DETAILED MATERIALS AND METHODS
Gene Targeting and development of knock-out mice. The murine genomic clone, RP23-
449P23, containing the mir142 gene, was obtained from the BACPAC Resource Center
(http://bacpac.chori.org). A replacement vector was constructed which was designed to replace
the miR-142 hairpin precursor (100001-1000064) and upstream 1000 base pairs (99040-
100001) as well as downstream 2640 base pairs(100064-102705) with a PGK-neomycin-
resistance cassette. The retrieval vector was constructed using PCR amplified left/right
homology arms cloned into a vector backbone containing the PGK-neomycin- resistance
cassette. The 5’ arm retrieval primers used were “5’Arm sense”’ and “5’Arm antisense”, which
produce a 3,050 base pairs arm. The 3’ arm retrieval primers used were 3’ arm sense and 3’
arm antisense, which produce 2,541 base pairs 3’ arm. The 5’ arm was cloned into ploxPFlpneo
vector at unique restriction site Swa I by using Takara DNA ligation Kit Long. Next, 3’ arm was
cloned into the targeting vector by using In-Fusion Advantage PCR Cloning Kit (Clontech) with
Infusion Forward and Reverse primers. The Targeting vector was delivered into JM8.F6
(C57BL/6N) stem cell by microinjection. Targeted heterozygotes were monitored by genotyping
using TaqMan real-time quantitative PCR with primers and probes: 5’ Geno Farward, 5’ Geno
Reverse, and 5’ Geno probe; 3’ Geno Farward, 3’ Geno Reverse and 3’ Geno probe (37). The
ES derived from C57BL/6 mouse substrains (JM8.F6 [C57BL/6N] stem cell) and carrying
targeting vector was injected into albino C57BL/6 mice to produce black on white chimeras. ES
cell-mouse chimeras with high coat color contribution from the ES cells (90%) are selected for
germline transmission. Pups that are produced from sperm derived from the C57BL/6 host
embryo will have black coats and those from the albino C57BL/6 host embryo will be white. Tail
biopsies from the pups are screened for the presence of the targeted gene. The absence of
miR-142 gene was further confirmed by qTaqMan-PCR using specific control reference probe
for targeting the telomerase reverse transcriptase (Tert) gene on chromosome 13, cytoband
13qC1, and probes specific for 3’arm and 5’arm designed for miR-142 gene homologous
recombination. PCR primers used for distinguishing mir142-/-, miR142+/- and WT littermates
were 5’ forward, 5’ reverse, 3’ forward and 3’ reverse’ and mice were genotyped from tail biopsy
genomic DNA. The absence of miR-142 expression in miR-142-/- mice was confirmed in bone
marrow tissues isolated from tibia and fibula and T cells isolated from secondary lymphoid
organ (spleen) by qTaqMan PCR using specific probes against miR-142-3p, using Raw264.7
cells as positive control and NIH3T3 cells as negative control (11).
The oligos used were:
Lower case denotes cloning sites & upper case genomic DNA
5’arm forward: 5’- tcgatttaaatGGCCGATTTCTGAGTTCAAGGCC -3’
5’ arm reverse: 5’-ccaatttaaatGCGCAAAGCCCTGGGTTCGGTTCCC-3’
3’ arm forward: 5’-tcgggccggccGACATAGCATGTGTACTGATG-3’
3’ arm reverse: 5’-ccaggccggccggtaccGGCAGATCAAACTCCCTCC-3’
3’ Infusion forward: 5’-gctcgaattgatccccgggtaccGACATAGCATGTGTACTGATGTTTAGACTGC-3’
3’ Infusion reverse: 5’-gacctcgagggggggcccggtaccGGCAGATCAAACTCCCTCCCCATCCGTC-3’
5’ Geno forward: 5’-AAGCTGGGAACCGAACCC-3’
5’ Geno reverse: 5’-GCCCGGCTAATTTTTCCTTTTTTAAT-3’
5’ Geno probe 5’-TTGCGCTTACCATTGAGC-3’
3’ Geno forward 5’-CACAGACATACTATGCATACTCTTCTATACA-3’
3’ Geno reverse 5’-AAGGTAACATTCATTTCTCTAAAGCAGTCT-3’
3’ Geno probe 5’-ATGCTATGTCATGTAACTTT-3’
5’ Forward: 5’-GCCCAAGGCTCAGAGAAGAGC-3’
5’ Reverse: 5’-CGATACCAGTCTCACTGTTTCAGC-3’
3’ Forward 5’-GAAGTTCCTATTCCGAAGTTCC -3’
3’ Reverse 5’-GGAATAGCAGCTAAAGCATAGAG-3’
Mice: C57BL/6 (B6, H2b, CD45.2), C3H.sw (H2b), BALB/c (H2d), B6D2F1 (H2b/d, CD45.2) and
B6 Ly5.2 (H2b, CD45.1) mice were purchased from The Jackson Laboratory and the National
Cancer Institute. The age of mice used for experiments ranged between 8 and 12 weeks. Mice
were housed in sterilized microisolator cages and received filtered water and normal chow. All
animals were cared for under regulations reviewed and approved by the University Committee
on Use and Care of Animals of the University of Michigan, based on University Laboratory
Animal Medicine guidelines.
DC isolation: dendritic cells (DC) were isolated from splenocytes either from WT or miR-142
deficiency mice. Single cell suspensions were prepared by collagenase D (Roche) digestion
according to manufacturer’s instruction then subjected to CD11c microbead (MACS) staining
and positive selection using autoMACSTM Pro Separator (Miltenyi Biotec). The purity of
enriched CD11c+ DC preparation was 85.6~90%. Culture media were collected for
measurements of IL-6 and TNF by ELIS A a
ng/ml) for 6 hours.
BMT, systemic analyses of GVHD: BMTs were performed as described before (38-40). The
donor T cells were isolated from individual or pooled spleen cells suspensions by negative
selection (Pan T cell Isolation Kit II; Miltenyi Biotec). BM cells were harvested from the tibia from
one side of the mice for LSK cell harvest and for TCD of BM cells. TCD (T cell deletion) BM
cells were isolated with negative selection by autoMACS using anti-CD90.2 microbeads
(Miltenyi Biotec, Bergisch Gladbach, Germany). The recipient BALB/c mice received an 800-
cGy total body irradiation on day -1 (split dose) and T cells (1 × 106, isolated from either WT B6
mice or miR-142 deficiency mice) and TCDBM cells (5 × 106, from WT B6 mice) were injected
intravenously into the recipients on day 0. The recipient B6D2F1 mice received a 1100-cGy
total body irradiation on day -1, and T cells (2.5 × 106, isolated from either WT B6 mice or miR-
142 deficiency nice) and TCDBM cells (5 × 106, from WT B6 mice) were injected intravenously
into the recipients on day 0. The recipient C3H.SW mice received a 1050-cGy total body
irradiation on day -1, and T cells (1.5 × 106, isolated from either WT B6 mice or miR-142
deficiency nice) and TCDBM cells (5 × 106, from WT B6 mice) were injected intravenously into
the recipients on day 0. The syngeneic B6 control mice received a 1000-cGy total body
irradiation on day -1, and T cells (1-2.5 × 106, isolated from either WT B6 mice) and TCDBM
cells (5 × 106, from WT B6 mice) were injected intravenously into the recipients on day 0. For in
vivo knockdown of miR-142-3p using LNA-anti-miR-142-3p, recipient B6D2F1 and B6 mice
were administered on day 1, 3 and 7 with saline-formulated LNA-anti-miR-142-3p, or LNA
mismatch control by the injection volume of 200 uL with an IP (Intraperitoneal injection) dose of
10 mg/kg respectively (9). For in vivo CRISPRi targeted silencing of atypical E2Fs using B6 into
BALB/c GVHD model as described above, purified miR-142 KO T cells were infected with
lentiviral particles carrying double guide RNAs targeting E2F7 and E2F8 or CRISPRi-control,
and purified WT T cells were infected with lentiviral particles carrying CRISPRi-control, along
with dCas9 lentiviral particles for 3 days. The recipient BALB/c mice received an 800-cGy TBI
on day -1 (split dose) and miR-142 KO T cells (1 × 106, infected with lentiviral particles carrying
CRISPRi-E2F7/8 or control along with dCas9 lentiviral particles) or WT T cells 1 × 106 and TCD
BM cells (5 × 106, from WT B6 mice) were injected i.v. into the recipients on day 0. Mice were
housed in sterilized microisolator cages and received normal chow and autoclaved
hyperchlorinated drinking water for the first 3 week after BMT. Survival was monitored daily.
The degree of systemic GVHD was assessed by a standard scoring system by summation of
five criteria scores: percentage of weight change, posture, activity, fur texture, and skin integrity.
At the time of analysis, coded cages were evaluated and graded from 0 to 2 for each criterion
(maximum index =10) (40). Acute GVHD was also assessed by histopathologic analysis of the
ileum and the ascending colon, liver and ear skin. Specimens were harvested from animals on
day +14 or +21 after BMT, then processed and stained with hematoxylin and eosin. Coded
slides were examined systematically in a blinded manner by using a semiquantitative scoring
system to assess the following abnormalities known to be associated with GVHD, small
intestine: villous blunting, cryptregener ation, loss of enterocyte brush border, luminal sloughing
of cellular debri, crypt cell apoptosis, outright crypt destruction, and lamina propria lymphocytic
infiltrate; colon: crypt regeneration, surface co loncytes, colonocyte vacuolization, surface
colonocyte attenuation, crypt cell apoptosis, outright crypt destruction, and lamina propria
lymphocytic infiltrate; liver: portal tract expansion, neutrophil infiltrate, mononuclear cell infiltrate,
nuclear pleomorphism, intraluminal epithelial cells, endotheliatitis, hepatocellular damage,
acidophilic bodies, mitotic figures, neutrophil accumulations, macrophage aggregates,
macrocytosis; skin: apoptoses in epidermal basal layer or lower malphigian layer or outer root
sheath of hair follicle or acrosyringium, lichenoid inflammation, vacuolar change, lymphocytic
satellitosis. The scoring system denoted 0 as normal, 0.5 as focal and rare, 1.0 as focal and
mild, 2.0 as diffuse and mild, 3.0 as diffuse and moderate, and 4.0 as diffuse and severe.
Scores were added to provide a total score for each specimen (40).
T cell transfer and proliferation experiments: To examine the proliferation capability of miR-
142 KO T cells following allogeneic BMT, first, 1 x 106 purified T cells either WT or miR-142
deficient mice were injected intravenously into the BALB/c recipients on day 0 after irradiation
along with WT TCDBM cells (5 × 106). After 7 days, donor T cells in spleen and mLN were
analyzed using FACS staining gated for H2b+ CD90.2+. To assess intrinsic deficiency of miR-
142 KO T cells, purified T cells either from WT mice and miR-142 deficient mice were co-
transferred intravenously into the BALB/c recipients on day 0 after irradiation along with WT
TCDBM cells (5 × 106). After 7 days, donor T cells in spleen and mLN were analyzed using
FACS staining gated for H2b+ CD90.2+ CD45.1+ for WT donor T cells and H2b+ CD90.2+
CD45.2+ for miR-142 deficient donor T cells. For BrdU incorporation experiments, WT B6 T
cells and miR-142 KO T cells purified by negative selection were injected intravenously into the
BALB/c recipients on day 0 after irradiation. After 7 days of BMT, mice were injected with
50mg/kg BrdU (5mg/ml in 0.9% saline, IP) 3 hours prior to tissue collection. Splenocytes were
prepared for FACS staining with antibodies H2b, CD3 and BrdU. For studies pertaining to the in
vivo evaluation of miR-142 KO T cells after targeted silencing of atypical E2Fs using CRISPRi
system, B6 into BALB/c BMT model was used and procedures for silencing of atypical E2Fs
were described as above. The syngeneic recipients are B6 Ly5.2/CD45.1. After 7 days of BMT,
donor T cells in spleen and mLN were stained and analyzed for H2b and CD3 in BALB/c
allogeneic recipients, CD3 and congenic marker CD45.2 in B6 ly5.2 syngeneic recipients.
Cytospin slide preparation and immunocytochemistry Spleen T cells purified by negative
selection either from WT or miR-142 deficiency mice were suspended in PBS containing 0.5%
BSA and adjusted to the concentration of 5 x 106/ml. 5 x 105 (100ul) T cells were spread onto a
poly-lysine precoated slide by cytocentrifugation at 1000 rpm for 5 minutes, fixed in 10% neutral
buffered formalin for 15 minutes and in 70% ethanol for 30 minutes. HistoMouse-MAX Kit (Life
Technologies) and antibodies against E2F7 and E2F8 (abcam) were chosen for
immunocytochemistry and the staining protocol suggested by manufacturer was followed.
Stained slides were observed and analyzed with microscopy (Olympus BX-51) equipped with an
Olympus DP70 digital camera.
Affymetrix microarrays and analyses: The tcRNA was extracted from purified WT B6 T cells
and miR-142 KO T cells with RNeasy Mini Kit (Qiagen). After the quality of the total RNA was
verified by an Agilent 2100 Bioanalyzer, the samples were processed using the WT-Ovation™
Pico System (Affymetrix), and a single round of amplification for samples with even stricter
concentration restraints. This system incorporates oligo(dT) and random primers for
amplification at the 3’ end and throughout the whole transcriptome. Affymetrix mouse genome
430 2.0 Arrays (Affymetrix, Santa Clara, CA), which contain 45,000 transcripts for annotated
genes and expressed sequence tags, were used. The stained arrays were scanned on an
Agilent Gene Array Scanner (Affymetrix) with a 560-nm filter. The data were published and
analyzed using the R statistical environment (http://cran.r-project.org/) provided by Bioconductor
(http://www.bioconductor.org/) and were examined for the quality control by showing the same
distribution of the PM probes for each chip and no degradation. The expression values were
then calculated for each gene using a robust multi-array average (41, 42). This modeling
strategy converts the PM probe values into an expression value (log2-transformed) for each
gene. 4,057 Affy IDs differentially expressed were converted to Human Entrez gene ID
(ConceptGen only uses each gene once) yielding 2392 genes and analyzed for gene function
concept (conceptgen.ncibi.org) based on multiple database including GO and MeSH database.
The probe sets with a fold change of 2 or greater were selected (the probe sets were subjected
to the additional constraint that one of the two samples had an enrichment value of 26 or greater
to prevent the selection of genes with large fold changes based on two small numbers. The
gene set that is involved in specific function concept was analyzed for enrichment by GSEA
(http://www.broadinstitute.org/gsea/index.jsp), and the top enriched genes were further
analyzed for function network by GeneMANIA (http://www.genemania.org/). The microarray
data were deposited in the Gene Expression Omnibus (GEO) database (GSE57543).
Cell-cycle measurement by DNA content Analysis of nuclear DNA content of T cells isolated
from WT or miR-142 deficiency mice treated with or without CD3-CD28 antibodies (0.1ng/ml) for
up to 4 days as indicated or infected with lentiviral particles for overexpression or targeted
silencing of atypical E2Fs. T cells was processed using CycleTEST PLUS DNA reagent kit (BD
Biosciences), following the vendor’s recommendations. After gating on live cells, single cells
were gated using width and area parameters from Propidium iodide. The area parameter
histogram was used to determine the percentage of cells in G1, S, G2/M and >4C phases.
CRISPR interference system, sgRNA design, cloning, lentiviral package and T cells
infection: The CRISPRi system, derived from the Streptococcus pyogenes CRISPR (clustered
regularly interspaced palindromic repeats) pathway, requiring only the coexpression of a
catalytically inactive Cas9 protein and a single guide RNA (sgRNA), was chosen to knockdown
E2F7 and E2F8 (31, 32). pHR-SFFV-dCas9-BFP-KRAB (Addgene, 46911) was utilized to
express dCas9, which lacks endonucleolytic activity because of carrying 2 point mutations in
both its RuvC-like (D10A) and HNH nuclease (H840A) domains, but it can efficiently silence a
target gene with up to 99.9% repression in Escherichia coli when coexpressed with an sgRNA
designed with a 20-bp complementary region to any gene of interest (43). For sgRNA design,
first we selected exon 2 or exon1 in E2F7 or E2F8 genome loci which contain the PAM sites for
dCas9 binding as the targets (see details below), then designed oligos to obtain chimeric
sgRNA which contain the sequences encoding dCas9 handle and transcription terminator
derived from S. pyogenes.
To avoid off-target effects, we searched the genome for the 14-nt specificity region consisting of
the 12-nt ‘seed’ region of the sgRNA and 2 of the 3-nt (NGG) PAM in the genome, in order to
rule out additional potential binding sites. To achieve the crucial interaction between dCas9 and
the dCas9 handle hairpin for target binding, the prediction of secondary structure folding of the
dCas9 handle hairpin has been processed for each sgRNA construct using online Quikfold
algorithm (http://mfold.rna.albany.edu/?q=DINAMelt/Quickfold).
Expression plasmids were cloned by inserting PCR products into the lentiviral U6-based
expression vector (Addgene, 44248) digested by BstXI and XhoI. To obtain multiplexed
targeting sgRNA plasmids, we inserted compatible restriction enzyme sites (BglII and BamHI) to
flank individual sgRNA expression cassettes as BioBrick parts (44) to concatenate multiple
sgRNA expression cassettes into a single expression vector. The target sequences of the 73
sgRNAs are shown below: the PAMs are in bold and the target sequences are underlined. The
sgRNAs were designed by searching for 5’-CCN-N (19-24) C3’ in nontemplate DNA strand
between 5’UTR and exon1 or exon 2 of the coding sequence of E2F7 and E2F8. CCN is the
PAM for the S. pyogenes Cas9 recognition. The N (19-24) sequence was used as the base
pairing region of the sgRNA (underlined and italicized). The distance between adjacent sgRNAs
was kept at 130 to 180 bp. The correct cloning for the first sgRNA and cloning of multiple
sgRNA expression cassettes into the same U6 vector with BioBrick strategy were confirmed by
sequencing step by step.
E2F7 Exon2: aaaatatatttgtcgaccgatcaaggatgaccccaaagacaccgatgaagaacgagcc gatcgaCCTgtcaaagcaaagaatcttcaccccagacagaaaccccattactccagta aagccggtcgacaggcagccgcaggtggagccctggacacccacagccaacctgaag atgctcatcagcgccgccagcccagacataagagaccgggagaagaaaaaggagctg ttcagaCCCattgagaataaggaggatgcgttcgtgaactccctgcag
E2F8 Exon1: 5’-agtgcttgcgccgggcgggacgcgggctactgctggggactgtacctgggaccgggagcg cagcgtacggtgcgctttggcatcgcggtgatttcggcacctagggaatccttccctcgc CCCagtacttcgtgtattgaaagaagcctgaaaaagggggtcaagatcccaaagcccttt gtaaatgcccggtcgtgcgcttagagcgcagaggctgaattggagggttgttctcaggcc acttcacaagtccttccttctgagcctgtgcacgtgtgtgtcaggcgagaaacttcagca tctcccccgatgcaggctcggtgcgtgctCCAtcggaacccgggctcgtgcgctccgtcc gcagcccggatcagtgcacaggatagtaaa.
Please see Table 1 for the sgRNA sequence for the E2F7/8 and controls.
Concentrated Lentiviral particles carrying double guide RNAs targeting E2F7 and E2F8, Cas9
or negative control construct were prepared by Vector Core of Biomedical Research Core
Facilities in University of Michigan. miR-142 KO or WT T cells were purified by negative
selection and infected with lentiviral particles carrying double guide RNAs targeting E2F7 and
E2F8, or negative control along with Cas9 lentiviral particles for 3 days with complete medium
supplemented with Polybrene (Sigma-Aldrich) at a final concentration of 5 μg/ml. Infection
efficiency was controlled under microscopy by fluorescence for BFP or mCherry infused in
lentiviral constructs for dCas9 or sgRNA.
Lentiviral infection: For overexpression experiments, lentiviral transduction particles
containing inserts specific for E2F7 (NM_178609) or E2F8 (NM_001013368.5) or control vector
were obtained from Applied Biological Materials Inc. B6 WT splenocytes were cultured in
complete medium for 24 hours. The medium was then replaced with complete medium
supplemented with Polybrene (Sigma-Aldrich) at a final concentration of 5 μg/ml, and the cells
were infected with lentiviral particles carrying E2F7 or E2F8, or control vector for 3 days. T cells
were isolated by negative selection (Pan T cell Isolation Kit II; Miltenyi Biotec), and their RNA
was isolated. The transduction and expression efficiency was examined by SYBR Green qPCR
using specific primers for E2F7, E2F8, PCAF (negative control) and GAPDH (input control). The
purified T cells were processed for cell cycle analyses and cell proliferation experiments. For
CRISPR interference system for targeted silencing in WT or miR-142 KO T cells, cells were
infected with lentiviral particles, processed for examining silencing efficiency and cell cycle
analyses and cell proliferation experiments same as above.
PCR: miRNA and mRNA quantitative real-time PCR assays (qPCR) were performed as
previously described (9,11, 15). For the miR qPCR, miR-enriched RNA was isolated using the
miRNeasy Mini Kit (Qiagen) from bone marrow cells (WT, heterozygous and miR-142
deficiency mice), T cells (from spleens) and control cells (Raw264.7, NIH3T3 cells). Reverse
transcription was performed by incubating a mixture of 10 ng RNA, 0.15 μl of 100 mM dNTPs,
1.00 μl MultiScribe Reverse Transcriptase (50 U/μl), 1.50 μl 10X RT Buffer, 0.188 μl RNase
Inhibitor (20 U/μl), 4.192 μl nuclease-free water, and 3 μl 5X specific RT primers for miR142-3p
and snoRNA135 (as an internal control; Applied Biosystems, Foster City, CA) at 16°C for 30
minutes, 42°C for 30 min and 85°C for 5 min. The qPCR was performed on an Eppendorf
realplex2 system (Eppendorf, Westbury, NY), which was set to the following program: 95°C for
10 min, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Each PCR
reaction mix contained 10 μl of TaqMan 2X Universal PCR Master Mix (no AmpErase UNG),
7.67 μl nuclease-free water, 1.33 μl RT product and 1 μl 20X specific PCR primers for miR142-
3p and snoRNA135 (Applied Biosystems, Foster City, CA). All of the samples were tested in
triplicate. snoRNA-135 was used to normalize the expression levels of the target miRs by
correcting the differences in the amount of RNA that was loaded into the qPCR reactions. The
threshold levels for each experiment were set during the exponential phase of the reaction. For
the mRNA qPCR, the total RNA was isolated from T cells purified from splenocytes of WT or
miR-142 deficiency mice treated with or without CD3-CD28 antibodies for 0, 6, 12, 24 and 48
hours, respectively, or infected with overexpression or targeted silencing of atypical E2Fs, using
RNeasy Mini Kit (Qiagen). Briefly, 2 μg of total RNA was reverse-transcribed into cDNA using
High capacity cDNA Reverse Transcription Kit (Applied Biosystems ) in the presence of random
hexamers. All of the reactions were performed in triplicate with SYBR Green Master Mix
(Applied Biosystems) and 25 ng of both the forward and reverse primers according to the
manufacturer’s recommended thermocycling conditions and were then subjected to melt curve
analysis. The threshold levels for each experiment were set during the exponential phase of the
reaction. The DNA in each sample was quantified by interpolation of its threshold cycle (Ct)
value from a standard curve of Ct values. The calculated quantity of the target gene for each
sample was divided by the average sample quantity of the housekeeping gene glyceraldehyde-
3-phosphate dehydrogenase (GAPDH) to obtain the relative gene expression. All of the
oligonucleotide primers were synthesized by Integrated DNA Technologies (Coralville, IA, USA).
The primers used were:
E2F1 forward 5'-agggtccctatggaagagga-3', reverse 5'-caggtccccaaagtcacagt-3';
E2F2 forward 5'-gatggagtcctggacctgaa-3', reverse 5'-gggagcaactctgaatgagc-3';
E2F3 forward 5'-gctgtaccctggacctcaaa-3', reverse 5'-gggtctgtgtgtttccgtct-3';
E2F4 forward 5'-caagcctgccttagctcaac-3', reverse 5'-atccagcagtgcagaggact-3';
E2F5 forward 5'- tgtggctacagcaaagcatc-3', reverse 5'-aggccctgagtgactcttca-3';
E2F6 forward 5'- ctgggggcattcttgactta-3', reverse 5'- gagttctgcctgcagcttct-3';
E2F7 forward 5'-gcgctgtggatgagtatgag-3', E2F7-2 reverse 5'-cgagactgacggcgacct-3'
E2F8 forward 5'- ttgcaagatgcagttggaag-3', reverse 5'-caggcactgcagatgacaat-3'.
PCAF Forward 5’-caaggccaatgaaacctgcaag-3’, reverse 5’-ggtagaaatagacttgtttggtg-3’
GAPDH forward 5’-ccacagtccatgccatcactgc-3’, reverse 5’-gcccaagatgcccttcagtggg-3’.
Mixed lymphocyte cultures (MLR), CFSE and Annexin v staining. For MLR, T cells were
isolated from spleen cells suspensions from WT or miR-142 deficiency B6 mice untreated or
treated for atypical E2Fs overexpression or targeted silencing by negative selection (Pan T cell
Isolation Kit II; Miltenyi Biotec). The splenocytes from BALB/c or WT B6 mice were processed
for T cell deletion after removal of red blood cells by negative selection via autoMACS using
anti-CD90.2 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and followed by
radiation (3000 cGY). Then T cells were cultured with radiated and T cell-deleted splenocytes
with ratio of 4:1 (T cells versus splenocytes, 3 x 105 : 7.5 x 104) for 48, 72 or 96 hours using 96-
well round-bottomed plates (Falcon Labware, Lincoln Park, NJ). Supernatants were collected
for measurements of cytokine concentrations by ELISA. Proliferation was determined by
incubation of cells with 3H-TdR (1 Ci/well [0.037 MBq]) for final 16 hours and proliferation was
determined on a 1205 Betaplate reader (Wallac, Turku, Finland). For CSFE tracing, purified T
cells were labeled with CFSE at final concentration of 5 µmol/L according to manufacturer’s
instruction (Molecular Probes). CFSE-labeled T cells were cultured similarly to above MLR for 4,
5 and 6 days, then collected cells were gated for APC-CD90.2 positive and CFSE dilution and
determined for apoptosis in divided cells by PE-Annexin V staining. For CD3-CD28 antibodies
activation, T cells isolated from WT or miR-142 deficiency untreated or treated same as above
were stimulated with CD3-CD28 antibodies (0.1ng/ml) for 48 or 72 hours. Supernatants were
collected for measurements of cytokine concentrations by ELISA. Proliferation was determined
by incubation of cells with 3H-TdR (1 Ci/well [0.037 MBq]) for final 6 hours and proliferation was
determined on a 1205 Betaplate reader (Wallac, Turku, Finland). CFSE-labeled T cells were
treated with CD3-CD28 antibodies for 2~6 days, and collected cells were gated for APC-
CD90.2 positive and CFSE dilution and determined for apoptosis in divided cells by PE-Annexin
V staining.
Immunoblot analyses: Cell lysates were prepared from WT and miR-142 KO T cells, and
CD3/28 T cells. A 50-μg quantity of each protein extract was boiled in sample buffer, separated
by SDS-PAGE, and transferred onto a PVDF membrane (GE Healthcare). The membrane was
incubated for 30 min with 5% nonfat dry milk and then incubated overnight at 4°C with the
following Abs: anti-E2F7 rabbit polyclonal Ab (1:1,000 in 5% nonfat milk; ab56022, Abcam),
anti-E2F8 rabbit polyclonal Ab (1:1,000 in 5% nonfat milk; ab109569, Abcam), anti-AxnA1 rabbit
polyclonal Ab (1:1, 000 in 5% nonfat milk; Cat. 3299 Cell Signaling) and anti-actin mouse mAb
(1:1,000; Abcam). After washing with TBS-T, the blot was incubated with an HRP secondary Ab.
The signals were visualized by enhanced chemiluminescence (Thermo Scientific).
ELISAs: Concentrations of TNF-α, IL-6, IL-2, IFN-γ and IL-17A were measured by ELISA with
specific anti-mouse mAbs for capture and detection, and the appropriate standards were
purchased from BD Biosciences — Pharmingen (IFN-γ and TNF-α) and R&D Systems (IL-6 and
IL-2). Assays were performed according to the manufacturer’s protocol and read at 450 nm by
using a microplate reader (Bio-Rad).
FACS and intracellular staining analysis: Single cell suspensions of spleens, thymuses and
bone marrows from tibia and fibula were prepared as previously described (38, 39, 40). Briefly,
to analyze cell surface phenotype, splenocytes, thymocytes, bone marrow cells from WT B6,
miR-142 deficiency mice, or transplanted animals were washed with FACS wash buffer (2%
bovine serum albumin [BSA] in phosphate-buffered saline [PBS]) and pre-incubated with the rat
anti-mouse FcR mAb 2.4G2 for 15 minutes at 4 ℃ to block nonspecific FcR binding of labeled
antibodies. resuspended in FACS wash buffer and stained with conjugated monoclonal
antibodies purchased from BD Biosciences (San Jose, CA): Fluorescein isothiocyanate (FITC) -
conjugated monoclonal antibodies (MoAbs) to CD4, CD8, CD90.2, CD3, c-Kit, IgM, CD44,
CD45.2, CD45.1, H2b, IL-7Rα and CD62L; phycoerythrin (PE)-conjugated MoAbs to CD45.1,
CD8, Lin, and allophycocyanin (APC)-conjugated MoAbs to CD90.2, CD3, CD4 were
purchased from eBioscience (SanDiego, CA). Next, cells were fixed with 1x BD FACSTM Lysing
Solution (BD Biosciences, San Jose, CA), and analyzed using a FACS Vantage SE (Becton
Dickinson, San Jose, CA). For intracellular staining (IL-17A, IFNγ and IL-2), cells were treated
with 1x cell stimulation cocktail (plus protein transport inhibitors 1:500, eBioscience, Cat. No. 00-
4975) for 6 hours, then stained for APC conjugated CD90.2. or CD3 antibodies. Next, the cells
were treated with fixation Buffer (Biolegend, Cat. No.420801) in the dark for 20 minutes at room
temperature, followed by 1X Permeabilization Wash Buffer (Biolegend Cat. No. 421002) for 20
minutes. Resuspend fixed/permeabilized cells in residual Permeabilization Wash Buffer were
incubated with predetermined optimum concentration of PE-conjugated antibody of interest
(against IFN-γ, IL-17A or IL-2) or an appropriate negative control for 20 minutes in the dark at
room temperature. Intracellular labeled cells were resuspended in 0.5 ml cell staining buffer and
analyzed with appropriate controls.
Statistical analyses: Data were analyzed using Prism GraphPad (Version 5 or 6). The relevant
statistics were clarified by biostatistician (T.B.). Briefly, comparisons between 2 groups were
calculated using t test, while comparisons between 2 groups at multiple time points were
calculated utilizing Holm-Sidak method. Log-rank (Mantel-Cox) test was utilized to analyze all
survival data. Mann-Whitney test was used for the statistical analysis of clinical scores (38, 39,
45, 46, 47). All of the gene expression and relative quantification data were analyzed on the log
(base 2) scale. The comparisons of the gene expression values across the sample classes were
performed using the paired two-sample Student’s t-test. Affymetrix microarray data were further
analyzed for function concept by GO, MeSH databases and gene sets for specific gene
concepts were ranked by P-Value or/and Q-Value. Gene enrichment was analyzed with GSEA
and genes in function network were determined by GeneMANIA database. P value less than
0.05 was considered statistically significant.
Study approval. All animals were cared for under regulations reviewed and approved by the
University Committee on Use and Care of Animals of the University of Michigan, based on
University Laboratory Animal Medicine guidelines.
Supplementary Figure legends
Supplementary Figure 1 Validation of null expression of miR-142 in miR-142-/- mice. A. The
loss of miR-142 expression at RNA level in BM cells isolated from tibia and fibula was confirmed
by qTaqMan PCR using specific probes against miR-142-3p, using Raw264.7 cells as positive
control, NIH3T3 cells as negative control and snoRNA-135 as loading control. Data are
representative of three similar experiments. B. The loss of miR-142 expression at RNA level in
purified T cells isolated either from WT or miR-142 KO mice was confirmed by qTaqMan PCR
using specific probes against miR-142-3p using snoRNA-135 as loading control. Data are
representative of three independent experiments. The calculated summary data were shown in
Figure 1 D.
Supplementary Figure 2. Confirmation of previously reported targets of miR-142-3p in miR-
142 KO mice. A. Validation of greater production of IL-6 in DCs isolated from miR-142 KO mice
upon stimulation of LPS. Splenic DCs were isolated from WT or miR-142 KO mice as described
in Methods and Materials. DCs were treated with or without LPS (500ng/ml) for 6 h, the
supernatants were collected for measurements of IL-6 protein by Elisa. Data were combined
from two independent experiments (mean± SEM). B. Null expression of miR-142 did not
change TNFα expression in DCs isolated from miR-142 KO mice upon stimulation of LPS. The
same supernatants as in A were detected for TNFα protein level. Data were combined from two
independent experiments (mean± SEM). C and D. Significantly higher expression of IL-6 and
AC9 (adenylyl cyclase 9) in miR-142 KO T cells. Data were extracted from Affymetrix
expression values (Log2) from 3 biological triplicates in T cells either from WT or miR142 KO
mice (mean± SEM). P values were obtained using unpaired t test.
Supplementary Figure 3. miR-142 KO mice showed no apparent developmental anomalies. A.
Flow cytometric analyses of BM cells isolated from tibia and fibula showed the similar numbers
of Lin-Scal+ c-Kit+ HSCs in miR-142-/- mice compared with WT littermates. Data were
summarized from three independent experiments (mean± SEM). B. Thymic analyses
demonstrated no significant differences in DP (double positive), DN (double negative), single
positive CD4 and CD8 T cells, and total thymocytes between WT and KO animals. Data were
summarized from three independent experiments (mean± SEM). C. Spleens demonstrated
similar numbers of total T cells (CD3+) and naïve T cells (CD44lowCD62L+), effector
(CD4+CD44highCD62L-, or CD8+CD44highCD62L-) and central memory T cells
(CD4+CD44highCD62L+, CD8+CD44highCD62L+) between the WT and KO animals. Data were
summarized from three independent experiments (mean± SEM). P values were obtained using
unpaired t test.
Supplementary Figure 4. miR-142 deficiency in T cells induced S and G2/M arrests. A. Plot
looks at the cell cycle data, and uses placed markers to estimate percentages. Cell cycle was
measured by analyses of nuclear DNA content of T cells isolated from WT or miR-142 KO mice.
After gating on live cells, single cells were gated using width and area parameters from
Propidium iodide staining. The area parameter histogram was used to determine the percentage
of cells in subG1, G1, S, G2/M and >4C phases. B. miR-142 deficiency in T cells induced S
and G2/M arrests on days 0, 1, 2, 3 and 4 and reduction in apoptosis on day 4 upon untreated
or CD3-CD28 Abs stimulation compared to WT T cells. Data are representative of three
independent experiments. C. Loss of miR-142 in T cells induced significant arrests in S and
G2/M phases. T cells were purified from WT or miR-142 KO mice and treated with CD3-CD28
Abs as in B. Flow cytometric analyses of DNA content of propidium iodide (PI)-stained cells
were measured as area parameter histogram to determine the percentage of cells in subG1,
G1, S, G2/M and >4C phases. P values were obtained using multiple t test. Combined results
were from three independent similar experiments (mean± SEM).
Supplementary Figure 5.Visual image for ranking enrichment scores along with heat map from
GSEA (http://www.broadinstitute.org/gsea/) shows the upregulated gene set in miR-142 KO T
cells that is involved in cell cycle function concept. The most predominant genes in miR-142 KO
T cells that significantly involved in cell cycle regulation were identified. Data were obtained from
three biological triplicates for each group. The significant ranking of top relevant genes sorted by
ES was listed in Supplementary table 2.
Supplementary Figure 6. Gene Set Network Prediction for top 35 genes by GeneMANIA
(http://genemania.org/). 35 genes which received ES value higher than 0.5 (from GSEA) among
upregulated genes which are involved in cell cycle function in miR-142 KO T cells were further
analyzed by GeneMANIA. Functional networks predicted by GeneMANIA were ranked by false
discovery rate (FDR) values. DNA replication network is ranked at top 1. Data were obtained
from three biological triplicates for each group.
Supplementary Figure 7. Top 7 upregulated genes which involved in cell cycle function in miR-
142 KO T cells were identified by Affymetrix expression microarray as shown by perfect match
probes. Data are collected expression values (Log2) from biological triplicates in T cells either
from WT or miR-142 KO mice (mean± SEM). P values were obtained using unpaired t test.
**P<0.01. The complete expression values were list in Supplementary table 1.
Supplementary Figure 8. Atypical E2Fs were significantly upregulated in miR-142 KO T cells
compared to WT T cells. A. Confirming the upregulated E2F7 and E2F8 in miR-142 KO T cells
using qPCR. Results shown were three independent experiments (mean± SEM), and
summarized and analyzed shown in Figure 6 A. B. Confirming the upregulated Anxa1 in miR-
142 KO T cells using western blot. AnxA1 was upregulated in miR-142 KO T cells, particularly
higher in CD4 T cells. Data are representative of three independent experiments.
Supplementary Figure 9. Kinetic expression5 of typical E2F family members in T cell cycling
when activated with CD3 and CD28 Abs. Similar dynamic expressions of E2F1, 2, 3, 4, 5 and 6
between miR-142 KO T cells and WT T cells upon stimulation with CD3-CD28 Abs from 0 to 48
h. Combined results were from three independent experiments (mean± SEM). P values were
obtained using multiple t test.
Supplementary Figure 10. . Overexpression of atypical E2F induced significantly increased
arrests in S and G2/M phases but less apoptosis. WT T cells infected with lentiviral particles
expressing E2F7 and E2F8 or scramble control for three days were processed for cell cycle
analyses as in Supplementary Figure 4. A. The transfection efficiency was examined by SYBR
Green qPCR using specific primers for E2F7, E2F8, PCAF and GAPDH. Data were combined
from three independent experiments (mean± SEM). P value was obtained using unpaired t test.
B. Overexpression of E2F7 and 8 in WT T cells significantly induced S and G2/M phase arrests,
but less apoptosis (SubG1 phase) in T cells untreated or treated with CD3-CD28 Abs. Data are
representative of three independent experiments. C. T cell phenotypes after infection with
lentiviral particles. After WT T cells were infected with lentiviral particles expressing E2F7 and
E2F8 or scramble control for three days, T cells were stained with Abs CD4-APC, CD8-PE or
APC, CD44-PE, CD62L-PE, CD25-PE, CD-PD1-PE, CTLA4-PE. For FACS analyses, CD4-APC
versus CD8-PE was used for CD4 and CD8 T cells proportion. Then CD4-APC or CD8-APC
was gated for analyzing T cell subpopulations or exhaustion. Data were from 3 sets of results
(mean± SEM).
Supplementary Figure 11. Improvement of proliferation and reduction of cell cycle arrests in S
and G2/M phases in miR-142 KO T cells after targeted silencing of E2F7 and E2F8 by CRISPRi
system. miR-142 KO T cells infected with lentiviral particles carrying double guide RNAs
targeting E2F7 and E2F8 along or control lentiviral particles along with dCas9 lentiviral particles
for 3 days were processed for cell cycle analyses as in Supplementary Figure 4. A. The
knockdown efficiency was examined by SYBR Green qPCR using specific primers for E2F7,
E2F8, PCAF and GAPDH. Data were combined from three independent experiments (mean±
SEM). P values were obtained using unpaired t test. B. T cell phenotypes after infection with
lentiviral particles. After miR-142 T cells were infected with lentiviral particles expressing
CRISPRi-E2F7- E2F8 or scramble control along with dCAS9 particles for three days, T cells
were stained with Abs CD4-APC, CD8-PE or APC, CD44-PE, CD62L-PE, CD25-PE, CD-PD1-
PE, CTLA4-PE. For FACS analyses, CD4-APC versus CD8-PE was used for CD4 and CD8 T
cells proportion. Then CD4-APC or CD8-APC was gated for analyzing T cell subpopulations or
exhaustion. Data were from 3 sets of results (mean± SEM). C. After treated with CD3-CD28 Abs
for 0-3 days, T cells were processed for cell cycle analysis. Knockdown of E2F7 and E2F8
significantly induced less arrest in S and G2/M phases but more apoptosis (subG1 phase). Data
were representative of three independent experiments. The summarized data were shown in
Figure 7 C.
Supplementary Figure 12. T cell phenotypes after infection with lentiviral particles. After WT T
cells were infected with lentiviral particles expressing CRIPSi-E2F7- E2F8 or scramble control
along with dCAS9 paticles for 3 days, T cells were stained with Abs CD4-APC, CD8-PE or APC,
CD44-PE, CD62L-PE, CD25-PE, CD-PD1-PE, CTLA4-PE. For FACS analyses, CD4-APC
versus CD8-PE was used for CD4 and CD8 T cells proportion. Then CD4-APC or CD8-APC
was gated for analyzing T cell subpopulations or exhaustion. Data were from 3 sets of results
(mean± SEM).
Supplementary Table 1 (Excel file). Analysis data of Affymetrix expression microarray from
biological triplicates of miR-142 KO and WT T cells. Upregulated genes in miR-142 KO T cells
identified by Affymetrix microarrays were analyzed using gene function concept
(conceptgen.ncibi.org)
Supplementary Table 2. (Excel file). Analysis data of genes involved in cell cycle functional
concept by GSEA ranked with Enrichment Scores. The upregulated gene set in miR-142 KO T
cells that is involved in cell cycle function concept was analyzed by GSEA. The most
predominant genes in miR-142 KO T cells that significantly involved in cell cycle regulation were
identified as listed by ES ranking.
miR-142-3p expression in BM using mature miR-142-3p TaqMan probes
Supplementary Figure 1
A
B
Fluo
resc
ence
Sig
nal
Fluo
resc
ence
Sig
nal
Fluo
resc
ence
Sig
nal
Fluo
resc
ence
Sig
nal
miR-142-3p expression in miR-142 KO T cells using mature miR-142-3p TaqMan probes
W T - D C W T - D C K O - D C K O - D C0
5 0
1 0 0
1 5 0
2 0 0P<0.01
W T - D C W T - D C K O - D C K O - D C0
5 0
1 0 0
1 5 0
LPS - + - + (500 ng/ml)
LPS - + - + (500ng/ml)
IL-6
(pg/
ml)
TN
Fα p
g/m
l IL-6
Exp
ress
ion
val
ue
(Log
2, A
ffy
)
Supplementary Figure 2
A
B
C
D AC9
NS
P<0.05
W T T c e lls 1 4 2 K O T c e lls0
2
4
6
8
1 0 P<0.01
Exp
ress
ion
val
ue
(log2
, Aff
y)
W T T c e l l s 1 4 2 K O c e l l s0
2
4
6
8
Supplementary Figure 3
BM Lin-S+K+ A B
W T 1 4 2 K O0
2 .0×1 0 6
4 .0×1 0 6
6 .0×1 0 6
W T 1 4 2 K O0
1 .0×1 0 6
2 .0×1 0 6
3 .0×1 0 6
4 .0×1 0 6
W T 1 4 2 K O0
2 .0×1 0 7
4 .0×1 0 7
6 .0×1 0 7
8 .0×1 0 7
W T 1 4 2 K O0
1 .0×1 0 6
2 .0×1 0 6
3 .0×1 0 6
4 .0×1 0 6
5 .0×1 0 6
W T 1 4 2 K O0
5 .0×1 0 5
1 .0×1 0 6
1 .5×1 0 6
2 .0×1 0 6
2 .5×1 0 6
W T m iR 1 4 2 K O0
2 .0×1 0 7
4 .0×1 0 7
6 .0×1 0 7
8 .0×1 0 7
1 .0×1 0 8
CD4-CD8- (DN)
CD4+ (SP)
CD4+CD8+ (DP)
CD8+ (SP)
Total Thymocytes
C
CD4+CD44highCD62L+
CD8+CD44highCD62L-
CD44lowCD62L+ Total T cells CD3+
W T 1 4 2 K O0
1 .0×1 0 7
2 .0×1 0 7
3 .0×1 0 7
W T 1 4 2 K O0
1 .0×1 0 7
2 .0×1 0 7
3 .0×1 0 7
4 .0×1 0 7
W T 1 4 2 K O0
1 .0×1 0 6
2 .0×1 0 6
3 .0×1 0 6
W T 1 4 2 K O0
1 .0×1 0 6
2 .0×1 0 6
3 .0×1 0 6
W T 1 4 2 K O0
1 .0×1 0 6
2 .0×1 0 6
3 .0×1 0 6
W T 1 4 2 K O0
2 .0×1 0 5
4 .0×1 0 5
6 .0×1 0 5
CD8+CD44highCD62L+
CD4+CD44highCD62L-
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Cel
l Num
ber
Supplementary Figure 4
Day 1 Day 2 Day 3 Day 4 Day 0
WT T cells
142KO T cells
>4C SubG1
G2/M S G1
A
B
SubG1 Phase
gate
d si
ngle
cel
ls (%
)
G1 Phase
0 1 2 3 40
5
1 0
1 5
2 0
W T
1 4 2 K O
D a y
S Phase
0 1 2 3 40
5
1 0
1 5
W T1 4 2 K O
D a y
G2/M Phase
0 1 2 3 40
1
2
3
4
W T1 4 2 K O
D a y
>4C
**
C
**
**
** **
** ** **
** ** ** **
** ** * ** **
** **
Supplementary Table 1 Affy analysis Excel file Upregulated genes in miR-142 KO T cells identified by Affymetrix microarrays were analyzed using gene function concept (conceptgen.ncibi.org)
Supplementary Table 2 GSEA excel file The upregulated gene set in miR-142 KO T cells that is involved in cell cycle function concept was analyzed by GSEA. The most predominant genes in miR-142 KO T cells that significantly involved in cell cycle regulation were identified as listed by ES ranking.
Supplementary Table 3: T cell precursors in bone marrow
Mouse Absolute Number of T cell precursor (L-S+K+ IL-7Ra+)
P value
WT 3.64 x 103 ± 4.2 x 103 NS miR-142 KO 6.11 x 104 ± 5.8 x 104
Bone marrow cells were isolated from 2 femurs and tibias from WT and miR-142 KO mice (n=4 for each group) aged at 12-16 weeks. Bone marrow cells were stained with antibodies against Lineage marker, Sca1, cKit and IL-7Ra. T cell precursors were identified as Lineage markers- Sca1+ cKit+ and IL-7Ra+. Absolute numbers of T cell precursors were calculated for each mouse as Mean ± SEM.
Supplementary Figure 5
D N A r ep lica t io
n
c e ll c y c le p
h a se tra n s it i
o n
G2 /M
tra n s it i
o n of m
itot ic
c e ll c y c le
p o s it iv e r e g u la
t ion o
f ce ll
d ivis io
n
c e ll c y c le c h e ck p o in
t
ma in
ten a n c e o
f lo c a t io
n in c e ll
r e g u lat io
n of D
N A r ep lica t io
n
o r g a n e lle a
s s emb ly
r e g u lat io
n of m
ic r o tub u le -b
a sed pr o c e s s
0 .0 0 0 0
0 .0 0 0 5
0 .0 0 1 0
0 .0 0 1 5
0 .0 0 2 0 F D R
Gene Set Network Prediction for Top 35 genes by GeneMANIA
Supplementary Figure 6
Func
tiona
l net
wor
k ra
nk
by fa
lse
disc
over
y ra
te v
alue
s
E2F8 E2F7 AnxA1 Evi5 Anln Ccne2
Expression values of Top 7 upregulated genes in miR-142 KO T cells (Affy. Expression values )
Supplementary Figure 7
Esco2
W T T c e l l s 1 4 2 K O T c e l l s0
5
1 0
1 5 **
W T T c e lls 1 4 2 K O T c e lls0
2
4
6
8
1 0**
W T T c e lls 1 4 2 K O T c e lls0
5
1 0
1 5 **
W T T c e lls 1 4 2 K O T c e lls0
5
1 0
1 5 **
Exp
ress
ion
Valu
es
(Aff
y. L
og2)
W T T c e lls 1 4 2 K O T c e lls0
5
1 0
1 5 **
W T T c e lls 1 4 2 K O T c e lls0
5
1 0
1 5 **
W T T c e lls 1 4 2 K O T c e lls0
5
1 0
1 5**
WT KO WT KO WT KO T cells CD8 CD4 1 6.8 1.3 9.4 1 3
B-actin AnxA1
Supplementary Figure 8
WT
1
WT
2
WT
3
1 4 2KO
1
1 4 2KO
2
1 4 2KO
30
5
1 0
1 5
2 0 E2F7
WT
1
WT
2
WT
3
1 4 2KO
1
1 4 2KO
2
1 4 2KO
305
1 01 52 02 5 E2F8
Rel
ativ
e E
xpre
ssio
n o
f mR
NA
A Q-PCR R
elat
ive
Exp
ress
ion
of m
RN
A
B Western Blot
0 h 6 h 1 2 h 2 4 h 4 8 h0
1
2
3
4
5
W T1 4 2 K O E2F1 E2F3
0 h 6 h 1 2 h 2 4 h 4 8 h0
1
2
3
4
5
W T1 4 2 K O E2F4
0 h 6 h 1 2 h 2 4 h 4 8 h0
5
1 0
1 5
W T1 4 2 K O E2F5
0 h 6 h 1 2 h 2 4 h 4 8 h0
5
1 0
1 5
2 0
W T1 4 2 K O
0 h 6 h 1 2 h 2 4 h 4 8 h0
2
4
6
8
W T1 4 2 K O
0 h 6 h 1 2 h 2 4 h 4 8 h0
5
1 0
1 5
W T1 4 2 K O E2F6
E2F2
Supplementary Figure 9
Kinetic Expression of E2F Family in Response to CD3-CD28 antibody Stimulation
Rel
ated
mR
NA
Exp
ress
ion
(F
old
chan
ges)
R
elat
ed m
RN
A E
xpre
ssio
n
(Fol
d ch
ange
s) *
*
**
*
** **
** *
*
* *
* ** **
Supplementary Figure 10
P C A F E 2 F 7 P C A F E 2 F 70
5
1 0
1 5
S c r a m b le E 2 F 7 O v e r e x p r e s s io nP C A F E 2 F 8 P C A F E 2 F 8
0
1
2
3
4
S c r a m b le E 2 F 8 O v e r e x p r e s s io n
A
Overexpression of E2F7 and E2F8
Day 0 Day 1 Day 2 Day 3 Day 4
E2F
7+E
2F8
Scra
mbl
e co
ntro
l
B
P<0.001 P<0.001
Rel
ated
mR
NA
Exp
ress
ion
(F
old
chan
ges)
C D 4+ C
D 4 4+
C D+ C D 6 2 L
+
C D 4+ C
D 2 5+
C D 4+ P
D 1+
C D 4+ C
T L A 4+
C D 8+ C D 4 4
+
C D 8+ C D 6 2 L
+
C D 8+ P D 1
+
C D 8+ C T L A 4
+0
5
1 0
4 0
5 0
6 0
7 5
9 0C o n tro lE 2 F 7 -8 o ve re xp re ss io n
C D 4 + C D 8 +0
2 0
4 0
6 0C o n tro l
E 2 F 7 -8 o v e re x p re s s io n
% %
C
Supplementary Figure 11 Targeted silencing of E2F7 and E2F8 by CRISPRi in miR-142 KO T cells
P C A F E 2 F 8 P C A F E 2 F 80 .0
0 .5
1 .0
1 .5
sg-Control sg-8AB
P<0.001
P C A F E 2 F 7 P C A F E 2 F 70 .0
0 .5
1 .0
1 .5 P<0.001
sg-Control sg-7AB
Day 0 Day 1 Day 2 Day 3
CR
ISPR
i C
TL
C
A R
elat
ed m
RN
A E
xpre
ssio
n
(Fol
d ch
ange
s)
B
C D 4+ C D 4 4
+
C D+ C D 6 2 L
+
C D 4+ C D 2 5
+
C D 4+ P D 1
+
C D 4+ C T L A 4
+
C D 8+ C D 4 4
+
C D 8+ C D 6 2 L
+
C D 8+ P D 1
+
C D 8+ C T L A 4
+0
1 0
2 0
4 0
5 06 0
8 0
1 0 0 C o n tro lE 2 F 7 -8 C R IS P i
C D 4 + C D 8 +0
2 0
4 0
6 0 C o n tro lE 2 F 7 -8 C R IS P i
% %
Supplementary Figure 12
CD
4+ C
D4 4
+
CD+ C
D6 2 L
+
CD
4+ C
D2 5
+
CD
4+ P D
1+
CD
4+ C
T L A4+
CD
8+ C
D4 4
+
CD
8+ C
D6 2 L
+
CD
8+ P D
1+
CD
8+ C
T L A4+
01 02 03 0
4 05 06 0
7 08 09 0
1 0 0C o n tro lE 2 F 7 -8 C R IS P i
C D 4 + C D 8 +0
2 0
4 0
6 0
8 0 C o n tro l
E 2 F 7 -8 C R IS P i
% %