Detection of enterotoxin genes ( ٍ ◌ِ◌ٍ◌sea-see) of Staphylococcus aureus isolated from raw milk by multiplex PCR and study of their pathogenicity A Thesis submitted to the council of the College of Veterinary Medicine- University of Basrah in Partial Fulfillment of Requirements for the Master Science Degree in Veterinary Medicine ( Microbiology) By Hasan Ikareim Idbeis B. V. M. S. 2008 Supervisor Supervisor Assistant professor Dr. Mohammed H. Khudor Assistant professor Dr. Basil A. Abbas 2010 A.D. 1431 A.H.
Transcript
Detection of enterotoxin genes ( ◌◌◌sea-see) of Staphylococcus aureus isolated from raw milk
by multiplex PCR and study of their pathogenicity
A Thesis submitted to the council of the College of Veterinary Medicine- University of Basrah in
Partial Fulfillment of Requirements for the Master Science Degree in Veterinary Medicine ( Microbiology)
By
Hasan Ikareim Idbeis B. V. M. S. 2008
Supervisor Supervisor Assistant professor
Dr. Mohammed H. Khudor
Assistant professor Dr. Basil A. Abbas
2010 A.D. 1431 A.H.
بسم اهللا الرحمن الرحیم
ب زدني علما ل ر ق و
صدق اهللا العلي العظیم
)١١٤اآلیة جزء من، سورة طه(
Dedication I would like to dedicate this thesis to the following people: My two favourite educators: my father who passed away , my God bless him. and to my mother for their support and encouragement during all my life that made the person that I am. You are the best parents ever. My brothers and sisters : I appreciate their support throughout my academic life. My fiance , whose love, support, understanding and patience, became an essential part of my life. Finally, this thesis is dedicated to all those who believe in the richness of learning. Hasan 2010
ACKNOWLEDGEMENT
It's from absolute oneness of God from no God but Allah alone. I thank God
for His support and influence in my life and work. Not only did He provided the
project of my interest, He encouraged me through the assistance of the expertise
of many knowledgeable and caring people.
I am deeply and extremely grateful to assistant professor Dr. Basil A. Abbas,
the Dean of the college of Veterinary Medicine and assistant professor Dr.
Mohammed H. Khudor, Head of the Department of Microbiology for their
supervision and for providing me with the opportunity to achieve this thesis.
I would like to thank assistant professor Dr. Rahman K. for his assistance in
statistical analysis.
I would like also to thank professor Dr. Fawzia A. Abdullah and assistant
professor Dr. Adnan M., My thanks are also to the Department of Microbiology
staff and all the instructors in the college of veterinary medicine.
My thanks also go to assistant professor Dr. Adnan Al-Badran who give
different advices to help me complete this research.
Finally, I am indebted to my family for their understanding, support, and love
which allowed me to finish my study successfully.
Hasan
2010
Certification
We certify that this thesis was prepared under our supervision at the
Department of Microbiology / College of Veterinary Medicine / University of
Basrah, as a partial requirement for the Master Science degree in Veterinary
Medicine (Microbiology).
Signature Signature Assistant professor Assistant professor
Dr. Basil A. Abbas Dr. Mohammed H. Khudor
The recommendation of the Head of the Department
In view of the available recommendation, I forward this thesis for debate
by the examining committee.
Signature Assistant professor
Dr. Mohammed H. Khudor Head of Department of Microbiology
College of Veterinary Medicine University of Basrah, Iraq.
Certification of Examining Committee
We, the members of examining committee, certify after reading this thesis ((Molecular detection of enterotoxin genes ( ◌◌◌SAA-SAE) by multiplex PCR in Staphylococcus aureus isolated from raw milk samples and the study of the enterotoxingenic activity on rabbits intestine )) and after examining the student in it's content, we found it is adequate for the award the Master Science degree in Veterinary Medicine in Microbiology. With excellent degree.
Signature professor
Chairman
Signature Signature Assistant professor Lecturer Esraa Abdul Wadood Ali College of Veterinary Medicine College of Veterinary Medicine University of Basrah University of Basrah Member Member Signature Signature Assistant professor Assistant Professor Dr. Basil A. Abbas Dr. Mohammed H. Khudor College of Veterinary Medicine College of Veterinary Medicine
University of Basrah University of Basrah Member and Supervisor Member and Supervisor Approval for the College Committee on graduate, studies.
Signature
Assistant professor Dr. Basil A. Abbas
Dean College of Veterinary Medicine
University of Basrah, Iraq.
Date of examination: 12 – 12– 2010.
List of abbreviate
Abbreviate Key
µg Microgram (s) µL Microliter (s) µm Micrometer Bap biofilm-associated proteins BHI Brain heart infusion broth Bp Base pair
Cna collagen adhesion ClfA a fibrinogen-binding protein that activates platelets aggregation DI dilatation index
ECHCPD EuropeanCommission Health and Consumer Protection Directorate .
MSSA Methicillin sensitive Staphylococcus aureus NA Nutrient agar Ng Nano gram
ONPG 4-Nitrophenl-B-D-galactopyranoside
ORSA Oxacillin resistance Staphylococcus aureus PBP penicillin binding protein PCR Polymerase Chain Reaction Pls plasmin-sensitive cell wall protein
PMN poly morph nuclear cell
ClfA fibrinogen-binding protein that activates platelets aggregation
PVL Panton-Valentine leukocidin R Resistance
RIA Radio Immuno Assay RPLA reversed passive latex agglutination
Scc mec Staphylococcal cassette chromosom mec SSSS Staphylococcus scaled skin syndrome SEs Staphylococcal enterotoxins TBE Tris-boric-EDTA-buffer TSS1 Toxic shock syndrome toxin one USA United states of Americans UV Ultraviolet
VFs Virulence factor
VISA Vancomycin intermediate-resistant Staphylococcus aureus
2.5.1. Surface antigens 9 2.5.2. Extracellular proteins 11 2.5.3. Other exoproteins – not superantigens
15
2.5.4. Role of pigment in virulence 17 2.6. Disease caused by S.aureus 18 2.7. Identification 19 2.8. Biotyping of S.aureus. 20 2.9.
Methods for detection of S. aureus enterotoxin 21 2.9.1. Bioassays 21 2.9.2. Immunoassays 22 2.9.3. Molecular biology
23
2.10 Susceptibility and mechanisms of antibiotic resistance 25 2.10.1. Methicillin resistance 26 2.10.2. Vancomycin resistance 27
Chapter Three
28-45 3.1 Materials 28
3.1.1. Instruments and equipments 28 3.1.2. Chemical and biological materials 29 3.1.3. Media 30
3.1.3.1. Commercial media 30 3.1.3.2. Prepared media 31 3.1.4. Stains and indicators 31 3.1.5. Kits. 32 3.2. Methods 32
3.2.1. Commercial media 32 3.2.2. Laboratory prepared media 32 3.2.3. Preparation of buffers , solutions and stains 33 3.2.4. Samples collection 35 3.2.5. Laboratory diagnosis 35
3.2.5.1. Biochemical testes 36 3.2.5.2. Serological test 37 3.2.6. Biotyping 37 3.2.7. Susceptibility to the vancomycin and methecillien 38 3.2.8. Molecular detection of SEA to SEE genes (using multiplex
PCR technique). 41
3.2.8.1. DNA extraction and purification 41 3.2.8.2. PCR amplification of SEA to SEE gene sequences for S. aureus
3.2.9.1. Culture of S. aureus for enterotoxin Production 44 3.2.9.3. Assay for enterotoxin activity 45 3.2.9.4. Post-mortem examination 45 3.2.9.5. Histopathology 45 3.2.10 Statistical analysis 45
Chapter four
46-58
4 Results 46 4.1. Occurrence of S.aureus isolates according to region of the
study 46
4.2. Biotypes of S. aureus 47 4.3. Molecular basis of S.aureus enterotoxigenicity detected by
multiplex PCR 49
4.4. Susceptibility of S.aureus to the methicillin and vancomycin 52 4.5. Relationships between S.aureus biotypes and SEs 53 4.6. Relationships between MRSA and SEs 54 4.7. Assay for enterotoxin activity 55 Chapter five
59-69
5 Discussion 59 5.1. Occurrence of S.aureus in raw milk 59 5.2. Biotypes 61 5.3. Molecular detection of enterotoxigenic ability of
staphylococcus aureus 62
5.4. Susceptibility to the methicillin and vancomycin and mechanism of antibiotic resistance 65
5.5. Relationships between SEs and MRSA 66 5.6. Relationships between S.aureus biotypes and SEs.
67
5.7. Assay for enterotoxin activity 68 Conclusions and recommendations 70-71 References 71-96
List of figures
Figure
No.
Title of figure
Page
2.1 Summary of virulence factors of S. aureus. 9
2.2 Superantigens and the non-specific stimulation of T cells 11
4.1 Biotype A and biotype C on the crystal violate agar 48
4.2 Pigment production on the milk agar 48
4.3 Total genomic DNA extraction of isolates using 1% agarose gel
electrophoresis 51
4.4
Electrophoresis in 2% agarose. M Lance= DNA ladder .Lance
4.5 Susceptiplity of S.aureus to methicillin and vancomycin 53
4.6
Ligated segments of rabbit ileal loop after injection with crude
preparations of staphylococcal enterotoxin (SE) produced under
different growth conditions.
56
4.7 Section of control rabbit ileum 125X 56
4.8 Section of rabbit ileum inoculated with crude staphylococcal
enterotoxin ph 4. 125X 57
4.9 Section of rabbit ileum inoculated with crude staphylococcal
enterotoxin ph 8 . 125 X 57
4.10 Section of rabbit ileum inoculated with crude staphylococcal
enterotoxin ph 8. 500 X 58
Table No. Title of table Page
3.1 The instrument and Equipments which were used throughout the study 28
3.2 Chemical and biological materials which were used throughout the study
29
3.3 All the commercial media which were used throughout the study 30
3.4 The prepared media which were used throughout the study 31
3.5 Stains and indicators used throughout the study 31
3.6 The Kits were used throughout the study 32
3.7 All the tests used in the detection of S. aureus biotypes
37
3.8 Interpretation of inhibition zone diameter that used in the antibiotic
susceptibility test. 39
3.9 Oligonucleotide primers sequences used for PCR amplification of SEs genes 41
3.10 PCR amplification program for SEs genes detection
42
4.1 The occurrence of the S.aureus in milk samples
46
4.2 Number and percentage of S.aureus biotypes isolated from milk samples 47
4.3 Number and percentage of S.aureus biotypes associated
with haemolysis patterns 49
4.4 Number, percentage and type of SEs in cow and buffalo milk
sample . 50
4.5 Distribution of SEs of S.aureus isolate in different region.
52
4.6 Susceptibility of S.aureus to the methicillin and vancomycin in milk
samples 52
4.7 Relationships between S.aureus biotypes andSEs
53
4.8 Relationships between MRSA and SEC in S.aureus strain.
54
Summary In this study, a total of 200 samples of raw milk (100 cow milk and 100 buffalo milk) were collected from different markets in Basrha City during tow month (October and November / 2009) and were analyzed for the presence of Staphylococcus aureus. The obtained results indicate that this bacterium observed in 28.5% from these samples (30% from cow milk and 27% from buffalo milk) and the high rate of S.aureus was observed in Al-hartha 34% followed by Al-hadi and Al-ashar 28% for each one then Old Basrah market 24%. All the S.aureus isolates were examined to biotypes, detection of Staphylococcal enterotoxin genes (A – E) by using multiplex PCR and susceptibility of this bacterium to methicillin and vancomycin. Depending on the biotyping, the results revealed that 61.4% (37/57)from the S.aureus isolates belong to the biotype C (bovine origin) and 26.31% (15/57) belong to the biotype A (human origin) while the remaining 12% (6/57)cannot be classified and placed in the group of the non- specific biotype. Staphylococcal enterotoxin C gene (SEC) was detected in 24.56% (14/57) of the S. aureus isolates investigated ( Nine of the enterotoxigenic strains were from cow milk and five from buffalo milk) and none of the S. aureus isolates tested harbouring SEA, SEB,SED and SEE genes. The relationship between the biotypes with SEs can be explained as follows, 33.33% from biotype C posses SEC gene while less percentage (13.33%) from biotype A posses this gene . By using disc diffusion method, all tested isolates showed high susceptibility ( 100 % ) toward vancomycin and 10.52% from these isolates revealed the resistance toward methicillin. Furthermore, the relation between the SEC gene with susceptibility to the methicillin showed that a higher percentage (83.33 %) of the isolates which have the ability to resist the
methicillin harboring SEC while the isolates that are susceptible to the methicillin posses lower percentage of this gene. Three isolates were PCR positive (harbouring SEC gene) of S. aureus isolated from contaminated milk were evaluated for their enterotoxin-producing ability and histopathological changes by the ligated rabbit ileal loop assay. The crud toxin preparation of this strain caused fluid accumulation in rabbit ileal loops. Fluid aspirated from the loops was bloody and histopathological changes in sections collected from rabbit ileum, inoculated with crude enterotoxin, were characterized by moderate to severe haemorrhage, erosion and inflammatory cells, oedema, in addition, there was destruction and sloughing of villi.
CHAPTER 1
INTRODUCTION
Introduction
Staphylococcus aureus is an important pathogen due to the combination of toxin-mediated virulence, invasiveness and antibiotic resistance (Lee Loir et al., 2003). This
bacterium causes nosocomial infection ,as well as community acquired disease, the spectrum of S.aureus infection ranges from pimple and furuncles to toxic shock
syndrome and sepsis (Kayser, 2005) S.aureus also are important mastitis pathogens in animals(Rodrigues da Silva et al.,2005) .Most of which depend on numerous
virulence factors, on the other hand, some infection such as Staphylococcal food poisoning ,rely on one single type of virulence (Staphylococcal enterotoxins) factors
(Lee Loir et al., 2003). The ability of S. aureus strains to produce one or more Staphylococcal
enterotoxins (SEs) in food products is linked to staphylococcal food poisoning (Bennett, 2005). Staphylococcal food poisoning was a major concern in Public health
programs worldwide (Lee Loir et al., 2003). According to public health and food safety experts, each year millions of illnesses throughout the world can be traced to
food-borne pathogens (Oliver et al., 2005) and S. aureus considered one of the major causes of gastroenteritis resulting from consumption of contaminated food
products (Lee Loir et al., 2003 ; Bhunia ,2008). Milk is one of the widely consumed nutrient foods and also it is an excellent
culture medium for the growth and reproduction of microorganisms (Prakash et al., 2007 ; Mohamed and El Zubeir, 2007 ).
Methods for detection of S.aureus in food varies from conventional bacteriological methods , selective media and Serological identification to the use of PCR
(Bhunia,2008). The phenotypical characterization of S. aureus biotypes establishes the
presumptive origin of isolates. Biotype has been stated that biotypes S. aureus strains may give an indication of the origin contamination in food products as the biotype correlates well with the animal host (Lamperll et al., 2004; Ordonez et al., 2005).
Various methods have been developed for detecting enterotoxin production but the PCR technique offers the possibility of detecting specific gene sequences by DNA
amplification ,therefore its combines all the favoured advantages and provide the ideal solution for SEs detection from various S.aureus isolates(Sharma et al.,2000).
Generally, diarrheagenic microorganisms including S.aureus are tested by ligated-ileal loop assay with rabbits or rats. This assay provides the ideal solution for
investigating certain bacterium host interactions. (Douglas et al.,1995 ; Bidinost et al., 2004; Augusta et al., 2007; Bhunia, 2008).
Over the past 50 years, staphylococci (especially S. aureus) have become resistant to various antimicrobial agents including the commonly used penicillin-related
antibiotics. methicillin-resistant S. aureus (MRSA) is a bacterium resistant to certain antibiotics such as oxacillin, methicillin and other beta lactams (Lee, 2003; Nimmo
and coombs, 2008). MRSA strains have become a major concern for hospital epidemics in many countries (Nimmo and coombs, 2008 ). On the other hand, reports
of MRSA in animals have been infrequent so far. However, people working with livestock are at a potential risk of becoming MRSA carriers and hence are at an
increased risk of infections caused by MRSA (Huber et al., 2010). Aims of the Study.
1-To investigate the occurrence of S.aureus in raw milk samples and
characterization of isolates including:-
a-Occurrence of MRSA and VRSA.
b-Biotyping of isolates.
2- Investigate the presence of sea, seb, sec, sed and see genes in S. aureus
isolates by using multiplex PCR technique.
3- Investigate the relationship between the toxigenic strains and resistance to
methicillin.
4- study the activity of SEs by the ligated rabbit ileal loop assay and explain
the histopathological changes caused by this enterotoxin in the rabbit intestines.
CHAPTER 2
REVIEW OF LITERATURE
2.1. History and General Characteristics In 1880, Sir Alexander Ogston, a Scottish surgeon and Louis Pasteur, a French scientist confirmed that cocci-forming organisms are capable of causing disease (Bhunia, 2008). In 1883 Ogston introduced the name Staphylococcus (staphyle= bunch of grapes), One year later, Rosenbach used the term in a taxonomic sense and provided the first description of the genus Staphylococcus (Sharon, 2006) . In1914, Barber discovered that a toxin substance produced by staphylococci was responsible for staphylococcal food poisoning (Bhunia, 2008).
Staphylococci are Gram-positiv, 0.5 to 1.5 μm in diameter, which occur singly and in pairs, tetrads, and form grape-like clusters, aerobic and facultative anaerobic, catalase-positive, oxidase-negative, non-motile, non-sporeforming and fermentative. Colonies appear smooth, raised, glistening, circular, entire. Single colonies can attain a size of 4-6 mm in diameter on non-selective media. Colony colour is variable, from grey or grey-white to orange (Quinn et al.,2004 ; Sharon, 2006).
The genus Staphylococcus includes over 30 species and subspecies ,the most important species from the viewpoint of human and veterinary medicine is S. aureus which of among the most frequent causal organisms in human and animals bacterial infections ( Biberstein and Hirsh., 1999; Kayser, 2005).
2.2.Classification In the Bergy’s manual of determinative bacteriology, Staphylococcus has been placed in the family of Micrococcaceae. DNA-ribosomal RNA hybridization and comparative oligonucleotide analysis of 16S rRNA has demonstrated that staphylococci form a coherent group at the genus level. (Bhunia, 2008). Staphylococci are differentiated from other close members of the family with its low G + C content of DNA ranging from 30 to 40 mol%. The genus Staphylococcus has been further classified into more than 30 species and subspecies by biochemical analysis and by DNA–DNA hybridization. Staphylococcus aureus is the primary species in the genus Staphylococcus and is responsible for food poisoning (Bhunia, 2008). 2.3.Natural habitats and other sources Staphylococci are widespread in nature; their major habitats include the skin and mucous membranes, especially of the upper respiratory tract and digestive tract of humans and other animals. The organisms have been isolated sporadically from soil, air, water, sewage, plant surfaces and products, feeds, dairy products, and kitchen worktops for food preparation. The incidence in
human carriers ranges from 4% to 60% ( Biberstein and Hirsh., 1999; Uemura et al., 2004).
2.4.1.Role of Staphylococci in Public Health
In recent years, Staphylococcus aureus has emerged as one of the most important human pathogens in community and hospital settings Staphylococci, particularly S. aureus are the most important bacterial organisms causing nosocomial infections in humans worldwide ( Kloos and Bannerman, 1995 ; Crum et al., 2006 ; Laupland et al., 2008).
Nettleman et al., (1991) reported that 50% of methicillin resistance Stahpylococcus aureus (MRSA) strains isolated from Iowa city medical center (USA) originated from the community. Asymptomatic carriers play an important role in the maintenance and spread of these microorganisms, especially when the carriers have professional activities related to public health (Soares et al., 1997).
S. aureus can cause many different infections, ranging from those that are relatively mild and superficial to those that are life threatening or fatal. The particular strain of S. aureus causing the infection may be derived from a patient’s own flora, or may be community or hospital acquired (Crum et al., 2006 ; Laupland et al., 2008). In the animal population, S.aureus strains have been studied extensively and identified in many production animals such as swine and cattle, and also in companion animals ( Ferguson et al., 2007; Huijsdens et al., 2007 ; McKay, 2008).
Staphylococcus species are one of the major mastitis-causing pathogens in dairy production resulting in low milk yield and large economic losses (Anderson et al., 2006; Ferguson et al., 2007 ; Park et al., 2007 ). Foodborne transmission of pathogens from food animals such as dairy, swine, and other food animal carcasses has always been a major concern around the globe (Chao et al.,2007 ; Normanno et al.,2007 , Simeoni et al., 2008).
2.4.2. Staphylococcal Food Poisoning Food-borne disease (FBD)are defined by the world health organization as disease of infectious or toxic nature caused by, or thought to be caused by the consumption of food or water (Lee Loir et al., 2003). Around 250 different food –born disease have been described, and the bacteria of the causative agent of two thirds of food-born disease ( Lee Loir et al., 2003).
Staphylococcal food-borne intoxication is one of the most common form of bacterial food-borne disease in many countries (Balaban and Rasooly, 2000). S.
aureus can cause food poisoning even with very small amounts(100-200 ng) of its heat-stable enterotoxin (Jay, 2000).
Nearly one third of all the food poisoning cases in the US were caused by Staphylococcus aureus during 1970s and 1980s, which in general has decreased over the past two decades. However, it remains the main reported cause of food poisoning in a number of countries including Brazil, Egypt, Taiwan, Japan, and most of the other developing countries. Intoxication occurs due to the ingestion of one or more preformed staphylococcal enterotoxins (SEs) in contaminated food. Staphylococcal contamination is associated with creamy food prepared with milk, deli foods, custard (pudding), salad dressing, meats, hams, fish, shellfish, and milk products. Staphylococci can be transmitted through meat grinder’s knives and food handlers(Lee Loir et al., 2003 ; Bhunia, 2008).
Milk is one of the widely consumed nutrient foods and also it is an excellent culture medium for the growth and reproduction of microorganisms (Prakash et al., 2007 ). Milk in addition to be nutrient media ,presents favourable physical environment for multiplication of microorganism (Mohamed and El Zubeir, 2007).
Yagoub et al., (2005) stated that milk is a good medium for bacteria including pathogenic microorganisms and if it is produced and processed under un hygienic condition, frequently outbreak of disease my result. Thus milk can transmit disease of microbial origin to the people from sick animals and/or people carrying certain disease and contaminating milk with pathogenic bacteria during handling(Teuvo, 2000 ). There is an evidence that S.aureus was isolated from milk and milk products (Grewal and Tiwari, 1990 ; Teufel et al., 1992 ; Masud et al., 1993 ) and Moroccan traditional milk product samples contaminated with enterotoxin C producing S.aureus strain (Hamama and Tatini, 1991).
Mechanism of action of enterotoxin is still under study but the initiation of the emetic response is thought to be du to the interactions with subsequent activation of modulatory emetic centre in the brain steam that is stimulated via the vagus and sympathetic nerves (Sharon, 2006). Symptoms of staphylococcal intoxication appears within 1–6 h and include nausea, acute vomiting, abdominal pain, diarrhoea, headache, cramping . The disease subsides within 24 h. In case of aerosol exposure, sudden onset of fever, chills, headache, and cough occurs. Fever may last for several days and the cough can last for 10–14 days (Bhunia, 2008). Recovery usually occurs within 6 to 24 hours, depending on the amount of food ingested, and the individual's general health ( Lee Loir et al., 2003).
2.5. Virulence factors One of the key factors enabling S. aureus to survive, colonise, proliferate and cause infections is the expression of virulence factors (VFs). S. aureus produces an array of VFs (Fig 2-1), which can be broadly grouped into those involved in bacterial attachment, evasion of host defences and tissue invasion (Sharon, 2006). Each single VF alone is not sufficient to cause infection and that it is much more likely that several VFs work together in concert to cause infection and disease .It has also been shown that not every S. aureus strain produces every VF, or does not produce each to the same degree (Karlsson and Arvidson, 2002).
Fig (2-1). Summary of virulence factors of S. aureus. (Todar, 2005).
2.5.1. Surface antigens .
Capsular polysaccharides : Some of S.aureus strain expresses surface polysaccharides, this has been called microcapsule because it can be visualized only by electron microscope unlike the true capsules of some bacteria which are readily visualized by microscopy(Todar, 2005).The capsule of S.aureus inhibits
opsonisation and phagocytosis and protect the cell from leukocyte destruction (Brooks et al., 2007).
Teichoic acid : The function of this molecules are still unclear ,but they may be important in maintaining the structure of the cell wall, the teichoic acid dos not present in Gram negative bacteria (Brooks et al., 2007).
Protein A: It is surface protein produced during cell wall synthesis, may have a role in host defence evasion, since its biological function is to bind the IgG Fc-domaine (Uhlen et al., 1984). In fact, studies involving mutation of genes coding for Protein A resulted in a lowered virulence of S. aureus as measured by survival in blood, and this has led to speculation that Protein A contributed virulence requires binding of antibody Fc regions(Patel et al.,1987). Protein A has become an important reagent in immunology and diagnostic laboratory technology , ex. protein A with attached IgG molecules (coagglutination) is direct against a specific bacterial antigen(Brooks et al., 2007). Protein A plays an important role in the purification and the therapeutic removal of IgG and IgG-containing immune complexes in the treatment of certain cancers and autoimmune diseases (Balint et al., 1989).
Adhesins : Staphylococci possess multiple adhesion molecules which are collectively known as MSCRAMM (microbial surface components recognizing adhesive matrix molecules). Adhesion proteins include Bap (biofilm-associated proteins),which is responsible for biofilm formation and colonization in the mammary gland during mastitis (Yarwood et al., 2004).
The fibronectin-binding protein (Fbp) binds to fibronectin. Bacterial binding to fibronectin also facilitates the internalization into non professional phagocytes, such as kertinocytes, epithelial cells, endothelial cells, and osteoblast. Staphylococci also produce other adhesion factors including ClfA, a fibrinogen-binding protein that activates platelets aggregation and plays a role in staphylococcal arthritis; Pls, a plasmin-sensitive cell wall protein that binds to ganglioside of cells and promotes adhesion to nasal epithelial cells and; Cna, a collagen adhesion binds to collagenous tissues, i.e. cartilages. ( Bhunia,2008).
2.5.2. Extracellular proteins Haemolysins: The majority of strains produce hemolysins, alpha-hemolysin (or alphatoxin) is dermonecrotic, neurotoxic and lyses mammalian cells, especially red blood cells, by forming a pore in the target membrane ( Bhakdi and
Tranum,1991). β-hemolysin acts as sphingomyelinase that damages membranes rich in this lipid , gamma-hemolysin has leucocytolytic activity, and it has been suggested that delta-hemolysin is a very small peptide toxin produced by most strains of S. aureus. Delta -toxin has an abroad hemolytic spectrum and has channel forming properties (Dinges et al., 2000). Exotoxin–superantigen: That binds directly to class II (Fig 2-2) major histocompatibility complex (MHC II) of antigen-presenting cells outside the normal antigen-binding groove and stimulate non-specific T-cell proliferation. Cytokines are released in large amounts, causing the symptoms of toxic shock (Balaban and Rasooly, 2000).
Fig (2-2). Superantigen and the non-specific stimulation of T cells. (Todar, 2005).
Toxic shock syndrome toxin (TSST-1)-superantigen: Toxic shock syndrome toxin is associated with strains that cause human toxic shock syndrome. TSST-1 not directly toxic to cells, it causes over-stimulation of T cells with efflux of lymphokines/ cytokines (Balaban and Rasooly, 2000). TSST-1 is the major exotoxin etiologically involved in staphylococcal toxic shock syndrome, especially in menstrual cases (Schlievert et al., 1981). The potentially fatal TSS is characterised by a diffuse rash, desquamation, hypotension, high fever and the involvement of three or more organ systems (Dinges et al., 2000). Most cases of TSS are wound or menstruation-associated, the latter linked to the use of tampons in women (Dinges et al., 2000).
Exfoliative toxins (ET)-superantigen:
The ETs are responsible for the staphylococcal scalded-skin syndrome, there are two different toxin serotypes; A and B, referred to as ETA and ETB, respectively (Johnson et al., 1979). This toxin included epidermolytic toxin which causes erthemia and separation seen in Staphylococcal scalded skin syndrome (Brooks et al., 2007). Although ETA and ETB have identical biological activity and a degree of genetic similarity but the gene coding for ETA is chromosomal, whereas the gene coding for ETB is plasmid linked (Lee et al., 1987).
Enterotoxins-superantigens. Staphylococcus aureus produces large numbers of extracellular proteins and toxins. The most important toxins are called staphylococcal enterotoxins (Bhunia, 2008). Staphylococcal enterotoxins (SEs) are a family of structurally related proteins that are produced by Staphylococcus aureus (Bergdoll et al., 1989). The enterotoxin family now contains 17 toxins. The SE family is divided into the classical enterotoxins SEA to SEE and a group of recently discovered toxins SEG to SER ,in addition, the SEC has three antigenically distinct subtypes: SEC1, SEC2, SEC3, and SEG have a variant form called, SEGv. (Lee Loir et al., 2003 ; Bhunia, 2008).
Staphylococcal enterotoxin F was produced by S. aureus strains involved in toxic shock syndrome (Bergdoll et al., 1989). Later it became clear that it was not an enterotoxin and not emetic. Thus, it has been removed from the SE nomenclature system and is now referred to as toxic shock syndrome toxin TSST-1 (Betley et al., 1992).
Many SEs are responsible for food poisoning, acute illness, fever, erythematous lesions, and hypotension ( Bhunia,2008). It is estimated that about 5% of food poisoning cases in which none of the classical enterotoxins were detected can, however, be attributed to new enterotoxins (Rosec and Gigaud, 2002; Lee Loir et al, 2003; Jorgensen et al, 2005). Since S. aureus may produce a large variety of enterotoxins but 95% of poisoning outbreaks are caused by classical enterotoxins: A, B, C, D and E (Letertre et al., 2003).
Staphylococcal enterotoxins are a heterogeneous group of water soluble single chain globular proteins with molecular weight of about 26–35 kDa, The SEpolypeptide chain contains relatively a large number of lysine, aspartic acid, glutamic acid, and tyrosine.(Lee Loir et al., 2003). The classical enterotoxins have well-recognized toxins and fall into two groups: SEB, SEC1, SEC2, and SEC3, which have 66to 98% amino acid sequence identity, and SEA, SED, and SEE, which have 53 to 81% identity (Marrack and Kappler, 1990) .
The SEs are generally heat resistant and a heat denatured enterotoxin can be renatured by prolonged storage or in the presence of urea. Toxins remain active even after boiling for 30 minutes and they are stable at 121 °C for 28 min. The SEs also are protease resistant and all are capable of causing food poisoning. (Lee Loir et al., 2003).
Staphylococcal enterotoxin are highly stable and resist most proteolytic enzymes such as pepsin or trypsin thus keep their activity in the digestive tract after ingestion (Bergdoll, 1989). Enterotoxins are expressed differentially and the toxin production depends on the growth phase of bacteria, pH, and CO2 levels. SEA and SEE are synthesized mostly during the exponential phase while SEB, SEC, and SED are produced during transition from exponential to the stationary phase of growth. (Bhunia, 2008). The genes coding for these toxins have been localized on the chromosome for SEB and SEC, on bacteriophage vectors for SEA, and on plasmids for SED (Couch et al., 1988).
Genes encoding SEs have different genetic supports, most of which are mobile genetic elements,for example , SEA is carried by a family of temperate phages (Coleman et al., 1989). SEB is chromosomally located in some clinical isolate, Whereas it has been found in a 750-kb plasmid in other S.aureus strain (Shalita et al, 1977). SEC is encoded by a gene located on a pathogenecity island (Fitzgerald et al.,2001) and SEE is carried by a defective phage(Couch et al.,1988).
Studies had shown a predominance of SEC producing strains in raw milk (Echcpd, 2003; Kuroishi et al., 2003). Sharma et al., ( 2000) found that enterotoxin C was most commonly associated with ovine and bovine enterotoxigenic S. aureus strains, who found that bovine strains were recovered with cases of subclinical and clinical bovine mastitis produce just SEC. Bovine strains were recovered from cases of bovine mastitis and the involvement of enterotoxin C-positive S. aureus strains has been well documented by other workers (Garcia et al., 1980; Lopes et al., 1990 ; Kenny et al.,1993).
S. aureus strains isolated from humans often produce SEA, whereas strains from cows produce SEC and those from sheep SEC or D (Bhunia, 2008). Stephan et al., (2001), however, isolated strains from human nasal carriers and found 9 SE producers all positive for SED either alone or in combination with other toxins. Generally, a high percentage of isolates from healthy humans are enterotoxin producers, Al- Bustan et al., (1996) noted that 86.6 % of 133 strains isolated from nasal swabs of restaurant workers in Kuwait City ,however Mehrotra et al.,( 2000): 34.6 % of healthy individuals.
In healthy animals the percentage of enterotoxinogenic strains seems to be lower: 3.9 % – 6.0 % for strains isolated from normal cows' milk (Gilmour and Harvey, 1990). The incidence of toxin producing strains in mastitis animals depends on the species: 14.6 % – 41.3 % in those of mastitis cows and 70.4 % and 83 %, respectively, in those of mastitic sheep (Gilmour and Harvey, 1990). This is in agreement with Bergdoll (1989) who found that the 70 – 80 % of strains isolated from mastitic sheep produced SEC.
2.5.3.Other exoproteins – not superantigens
Plasma coagulase : Is an enzyme that functions like thrombin to convert fibrinogen into fibrin. Tissue microcolonies surrounded by fibrin walls are difficult to phagocytose.(kayser ,2005). Coagulase produced during the logarithmic phase of growth from the pathogenic strain and production reach to optimum in the PH 7.3-7.9 (Jawetz et al., 1984). Coagulase a traditional marker for identifying S.aureus in the clinical microbiology laboratory ,howover there is no evidence concerning its virulence factor although its responsiple for speculating that bacteria could protect themselves from phagocytises and immune defense by causing localising clotting (Olorunfemie et al.,2005 ). Panton-Valentine leukocidin ( PVL): Is a two-component polymeric pore-forming exotoxin belonging to the synergohymenotrophic toxin family which includes gamma haemolysin and other secreted proteins which can combine with each other to form related, but less potent, exotoxins (Kaneko and Kamio, 2004). PVL binds to and damages the cell membranes of neutrophils, monocytes and macrophages resulting either in cell lysis or neutrophil apoptosis (Genestier, 2005).
Neutrophil lysis results in local release of active oxygen species, cytotoxic lysosomal granule contents and proinflammatory mediators, whereas neutrophil apoptosis has been postulated as the mechanism behind the neutropaenia which can be observed during the course of severe ‘PVL-positive’ staphylococcal infection . When injected into the dermis of rabbits, purified PVL causes inflammation and skin necrosis( Ward and Turner, 1980).
Proteases S.aureus produces several extracellular proteases include metalloprotease ,collagenase ,hyaluronidase and endopeptidase elastase ( Bhunia, 2008). These proteases are thought to be involved in evading host defenses and invading tissue (Archer, 1998). The general function of all proteases is to cleave
proteins and may inactivate antimicrobial peptides involved in host defenses. The proteases may destroy host tissue proteins, leading to generalised tissue destruction (Sharon, 2006) and at the same time the creation of valuable nutrients for microbial growth. In addition to the functions described above, the expression of proteases may contribute to the severity of superficial S. aureus infections, given that S. aureus strains isolated from patients with atopic dermatitis have been shown to produce much higher levels of proteases than strains from healthy volunteers (Miedzobrodzki et al., 2002). 2.5.4.Role of pigment in virulence
Some strains of S. aureus are capable of producing staphyloxanthin (carotenoid pigment ) that acts as a virulence factor. Its has an antioxidant action that helps the microbe to evade killing with reactive oxygen used by the host immune system. It is thought that staphyloxanthin is responsible for S. aureus' characteristic golden colour( Clauditz et al., 2006). When comparing a normal strain of S. aureus with a strain modified to lack the yellow coloration, the pigmented strain was more likely to survive dousing with an oxidizing chemical such as hydrogen peroxide than the mutant strain was.Colonies of the two strains were also exposed to human neutrophils. The mutant colonies quickly succumbed while many of the pigmented colonies survived( Clauditz et al., 2006).
Wounds on mice were swiped with the two strains. The pigmented strains created lingering abscesses. Wounds with the unpigmented strains healed quickly. These tests suggest that the yellow pigment may be key to the ability of S. aureus to survive immune system attacks. Drugs designed to inhibit the bacterium's production of the staphyloxanthin may weaken it and renew its susceptibility to antibiotics (Liu et al., 2005) .In fact, because of the similarities in the pathways for biosynthesis of staphyloxanthin and human cholesterol, a drug developed in the context of cholesterol-lowering therapy was shown to block S. aureus pigmentation and disease progression in a mouse infection model. (Liu et al., 2008).
2.6. Disease caused by S.aureus
In animals, although all warm-blooded animals can be clinically affected by coagulase-positive staphylococci ,the prevalence and form of such interactions vary among host species(Biberstein and Hirsh, 1999). Staphylococcus aureus is an important cause of mastitis in cattle, sheep and goats (Yazdankhah et al., 2001; Rodrigues da Silva et al., 2005). Infection occurs via the teat canal and the course of the infection varies from the subclinical to acute suppurative ,gangrenous or chronic depending on the infective strain ,infecting dose, and host
resistance (Biberstein and Hirsh, 1999).Tick pyemia of lambs resulting from inoculation of indigenous skin S.aureus by tick bites my be acute with toxemic death or chronic with disseminated abscess formation,it is often linked with tick-born fever caused by Ehrlichia phagocytophila (Biberstein and Hirsh, 1999).
S.aureus may cause abscess disease of sheep that resembling caseous lymphadenitis(Biberstein and Hirsh, 1999).Botrymycosis is a term hase been used to describe chronic granulomatous lesion associated with S.aureus infection especially in the udder of sows, mares and cows, and in the equine spermatic cord after castration (Biberstein and Hirsh, 1999 ; Quinn et al., 2004). Also S.aureus can cause perioribtal eczema in adult sheep and staphylococcal septicemmia of new born in lambs(Radostits et al ., 2007).
S.aureus cause many type of disease in birds as synovitis, arthritis , tendinitis, yolk sac infection, omphalitis , endocarditis , septicema and urinary tract infection(Boynukara et al., 1999). Staphulococcosis in turkeys is abacterimia localizing in joint and tendon sheath, while “Bumblefoot” of gallinaceous bird is a chronic pyogranulomatous process in the subcutaneous tissue of the foot resulting in thick-walled swelling on one or more joint (Biberstein and Hirsh, 1999).
In human, the nature and extent of the disease depends on the pathogenic characteristic of the infecting strain, host susceptibilities and the rout of host entry, the most common ailments are skin and soft tissue infections that include abcesses ,cellulitis , folliculitis, furunculosis, impetigo ,eye infection and post operative surgical wounds(Sharon, 2006 ; Cohen, 2007). Staphylococcal scalded skin syndrom ( SSSS) result from the action of S.aureus exofolative toxin on the skin epidermis (Sharon, 2006).
Toxic shock syndrome (TSS) is caused by strains that produce TSST-1, the main symptoms are hypotension, fever, and rash(kayser ,2005). Serious S. aureus infections include osteomyelitis, pneumonia, urinary tract infections sepsis, acute endocarditis, myocarditis, pericarditis, cerebritis, meningitis, scalded skin syndrome (Jarvis and Martone 1992 ; kayser ,2005).
2.7. Identification: The laboratory diagnosis is based on culture and biochemical tests: typical morphology, positive coagulase reaction, fermentation of mannitol and trehalose, and production of heat stable nuclease (Sharon ,2006). Although the coagulase tube test is the standard phenotypic routine test used to identify S. aureus in biological samples, several groups have implemented the molecular analysis of the coagulase gene as an accurate defined test (Silva et al., 2006).
Several tests of staphylococci in primary no selective cultures, testing for the presence and the type of haemolysis on blood agar plates represents a first simple and rapid method ( Lam et al., 1996). Among the three coagulase-positive staphylococci, S. aureus is the only one with hemolytic activity that is regularly encountered in clinical milk samples. Therefore, a combination of hemolysis and coagulase activities seems to represent an optimal criterion for the identification of S. aureus in cultures from milk samples ( Lam et al., 1996). Several rapid identification tests for S. aureus are commercially available and have been extensively validated for use in human medicine (Griethuysen et al., 2001 ; Smole et al., 1998 ). They could be very helpful for the identification of S. aureus in cultures from milk samples but seem not to be used frequently for this purpose. The majority of these tests are based on slide agglutination (Patrick, et al 2003 ). A latex slide agglutination test detecting clumping factor and protein A simultaneously is recommended for rapid and reliable routine identification of Staphyloccus aureus ( Ludwig and Klaus,1980). 2.8. Biotyping of S.aureus. The biotyping of S. aureus strains may give an indication of the origin of contamination in food products, as the biotype correlates well with the animal host (Isigidi et al., 1992 ; Rosec and Gigaud 2002 ; Lamperll et al.,2004 ) . The criteria used so far for the subdivision of S. aureus serve the purpose for a realistic means of tracing the source of an S. aureus isolate and reflect to a great extent the influence of the mammalian host in the development of a specific S.aureus phenotype (Dimitracopoulos et al.,1977) ,besides, according to (Live,1982), additional progress in determining the characteristics of S.aureus peculiar to different animal species will contribute further to epidemiological studies in assessing the role of staphylococci of animal origin in human staphylococcosis. S.aureus strain can be classified into biotypes A, B, C and D according to their human or animal origin ( Ordonez et al., 2005). However, many strains cannot be assigned to these host specific biotypes and belong to non host specific biotypes(Hennekinne et al.,2009). The majority of the S. aureus isolates in dairy products were found to belong to the C bovine biotype (Isigidi et al.,1992 ; Roberson et al .,1996 ; Ordonez et al .,2005). 2.9. Methods for detection of S. aureus enterotoxin. Three types of methods are usually used to detect a contaminant in food: bioassays, Immunoassays and molecular biology (DNA amplification in PCR). (Bystron et al.,2006 ; Bhunia, 2008; Agnes and Geoff., 2008).
2.9.1.Bioassays: Rodents are most commonly used as animal models. They include mice, rats, rabbits, hamsters, and guinea pigs. The advantages of using animal models for pathogenicity testing are; generally inbred lines are used, therefore the disease could be reproduced and variability could be reduced( Bhunia, 2008). Animal organs can be used as an alternative for animal model and should be ideal for investigating certain bacterium host interactions. Examples are, ligated-ileal loop and embryonated eggs, organs are genetically intact, multiple cell types are represented, and cells retain their original shape and configurations, Generally, diarrheagenic microorganisms are tested by ligated-ileal loop assay with rabbits or rats(Douglas et al .,1995 ; Bidinost et al .,2004; Bhunia, 2008).
In the study of Koupal and Deibel (1977),they found the ability to elicit a positive ileal loop response in rabbits that occurred in all S.aureus strains producing the enterotoxins and there were no direct correlations between enterotoxigenic activity and any of the other tested characteristics. In other study, six Staphylococcus aureus strains isolated from contaminated yoghurt were evaluated for enterotoxigenicity. Two of the strains were enterotoxigenic and caused fluid accumulation in rabbit ileal loops. Fluid aspirated from the loops was bloody and histopathological changes in sections collected from rabbit ileum, inoculated with crude enterotoxin, were characterized by circulatory disturbances, degenerative/ necrotic and inflammatory changes, including hyperaemia, fibrinous exudation and necrosis of villi epithelial cells(Augusta et al., 2007). These findings are similar to those reported by Kuroishi et al., (2003), elucidated mechanisms by which SEC induced inflammatory changes in bovine mammary glands. The SEC-inoculated mammary glands exhibited interstitial inflammation, with epithelial cell degeneration and migration of polymorphonuclear neutrophils.
2.9.2. Immunoassays: Reversed passive latex agglutination (RPLA) which is most commonly employed and is commercially available. In this test the enterotoxins are identified by antibodies specific for each of the enterotoxins. Cross reactions between SEB and the SECs and between SEA and SEE have been reported( Sergeev et al., 2004 ); hence, kits are generally deficient in antibody specific for enterotoxin E, and SEE-producing strains would be classified as SEA producing. RPLA also depends on sufficient amounts of toxin being produced in the absence of interfering bacterial products for successful detection(Sharma et al., 2000). Toxin production requires long (e.g., 20 h) incubation periods and is also influenced by culture conditions, pH, water activity, and the substrate used. Insufficient production of toxins at levels below
the threshold of these immunological assays leads to false-negative results(Sharma et al., 2000). An Enzyme-Linked ImmunoSorbent Assay (ELISA) method was developed to detect SEs and replaced Radio Immuno Assay. Monoclonal antibodies against SEs were used to develop an ELISA sandwich type; this method is able to detect concentrations of SEs as low as 0.1 ng of entertoxin (Echcpd, 2003; Bhunia, 2008).In a study involved a commercial ELISA and multiplex-PCR were used to determine the enterotoxigenicity of 99 S. aureus strains. In 36 strains the genes of enterotoxins SEA to SEE were detected. Out of these, 32 strains were found to be enterotoxin producers. In the remaining 4 strains the enterotoxin was not detected(Bystron et al., 2006) Fueyo et al., (2005) testing 269 S. aureus isolates, found that 4 isolates, which carried sea and tst genes, were TSST-1-negative. Also, Becker et al.,(1998) using a combination of multiplex-PCR and enzymeimmunoassay (EIA) described an SEA-negative S. aureus strain containing the sea gene. Since the low level of the entertoxin production below the threshold of immunoassay detection leading to the inability of its detection in ELISA (Bystron et al., 2006).
2.9.3.Molecular biology: recently, oligonucleotide probes for specific detection of toxin genes have been developed by several workers (Jaulhac et al., 1992 ; Tsen et al., 1993 ) however, hybridization techniques are laborious and time consuming and, moreover, cross-reactions of the probe for SEA with the SEE enterotoxin gene have been reported (Ewald et al., 1990). In addition, the hybridization assay requires enrichment steps for S. aureus, and thus the detection time could not be reduced significantly (Sharma et al., 2000). PCR is a rapid and extremely sensitive procedure, which is a very good tool for the detection of enterotoxin genes in clinical isolates of S. aureus. It can be used for specifying the staphylococcal infection of the mammary gland and to speed up the diagnosis of the hazardous staphylococcal strains (Tkacikova et al.,2003 ; Anvari et al ., 2008) . PCR assays for the specific detection of enterotoxin genes SEA to SEE from various S.aureus isolates have been reported by many worker (Johnson et al., 1991; Tkacikova et al., 2003; Adwan et al., 2005; Kalorey et al.,2007), but in all of these studies, a series of separate reactions is needed to identify a single gene or subset of these genes. Becker et al.,( 1998) have reported the development of a multiplex PCR reaction for the detection of multiple staphylococcal enterotoxin genes which uses individual primer sets for each toxin gene. Recently, Monday and Bohach, (1999) have developed a multiplex PCR assay for all of the characterized enterotoxin genes (sea-sej) and tst, but again this requires unique primer sets for the detection of individual genes.
Sharma et al.,(2000) report the development of a rapid (3 to 4 h) single-reaction multiplex PCR assay which specifically detects genes for staphylococcal enterotoxins A to E in strains of toxigenic S. aureus from various environmental sources, this PCR reaction takes advantage of both conserved and unique regions of the toxin genes and uses one universal forward primer with reverse primers specific for each individual toxin gene. Genes encoding SEs have different genetic supports, most of which are mobile genetic elements, for example ,SEA is carried by a family of temperate phages, SEB is chromosomally located in some clinical isolate whereas it has been found in a 750-kb plasmid in other S.aureus strain, SEC is encoded by a gene located on a pathogenecity island and SEE is carried by a defective phage (Shalita et al., 1977 ; Couch et al.,1988 ; Coleman et al., 1989 ; Fitzgerald et al.,2001 ; Bystron et al .,2006). Staphylococcal isolates from different animal species produce host specific SECs (Bystron et al .,2006 ; Bhunia .,2008 ) and Sharma et al.,(2000) found that enterotoxin C was most commonly associated with bovine enterotoxigenic S. aureus strains and this was the only enterotoxin detected while in poultry strains 50% of the isolates carried enterotoxin D only. Other studies have shown a predominance of SEC producing strains in raw milk (Echcpd, 2003; Kuroishi et al., 2003). Bovine strains were recovered from cases of bovine mastitis and the involvement of enterotoxin C-positive S. aureus strains has been well documented by other workers (Garcia et al., 1980 ; Lopes et al., 1990 ; Kenny et al., 1993). S. aureus strains isolated from humans often produce SEA, whereas strains from cows produce SEC and those from sheep SEC or D. (Stephan et al. 2001). However, Anvari et al.,(2008) found that the SEC gene is most commonly associated with S.aureus strain isolated from patient scar. Many authors use PCR for the detection staphylococcal enterotoxin genes and all of them fonud high variability in the presence of enterotoxin genes(Anvari et al.,2008 ; Tkacikova et al.,2003). 2.10. Susceptibility and Mechanisms of Antibiotic Resistance: The accumulation of a number of discrete genetic ‘accessory’ elements that encode virtually the full gamut of antibiotic resistance determinants as the principal basis for the evolution of multiple-antibiotic resistance in S. aureus( Firth and Skurray .,2006).These accessory elements comprise plasmids, transposable genetic elements (insertion sequences and transposons) and genomic islands incorporating genes for antimicrobial resistance, which have been acquired via horizontal gene transfer (HGT) amongst interrelated bacterial strains and even between different species and genera (Jensen et al., 2008 ).
2.10.1.Methicillin resistance: Methicillin-resistant strains of S. aureus are able to grow in the presence of beta-lactams and its derivatives, including cephalosporins and staphylococcal penicillins. Low-level methicillin resistance can result from the production of large amounts of betalactamases, or increased production and/or modified penicillin-binding protein capacity of normal PBPs ( McDougal and Thornsberry,1986 ;Tomasz et al., 1989 ) but the most clinically relevant and the most prevalent form of methicillin resistance is characterized by the production of an additional penicillin binding protein, PBP2a or called (PBP2’) (Reynolds, 1986; Tomasz et al., 1989). PBP2a has an unusually low binding affinity for all beta-lactam antibiotics, substituting the native PBPs and allowing continuous cell wall assembly (Reynolds, 1986 ; Chambers and Sachdeva ,1990). The resistance to methicillin and all B-lactam antibiotic is mediated by an exogenous substitute for the intrinsic PBPs, termed PBP2 orPBP2a, which is carried by a mobile genetic element termed as the staphylococcal cassette chromosom mec (Scc mec) (Jensen et al., 2008). PBP2 a feature subtle structural change that reduce the binding affinity of methecillin, so avoiding inactivation and therefore maintaining a viable cell wall in otherwise lethal antibiotic conditions(Hartman and Tomasz, 1984) . Methicillin-resistant strains of S. aureus are often resistant to other antibiotic groups in addition to beta lactams. The SCCmec itself may carry several resistance genes generally located in integrated plasmids or transposons. (Chikramane et al., 1991 ; Jensen et al .,2008) The expression of methicillin resistance varies among strains ( Kayser and Bachim , 1994 ; Hiramatsu, 1995). 2.10.2.Vancomycin Resistance . The most effective treatment available against multi-resistant MRSA infection is the glycopeptied vancomycin ( Schentag et al., 1998) . However, Several newly discovered strains of MRSA show antibiotic resistance even to vancomycin and teicoplanin. These new evolutions of the MRSA bacterium have been dubbed vancomycin intermediate-resistant Staphylococcus aureus (VISA). (Sieradzki and Tomasz , 1997 ; Marchese et al .,2000 ; Schito , 2006). The molecular mechanism of resistance has not been fully elucidated. However, the thickening of the cell wall through the accumulation of excess peptidoglycan, , seems to be common to all VISA strains (Hanaki et al., 1998 ; Hiramatsu , 2001) .This results in the trapping of glycopeptide molecules in the cell wall, and the blocking of the access to the major target of glycopeptide
antibiotics, D-ala-D-ala residue on the N-acetyl-muramic acid precursor in the cytoplasm (Hiramatsu , 2001). The fist high level vancomycin –resistant S.aureus (VRSA) isolate was reported from the united states in 2002(Weigel et al.,2003).VRSA resistance is mediated by vanA gene, which is identical to the mechanism utilised by (VRE) vancomycin-resistant enterococci (Weigel et al.,2003).
CHAPTER 3
MATERIALS AND
METHODS
Materials and methods
3.1. Materials 3.1.1. Instruments and Equipments: The instrument and equipments which were used throughout the study are
shown in the table below:
Table (3-1): The Instrument and Equipment and their remarks.
Company (Origin)
Name No.
Monarch MSI (Germany) Autoclave 1.
Mettler (Switzerland) Balance 2.
Elite – Medichem (India) Centrifuge 3.
Hettich (Germany) Cooled centrifuge 4.
AlabTech (Korea) Distillator 5.
Binder (Germany) Electric oven 6.
Hipot Tested (UK) Electrophoreses 7.
Heidolph (Germany) Hot plate magnetic stirrer 8.
Binder (Germany) Incubator 9.
Hanna (Romania) Microprocessor pH– meter 10.
Olympus (Japan) Microscope 11.
Techne(UK) Thermocycler apparatus 12.
Denver ( Germany) Electronic balance 13.
EEC (France) Vilber Lourmater UV light 14.
Memmert ( Germany) Vortex 15.
Tafesa-hannover(Germany) Water bath 16.
Gelson (France) Micropipettes (different size) 17. Eppendorf (USA) PCR tubes 18. Sony (Japan) Digital camera 19. APEL (Japan) Spectrophotometer 20. Merk (Germany) Millipore 21.
3. 1.2. Chemical and biological materials
The chemical and biological materials which were used throughout the study
are listed in table (3-2).
Table (3-2). Chemical and biological materials
Country Sources Chemicals of biological
materials.
No.
Germany Fluka Absolute ethanol 1.
USA Promega Agarose 2.
England BDH BaCl2-H2O 3.
USA Difco Boric acid 4.
England BDH EDTA. 5.
USA Sigma Glycerol 6.
England BDH Isopropanol 7.
England BDH K2HPO4 8.
England BDH KH2PO4 9.
England BDH NaCl 10.
3.1.3. Media
3.1.3.1. Commercial Media:
Commercial media which were used throughout the study are listed in table (3-
3) below.
Table (3-3). Commercial media
England Oxoid Peptone 11.
USA Promega Protenase K 12.
Germany Fluka Trise-base 13.
India Gracure pharm-
aceuticalsLtd.Bhi
wadi, (Raj.)
Ketamine 14.
India Horsterweg 26A
castenray Holland
Xylazine 15.
Company- Origin Medium No.
Himedia - India Agar-agar 1.
Himedia - India Blood agar base 2.
Himedia – India Brain heart infusion agar 3.
Himedia - India Brain heart infusion broth 4.
Himedia - India Mannitol salt agar 5.
Himedia - India Muller- Hinton agar 6.
Himedia - India Nutrient agar 7.
Himedia - India Nutrient broth 8.
3.1.3.2. Prepared media
The prepared media which were used throughout the study are listed in table
(3-4) below.
Table (3-4). The prepared media
Medium No.
Blood agar medium 1.
Methyl red and Voges – Proskauer test medium 2.
Milk agar 3.
Crystal violet agar 4.
3.1.4. Stains and indicators
Stains and indicators used throughout the study are listed in (table 3-5)
below.
Table (3-5). Stains and indicators
Company/ Origin Stain and indicator No.
Fluka/ Germany Bromophenol blue 1.
Fluka/ Germany Hydrogen peroxide 2.
Promega /USA Ethidium bromide 3.
Biomerieux/France Vogus –proskauer VP1-VP2 4.
Prepared Crystal violet 5.
3.1.5. Kits
The Kits were used throughout the study are listed in table (3-6).
with young culture and incubated at 37 ºC for 24 hrs. 0.2 ml of 40% KOH and
0.6 ml of 5% solution of α –naphthal were added. A positive reaction was
indicated by the development of brown colour in 2-5 min (Macfaddin, 2000).
♦-4-Nitrophenl-B-D-galactopyranoside (ONPG): Using 1 ml from D.W in
sterile tube and small portion from the colony was added, a disc of ONPG was
added, the incubation took place at 37 ºC and the results were read after 1- 4-24
hrs., then if the color was converted to yellow, the results were S. intermidius,
but when white color remained, this was S. aureus (Sharon, 2006) .
3.2.5.2.Serological test.
Latex agglutination (MASTSTAPH): latex was allowed to equilibrate at room
temperature before use and was shaken. One drop of latex was added into circle
on the test card using clean mixing stick, 2-4 average size colonies were picked
up from a fresh overnight culture , emulsified in the latex, mixing thoroughly
and spreading over half the area. Rotate and rock the card slowly and the result
was recorded within 1 minute and dispose the test card safely.
3.2.6. Biotyping.
Depending on Lamprell et al., (2004), Table (3-7) revealed the tests used in
the detection of S. aureus biotypes
Key property A B C D Non-
spesific
Pigment + + + V_ +
Coagulation of human plasma
+ + + + +
Coagulation of bovine plasma
_ _ + _ _
Alpha haemolysis + V+ V_ _ V
Beta haemolysis V_ V+ + + V
Growth on Crysal violet agar
positive to crystal violet
White yellowish No growth
V
Host human canine Bovine Poultry Non-specific
+ = more than 80% of organism positive
_ = more than 80% of organism negative
V = variable (predominance of negative or positive organism)
V_= (predominance of negative organism)
V+ = (predominance of positive organism)
3.2.7. Susceptibility to the vancomycin and methecillin. The antimicrobial susceptibility testing was done by the agar discs diffusion
method as that described by Bioanalyse® sensitivity discs . as follows :
Inoculum preparation and plates inoculation:
At least 3 – 5 well isolated colonies of the same morphological type were
selected from the agar plat culture . The top of each colony was touched with a
loop and the growth was transferred into a tube containing 4 ml BHI broth and
incubated at 35 ºC.The turbidity of the actively growing broth culture was
adjusted with sterile broth to obtain turbidity optically comparable to the 0.5
McFarland standards .
Optimally with 15 minutes after adjusting the turbidity of the inoculums
suspension .Sterile cotton swab was dipped into adjusted suspension ,the swab
then rotated several time pressed firmly on the side of the tube above the fluid
level .This removed excess inoculum from the swab.
The dried surface of the a Mueller – Hinton agar plate was inoculated by
streaking the swab over the entire sterile agar surface .This procedure was
repeated by streaking two more times, rotating the plate approximately 60 ◌
each time to ensure an even distribution of the inoculums . As a final step the
rim of the agar was swabbed. The procedure was done under laminar flow to
avoid contamination. The predetermined antimicrobial disks were dispensed on
to the surface of the inoculated agar plate. Each disk was pressed down
individually to ensure complete contact with agar surface. The disk placed in the
agar surface was not closer than 24 mm from the center to the centre.
The plates were inverted and placed in an incubator set to 35 ºC with
15miuntes after the disk were applied. After 18 hrs of incubation , the plate was
examined .The resulting zone of inhibition was uniformly circular with
confluent lawn of growth . The diameter s of the zones of complete inhibition
were measured ,including diameter of the disk. The inverted petri plate on the
back few inches a black non reflected background and illuminated with
reflected light. The zone margin was taken as the area showing no obvious
,visible growth that can be detected with unaided eye.
The size of inhibition zones were interpreted by referring to zone diameter
interpretive standard from (Bioanalyse sensitivity discs Ankara/Turkey)
Table ( 3-8 ). Interpretation of inhibition zone diameter (Bioanalyse sensitivity
discs Ankara/Turkey)
3.2.8. Molecular detection of SEA to SEE genes (using Multiplex PCR
technique).
3.2.8.1.DNA extraction and purification
The DNA was extracted and purified according to the instructions of Promega
kit ( Promega / USA ) as a fallowing :
1-Pellet cells: One ml of overnight BHI broth culture of test bacteria was
transferred to 1.5 ml eppndorff tube, centrifuged at 1600 rpm for 2 min the
precipitate was maintained and supernatant was discarded. The precipitated
cells suspended in 480µl of 50Mm EDTA and lytic enzymes (proteinase K 30µl
Sensitiv
e
Intermed
iate
Resista
nce
Concentrati
on( µg /ml)
Symbol
Antibiotic
No.
≥15 - ≤13 1 M Methicillin 1.
≥12 10-11 ≤9 30 VA Vancomycin 2.
)was added, and incubated at 37ºC for 30-60 minutes, after centrifugation for 2
minutes at 13000 rpm. the supernatant was discarded.
2-Nuclei lysis solution ( 600 µl ) was added , gently pipette until the cells were
resuspended . Incubated at 80 ºC in water bath for 5 min. to lyse the cells, then
cooled to room temperature .
3-RNase solution ( 3 µl ) was added to the cell lysate . Inverted the tube 2 – 5 times
to mix and incubated at 37 ºC for 15 – 60 minutes , then cool the sample to room
temperature .
4-Two hundred µl of protein precipitation solution added to the RNase – treated
cell lysate and mixed by vortex for 20 seconds to mix the protein precipitation
solution with the cell lysate . The sample was incubated on ice for 5 minutes and
then centrifuged at 13000 rpm. for 3 minutes .
5-The supernatant containing the DNA was transferred to a clean 1.5 ml micro
centrifuge tube containing 600 µl of room temperature isopropanol . Gently mixed
by inversion until the thread –like strands of DNA form a visible mass then
Centrifuged at 13000 rpm. for 2 min and the supernatant was decanted .
6- Six-hundreds µl of70 % ethanol at room temperature was added to the
precipitate and gently invert the tube several times to wash the DNA pellet and
centrifuge at 13000 rpm. for 2 minutes then carefully aspirate the ethanol . The
tube was drained on clean absorbent paper and allow the pellet to air – dry for 10 –
15 minutes .
7-Finally 100 µl of DNA rehydration solution was added to the tube and rehydrate
the DNA by incubating the solution at 4 ºC for 24 hrs and the DNA was stored at 2
– 8 ºC . The purified DNA was detected by electrophoresis on 1 % agarose .
3.2.8.2. PCR amplification of enterotoxin (SEA to SEE) gene sequences for S.
aureus isolates.
The SEs genes were studied according to protocol of (Sharma et al,.2000).
The PCR amplification mixture (25µl)which was used for the detection SEs
genes includes 12.5 µl of green master mix ( which contains bacterially derived
Taq DNA polymerase , dNTPs , MgCl2 and reaction buffer at optimal
concentration for efficient amplification of DNA templates by PCR ) , 2.5 µl of
template DNA , 1 µl of each primers given in( Table 3-9) and 4µl of nuclease
free water to complete the amplification mixture to 25 µl .
Table (3-9): Oligonucleotide primers sequences used for PCR amplification of enterotoxins (SEs) genes according to (Sharma et al.,2000)
Primer name
and size Description Nucleotide sequence (5→3)
PCR product size (bp)
SA-U (20) Universal forward primer
TGTATGTATGGAGGTGTAAC
SA-A (18) Reverse
primer for SEA
ATTAACCGAAGGTTCTGT 270
SA-B (18) Reverse
primer for SEB
ATAGTGACGAGTTAGGTA 165
SA-C (20) Reverse
primer for SEC
AAGTACATTTTGTAAGTTCC 69
SA-D (20) Reverse
primer for SED
TTCGGGAAAATCACCCTTAA 306
SA-E (16) Reverse
primer for SEE
GCCAAAGCTGTCTGAG 213
The PCR tubes containing amplification mixture were transferred to
preheated thermocycler and start the program as in the following in table (3-10).
Table (3-10): PCR amplification program for enterotoxins (SEs) genes detection
according to (Sharma et al., 2000)
Step Temperature (C˚) Time NO. of cycle
Initial denaturation 94 5min 1
Denaturation 94 30s
25 Annealing 50 30s
Extension 72 30s
Final extension 72 2min 1
3.2.8.3. Agarose gel electrophoresis
The agarose gel was prepared according to the method of Sambrook et al.,
(1989).Two concentrations of agarose gel were prepared ( 1% and 2% ) . The
concentration of 1% agarose was used in the electrophoresis after DNA extraction
process , while 2% agarose was used after PCR detection,
The preparation of agarose gel. A 25ml of 1X TBE buffer was pipette into a
beaker, 0.25 or 0.5 g agarose was added to the buffer and 0.2 μl ethidium
bromide were added. The mixture was heated for boiling by hot plate until all
gel particles were dissolved and allowed to cool down to 50-60ºC.
1. Casting of the agarose gel
The gel was assembled to a casting tray and the comb was positioned at one
end of the tray.
The agarose solution was poured into the gel tray and it was allowed to cool
at room temperature for 30 minutes .
The comb was carefully removed and the gel replaced electrophoresis
chamber . The chamber was filled with TBE – electrophoresis buffer until
the buffer reached 3 – 5 mm over the surface of the gel .
2 . Loading and running DNA in gel agarose
DNA ( 9 µl ) was mixed with ( 3µl ) bromophenol blue ( loading buffer )
and loaded in the wells of the 2% agarose gel .
The cathode was connected to the well side of the unit and the anode to
the other side .
The gel was run at 75 V until the bromophenol blue tracking dye
migrated to the end of the gel .
The DNA was observed and viewed under UV transilluminator
3. PCR result analysis
The results of PCR were performed after the amplification process. 10 µl
from amplified sample was directly loaded in a 2% agarose gel containing 0.5 µl
/25 ml ethidium bromide with the addition of loading buffer and DNA size marker
as standard in electrophoresis and run at 75 V for 1 hr , then the products were
visualized by UV transilluminator .
3.2.9. Ligated rabbit ileal loop assay
Three strains of PCR positive S. aureus isolated from contaminated milk
were evaluated for their enterotoxin-producing ability and histopathological
Changes by the ligated rabbit ileal loop assay according to (Beecher et al.,
1995; Augusta et al., 2007).
3.2.9.1.Culture of S. aureus for Enterotoxin Production:
Cultures for enterotoxin production were initially prepared using nutrient
broth. Ten milliliter aliquots of sterile nutrient broth, in sterile tube, were
inoculated each with approximately 108 cells per ml ( McFarland 0.5) and
incubated at 37 ºC for 48 h. Subsequently, the S.aureus strains were cultured in
10 ml of milk (at pH 8 and pH 4 ) , pasteurized by heating to 80 ºC for 30 min
and cultures were incubated as with nutrient broth cultures(Augusta et al.,
2007).
Following 48 hrs incubation of the nutrient broth and milk cultures, cell free
culture supernatants were collected by centrifugation at 5000 rpm. Followed by
filtration through 0.20 μm Millex syringe filters. The cell free filtrates were then
used as crude toxin preparation. (Beecher et al., 1995; Augusta et al., 2007)
3.2.9.2. Assay for Enterotoxin Activity:
One to 1.5 Kg body weight female rabbits were starved for 24 hrs with water
supplied ad libitum. Each S.aureus isolate was tested in triplicate animals. Each
rabbit was anaesthetized with 2 ml of ketamin injection and secured in dorsal
recumbency. Following a midline incision, starting from the rectal end, the
ileum was divided into 12 segments of 5 cm in length with string ligatures. The
crude toxin preparation (0.5 ml) was injected into different segments. Sterile
saline were injected into one segment to serve as negative control. The incisions
were then sutured and the animals allowed to recover from anaesthesia (Beecher
et al., 1995; Augusta et al., 2007).
3.2.9.3. Post-mortem Examination.
After 7 hrs, test animals were killed and opened immediately for examination.
The gross appearance of the loops was noted, and, if either the control loop
contained fluid, all tests in that rabbit were considered invalid. The length
(centimeters) and volume (milliliters) of each test loop was measured.. For
positive loops, the volume of fluid recovered by aspiration was used to
determine the dilatation index (DI) estimated as the ratio of volume of fluid to
length of ileal segment. A DI > 0.2 was taken as positive. Each S.aureus isolate
was tested in triplicate animals(Augusta et al., 2007).
3.2.9.4. Histopathology:
Sections of both normal and enterotoxin-inoculated rabbit ileum were fixed
by immersing the cut pieces in 10 % formalin for 24 – 48h (Augusta et al.,
2007).
Following fixation, this sections were sending to the Collage of Pharmacy -
University of Basrah for histopathological dissection.
3.2.10. Statistical analysis In order to determine the statistical significances among different
variables SPSS program (Statistical package for social sciences) version 11, was
used. Chi-square and analysis of variance tests were applied to analyze the
obtained results.
CHAPTER 4
RESULTS
Results
4.1. Occurrence of S.aureus isolates in raw milk samples according to the
regions of study.
According to the results of isolation and identification there were out of 200
tested samples analyzed 57 were S.aureus positive. The high rate of S.aureus
was observed in Al-Hartha 34% followed by Al-Hadi and Al-Ashar 28% each
and the lower rate was found in Old Basrah market 24%. The percentage of
isolates in cow milk were 30% while in buffalo milk 27%.There were no
significant differences (P > 0.05) in the rate of S.aureus isolation among the
regions of the study and between the cow and the buffalo milk samples(Table.4-
1).
Table (4-1). The occurrence of S.aureus in raw milk samples according to
Region
Cow milk
Buffaloes milk
Total % positive No. Of samples
S.aureus positive
No. Of samples
S.aureus positive
Al-Haretha
25
7
25 10 34
Al-Hadi
25
8
25 6 28
Old Basrah market
25
6
25 6 24
Al-Ashar
25
9
25 5 28
Total
100
30
100 27 57(28.5%)
X2= 0.221 P > 0.05
X2 = 1.251 P > 0.05
the region of the study.
4.2. Biotypes of S. aureus
S. aureus isolates were biotyped by using pigment production ,type of
haemolysin, coagulation of bovine plasma and the growth on crystal violet agar
. (Figure 4-1,2).
The results of biotyping revealed that, 63.15% of the S.aureus isolates belong
to the biotype C (bovine origin) and 26.31%belong to the biotype A (human
origin) while the remaining 10.52% cannot be classified and placed in the group
of the non- specific biotype (Table 4-2). There were high significant differences
(P < 0.01) among biotype A, C and non-specific biotype of S.aureus isolates.
Table (4-2): Number and percentage of S.aureus biotypes isolated from raw milk samples.
Region Milk sample
No.of S.aureus exam
Biotype A Biotype C Non-specific
Al-Haretha 17 3 14 0
Al-Hadi 14 2 11 1
Old Basrah market 12 4 5 3
Al-Ashar 14 6 6 2
Total 57 15 (26.31%) 36 (63.15%) 6 (10.52%)
X2 =37.421 P < 0.01
Figure (4-1). Biotype A and biotype C of S.aureus isolates on crystal violet agar , (1- Biotype C, 2- biotype A).
Figure (4-2). Pigment production of S.aureus isolates on milk agar , (1-positive result , 2-negative result).
1 2
1 2
4.3.Molecular results of S.aureus enterotoxin genes (SEs) detected by
multiplex PCR technique.
The PCR analysis was applied to DNA extracted from pre-conventional
microbiological and serological confirmed of S.aureus isolates from milk
samples (figure 4-3).
Out of 57 isolates were analyzed by PCR technique for SEs genes , 14
isolates of S. aureus (24.56%) found to possess a gene for enterotoxin SEC (
30% from Cow milk and 18.51% from buffalo milk) while SEA, SEB,SED and
SEE were not detected in both raw milk sample (cow , buffalo) Table (4-3).
There were no significant differences (P > 0.05) in the rate of SEC genes of
S.aureus isolates from cow and buffalo milk samples.
Table (4-3).Number, percentage and type of SEs in cow and buffalo milk
samples.
Type of sample No. of milk
sample
No. of S.aureus
isolates
No. of of SEC
(%)
Cow milk 100 30 (9)C
(30%)
Buffalo milk 100 27 (5 )C (18.51%)
Total 200 57 (14)C (24.56%)
X2=1.011 P > 0.05
Obviously as it is shown in table (4-4), the high rat of SEC was detected
in Old Basrah market (41.66%) fallowed by Al-Ashar , Al-Hadi and Al-
Haretha (28.57%, 21.42% and 11.76%) respectively. There were no
significant differences (P > 0.05) in the rate of SEC genes of S.aureus isolates
among the regions of the study.
Only the band with suspected size 69bp (in case of SEC gene) observed
while no bands were observed in negative isolates figure (4-4).
Table (4-4). Distribution of SEC of S.aureus isolates from milk samples
in different regions.
Region No. of Milk sample
No. S.aureus Isolates
No. and Type of SEs (%)
Al-Haretha 50 17 (2)SEC (11.76%)
Al-Hadi 50 14 (3)SEC (21.42%)
Old Basrah market 50 12 (5)SEC (41.66%)
Al-Ashar 50 14 (4)SEC (28.57%)
Total 200 57 (14)SEC (24.56%)
X2 = 3.593 P > 0.05
Figure(4-3).Total genomic DNA extracted from S.aureus isolates using 1%agarose gel electrophoresis.
Figure (4-4) Electrophoresis in 2% agarose. M Lane= DNA ladder .Lane 1,2,3,4, =SEs 69 bp positive isolates. Lane 5,6,= negative isolates . Lane 7= control negative
genomic DNA
500bp
100 bp
69 bp
7 6 5 4 3 2 1 M
4-4.Susceptibility of S.aureus isolated from raw milk samples to the methicilin and vancomycin . By using disc diffusion method 57 isolates of S.aureus were tested for their
susceptibility toward methicillin and vancomycin (figure 4-6). All tested isolates
showed high susceptibility ( 100 % ) toward vancomycin. On the other hand ,
10.52% of these isolates revealed the resistance toward methicillin (Table 4-5).
There were no significant differences (P > 0.05) in the rate of MRSA was
isolated from cow and buffalo milk samples.
Table (4-5) Susceptibility of S.aureus isolated from milk samples to the methicillin and vancomycin.
Samples No. of
S.aureus isolates
MRSA MSSA VRSA VSSA
Cow milk 30 4(13.33%) 26(86.77%) 0(0%) 30(100%)
Buffalo
milk 27 2(7.40%) 25(92.60%) 0(0%) 27(100%)
Total 57 6(10.52%) 51(89.48%) 0(0%) 57(100%)
X2 =0.078 P > 0.05
Figure (4-5). Susceptibility of S.aureus isolates to methicillin and
vancomycin antibiotic .
4-5.Relationships between S.aureus biotypes and SEs.
The relationship between the biotypes with SEs can be explained as follows
33.33% of biotype C posses SEC gene while less percentage (13.33%) of
biotype A posses these gene was recorded (Table 4-6)
Obviously as it is shown in table (4-6) SEC gene were not detected in all the
strains that belong to non-specific biotype.
Table(4-6). Relationships between S.aureus biotypes andSEs.
Biotype No. of S.aureus isolates No. and type of SEs(%)
A 15 (2) C (13.33%)
C 36 (12) C (33.33%)
Non specific 6 (0)
4-6 .Relationships between MRSA and SEC The study of the relation between the SEC gene with susceptibility to the
methicillin showed that a higher percentage (83.33 %) of the strains which have
the ability to resist the methicillin harboring SEC while the strains that are
M VA VA
M
susceptible to the methicillin posses lower percentage (10.52%) of this gene
(Table 4-7) . There were high significant differences (P < 0.01) between MRSA
harboring SEC and MSSA harboring this gene.
Table(4-7) Relationships between MRSA and SEC in S.aureus strain. Resistance or susceptible
to methicillin
No. of S.aureus isolates No. of SEC(%)
MRSA 6 (5)C (83.33%)
MSSA
51 (9)C (17.64%)
Total 57 (14)C (24.56%)
X2 =9.207 P < 0.01 4-7. Assay for Enterotoxin Activity. Cell-free culture supernatants (crude toxin preparations) of the S.aureus
strains caused fluid accumulation when injected into rabbit ileal segments,
indicating enterotoxin activity. Dilatation index (DI) values ranged from 0.2 to
0.48. Moreover, there was a dark-reddish colouration of the positive ileal loops
(Figure 4-6) and the aspirated fluid from such segments appeared bloody.
Histopathological changes in sections collected from the rabbit ileum were
characterized by circulatory disturbances and inflammatory changes. Sections of
the intestine collected from non exposed (control) rabbits showed mucosae
(including glands) and submucosae with normal histomorphology (Figures 4-7),
while sections from rabbit’s ileum inoculated with crude toxin preparations
showed moderate to severe haemorrhage, Oedema and erosion and
inflammatory cells, In addition, there was destruction and sloughing of villi
(Fi
gur
es
4-
8,9,
10)
.
Fig (4-6) Ligated segments of rabbit ileal loop after injection with crude
preparations of staphylococcal enterotoxin (SE) produced under different growth
conditions. 1 – 6, SE produced at pH 8; 7-11, SE produced at pH 4 –there was
change to a brownish colouration with less fluid accumulation than the previous
pH; 12, segment inoculated with sterile saline (control).
2
3
1
4
6 7 8
9
10 11
12
5
Fig
(4-
7)
Sec
tion
of
con
trol
rab
bit
ileu
m
sho
wing normal villus (arrow) and intestinal gland. 125X H&E( )
Fig (4-8) Section of rabbit ileum inoculated with crude staphylococcal
enterotoxin ph 4, showing A) Erosion in the mucausal layer B) presences of
intestinal glands and the some of the villi which shows destruction and sloughing
C)Oedema 125X H&E ( )
B
A
C
Fig (4-9) Section of rabbit ileum inoculated with crude staphylococcal enterotoxin ph 8, showing A) large areas of hemorrhage in the wide area of mucosal erosion and complete absence of the villi B) infiltration of poly
morphonuclated cells. 125X H&E ( )
Fig (4-10) Section of rabbit ileum inoculated with crude staphylococcal
enterotoxin ph 8, A) Showing the infiltration of inflammatory cells in the
mucosal region most of them of acute form (neutrophils) B) Oedema 500X
B
A
A
B
H&E ( ).
CHAPTER 5
DISCUSSION
Discussion 5 . 1 . Occurrence of S.aureus in raw milk. Staphylococcal foodborne intoxication mainly (S. aureus) is reported to be one of
the most common form of bacterial foodborne outbreaks in many countries. The
overview of outbreak reports from 15 European countries indicates that milk and
dairy products were involved in 1 – 9 % (mean 4.8 %) of all the incriminated foods
in staphylococcal outbreaks (Echcpd, 2003).
In this study biochemical identification and serological confirmation were used
for S.aureus detection in raw milk samples obtained from Basrah markets. Different
works from different parts of the world give varying frequency of S.aureus
isolation from raw milk , some of which agree while others disagree with the
findings of the present study.
This microorganism was isolated in the present study from raw milk samples in a
Phylogenetic analysis of livestock oxacillin-resistant Staphylococcus aureus.J.
Veterinary Microbiology 126. 234–242.
Huber, H. ; Koller, S. ; Giezendanner, N. ; Stephan, R. and Zweife,C. (2010). Prevalence and characteristics of methicillin-resistant Staphylococcus aureus
in humans in contact with farm animals, in livestock, and in food of animal
