have been observed using specific antibodies (23); TRa2 has also been detected by use of specific antibodies, but its relative level of expression is unknown (24).

A prerequisite for T, and steroid hormones to modulate the rate of gene transcription is that their receptors bind to specific cis-acting sequences of responsive genes (10, 11). Detailed mutational analyses of the rat growth hormone gene promoter have shown that an optimal binding site for TRs is formed by the hexanucleotide AGGTCA (25, 26). Thyroid hormone-response elements (TREs) within the rat growth hormone gene promoter and in the promoters of other genes positively regulated by T, are composed of at least two such half-sites, sug- gesting that TRs bind as homo- or heterodimers to their response elements (17, 25-30). However, TREs are remarkably divergent with respect to half-site composition, spacing, and orientation (17, 25-30). These observations, in conjunction with observations that nuclear extracts from a variety of sources are able to enhance the binding of TRs to their response elements (31-35), have led to the suggestion that TRs may bind to TREs as heterodimers. Recently, the RXRs were identified as heterodimerization partners not only for TRs but also for vita-

GEMSA, gel electrophoretic mobility shiR assay; h, human; r, rat; TR- P-GR, TR with glucocorticoid receptor P-box; RXR-P-GR, RXR with glucocorticoid receptor P-box.

13021

13022 TREs in Sarcoplasmic Reticulum Ca2+ATPase Promoter

min D, and all-trans-retinoic acid receptors (3640). Transfec- tion studies have shown that RXRS potentiate the transcriptional effects of TRs on several, but not all, TRE-containing promoters, and RXRs greatly stabilize the binding of TRs to response elements in vitro (36, 38, 40-42). RXRs have been shown to bind to similar half-sites as TRs (43), and this is related to the fact that all RXR and TR isoforms share identical P-boxes. The P-box, a short stretch of amino acids located between cysteines 3 and 4 in the first zinc finger of the DNA binding domain, has been shown to be critical for recognizing half-site nucleotide sequences (44).

The present study was undertaken to gain further insight into both the mechanism of T, action and the regulation of SERCA 2 gene expression. We decided to delineate functional TREs within the SERCA 2 promoter and to analyze heterodimerization of TRs and RXRs on these elements. Our data indicate the presence of three separate TREs in the SERCA 2 promoter that differ from each other in spacing, orientation, and nucleotide sequence of the half-sites. Moreover, these TREs behave differently with respect to homo- and heteromeric complex formation. In addition, we show that in TRE 1, which is a direct repeat of two half-sites separated by four nucleotides (DR+4 motin, RXR binds 5’ to the TR. Taken together, our data show that TR.RXR heterodimers bind with a distinct polarity to a natural TRE with a DR+4 motif and further point to complex and diverse mechanisms by which T, regulates the transcription of the SERCA 2 gene in the heart.

MATERIALS AND METHODS Cell Culture and Bansfiction-Primary cultures of rat ventricular

neonatal myocytes were prepared as previously described (9). In short, ventricles from 1-2-day-old neonatal rats were minced, digested with collagenase and pancreatin, and subjected to discontinuous Percoll (Pharmacia LKB Biotechnology Inc.) gradient centrifugation. The myocyte-enriched fraction was washed twice, resuspended in a 4:l mixture of Dulbecco’s modified Eagle’s medium:mediurn M199 supplemented with antibiotics (penicillin, streptomycin, and Fungizone; Life Technolo- gies, Inc.) plus 10% (v/v) horse serum and 5% (v/v) fetal calf serum stripped of thyroid hormones by treatment with the resin Bio-Rad AG 1-X8 (45), and plated at a density of 2 x lo6 cells/lO-cm tissue culture dish precoated with 1% (w/v) gelatin. Cells were allowed to adhere to the dishes for 24 h, after which the media were changed to a 4:1 mixture of Dulbecco’s modified Eagle’s medium:medium M199 supplemented with antibiotics as above plus 3.4% (v/v) horse serum and 1.7% (v/v) fetal calf serum stripped of thyroid hormones.

After 4 0 4 8 h, media were replaced with fresh media, and myocytes were transfected for 20-24 h with 20 pg of DNA using a calcium phosphate coprecipitation protocol (46). Quadruplicate dishes were transfected with 5 pg of p-galactosidase expression vector driven by the cytomegalovirus enhancer/promoter (47),7.5 pg of human p T, receptor expression vector (48), and 7.5 pg of chloramphenicol acetyltransferase (CAT) reporter plasmid (see below). Duplicate control plates were transfected with 20 pg of the plasmid pBS (Stratagene). M e r transfection, cells were washed twice with serum-free media and refed with fresh media containing antibiotics and stripped serum. Two plates of each set of four received T, to a final concentration of 10” M, and the other two plates were treated with vehicle (NaOH at a final concentration of lo-‘ M). 24 h after hormone treatment cells were harvested and analyzed for p-galactosidase and CAT activity as described below. Two preparations of each reporter plasmid were tested in a total of at least three independent experiments.

Preparation of Cellular Extracts and Enzyme Assays-After treatment, transfected myocytes were washed twice with phosphate-buff- ered saline (49) and harvested in 200 pl of 0.25 M Tris, pH 7.6, using a Teflon policeman. Cells were lysed by three cycles of freezing in dry ice/methanol and thawing in a 37 “C water bath, and cell debris was pelleted by a 10-min spin at maximum speed in an Eppendorf micro- centrifuge at 4 “C; supernatants were collected and used for determination of enzyme activities. P-Galactosidase activity was measured in 30 pl of the supernatants as described (50), and CAT assays were performed according to Casadaban et al. (51) using varying amounts of extract (maximum, 100 pl) containing identical amounts of P-galactosidase activity. After autoradiography, spots containing nonacetylated

and acetylated chloramphenicol were excised from the thin layers, and radioactivity was determined by liquid scintillation counting.

Reporter PlasmidsSets of overlapping restriction fragments encompassing nt -559 to -163 relative to the start site of transcription of the SERCA 2 gene were isolated from appropriate restriction digests of clone GCCAT,, (9) using standard techniques (49). HindIII sites were created at the 5‘ ends and BamHI sites at the 3‘ ends by ligation of linkers to the blunt-ended fragments (49). Reporter plasmids were constructed by subcloning these fragments into HindIIIIBamHI-digested pBLCAT2; this plasmid contains a multiple cloning site in front of a minimal (105 nt) viral thymidine kinase promoter driving the CAT gene (52). The identity of the subclones was confirmed by restriction mapping and occasionally by sequence analysis using a Sequenase kit (U. S. Biochemical Corp.). Oligonucleotides were synthesized by the Univer- sity of California, San Diego core facility; double-stranded oligonucleotides with HindIII and BamHI overhangs at the 5’ and 3’ ends, respectively, were cloned into HindIIIIBamHI-digested pBLCAT2. Their sequence was confirmed by sequence analysis as above.

Expression of Wild Qpe and Mutant Receptors-Human TRpl (hTRP1) was expressed in Escherichia coli BL 21 and further processed to approximately 7% purity as described (53). 1 1.1 was used per binding assay. Rat TRal (rTRal) was expressed in E. coli BL 21 as described (541, and total bacterial extract containing 5 pg of protein was used per binding assay unless indicated otherwise; extracts (5 pg of protein) from bacteria not transformed with TRa1 expression vectors served as a control. Bacterially expressed rat RXRp was a kind gift of V. Yu and G. Rosenfeld and has been described (36). 1 p1 of extract was used per binding reaction. In some experiments, an RXRWglutathione S-transferase fusion protein was used in which the 15 N-terminal amino acids of RXRP were replaced by the glutathione S-transferase protein. An expression vector encoding this protein was constructed by cloning a cDNA encoding amino acids 16-451 of RXRP in frame into the vector pGEX-2T (Pharmacia) and was a gift of V. Yu and G. Rosenfeld. The fusion protein was expressed in E. coli BL 21 as described (58, and the fusion protein was recovered from the bacterial lysate by affinity chro- matography using glutathione-agarose beads (Sigma) (55). Bound protein was eluted from the matrix by a 5-min incubation at room temperature with 10 m~ glutathione in 50 IIIM Tris.HC1, pH 8.0. Glycerol was added to 20% (v/v), and protein was stored at -70 “C. 1 pl of extract was used per binding reaction. cDNAs encoding hTRp and hRXRa P-box mutants (encoding proteins containing the glucocorticoid receptor P-box GSCKV rather than the wild type P-box EGCKG) were generated by site-directed mutagenesis as described (56). Mutant receptors were prepared by in vitro transcriptiodtranslation of mutant receptor cDNAs as described (36); wild type hRXRa was prepared in the same way. Equivalent amounts of wild type hRXRa and mutant hTRP and hRXRa (2, 1, and 2.5 pl, respectively, based on [36Slmethionine incor- poration) were used in gel electrophoretic mobility shift assays as described below.

Gel Eleetrophoretic Mobility Shift Assay (GEMSA) and Methylation Interference Analysis-Bacterially expressed receptor proteins in amounts indicated above were incubated with 32P-labeled DNA fragments (-20,000 cpm, 0.1-0.3 ng) in 15 1.1 of a buffer containing 10 m~ HEPES pH 7.9, 75 m~ KC], 1 m~ dithiothreitol, 1 m~ EDTA, 10% (dv) glycerol, and 1.5 pg of poly(d1-dC) (Boehringer Mannheim). DNA fragments were labeled by filling in 5’ overhangs with the Klenow fragment of E. coli DNA polymerase I in the presence of [ u - ~ ~ P I ~ C T P (49). After incubation for 20 min at room temperature, the binding reactions were loaded on a 5% polyacrylamide gel in 0.5 x E s borate-EDTA buffer (49). Gels were run at 100-150 V for 2 4 h at room temperature, dried, and exposed at -70 “C to Kodak XAR-5 films using intensifying screens. GEMSAs with in vitro translated proteins were performed under identical conditions except that approximately 1 ng of DNA was used as a probe. For competition experiments, proteins were incubated with a 100-fold molar excess of competitor DNA for 10 min on ice prior to the addition of 32P-labeled DNA probes, and incubation continued for 20 min at room temperature. Palindromic TRE (25) served as a specific competitor, and two 76- and 78-nt SERCA 2 promoter fragments that were not T, responsive in functional assays served as nonspecific com- petitors. Methylation interference analysis was performed essentially as described (49). T,-responsive region I, extending from nt -501 to -440 relative to the transcription start site (see “Results”), was isolated by appropriate digestion of one of the reporter plasmids, followed by electrophoresis on a 5% polyacrylamide gel and elution of the fragment of interest from a crushed gel slice (49). The 3’ end of the upper strand was labeled with 32P by first cutting the plasmid withAuaI1, followed by filling in the 5’ overhang with Klenow DNA polymerase in the presence of [CY-~~PI~CTP and subsequent cutting with HindIII; The 3’ end of the

TREs in Sarcoplasmic Reticulum Ca2+ATPase Promoter 13023

lower strand was labeled in the same way except that the order of restriction enzyme digestion was reversed. The probes were methylated on approximately one guanosine residue per molecule (49) prior to use in the GEMSA as described above. Nine separate binding reactions were performed with TRa and three with TRa plus RXRP. Protein- bound and free DNA were separated on a polyacrylamide gel as above, identified by overnight exposure of the wet gel to x-ray films, and cut out and eluted from the gel as above. Eluted DNA was cleaved with piperidine and run on a 10% sequencing gel using standard procedures (49).

RESULTS

Functioml Delineation of Three Separate T,-responsive Re- gions in the Proximal Promoter Region of SERCA 2 Gene-In a previous study, we demonstrated the existence of two T,-responsive regions between n t -559 and -262 relative to the transcription start site of the SERCA 2 gene (9); this study involved transient transfection of CAT expression vectors driven by a series of 5' deletion mutants of the SERCA 2 promoter into neonatal rat cardiac myocytes. To define the 5' and 3' borders of these responsive regions more precisely, we first determined whether sequences from the SERCA 2 promoter were able to confer T, responsiveness upon a heterologous promoter in the same system. Fig. lA shows that nucleotides -559 to -163 of the SERCA 2 promoter confer a strong (>2O-fold) T, inducibility upon the viral thymidine kinase promoter in transient transfection assays. Furthermore, three overlapping fragments encompassing this region all show a 3-5-fold induction of CAT expression by T, when placed upstream of the thymidine kinase promoter, confirming the presence of at least two TREs in the -559/-163 fragment. This fragment was next divided into a series of smaller, generally overlapping fragments, and each of these fragments was tested for its ability to confer T, responsiveness upon the thymidine kinase promoter in transient transfection assays. These experiments are summarized in Fig. 1B and indicate the presence of at least three separate regions of T, responsiveness in the SERCA 2 proximal promoter. The putative T,-responsive regions are indicated as black boxes in Fig. lB, and their sequence is shown in Fig. 1C. Visual inspection of these sequences reveals the presence of multiple imperfect but potential TRE half-sites (overlined by arrows in Fig. 1C) in all three regions using the degenerate hexanucleotide (A/G)GG(T/A)(C/G)(A/G) as a consensus TR binding site (57).

Delineation of One Functional TRE in Each of the T,-responsive Regions-The three regions depicted in Fig. 1, B and C, were tested for their ability to bind hTRPl and rTRa1 alone or in combination with hRXRa and/or rRXRP. As shown in Fig. 2 A , each of the three regions forms a single retarded complex A with TRP in a gel mobility shift assay, with region I being the weakest binder and region I11 being the strongest binder. In contrast, two retarded complexes are observed when binding to TRa is examined (Fig. 2B): one complex A with a similar mobility as the complex A formed with TRP and one faster migrat- ing complex B. Region I1 is the strongest overall binder with complex A predominating over complex B, followed by region 111, which shows more complex B than complex A, and by region I, which shows almost exclusively complex A. The binding of hTRp and rTRa to the three regions is specific since 1) no retarded complexes are observed in the absence of receptors; 2) no binding is observed to DNA fragments derived from the SERCA 2 promoter that do not confer T, inducibility upon the thymidine kinase promoter; and 3) binding to each of these regions can be competed with a 100-fold molar excess of an idealized palindromic TRE (25) but not with a 100-fold molar excess of the non-TR-binding DNA fragments mentioned above. Both hRXRa and an rRXRP.glutathione S-transferase fusion protein, in amounts where they by themselves do not detect-

A ~500 -300 -lM +I Ca-ATPase PROMOTER

I -559 -1 63

-559 -379 w

rn I 1 -426 -271

-286 -163

* B ~ 5 p 0 c , ~3p0 I ~ 1 p O +I a-ATPase PROMOTER

-559/-440

L7 -m CAT -501 -379

-426 - 3 5 1

-374 P -271

-286/-260 0-rn

'XICITI * -255 -163

FOLD CAT-INDUCTION BY 100 nM T3 20

r b FOLD CAT-INDUCTION BY 100 nM T3

10

C -501 -" CGGCTCGCGCTGCCCAGGGCGCGGAGGCAAGCCAAGGACACCAGTCCCTGCGCGCCTCGGTC

-440

-350 AGCTCCGCGATCTATTCCTGCACGCGGACGGAATGGGAAAGCCGCGACCGCGTAAGGTCGGGCT

- - - - -287

- I REGION 111 I -255 - CAGCGAGGACGCGGAGGTOOCCTDC(ICOCOCRCACI3CGCGCGGCCTCGATCCGGGTTACTGGGG

- - - - -163 GCGGCGCGCGGGAGGAGGCGGGGCCTGCC

FIG. 1. Functional delineation of three thyroid hormone-responsive regions in proximal SERCA 2 promoter. A, various fragments of the SERCA 2 promoter (shown as bars on the left side) were cloned upstream of the thymidine kinase (TK) promoter in the expression vector pBLCAT2. The nucleotide positions (relative to the transcription start site) of the 5' and 3' extremes of the SERCA 2 promoter fragments are indicated below each bur; the plasmid pBLCAT2 is sche- matically shown at the bottom of the figure. The constructs were transfected into neonatal rat cardiac myocytes, together with a human TRpl encoding expression vector and a P-galactosidase expression vector to correct for transfection efficiency. Duplicate plates of transfected cells were treated with 100 xm T, or vehicle, harvested, and assayed for P-galactosidase and CAT activity. Data are expressed as the CAT activity in the presence of T,, divided by the CAT activity in the absence of T, (after correction for transfection efficiency), and represent the mean f S.E. of at least three independent experiments. An additional correction was made to take a small effect of T, on pBLCAT2 expression into account. B , the SERCA 2 promoter fragments shown in Fig. L4 were divided into smaller fragments and cloned into pBLCAT2. Experimen- tal protocol and representation of data are as in Fig. L4. The black boxes on the left side indicate possible regions of T, responsiveness. C, sequence of the putative T,-responsive regions. A number of possible TRE half-sites are overlined by arrows.


I REGION I I REGION I I ]REGION II I 1 CON I

C hTRp hRXRa

- + - + t - - - + " - " - - + - +

+ + - - - - rRXFq3-GST - - - - + + - + + - - + - + + - + - + +

C' I A I

I REGION I I REGION I1 I REGION Ill I

A I

B d

I

REGION I I REGION I I REGION I I I I CON

D rTRa rRXRf3

A I

B - )

+ - + - + - + - + - + - +

Y

REGION I REGION I I REGION I I I

FIG. 2. Gel shift analysis of binding of different TR and RXR isoforms to T3-responsive regions. GEMSAs were performed using 0.1-0.3 ng of 32P-labeled DNA fragments of the SERCA 2 promoter as probes. The region I probe spans nt -5OV-440, the region I1 probe spans nt -3461-271, and the region 111 probe spans nt -2551-163. Non-T,-responsive promoter fragments served as negative controls (con; nt -4/+75 and n t -4261-351 for binding reactions involving hTRp and rTRa, respectively). Receptor proteins were used in the amounts specified under "Materials and Methods." Competition was performed with palindromic TRE (spec comp) or with the non-T,-responsive promoter fragments indicated above (nonspec comp) in a 100-fold molar excess over the probes. F indicates free probe; other letters at the left side of the figure indicate the various retarded complexes. A, binding of hTRp1; the first four lanes were exposed approximately two times longer than the rest of the gel. B, binding of TRal. C, binding of TRpl alone or in combination with hFKRu or an rRXRp.glutathione S-transferase fusion protein; the second lane was exposed approximately six times longer than the rest of the gel. D, binding of TRal alone or in combination with rRXRP. The amount of TRal used per binding reaction was 5-fold lower than in B .

ably bind to any of the three regions, enhance the binding of TRP to the three regions (Fig. 2C and data not shown). The effect of both FXR isoforms is most pronounced on region I and least pronounced on region 111. Inclusion of the rRXRP-glutathione S-transferase fusion protein in the binding reaction results in the formation of a new, more slowly migrat- ing complex C on all three regions; inclusion of FXRa results in the formation of a new complex C' on region I but does not affect the mobility of complex A formed on regions I1 and 111. Fig. 20 shows that rRXRj3, in amounts where it by itself does not show detectable binding, significantly enhances the binding of TRa to the three regions, again with the effect being most pronounced on region I and least pronounced on region 111. Furthermore, RXRP significantly retards the migration of the TRa complex with region I, but the mobility of the heteromeric complexes formed on regions I1 and I11 does not differ greatly from the mobility of the homomeric complexes.

Having established that each region binds both TRP and TRa as specific homomeric complexes and as heteromeric complexes in the presence of RXRs, the binding sites for nuclear receptors within each region were further defined. First, the presence of receptor binding sites around nt -470 in region I (cfi Fig. 1C) was confirmed by cutting the isolated DNAfragment at nt -469

with StyI. The resulting fragments were labeled and used as probes for bandshifts with TRP plus RXRP-glutathione S- transferase or with TRa plus RXRa. No complexes could be detected when the 5' fragment (nt -5OU-466 after filling in of the 5' overhangs) was used as a probe, and heteromeric complexes were barely detectable on the 3' fragment (nt -4691-440 after filling in) (data not shown). These data indicate that the 5'-most half-site (cf. Fig. 1C) is critical for TReRXR binding and that the other two potential half-sites together are not capable of significant heteromeric complex binding. We therefore synthesized two oligonucleotides, one containing only the first two putative half-sites shown in Fig. 1C and the other containing all three putative half-sites (nt -48U-458 and nt -48U-452, respectively). Both oligonucleotides show homomeric complex formation with TRP and heteromeric complex formation with TRP plus RXRa and with TRa plus FXRP.glutathione S-transferase, indistinguishable from the complexes formed with the entire region I (Fig. 3A) . These data indicate the presence of one TReFXR binding site within region I located between nt -481 and -458.

Since the potentiating effect of FXRa on complex formation over regions I1 and I11 was similar to the effect of FXRP-glutathione S-transferase, only the combinations TRP

TREs in Sarcoplasmic Reticulum Ca2+ATPase Promoter 13025 plus RXR@glutathione S-transferase and TRa plus RXRp- glutathione S-transferase were used to screen for binding sites in regions I1 and 111. Nuclear receptor binding sites in region I1 were narrowed down by synthesizing three oligonucleotides: one containing all four putative half-sites (nt -3291-287) (see Fig. 1C); one containing only the first three putative half-sites (nt -3261-295); and one containing only the last two putative half-sites (nt -310/-287) (see Fig. 1C). As shown in Fig. 3B, heteromeric complex formation over region I1 is indistinguishable from complex formation over oligonucleotides -3291-287 and -3101-287; oligonucleotide -326/-295 exhibited barely detectable binding (not shown). Thus, there is only one TR.RXR binding area within region 11, and it is located between nt -310 and -287.

Region I11 contains a number of potential half-sites dispersed over its entire length, and therefore we initially used a strategy similar to that used on region I. Region I11 was divided into two roughly equal parts utilizing a unique HpaII site at position -205. In bandshift assays (not shown),only weak heteromeric complex formation was observed over both DNA fragments, indicating the presence of one high affinity TRaRXR binding region around position -205. Therefore we synthesized an oligonucleotide spanning nt -2191-194. The binding of TR-RXR heteromers to this oligonucleotide is shown in Fig. 3B. Com- parison with complex formation on the entire region I11 shows that although overall binding to both probes is of similar magnitude, they do exhibit different patterns of complex formation. Binding to region I11 shows almost exclusive formation of (heteromeric) complex C, whereas binding to the oligonucleotide also shows formation of (homomeric) complex A. Taken together, these data indicate the presence of one high affinity TR.RXR binding site within region 111; it is located between nt -219 and -194, although nucleotides just outside of this site may stabilize heterocomplex formation.

Since the formation of heteromeric complexes was used to screen for binding sites within each of the regions, the minimal TRsRXR binding sites defined above were tested for their ability to form homomeric complexes with both TRs (Fig. 3C). The binding of TRa to oligonucleotides -48ll-458 and -3101-287 is similar to the binding to the larger regions from which they were derived, showing formation of predominantly complex B and complex A, respectively (cfi Fig. 2A) . However, binding to oligonucleotide -219/-194 shows formation of predominantly complex A, whereas a predominant formation of complex B is seen when the entire region I11 is used as a probe. On the other hand, the binding of TRp to the three oligonucleotides is similar to its binding to the complete regions. All form one single retarded complex A with TRp, with the strongest binding observed to the region 111-derived oligonucleotide followed by the oligonucleotides derived from regions I1 and I (cf. Fig. 2A).

Having identified three short stretches of nucleotides with identical or similar TR and TR plus RXR binding characteristics as the larger parent regions, we tested the functionality of these oligonucleotides in transient transfection assays. Fig. 4A shows that all three oligonucleotides confer a 3-5-fold T, inducibility upon the thymidine kinase promoter. This induction is similar in magnitude to the induction conferred by the larger DNA fragments (cfi Fig. 1, A and B) and identifies the three oligonucleotides as genuine TREs. Sequence comparison reveals that the three oligonucleotides all contain two half-sites of similar nucleotide sequence but that these half-sites differ in relative spacing and orientation among the three TREs (Fig. 4B). TREs with half-site spacing and orientation similar to TREs 1 and 3 have been found in the promoters of other T,- responsive genes (see "Discussion"), but to our knowledge no naturally occurring homologs of TRE 2 have been described.

Determination of Heterodimer Polarity on TRE 1-TRa alone

. .~ ~~ ~

OLIGO OLlGO 1 REG'oN ' I -481/-458 [ -481/-452 1

A 'I

C hTRfs

t - - t " - t - rTRa t" t t" - -

(-481/-4581-310/-Z87~-Zl9/-1941

RG. 3. Identification of one high affinity T F t e R X R binding site within each T,-responsive region. GEMSAs were performed as in Fig. 2; the three T,-responsive regions or the indicated oligonucleotides served as probes. A, binding of TRP, TRP plus RxRa, and TRa plus RXRP.glutathione S-transferase to region I and to oligonucleotides (oligo) derived from this region. Ho and He a t the left side of the figure indicate homomeric and heteromeric complexes, respectively. B , binding of TRa plus RXRP.glutathione S-transferase and of TRP plus RXRP.glutathione S-transferase to regions I1 and 111 and to oligonucleotides derived from these regions. The figure is a composite of three independent GEMSAS performed under identical conditions. C , binding of TRa and TRP to the three minimal T R . R X R binding regions. Letters a t the left side of B and C are as in Fig. 2.

and in combination with the RXRS shows identical binding to region I and to the 24-nt oligonucleotide -4811-458; this led us to assume that complex B (see Figs. 2 B , 3C, and 4B) represents a TRa monomer bound to DNA, whereas complex A (in the presence of RXRp) (Fig. 2 0 ) represents a heterodimer. Since


A Ca-ATPase PROMOTER FOLD CAT-INDUCTION BY 100 nM T3

.SO0 -300 -100 +1 0 5 10 I I I I

-481/-458

0 -3101-287

o"-ma -21 9/-194

B

TRE 1: GCGGAGGCAAGCCAAGGACACCAG -481 -458

-310 -287 TRE 2: GCCGCGACCGCGTAAGGTCGGGCT

-219 -194 TRE 3: CGCGCGGCCTCGATCCGGGTTACTGG

FIG. 4. Functional analysis of three minimal TR-RXR binding sites. A, the three oligonucleotides used in Fig. 3C were cloned into pBLCAT2 and tested for TRE function by transient transfections; experimental protocol and representation of data are as in Fig. L4. B , sequence of the three TREs; 6-nt TRE half-sites are overlined by arrows. TK, thymidine kinase.

TRa readily forms complexes of lower mobility ( i e . presump- tive homodimers) (cf. Figs. 3C and 4B) on the other two oligonucleotides under conditions of similar protein-DNA stoichiom- etry, the binding characteristics further suggested that TRa has a high affinity for only one of the two half-sites of TRE 1. We tested this possibility by analyzing the interaction of TRa alone and in combination with RXRP with region I using methylation interference analysis. This analysis detects pri- marily protein contacts with guanosines in the major groove of the DNA double helix. Footprints of TRa and of TRa plus RXRP on region I are shown in Fig. 5. Contacts of TRa on the upper strand are apparent at G4= and G465, and methylation of G471 appears to partially interfere with TRa binding; the TRaeRXRP heterodimer contacts G4"j and G475 in addition to the guanosine residues contacted by TRa alone. Since the B lanes exhibit overall weaker signals in the smaller fragments than the F lanes, a possible contact at G458 (which forms part of the third putative half-site in region I) (see Fig. 1C) is probably artifactual. No contacts are observed with G4w456 (which form part of the same putative half-site) on the lower strand, and bandshiR assays gave no indication that the third putative half-sib is involved in TR-RXR binding (Fig. 3A) . Lower strand contacts of TRa are evident at G4'j3 and G461, and a partial interference with TRa binding is observed when G470 and G469 are methylated. The TRa.RXRP heterodimer contacts G474 on this strand in addition to the guanosine residues contacted by TRa alone. For the same reason as mentioned above for the upper strand contacts, protein-DNA interactions at G487'489 cannot be ruled out but are unlikely since 1) no upper strand contacts are observed in this area; 2) no binding of TR-RXR complexes was observed to a DNA fragment containing this area (nt -5OV-466) (see above); and 3) no consensus TRE half- site can be detected in this area. The combined footprinting

B

TR

TR+

- -00- - C

-460

-470

1 0-480

3 '

-480 0 0 . -457 CGGAGGCAAGCCAAGGACACCAGT

GCCTCCGTTCGGTTCCTGTGGTCA ___) -

00 0 0

-480 ++ o 0 0 -457 CGGAGGCAAGCCAAGGACACCAGT

R X R ~ - - GCCTCCGTTCGGTTCCTGTGGTCA + 00 0 0

FIG. 5. Methylation interference analysis of binding of TRal and RxRp to region I. A, methylation interference footprints of TRal and of TRal plus RXRP on region I. The region I probe (see legend to Fig. 2) was 32P-labeled a t the 3' end of either the upper or the lower strand. Further experimental details are described under "Materials and Methods." Methylated guanosine residues that interfere with the binding of TRal are indicated by circles, and additional guanosines whose methylation interferes with the binding of TRal plus RXRP are indicated by diamonds. Filled symbols indicate complete interference, and open symbols indicate partial interference of guanosine-methylation with protein binding; numbers refer to nt positions relative to the transcription start site. B, summary of the data of A. Arrows indicate 6-nt TRE half-sites; other symbols are as in A.

data are summarized in Fig. 5B. TRa interacts with a stretch of 10 nt encompassing the 3' half-site (AGGACA) of TRE 1 plus surrounding nucleotides but not the 5' half-site (AGGCAA). The TRa.RXRP heterodimer interacts with a stretch of 16 nt, which contains both half-sites. This confirms our initial as- sumption that complex B (Figs. 20 and 3C) represents a TRa monomer bound to DNA and that complex A represents a TR.RXR heterodimer. In addition, since TRs and RXRs have similar molecular weights, complex A formed over TREs 2 and 3 in the absence of RXR probably represents receptor homodimers bound to DNA (cf. Figs. 20 and 3C).

The footprinting data suggest that there may be a distinct polarity in the TRsRXR heterodimer on TRE 1, and this prompted us to further investigate this possibility. To this end, altered specificity mutants of TRP and RXRa were generated (TR-P-GR and RXR-P-GR, respectively) by converting their P-boxes into the glucocorticoid receptor P-box. Binding site se-

TREs in Sarcoplasmic Reticulum Ca2+ATPase Promoter 13027 probe hTRp

hRXRa hRXRa- P - G I

hTR0-P-GR

F

1 2 1 2 t t " " + + ""

+_ ?I; ?I; 5 1 2 1 2 1 2 1 2

t t t t " "" t t t t

FIG. 6. Determination of polarity of TR-RXR heterodimer bound to TRE I. GEMSA was performed as in Fig. 2 except that approximately 1 ng of probe was used per binding reaction. Probe 1 is wild type TRE 1 (the 3' half-site of which is simultaneously a TRE and a GRE half-site), and probe 2 is a mutated version of TRE 1, in which the 5' half-site was converted to a consensus glucocorticoid response element half-site AGAACA (cf. Fig. 4B). hTRP-P-GR and hFtXRa-P-GR are mutant versions of hTRp and hRXRu, respectively, in which their P-boxes are mutated into the glucocorticoid receptor P-box. Lanes 5, 6, 9, and 10 are a 6-h exposure, and the other lanes are a 64-h exposure of the same gel.

lection assays have shown that TRP containing this mutation preferentially binds half-sites with a 6-nt core motif of AG(G1A)ACA (56). Thus, the 3' half-site of TRE 1 is simultaneously a TRE and a glucocorticoid-response element half-site. Mutant and wild type proteins were used in bandshift assays using either wild type TRE 1 (oligonucleotide -4811-458; probe 1) or a mutant version of TRE 1 in which the 5' half-site was converted to AGAACA (probe 2). As shown in Fig. 6, wild type TRP binds weakly to probes 1 and 2; two complexes are observed with each probe (lanes 1 and 21, possibly due to the presence of a truncated form of the receptor in the in vitro translation mix. By contrast, the TR-P-GR mutant does not detectably bind to probe 1 but does show complex formation with probe 2 (lanes 3 and 4) ; this is probably related to the fact that probe 2 contains two glucocorticoid-response element-like half-sites, whereas probe 1 contains only one such half-site. RXRa by itself does not detectably bind to either of the probes (not shown) but greatly enhances the binding of TRP to both probes with stronger complex formation observed on probe 1 than on probe 2 (lanes 5 and 6). Likewise, RXR-P-GR enhances the binding of TRP to both probes (lanes 9 and lo ) , but in contrast to RXRa, RXR-P-GR forms a stronger complex with TRP on probe 2 than on probe 1. Binding assays involving TR-P-GR and RXRa show appreciable heterocomplex formation with probe 1 but hardly any with probe 2 (lanes 7 and 8). By contrast, a heterocomplex is formed between TR-P-GR and RXR-P-GR on probe 2 but not on probe 1 (lanes 11 and 12).

Taken together, mutation of the 5' half-site results in a de- creased complex formation of TRP with RXRa but in an increased complex formation with RXR-P-GR, indicating that the 5' half-site is involved in RXR binding. The possibility that TRP occupies the 5' half-site in a significant fraction of the complexes is excluded by the observation that mutation of this half-site abolishes complex formation between TR-P-GR and RXRa but induces complex formation between TR-P-GR and RXR-P-GR. Thus, the heterodimer formed on TRE 1 shows a

distinct polarity with RXR binding to the 5' half-site and TR binding to the 3' half-site.

DISCUSSION In the present study, we have identified three separate TREs

located at nucleotides -48ll-458, -3101-289, and -2191-194 relative to the transcription start site of the SERCA 2 gene. The presence of the two 5'-most TREs was anticipated in a previous study, but the TRE located at -219/-194 was not, since CAT vectors driven by nt -2621+75 of the SERCA 2 promoter did not show T3 inducibility in transient transfection assays (9). The reason for this discrepancy is unknown, but other context-dependent TREs have been described in which the activity of one TRE is induced or enhanced by the presence of another TRE or a non-TRE promoter element (27,58,59). In this regard, it is of importance to note that a TRE is present in the thymidine kinase promoter used in the present study (60,611. The thymidine kinase-TRE is active in our system since we observed a small (10-20%) but consistent T,-dependent decrease in thymidine kinase promoter activity in transfected neonatal myo- cy te~ . Alternatively, it is possible that in the -2621+75 SERCA 2 promoterlCAT construct a non-TRE element is deleted that is necessary for TRE 3 function. A similar situation has been observed for the phosphoenolpyruvate carboxykinase promoter where mutation of a non-TRE promoter element abolishes the function of a TRE. However, this TRE is functional when placed upstream of a neutral promoter (27).

An important finding of the present study is that the proximal SERCA 2 promoter contains three TREs that differ from each other with respect to the spacing and orientation of the half-sites. TREs with half-site spacing and orientation similar to TREs 1 and 3 have been encountered in the promoters of various genes (17,28-30,621, but a TRE organized like TRE 2 has only been described as an artificial TRE composed of idealized half-sites (56, 63). Thus, whereas the spacing between direct repeats of half-sites may determine whether an element confers responsiveness to vitamin D,, T,, or retinoic acid (62, 63), it appears that natural elements composed of inverted palindromes can tolerate considerable variation in half-site spacing while still retaining responsiveness to T,.

The different organization of the three TREs is reflected in their differences with regard to TR and TR plus RXR binding. Thus, TRE 1 binds TRal almost exclusively in monomeric form, whereas TRP is exclusively bound as a homodimer. These data are in agreement with a recent report by Darling et al. who observed a similar pattern of TRa and TRP binding to a DR+4 motif (64). The preferential binding of TRa in monomeric form to DR+4 elements appears to be an intrinsic property of the a receptor. This may be related to the fact that TRa and TRP have different D-boxes, a stretch of amino acids located between cysteines 5 and 6 in the second zinc-finger involved in protein-protein interactions (44, 65, 66). In addition, 2 amino acids in TRP (leucine 181 and alanine 182) were recently shown to be critical for homodimerization of TRP over a DR+4 element (56). It is interesting to note that the region surrounding these amino acids is perfectly conserved among both receptors except for leucine 181 in TRP, which is a valine at the homologous position in TRa. In contrast to TRE 1, TRE 3 and especially TRE 2 are capable of accommodating TRa homodimers (Fig. 2B ). These latter two TREs also show stronger TRP homodimer binding than TRE 1 (Fig. 2A). Interestingly, TRa binds more strongly to the region 11-derived oligonucleotide -3101-287 (containing two half-sites arranged as an inverted palindrome separated by 4 nt; IP+4) than TRP, whereas on the region 111-derived oligonucleotide -2191-194 (containing an IP+6 motin, TRP is the stronger binder (Fig. 3C). In fact, TRP binding to region I11 is hardly enhanced by the RXRs (Fig. 2 0 , and


homodimeric complexes can be observed on regions I1 and 111 even when RXRs are present (Fig. 3B). This contrasts with TRE 1 as R X R s dramatically enhance TRa and TRP binding; TRE 1 shows exclusive heterodimer binding when both TRs and RXRs are present (Figs. 2, C and D , and 3A). The observation that a TRE with a DR+4 motif has a strong preference for RXR.TR heterodimers, whereas TREs with an inverted palindrome motif also accommodate homodimers, may be a gen- eral phenomenon (e.g. see Refs. 56 and 66). However, additional experiments are required to assess the generality of our observation that TRa homodimers preferentially form on a TRE with an IP+4 motif whereas TRP homodimers preferentially form on a TRE with an IP+6 motif.

The TRE 1- and TRE 2-containing oligonucleotides showed binding to TRs and RXRs very similar to the larger regions from which they were derived, but some differences were observed between the TRE 3 oligonucleotide and the larger region 111. However, the core sequences of each TRE are functionally equivalent to the extended sites in our transfection system (cf. Figs. 1B and 4A), indicating that the minimal TR binding sites are sufficient for transcriptional regulation by T,. In spite of their different architecture and in vitro binding properties, the three TREs confer a very similar degree of responsiveness to T, upon the thymidine kinase promoter. This could relate to the observation that all of the TREs are strongly bound by the TR.RXR heterodimer. Clearly, further studies will be required to delineate the relative roles of the homodimeric and het- erodimeric TR in the cardiac myocyte. Indeed, there may be TR auxiliary proteins other than RXRs in these cells.

The interaction between region I and TRa alone or in combination with RXRP was further analyzed by methylation interference footprinting. The footprints clearly show that TRa by itself binds exclusively to the 3' half-site of TRE 1 and further demonstrate that nucleotides outside the 3' hexameric half-site are important for the formation and/or stability of a complex with TRa. These findings confirm several recent reports in which the interactions between TRs and several DNA elements were assessed using footprinting and mutational analyses (56, 60, 66, 67). The interaction of TRol with the 3' half-site, rather than with the 5' half-site, can be explained by the observation that lower strand contacts with G-463 and G4'l are important for receptor binding; no guanosines are found at the homologous positions in the 5' half-site (Fig. 5). Subsequent studies were aimed at determining whether TRs also occupy the 3' half-site of TRE 1 when forming a heterodimer with RXR. These studies involved analysis of the binding of altered specificity TR and RXR mutants and showed that the heterodimer has a distinct polarity with RXR occupying the 5' half-site and TR occupying the 3' half-site (Fig. 6). This finding confirms two recent reports where the binding of the same or similar receptor mutants to optimized, non-natural DR+4 elements was assessed (56, 66). An additional aspect of the ex- periment shown in Fig. 6 is the observation that there is quite significant complex formation between TRP and RXRa over TRE 1 even when the 5' half-site is mutated and between TRP and RXR-P-GR even when the 5' half-site is not mutated. These complexes are quite strong since they are also observed when the stringency of the binding reactions is increased by increasing [KC11 to 150 m ~ . ' These data indicate that interactions between specific RXR P-box residues and nucleotides of the 5' core half-site are not absolutely necessary for high affinity complex formation and point to a possibly even greater degeneracy of direct repeat TREs than hitherto suspected. Functional experiments are required to further address this possibility.

Taken together, we have demonstrated the presence of three

* R. Hartong, unpublished data.

different TREs in the promoter of a gene that is critical for cardiac function. The presence of multiple sites with different preferences for TR homo- and heterodimers, rather than a single perfect repeat, may allow for a complex interplay between thyroid hormones and other factors and may serve to fine tune the effects of T, under normal and pathophysiological conditions.

Acknowledgments-We thank Drs. Victor Yu and Geoff Rosenfeld for kindly providing bacterially expressed RXRP and the expression plasmid encoding the RXRP.glutathione S-transferase fusion protein. We also thank Drs. Ruben Mestril and Tom Popoian for critically reading the manuscript.

1. 2. 3.

4.

5.

6.

8. 7.

9.

10. 11. 12.

13.

14.

15.

16.

17. 18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31. 32.

33. 34.

35. 36.

37.

38.

39.

REFERENCES Morgan, J., Perreault, B., and Morgan, K. (1991)Am. Heart J . 121,961-968 Langer, G. (1992) FASEB J. 6, 893-902 Burk, S . E., Lytton, J., MacLennan, D. H., and Shull, G. E. (1989) J. Biol.

Brandl, C. J., deleon, S. , Martin, D. R., and MacLennan, D. H. (1987) J. Biol. Chem. 284, 18561-18568

de la Bastie, D., Levitsky, D., Rappaport, L., Mercadier, J. J., Marotte, F., Chem. 262,376%3774

Wisnewsky, C., Brovkovich, V., Schwartz, K., and Lompre, A. M. (1990) Circ. Res. 86,554-564

Nagai, R., Zarain, H. A., Brandl, C. J., Fujii, J., Tada, M., MacLennan, D. H., Alpert, N. R., and Periasamy, M. (1989) Pnx. Natl. Acad. Sci. U. S. A. 86, 296tL2970

Rohrer, D. K, and Dillmann, W. H. (1988) J. Biol. Chem. 283,69414944 Ojamaa, K., Samarel, A. M., Kupfer, J. M., Hong, C., and Klein, I. (1992) Am.

Rohrer, D. K., Hartong, R., and Dillmann, W. H. (1991) J. Biol. Chem. 286,

Evans, R. M. (1988) Science 240,889-895 Beato, M. (1989) Cell 68,335344

Heyman, R. A,, Mangelsdorf, D. J., Dyck, J. A,, Stein, R. B., Eichele, G., Evans, R. M., and Thaller, C. (1992) Cell 88,397-406

Levin, A. A,, Sturzenbecker, L. J., Kazmer, S . , Bosakowski, T., Huselton, C., Allenby, G., Speck, J., Kratzeisen, C., Rosenberger, M., Lovey, A., and

Mangelsdorf, D. J., Ong, E. S . , Dyck, J. A,, and Evans, R. M. (1990) Nature 345, Grippo, J. F. (1992) Nature 355,359-361

Sap, J., de Magistris, L., Stunnenberg, H., and Vennstrom, B. (1990) EMEO J. 224-229

Weinberger, C., Thompson, C. C., Ong, E., Lebo, R., and Evans, R. M. (1986) 9 ,887496

Izumo, S. , and Mahdavi, V. (1988) Nature 394, 539-542 Nature 3 2 4 , 6 4 1 4 6

Mitsuhashi, T., Tennyson, G. E., and Nikodem, V. A. (1988) Proc. Natl. Acad.

J. Physiol. 283, E53PE540

8638-8646

Lazar, M. A,, Hodin, R. A,, Darling, D. S. , and Chin, W. W. (1988) Mol. Endo- Sci. U. S. A. 85, 5804-5808

Hodin, R. A,, Lazar, M. A., Wintman, B. I., Darling, D. S. , Koenig, R. J., Larsen,

Koenig, R. J., Lazar, M. A,, Hodin, R. A,, Brent, G. A,, Larsen, P. R., Chin, W.

Lazar, M. A., Hodin, R. A., and Chin, W. W. (1989) Proc. Natl. Acad. Sei.

Schwartz, H. L., Strait, K. A,, Ling, N. C., and Oppenheimer, J. H. (1992) J.

Falwne, M., Miyamoto. T., Fierro-Renoy, F., Macchia, E., and DeGroot, L. J.

crinol. 2, 893-901

P. R., Moore, D. D., and Chin, W. W. (1989) Science 244,76-79

W., and Moore, D. D. (1989) Nature 337,659461

U. S . A. 86,7771-7774

Biol. Chem. 287, 11794-11799

Glass, C. K., Holloway, J. M., Devary, 0. V., and Rosenfeld, M. G. (1988) Cell (1992) Endocrinology 131,2419-2429

Brent, G. A., Harney, J. W., Chen, Y., Warne, R. L., Moore, D. D., and Larsen,

Giralt, M., Park, E. A,, Gurney, A. L., Liu, J., Hakimi, P., and Hanson, R. W.

Desvergne, B., Petty, K. J., and Nikodem, V. M. (1991) J. Eiol. Chem. 286,

Baniahmad, A., Steiner, C., Kohne, A. C., and Renkawitz, R. (1990) Cell 81,

Farsetti, A., Desvergne, B., Hallenbeck, P., Robbins, J., and Nikodem, V. M.

Murray, M. B., and 'lbwle, H. C. (1989) Mol. Endocrinol. 3, 1434-1442 Burnside, J., Darling, D. S., and Chin, W. W. (1990) J. Biol. Chem. 285,

Lazar, M. A,, and Berrodin, T. J. (1990) Mol. EndocrinoZ. 4, 1627-1635 Darling, D. S., Beebe, J. S . , Burnside, J., Winslow, E. R., and Chin, W. W. (1991)

Yu, V. C., Delsert, C., Andersen, B., Holloway, J. M., Devary, 0.. Naar, A. M., Beebe, J. S . , Darling, D. S., and Chin, W. W. (1991) Mol. Endocrinol. 5,85-93

Kim, S . Y., Boutin, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell 87,

h i d , M., Kastner, P., Lyons, R., Nakshatri, H., Saunders, M., Zacharewski, T., 1251-1266

Chen, J.-Y., Staub, A,, Gamier, J.-M., Mader, S. , and Chambon, P. (1992) Cell 88,377495

Zhang, X.-K., Hof€mann, B., Tran, P. B.-V., Graupner, G., and Pfahl, M. (1992) Nature 3 6 5 , 4 4 1 4 6

Kliewer, S . A,, Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992) Nature 355,446449

64,313423

P. R. (1989) Mol. Endocrinol. 3, 199tL2004

(1991) J. Biol. Chem. 286,21991-21996

1008-1013

505-514

(1992) J. Biol. Chem. 287, 15784-15788

2500-2504

Mol. Endocrinol. 5, 7 3 4 4

TREs in Sarcoplasmic Reticulum Ca2'ATPase Promoter 13029 40. Marks, M. S., Hallenbeck, P. L., Nagata, T., Segars, J. H., Appella, E., Ni-

41. Hermann, T., Hoffmann, B., Zhang, X.-K., Tran, P., and Pfahl, M. (1992) Mol.

42. Hallenbeck, P. L., Marks, M. S., Lippoldt, R. E., Ozato, K., and Nikodem, V. M.

43. Marks, M. S., Levi, B.-Z., Segars, J. H., Driggers, P. H., Hirschfeld, S., Nagata,

44. Umesono, K., and Evans, R. M. (1989) Cell 57, 1139-1146 45. Samuels, H. H., Stanley, F., and Casanova, J. (1979) Endocrinology 105,8&85 46. Chen, C., and Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752 47. Gehalle, A. P., Spaete, R. R., and Mocarski, E. S. (1986) Cell 46, 865-872 48. Glass, C. K., Lipkin, S. M., Devary, 0. V., and Rosenfeld, M. G. (1989) Cell 59,

697-708 49. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. H., Smith,

J. A,, and Struhl, K. (eds) (1987) Current Protocols in Molecular Biology,

50. Gorman, C . M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, John Wiley and Sons, Inc., New York

51. Casadaban, M., Martinez-Arias, A,, Shapira, S., and Chou, J. (1983) Methods 104P1051

52. Luckow, B., and Schutz, G . (1987) Nucleic Acids Res. 15, 5490 Enzymol. lOOB, 293-308

53. Ribeiro, R. C. J., Kushner, P. J., Apriletti, J. W., West, B. L., and Baxter, J. D.

54. Lazar, M. A,, Berrodin, T. J., and Harding, H. P. (1991) Mol. Cell. Biol. 11,

kodem, V. M., and Ozato, K. (1992) EMBO J. 11, 1419-1435

Endocrinol. 6, 1153-1162

(1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5572-5576

T., Appella, E., and Ozato, K. (1992) Mol. Endocrinol. 6, 219-230

11992) Mol. Endocrinol. 6, 1142-1152

55. Smith, D. B., and Johnson, K. S. (1988) Gene (Amst.) 67,3140 56. Kurokawa. R., Yu, V. C., Naar, A,, Kyakumoto, S., Han, Z., Silverman, S.,

57. Glass, C. K., and Holloway, J. M. (1990) Biochim. Biophys. Acta 1052,

58. Leidig, F., Shepard, A. R., Zhang, W., Stelter, A., Cattini, P. A,, Baxter, J. D.,

59. Voz, M. L., Peers, B., Wiedig, M. J., Jacquemin. A., Belayew, A., and Martial,

60. Kim, H.-S., Crone, D. E., Sprung, C. N., Tillman, J. B., Force, W. R., Crew, M.

61. Park, H.-Y., Davidson, D., Raaka, B. M., and Samuels, H. H. (1993) Mol.

62. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell

63. Naar, A. M., Boutin, J. M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C.

64. Darling, D. S., Carter, R. L., Yen, P. M., Welbom, J. M., Chin, W. W., and

65. Luisi, B. F., Xu, W. X., Otwinowski, Z., Freedman, L. P., Yamamoto, K. R., and

66. Perlman, T., Rangarajan, P. N., Umesono, K., and Evans, R. M. (1993) Genes

67. Katz, R. W.. and Koenig, R. J. (1993) J. B i d . Chem. 268, 19392-19397

5005-5015

Rosenfeld, M. G., and Glass, C. K. (1993) Genes & Dev. 7, 1423-1435

157-176

and Eberhardt, N. L. (1992) J. Biol. Chem. 267, 913-921

J. (1992) Mol. Cell. Biol. 12, 3991-3997

D., Mote, P. L., and Spindler, S. R. (1992) Mol. Endocrinol. 6, 1489-1501

Endocrinol. 7, 319-330

65, 1255-1266

K., and Rosenfeld, M. G. (1991) Cell 65, 1267-1279

Umeda, P. K. (1993) J. Biol. Chem. 268,10221-10227

Sigler, P. B. (1991) Nature 352,497-505

& Dev. 7, 1411-1422

Date post:	11-Jan-2017
Category:	Documents
Upload:	trinhminh
View:	219 times
Download:	0 times

Delineation of Three Different Thyroid Hormone-response Elements ...

Documents