Determination of Onchocerca volvulus strains prevalent in ...

DETERMINATION OF ONCHOCERCA VOLVULUS STRAINS

PREVALENT IN THE NKWANTA NORTH DISTRICT OF GHANA

BY

ROWLAND ADUKPO

(10508507)

THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL

FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF MPHIL

MICROBIOLOGY DEGREE

UNIVERSITY OF GHANA

COLLEGE OF HEALTH SCIENCES

FEBRUARY, 2019

University of Ghana http://ugspace.ug.edu.gh

i

DECLARATION

I hereby declare that this thesis is my original work and has not been presented for a degree in

any other institution. I have duly acknowledged references made to other authors’ work in the

reference section of this thesis

Signature………………………………. Date………………………………

ROWLAND ADUKPO

(STUDENT)

Signature……………………………… Date………………………………

DR. SIMON KWAKU ATTAH

(SUPERVISOR)

Signature……………………………… Date……………………………

DR. PATIENCE B. TETTEH-QUARCOO

(SUPERVISOR)


ii

DEDICATION

To Hetty and Gabriella


iii

ACKNOWLEDGEMENTS

My sincere thanks and appreciation go to my supervisors, Dr. Simon K. Attah and Dr. Patience

B. Tetteh-Quarcoo for their patience, invaluable support and guidance throughout my course

work and during the preparation of this thesis. Special appreciation also goes to Prof. Yaw

Afrane and Prof. Kwamena W. C. Sagoe for their encouragement.

I wish to also express my profound gratitude to Dr. Michael Osei-Atweneboana, Head of the

Biomedical and Public Health Research Unit of the Council for Scientific and Industrial

Research (CSIR) for his mentorship and direction and also for allowing us to use the laboratory

for the bench work. Special thanks also go to the staff of the Biomedical and Public Health

Research Unit and the Molecular Biology Laboratory (CSIR) especially Dr. Samuel Armoo,

Edward Jenner Tettevi, Queenstar Naa Dedei Quarshie for their support. Special mention is to

be made of Mr. Isaac Owusu Frimpong for whom I am eternally grateful to for his technical

support and guidance during the molecular work. God bless you Ike for your sacrifice.

My appreciation also goes to Dr. Laud Boateng and his team at the Nkwanta North District

Health Directorate of the Ghana Health Service for facilitating the community entry and data

collection. I want to thank especially Mr Amatus Nambagyira and Dominic Nanga both of

Nkwanta North District Health Directorate and Mr. Reuben Tettey Martey and Michael Dicko of

the Pentecost Health Centre, Kpassa, for their support on the field. I also wish to thank all the

chiefs, elders and community leaders in the study communities.


iv

Additionally, I am eternally indebted to my wife Ms. Henrietta Appiah who is always available

to tell me in that sweet assuring voice “Rowland, you are capable, go for it”. To my siblings and

family, I say thank you for your love and support. Also to my very good friends; Francis Dzidefo

Krampa of West African Centre for Cell Biology of Infectious Pathogens (WACCBIP), Israel

Mensah-Attipoe of the Department of Medical Microbiology, School of Biomedical and Allied

Health Sciences and Richard Kutame of the National Public Health and Reference Laboratory,

Korle-Bu for the diverse roles they played in making this work a success.

And finally, to God be the glory and great things He has done.


v

TABLE OF CONTENTS

DECLARATION ........................................................................................................................................... i

DEDICATION .............................................................................................................................................. ii

ACKNOWLEDGEMENTS ......................................................................................................................... iii

LIST OF FIGURES ..................................................................................................................................... ix

LIST OF ABBREVIATIONS ....................................................................................................................... x

ABSTRACT ................................................................................................................................................. xi

CHAPTER ONE ........................................................................................................................................... 1

1.0 INTRODUCTION .................................................................................................................................. 1

1.1 General introduction ........................................................................................................................ 1

1.2 Research problem ............................................................................................................................. 3

1.3 Justification ....................................................................................................................................... 5

1.4 Aim of the study ................................................................................................................................ 5

1.5 Specific objectives ............................................................................................................................. 5

CHAPTER TWO .......................................................................................................................................... 6

2.0 LITERATURE REVIEW ....................................................................................................................... 6

2.1 Onchocerca volvulus ......................................................................................................................... 6

2.2. The genome of Onchocerca volvulus ............................................................................................... 8

2.2.1 The coding sequence .................................................................................................................. 8

2.2.2 The non-coding sequences ......................................................................................................... 9

2.3 Life cycle of Onchocerca volvulus .................................................................................................. 10


vi

2.4 Epidemiology and socioeconomic significance of Onchocerca volvulus ..................................... 12

2.5. Clinical manifestations and pathogenesis of onchocerciasis ...................................................... 15

2.5.1 Ocular onchocerciasis .............................................................................................................. 15

2.6 Parasite, vector and host dynamics of onchocerciasis ................................................................. 21

2.7 Laboratory diagnosis of Onchocerca volvulus .............................................................................. 24

2.7.1 Skin snip microscopy ............................................................................................................... 25

2.7.2 Mazzotti test ............................................................................................................................. 25

2.7.3 Immunological tests ................................................................................................................. 26

2.7.4 Molecular techniques ............................................................................................................... 26

2.8 Onchocerciasis control .................................................................................................................... 27

CHAPTER THREE .................................................................................................................................... 31

3.0 MATERIALS AND METHODS .......................................................................................................... 31

3.1 Study area and population ............................................................................................................. 31

3.2 Sample size calculation ................................................................................................................... 33

3.3 Sampling techniques ....................................................................................................................... 33

3.3.1 Community selection and inclusion criteria .......................................................................... 33

3.3.2 Participants selection ............................................................................................................... 34

3.3.4 DNA extraction of O. volvulus from skin snips ...................................................................... 35

3.3.5 Onchocerca volvulus DNA amplification using diagnostic primer ...................................... 35

CHAPTER FOUR ....................................................................................................................................... 38

4.0 RESULTS ............................................................................................................................................. 38


vii

4.1 Analysis of skin snip microscopy and O. volvulus DNA PCR results ......................................... 38

4.1.2 Analysis of skin microscopy and DNA PCR results by occupation ..................................... 39

4.2 Analysis of results of Clinical manifestations of onchocerciasis ................................................. 39

4.2.1 Analysis of subjects manifesting onchocercal lesions by sex ................................................ 39

4.2.2 Analysis of subjects manifesting onchocercal lesions by age groups ................................... 40

4.2.3 Analysis of subjects manifesting onchocercal lesions by occupation ................................... 40

4.3 DNA results analysis ....................................................................................................................... 41

4.3.1 Detection of O. volvulus using Diagnostic primers ................................................................ 41

4.3.2 Analysis of PCR test results for determination of O. volvulus strain using forest strain

specific primers ................................................................................................................................. 43

CHAPTER FIVE ........................................................................................................................................ 45

5.0 DISCUSSION, CONCLUSION AND RECOMMENDATIONS ........................................................ 45

5.1 Discussion......................................................................................................................................... 45

5.2 Conclusion ....................................................................................................................................... 49

5.3 Limitations ....................................................................................................................................... 50

5.4 Recommendations ........................................................................................................................... 50

REFERENCES ........................................................................................................................................... 51

APPENDICES ............................................................................................................................................ 75

APPENDIX 1 .............................................................................................................................................. 75

PARTICIPANT INFORMATION FORM ................................................................................................. 75

APPENDIX 2 .............................................................................................................................................. 77


viii

INFORMED CONSENT FORM ................................................................................................................ 77

APPENDIX 3 .............................................................................................................................................. 78

ETHICAL CLEARANCE .......................................................................................................................... 78

APPENDIX 4 .............................................................................................................................................. 79

QUESTIONNAIRE .................................................................................................................................... 79


ix

LIST OF FIGURES

Figure 1. Adult female worms of Onchocerca volvulus ................................................................ 7

Figure 2. Microfilaria of Onchocerca volvulus............................................................................... 7

Figure 3. Life cycle of Onchocerca volvulus ................................................................................ 11

Figure 4. Distribution of onchocerciasis worldwide, 2014. ......................................................... 14

Figure 5. Sclerosing keratitis in onchocerciasis. © Ian Murdoch & Allen Foster, 2001 ............. 17

Figure 6. Lichnenified onchodermatitis in a young male ............................................................ 20

Figure 7. Chronic onchodermatitis with Leopard spotting over lower legs ................................. 20

Figure 8. Chronic onchodermatitis producing a Lizard skin appearance in a young patient....... 20

Figure 9. District map of Nkwanta North ..................................................................................... 32

Figure 10. Agarose gel electrophoresis pattern for amplification products of samples from

Kabonwule (KA) in lanes 3, 4, 7, 8 and 9 by OV Diagnostic primers ......................................... 42

Figure 11. Agarose gel electrophoresis pattern for amplification products of samples from

Lemina (LM) in lanes 3, 4, and Controls from Agborlekame ABI, AB2 AB3 in lanes 6, 7, 8 and

Asubende ASU 1, ASU 2, ASU3 IN lanes9, 13, and 14 and forest controls in lane FSP 1,FSP 2,

FSP 3 and FSP 4 in lanes 5,10, 11, 12, by OV diagnostic primer. ............................................... 42

Figure 12. Agarose gel electrophoresis pattern of savannah controls in lanes 2, 3, 4, 6, 7, 8 and 9

showing no amplification with nested PCR primers. Lanes 5, 10, 11 and 12 amplified with the

nested PCR producing amplicon size of 153 bp. .......................................................................... 44


x

LIST OF ABBREVIATIONS

APOC – African Programme for Onchocerciasis Control

CDC – Centres for Disease Control and Prevention

CDTI – Community-Directed Treatment with Ivermectin

DALYs- Disability-Adjusted Life Years

DNA-Deoxyribonucleic acid

IVM – Ivermectin

LAMP- Loop Mediated Isothermal Amplification

L3- Infective stage larvae of O. volvulus

MDA – Mass Drug Administration

MF – Microfilariae

NTD - Neglected Tropical Disease

NTDCP – Neglected Tropical Disease Control Programme

OCP – Onchocerciasis Control Programme in West Africa

OEPA – Onchocerciasis Elimination Programme for the Americas

OSD- Onchocercal Skin Diseases

REMO- Rapid Epidemiology Mapping of Onchocerciasis

WHO – World Health Organization


xi

ABSTRACT

Background

Onchocerca volvulus is a filarial parasite that causes onchocerciasis or ‘river blindness’. Two

strains of the parasite exist in West Africa namely, savannah and forest strains. They differ

significantly in epidemiology, disease severity and are specific to different vectors. The savannah

strain found in West Africa is associated with blindness while the forest strain, on the other hand,

causes less severe ocular diseases even in individuals with high parasite load. Information

obtained from some workers of the Onchocerciasis Chemotherapy Research Centre who carried

out some investigations in the Nkwanta North district suggested that the MF of the parasite

appear morphologically longer, a character that is associated with the savannah strain. However,

the preponderance of the ocular manifestations in patients that are usually associated with the

savannah strain was absent in the patients. The lack of empirical data to address this issue calls

for further investigation and research in this area. Therefore, this study was aimed at

characterizing the strain types of O. volvulus present in these communities and evaluating clients

for clinical lesions of onchocerciasis.

Methodology

Subjects who consented to participate in the study were physically examined for clinical signs of

onchocerciasis, particularly; skin rashes, depigmentation (leopard skin), visible and palpable

nodules as well as visual acuity assessment using the Snellen chart. Skin snips were collected

and examined microscopically for O. volvulus MF. The residual skin snips were analyzed for O.

volvulus DNA using conventional PCR. A nested-PCR was performed on positive samples with

a forest strain specific primer to further characterize the strain type.


xii

Results

A total of 218 participants were enrolled. The most predominant clinical manifestations among

the participants was rashes/itches 15.1% (33/218) followed by visual impairment (low vision,

severe low vision and profound low vision) 8.3% (18/218). Palpable nodules were found in only

0.5% (1/218) of the study participants while lizard and leopard skin presentations were absent.

About 9.2% (20/218) participants were positive for O. volvulus DNA PCR as compared with

3.7% (8/218) by microscopy (p< 0.05). All the 20 O. volvulus samples were classified as

savannah strains by the nested PCR analysis.

Conclusion

The results from this study suggest that the Nkwanta North district is endemic for savannah

strains of O. volvulus. The prevalence of the savannah strains in these communities may indicate

a changing trend in the vector population as a consequence of deforestation and climate change.

The prevalent clinical manifestations found among the study subjects were predominantly skin

rashes/itches and ocular lesions with blindness in just 0.5% of the participants. The generally low

prevalence of clinical manifestations and MF in skin snip microscopy is an indication of success

of several years of control activities in these communities in spite of evidence of disease

transmission in the area.


1

CHAPTER ONE

1.0 INTRODUCTION

1.1 General introduction

Onchocerciasis or ‘river blindness’ is one of the neglected tropical diseases (NTDs) that causes

both health and socio-economic problems in the affected communities (Crump et al., 2012). It is

a chronic disease caused by the filarial nematode parasite, Onchocerca volvulus.

Onchocerciasis is endemic in 30 countries in Africa which accounts for over 99% of people

infected worldwide. It is also present in small foci in 6 Latin American countries as well as

Yemen (WHO, 1995, 2010). It has been estimated that about 123 million people globally were

at risk of contracting the infection with 18 million actually infected of whom 500,000 were

severely visually impaired. In addition, 270,000 were completely blind due to the disease

(WHO, 1995). However, a more recent estimates indicated that about 37 million people are

infected with at risk population in Africa standing at 90 million (Basáñez et al., 2006). In

Ghana, the disease is endemic in nine (9) out of the ten (10) regions with an estimated 3.2

million people in 3,204 communities in 66 districts at risk of the infection (Taylor et al., 2009).

Infection with O. volvulus results in relentless itching and debilitating skin lesions as well as

visual impairment and ultimately blindness. Onchocerciasis has serious socio-economic

consequences, which includes depopulation of arable lands along river valleys. It also leads to

reduction in productivity of affected persons (Murdoch et al., 2002). The disease is second to

trachoma as the leading cause of blindness due to infection in the developing world (Thylefors


2

et al., 1995; WHO, 2001). Onchocerciasis is least prevalent in individuals aged between 0 and

10 years, but highest in those aged between 20 and 30 years (Anosike & Onwuliri, 1995;

Michael, et al., 1996; Little, et al., 2004). The reason for the low prevalence in the 0 to 10 year

old group who are of school going age is largely due to reduced bites from the blackflies whose

biting activity is greatest in the mornings. The disease is generally more prevalent in males than

in females (Anosike & Onwuliri, 1995; Hailu et al., 2002; Wogu & Okaka, 2008). This is due to

increased exposure to blackfly bites in men as they go about their daily tasks that include

fishing, farming and hunting (Little et al., 2004; Wogu & Okaka, 2008).

Onchocerciasis exhibits a wide range of clinical spectrum from an asymptomatic infection or

generalized onchocerciasis to severe conditions such as blindness and chronic skin diseases

(Hoerauf et al., 2005). The host’s immune response to the dead or dying microfilariae (MF) is

responsible for the eye damage and skin manifestations in onchocerciasis (Tamarozzi et al.,

2011). It has been proposed that an rickettsia-like endosymbiont bacterium of O. volvulus,

Wolbachia rather than the parasite itself is the driver of the immunopathology associated with

the disease (Andre et al., 2002; Gillette-Ferguson et al., 2006).

There is no protective vaccine or chemoprophylactic drug against O. volvulus; therefore the

control and elimination programmes being carried out currently depend on ivermectin (IVM) as

the only safe and effective drug available for mass drug administration (Webster et al., 2014;

WHO, 2017). Ivermectin, as a single dose of 150 µg/kg body weight, is a highly microfilaricidal

agent which clears MF from the skin for many months and also inhibits uterine release of MF

by adult female worms (Schulz-Key, 1990; Basáñez et al., 2006; Lustigman & McCarter, 2007).


3

Simulium flies or blackflies are the obligate intermediate hosts of O. volvulus (Hall &

Pearlman, 1999), and many species of these flies have been involved in the transmission of the

parasite (Crosskey, 1990.). The relative vectorial roles of the flies have contributed to shape the

different transmission patterns across the endemic areas (Basáñez et al., 2006). Simulium

damnosum sensu lato (s.l.) (species complex), consisting of about 60 cytoforms, is the vector

responsible for more than 95 percent of onchocerciasis cases in Africa (Crosskey, 1990). The

main vectors of O. volvulus in Latin America are S. ochraceum s.l. (the principal vector), S.

metallicum s.l., S. guianense s.l. and S. exiguum s.l. (Boakye et al., 1998).

The blackflies breed in fast-flowing aerated rivers and the infective stage larvae (L3) of the

parasites are released from infected blackflies when they take blood meal. In the human host,

surviving infective stage larvae undergo two moults to develop into adult male and female

worms which live inside thick fibrous nodules (Basáñez & Boussinesq, 1999).

1.2 Research problem

Prior to the implementation of the Onchocerciasis Control Programme (OCP), the risk of

onchocercal blindness was very high in the West African savannah areas. In some communities,

blindness reportedly affected up to 50% of adults and consequently for the fear of contracting

the disease, people abandoned the fertile lands along river valleys. In the 1970s, a whopping

US$30 million was estimated as economic losses due to onchocerciasis, making it a major

obstacle to socioeconomic development (WHO, 2016).


4

Despite almost four decades of onchocerciasis control in Ghana, the disease is still endemic in

all regions of Ghana except the Greater Accra region with the at risk population of infection

estimated at 3.2 million in 3,204 communities in 66 districts (Taylor et al., 2009).

There is evidence that in West Africa, at least two strains of O. volvulus exist (Cianchi et al.,

1985; Dadzie et al., 1989; Remme et al., 1989). These strains differ significantly in their

transmission by Simulium vectors, their general epidemiology and the severity of clinical

manifestation (Duke, 1976). The savannah strain found in West Africa is associated with

blindness in large proportions of individuals it infects while the forest strain, on the other hand,

has been found to be less likely to cause blindness, even in individuals with high parasite load

(Dadzie et al., 1989; Remme et al., 1989). Some reports indicated that the blindness rate among

infected people in the savannah is up to a maximum of 15% which is higher than that in the

forest where the rate is usually about 2%. In the forest areas severe eye problems such as

sclerosing keratitis is mostly not common but, rather, skin manifestations predominate (Duke,

1981).

Information obtained from some workers of the Onchocerciasis Chemotherapy Research Centre

(OCRC) who carried out some investigations in the Nkwanta North district suggested that the

MF of the parasite appear morphologically longer, a character that is associated with the

savannah strain. However, the prevalence of the ocular pathology that are usually associated

with infection of the savannah strains is absent in these communities. This observation is casual

and not based on any empirical data, warranting further research work. The present study

therefore sought to identify the strain type present in these communities.


5

1.3 Justification

There is little evidence from available literature on the strain type present in the Nkwanta North

district of Ghana. The study, if carried out, will add on to existing knowledge by providing

information on the type(s) of strain present in that community. This information will be useful

for disease mapping and treatment schedules and epidemiological investigation in the area. This

information will also be useful in the search for chemotherapy and vaccine development since

some drugs and vaccines could be strain specific. It will also be useful in monitoring drug

resistance should this also be associated with a particular strain.

1.4 Aim of the study

The main objective of the study was to characterize the O. volvulus strains prevalent in the

Nkwanta North District.

1.5 Specific objectives

The specific objectives of the study are to determine the:

1. Onchocerca volvulus strains prevalent in the Nkwanta North district;

2. predominant clinical manifestation of onchocerciasis among the population in the

district.


6

CHAPTER TWO

2.0 LITERATURE REVIEW

2.1 Onchocerca volvulus

The genus Onchocerca consists of 28 parasite species of large hoofed animals (Anderson, 2000)

except the dog parasite O. lupi (Eberhard et al., 2000; Egyed et al., 2002) and the human

parasite O. volvulus (Hall & Pearlman, 1999). The matured adult male of O. volvulus measures

up to 5 cm in length and diameter of 0.02 mm while the much larger females measure between

30 cm and 80 cm in length and diameter of 0.04 mm (Fig 2.1) (Forgione, 2002). The adult

worms are normally found in subcutaneous nodules or onchocercomata which are most easily

seen on bony prominences (Okulicz et al., 2004), where they live for up to 15 years

(Ranganathan, 2012). The adult female worms generally remain in the nodules while the

itinerant adult male worms move between nodules inseminating the females (Brattig, 2004).

The much migratory unsheathed MF (Fig 2.2) which are usually associated with disease

manifestations measure between 220 µm and 360 µm in length and diameter between 5 µm and

9 µm. The MF have a life span of up to 2 years (CDC, 2016).


7

Figure 2.1. Adult female worms of Onchocerca volvulus

Source; https://microbewiki.kenyon.edu/index.php/Onchocerciasis_ (Onchocerca_volvulus

Figure 2.2. Microfilaria of Onchocerca volvulus

Source; https://web.stanford.edu/group/parasites/ParaSites2006/Onchocerciais/parasite.htm


https://web.stanford.edu/group/parasites/ParaSites2006/Onchocerciais/parasite.htm

8

2.2. The genome of Onchocerca volvulus

2.2.1 The coding sequence

The nuclear genome of O. volvulus has been estimated to be approximately 1.5X 108 bp

consisting of three pairs of autosomes and a pair of dimorphic sex chromosomes (Donelson et

al., 1988; Post, 2005). Based on the analysis of RNAseg data from eight stages of O. volvulus

life cycle the total number of protein-coding genes was predicted to be 12,143. Approximately

91% of these genes were shared with other nematodes with just 9% being specific for O.

volvulus which shares little or no homology with other human nematodes (Cotton et al., 2016).

Structurally, these genes are compact averaging approximately 5 kbp in size and interrupted

repeatedly by several small introns measuring between 100 and 300 bp. Similarly, the exons are

small with median length of 124 bp (Unnasch & Williams, 2000).

There is a high level of variation observed in gene density, GC content and repeat density of O.

volvulus genome which is relatively AT-rich with an overall AT content of 68% but with slight

variation between the intron sequences (73%) and exons (61%) (Unnasch & Williams, 2000).

The intron-exon boundaries of these genes generally follow the GU-AG rule which is

characteristic of the splice donor and acceptors of other vertebrate organisms except that there

are some observed variations in the conserved GU and AG sequences at the 5´ and 3´ ends of

the introns. It has also been observed from the genes examined so far that the most conserved

positions in the intron are five nucleotides from each end. This conclusion was drawn from the

finding that at the 5´ end of the intron, a purine is found at position +5 in 83% of the introns and

at the 3´ end, a pyrimidine is found at position -5 in 88% of the introns (Aroian et al., 1993).


9

The mRNAs of O. volvulus contain 22-nucleotide spliced leader (SL) at their 5´ ends with the

genes encoding the SL RNA encoded in the intragenic region of the spacer of the 5S rRNA

gene cluster (Zeng et al., 1990).

2.2.2 The non-coding sequences

The best characterized non-coding sequence of O. volvulus is that of the O-150 family. It is a

distinct, variable and tandemly repeated sequence with a unit length of approximately 150 bp

which is organized into large tandem arrays (Erttmann et al., 1987; Meredith et al., 1989). Cross

hybridization and PCR experiments using degenerate primers have shown that these sequences

are found only in the genus Onchocerca but not in any other nematodes or the vectors. Thus,

probes and primers can be used to identify specific sequences within the O-150 family to

distinguish O. volvulus from other Onchocerca species as well as characterize the strains of O.

volvulus (Erttmann et al., 1987 and 1990; Ogunrinade et al., 1999; Adewale et al., 2005).

2.2.3 The mitochondrial genome

The mitochondrial genome of O. volvulus is the smallest among the metazoan mitochondrial

genomes described to date, only 13,747 bp in size (Keddie et al., 1998). In keeping with the

compact nature of the genome, four gene pairs overlap, eight contain no intergenic regions and

the remaining gene pairs are separated by small intergenic regions with sizes ranging from 1 to

46 bp. The genome contains two ribosomal RNA genes, genes for 12 mitochondrial proteins

and genes for 22 transfer RNAs (Keddie et al.,1998). The protein-coding genes of the O.

volvulus mitochondrial genome exhibit extreme codon bias, where for 15 out of the 20 amino

acids, a single member of the codon is used more than 70% of the time. There is limited


10

intraspecific variation in both the nuclear and mitochondrial genomes of O. volvulus (Unnasch

& Williams, 2000).

2.3 Life cycle of Onchocerca volvulus

The life cycle of O. volvulus begins when the adult blackfly during a blood meal ingests the

MF. After ingestion, the MF which survive the peritropic membrane that forms around the

blood meal penetrate the midgut and migrate to the thoracic muscles of the blackfly and

differentiate into L1 larvae. By 96 hours the L1 undergo the first moult to form L2 larvae which

after a second moult by day 7 differentiate into the third-stage infective larvae (L3) (Burnham,

1998). The L3 now move to the mouth parts of the blackfly. The cycle of transmission

continues when during a blood meal, an infected blackfly introduces infective filarial larvae

onto the skin of the human host, where they penetrate into the bite wound (Burnham, 1998;

CDC, 2016). Once in the subcutaneous tissues the larvae undergo moulting to L4 stage to reach

adult stage in about one year (Bari & Rahman, 2007) and become encapsulated in the nodules

(Burnham, 1998). The female worm produces numerous oocytes which when not fertilized

degenerate within the uterus (WHO, 1995). When the female is fertilized, MF develop in 3-12

weeks and are released from the uterus. MF move freely through the skin and connective tissue

and ultimately reach the eye. They can be found also in the blood, cerebrospinal fluid, urine and

internal organs (Duke, 1993).


11

Figure 2.3. Life cycle of Onchocerca volvulus

https://www.cdc.gov/dpdx/onchocerciasis/index.html



12

2.4 Epidemiology and socioeconomic significance of Onchocerca volvulus

Onchocerciasis is endemic in 37 countries, of which 30 are in sub-Saharan Africa. The endemic

area starts from Senegal in the west to Ethiopia in the east and extends to the south of the

equator from Angola in the west to Tanzania in the east. Pockets of onchocerciasis exist in

Sudan and Yemen (WHO, 2008). The disease is also endemic in small foci in 6 Latin American

countries. The disease burden of O. volvulus has been largely underestimated in earlier literature

with just 18 million people reportedly infected with onchocerciasis (WHO, 1995). However,

since then, the true extent of the disease burden has been determined by the Rapid

Epidemiology Mapping of Onchocerciasis (REMO), which uses the prevalence of palpable

nodules as proxy for infection. Thus, by the end of 2005, using REMO, over 22,000 additional

villages outside the OCP region have been surveyed leading to the discovery of a lot more

endemic areas. As a result, the current prevalence of onchocerciasis globally is estimated at 37

million with about 90 million people in Africa at risk of infection (Basáñez et al., 2006).

Onchocerciasis is a clinical condition which is generally characterized by skin, eye, lymphatic

and sometimes systemic manifestations with the most severe lesion being blindness (Nwoke,

1992). It has been estimated that approximately 270,000 people are blind and 500,000 suffer

from visual impairment globally as a direct result of onchocerciasis (WHO, 1995). A further

40,000 new blind cases are added to these figures each year (Alonso et al., 2009).

In addition to the debilitating health problems, onchocerciasis have caused serious social and

economic problems to individuals and entire communities. For example, Remme (1989) quoting

from an unpublished document of Rolland and Balay (1986), stated that over 41,000 km2 of

fertile land in river valleys in Burkina Faso was uninhabited as a result of onchocerciasis.


13

It has been reported that onchocerciasis contributed to the loss of an estimated 1 million DALYs

annually globally, with severe itching accounting for 60% and visual impairment and blindness

making up the remaining 40% (Remme, 2004). It has been documented that the presence of

onchocercal skin lesions affected the ability of the patients to interact with peers thereby

reducing their marriage prospects. Onchocercal skin disease (OSD) has also been blamed for

poor school performance and a high dropout rates in affected communities. In addition,

productivity of these individuals is affected as a result of time spent out of work and health

related costs. Furthermore, victims of onchocerciasis suffer embarrassment, sleeplessness, and

reduced concentration (Wagbatsoma & Okojie, 2004; Wogu & Okaka, 2008).


14

Figure 2.4. Distribution of onchocerciasis worldwide, 2014. (Source: WHO, 2015)


15

2.5. Clinical manifestations and pathogenesis of onchocerciasis

Previously, the view was held that filarial products were the major causes of the underlying

inflammatory reactions, however, there is now a growing evidence to show that an obligatory

endosymbiotic rickettsia-like bacteria, Wolbachia have been incriminated in the clinical

manifestations of the disease and in adverse reactions after treatment (Hoerauf et al., 2003). The

main clinical manifestation of the disease are mainly observed in the eyes and skin with

troublesome itching being the most common early clinical symptom (Alonso et al., 2009).

Although the mechanisms are not fully understood, musculo-skeletal pains and reduced body

mass index are the systemic conditions associated with onchocerciasis (Kale, 1998). In addition,

there is evidence from available literature which links onchocerciasis to epilepsy (Marin et al.,

2006; Pion et al., 2009).

2.5.1 Ocular onchocerciasis

It is now understood that the migratory MF enter the cornea from the skin and the conjunctiva

leading to ocular pathology which is generally classified into anterior and posterior eye diseases

(Abiose, 1998).

The posterior ocular onchocerciasis presents with atrophy of the retinal pigment epithelium

which later becomes widespread. Evidence from experimental studies showed that autoimmune

responses are involved in posterior ocular onchocerciasis. This was based on the observation

that patients show persistent, low level, progressive pathologic changes of the retina and

pigment epithelium even after treatment (Semba et al., 1990). The role of reactive antigens in

posterior ocular onchocerciasis was demonstrated by McKechnie and colleagues (1997), who

injected rats with 39 kDa O. volvulus protein and found that the antibodies cross-react with a 44


16

kDa, human retinal protein. They observed that the animals developed many pathological

changes in the posterior region but none in the anterior region of the eye (McKechnie et al.,

1997).

The anterior segment onchocerciasis mostly affects the cornea even though other parts of the

anterior segment can be affected. This is initiated by inflammatory reactions to dead or dying

MF and presents as completely separate areas of corneal opacification (punctate keratitis). As a

result of heavy infection or continued exposure to the parasites, these opacities coalesce and

sometimes become hyper pigmented (sclerosing keratitis) leading to visual impairment and

ultimately to blindness. Blindness resulting from onchocerciasis is mainly due to this condition

(Pearlman & Hall, 2000).


17

Figure 5. Sclerosing keratitis in onchocerciasis. © Ian Murdoch & Allen Foster, 2001

Source: Community Eye Health Journal, Vol 14. No. 382001


18

Although onchocerciasis is associated with skin and eye lesions, the disease pattern varies

considerably between geographical zones with ocular pathology being more common in hyper

endemic localities within the savannah bioclimes while the forest communities are characterized

by dermal manifestations of the disease (Dadzie et al., 1989; Murdoch et al., 2002). This

difference in disease presentation has been attributed to many factors but evidence from clinical,

epidemiological, and genetic studies have all shown that O. volvulus exists as two strains in

West Africa. Some researchers have attempted to link the differences in pathogenesis between

the two strains of O. volvulus to the differences in their Wolbachia load. The evidence in

support of this observation was provided by the quantitative measurement of the amount of

Wolbachia DNA per nuclear genome of adult O. volvulus and it was found to be significantly

higher in savannah strains than in forest strains (Higazi et al., 2005). This correlation between

Wolbachia DNA copy number and blindness was disputed by Armoo et al, (2017). Much as

Armoo and colleagues also found significant heterogeneity in the Wolbachia DNA ratio

between savannah and forest strains, they found the linkage problematic. They argued that

because Higazi and colleagues used whole nodule for the analysis which means that there could

be an unknown mix of parasites it is difficult to understand what the Wolbachia density actually

means in the light of the findings of Higazi and colleagues. Armoo and colleagues held the

opinion that histological data from studies conducted on Brugia malayi by Fischer, et al, (2011)

suggest less variation in Wolbachia density in MF and therefore concluded that since the

immunopathology is caused by the MF and not adult worms the Wolbachia density may not be

the cause of the difference in pathology by the parasites in the two ecotypes.


19

2.5.1 Onchocercal skin disease

The skin is the main organ affected by onchocerciaisis with a variable spectrum of skin lesions

(Murdoch et al., 1993). The initial manifestations of cutaneous onchocerciasis which can occur

anywhere include itching, scratching and alterations in skin pigmentation (Bari & Rahman,

2007). The mildest form of cutaneous onchocerciasis presents as itching with localized

maculopapular rash which may disappear completely without any treatment or may progress to

chronic papular dermatitis. In some cases, bleeding, ulceration and secondary infection may

occur as a result of excessive scratching (Burnham, 1998). The pathology of onchocercal skin

disease may be associated with generalized lichenified skin condition known as “leopard skin”

(Greene et al., 1983). With prolonged exposure to active infections, degenerative skin changes

usually set in with the destruction of elastic fibres which leaves the skin very thin and wrinkled.

The atrophied skin begins to sag, resulting in the so-called “hanging groin” in extreme cases

(Greene et al., 1983); Brattig et al., 1994).

A less common and localized chronic papular dermatitis called Sowda is often confined to one

extremity and is most commonly found in certain geographical regions such as Sudan and

Yemen. This condition is associated with local lymphadenopathy as a result of exceptionally

strong IgG response (Cabrera et al., 1988; Murdoch et al., 1993).


20

Figure 7. Chronic onchodermatitis with Leopard

spotting over lower legs

Source; : Arfan ul Bari & Simeen Ber Rahman.

Journal of Pakistan Ass. of

Dermatologists,2007

Figure 6. Lichnenified onchodermatitis in a

young male

Source; : Arfan ul Bari & Simeen Ber Rahman.

Journal of Pakistan Ass. of Dermatologists,2007

Figure 8. Chronic onchodermatitis producing a Lizard skin appearance in a young patient

Source: Arfan ul Bari & Simeen Ber Rahman.Journal of Pakistan Association of

Dermatologists, 2007


21

2.6 Parasite, vector and host dynamics of onchocerciasis

The clinical pattern of onchocerciasis with regards to the preponderance of blindness and skin

lesions, varies considerably between geographical zones and even between different ecotypes

within a single region (Remme et al., 1989). The most striking of these differences is mostly in

the prevalence of more blindness due to onchocerciasis in the savannah than forest regions of

West Africa. Among the savannah populations, blindness is present in hyper endemic

communities with little or no blindness found in forested communities with a comparable level

of endemicity (Duke, 1981; Dadzie et al., 1989; Remme et al., 1989). These observations of

greater severity and high preponderance of blindness in the savannah regions were the reasons

why the Onchocerciasis Control Programme (OCP) was originally limited to the savannah

regions of West Africa (WHO, 1987).

A number of hypotheses have been put forward to explain this difference in clinical

manifestation of onchocerciasis in the savannah and forest regions but the most widely accepted

hypothesis is that intrinsic differences exist among the strains of parasites occurring in the forest

and savannah zones (Duke, 1981). Initial evidence to support this “strain difference” hypothesis

was provided by vector switch experiment conducted in Cameroon (Duke, 1966; Duke et al.,

1966). They concluded from the findings that separate strains of O. volvulus exist in the forest

zones of Cameroon and that of the Sudan savannah each of which is adapted for transmission by

a different form(s) of S. damnosum s.l.

Also, this savannah-forest strain hypothesis was experimentally demonstrated by

subconjunctival injection of forest and savannah strains into rabbits by Duke and colleagues

(1972). They observed that MF of the savannah strain induced a more severe inflammatory


22

response in the cornea compared to those of the rain forest strain (Duke & Anderson, 1972;

Garner et al., 1973). Another evidence in support of the strain difference hypothesis came from

isoenzyme studies on adult O. volvulus obtained from representative bioclimatic zones in Zaire,

Ivory Coast and Mali (Cianchi et al., 1985). Even though they used a limited number of

samples, Cianchi and colleagues concluded that there are genetic differences between the

savannah and forest strains. Subsequent studies using oligonucleotide DNA probes led to the

identification of DNA sequences specific for the two strains of the parasite (Erttmann et al.,

1987 and 1990) and classification of these strains based on sequence showed that strains from

the forest zones are different from those from the savannah regions (Meredith et al., 1989;

Zimmerman et al., 1993).

However, this “two strain” hypothesis does not seem to apply to parasites from other regions of

Africa. For example, using the forest strain specific probes, Fischer et al. (1996) observed a

pattern of hybridization which does not fit the classical savannah-forest categorization i.e.

neither the forest nor savannah probes hybridized with the S. neivei-transmitted O. volvulus in

Uganda. Prior to this finding, Kron and Ali (1993), reported that the DNA sequence of O-150

family from O. volvulus isolates obtained from northern Sudan were different from those

obtained from West Africa. This goes to support the preliminary hypothesis that there are

differences in the parasites present in the western and eastern foci of onchocerciasis in Africa

(Kron & Ali, 1993). In another study conducted in Sudan by Higazi et al. (2001) in which O-

150 repeat analysis performed on DNA of parasites obtained from the three onchocerciasis

hotspots in Sudan and other parts of Africa were compared, they found that sequences from

isolates obtained from eastern Sudan and Yemen are genetically indistinguishable from those

obtained from West Africa. However, they observed that clinical and epidemiological picture of


23

the disease seen in these foci in Sudan and Yemen do not resemble the pattern observed in West

Africa.

A complication of the forest savannah dichotomy is the rampant deforestation in the West

African sub-region which has allowed invasion by savannah flies in these areas which were

previously not ecologically suitable for them (Baker et al., 1990). High levels of blindness (5.5

%) was reported in a deforested region of Sierra Leone (Zimmerman et al., 1992; Wilson et al.,

2002) This observation was attributed to the fact that the savannah species, S. damnosum s.s and

S. sirbanum are able to migrate over a distance of 500 km with the attendant possibility of

reintroduction of O. volvulus into areas previously brought under control (Wilson et al., 2002).

Simulium damnosum Theobald complex are currently the only known vectors of human

onchocerciasis of which nine species have been identified in the areas covered by the OCP.

These are S. damnosum s.s., S. squamosum, S. sanctipauli, S. leonense, S. soubrense, S.

yahense, S. sirbanum, S. konkourense and S. dieguerense. Using chromosomal studies some

variant forms have been identified within these species (Boakye, 1993).

According to the Onchocerca-Simulium complexes concept which involves savannah and

forest strains of the parasite, the vectors also differed in these bioclimatic regions (Duke et al.,

1966). Evidence now abounds that forest vectors such as S. yahense and members of the S.

sanctpauli sub-complex have higher average parasite loads than in savannah vectors such as S.

damnosum and S. sirbanum. Furthermore, the number of infective larvae transmitted by S.

damnosum and S. sirbanum are generally lower than those transmitted by S. yahense and by

most members of the S. sanctipauli sub-complex (Cheke & Garms, 2013). The two strain

hypothesis has been used to explain the observations that the savannah vectors transmit blinding


24

form of the parasite but Garms and Cheke (2013) countered with arguments that there were

reports of blindness in forest areas where the vector was S. yahense. All these data put together

led to Fischer and Buttner (2002) to suggest that there could be a spectrum of different strains of

O. volvulus and they stated that “It appears reasonable to conclude that several different strains

of O. volvulus occur throughout its large distribution area, but strain differences are not

sufficient to explain all the geographic variation of the disease. The human host, biting habit of

the vector or environmental factors may also influence the clinical picture of onchocerciasis.”

The competence of a member of a particular vector species complex to transmit parasite strain

was demonstrated through a number of cross-infection experiments in which flies were fed on

MF of the same and distant localities. These localities were as diverse as within West Africa,

between West Africa and Guatemala (De Leon & Duke, 1966), West Africa and northern

Venezuela, Guatemala and northern Venezuela (Takaoka et al., 1986) and then between the

northern and Amazonian foci within Venezuela (Basáñez et al., 2000). The conclusion drawn

from the results of these experiments was that there is a strong local adaptation between the

parasites and vectors within well-established endemic areas. Thus, regardless of location, these

vectors have their own unique parasite transmission characteristics in that even if the “forest”

and “savannah” flies are living together, they will transmit only their respective parasites

(Cheke & Garms, 2013).

2.7 Laboratory diagnosis of Onchocerca volvulus

The tools for diagnosis of onchocerciasis in the laboratory include examination of skin snips by

microscopy for emergent MF, the Mazzotti test, detection of antibodies to onchocercal antigens


25

or use of highly sensitive polymerase chain reaction-based (PCR) techniques for detection of

MF DNA in skin snips (Udall, 2007; Winthrop et al., 2011).

2.7.1 Skin snip microscopy

Microscopic examination of skin snips is the most widely used standardized technique for

onchocerciasis in many endemic regions. Samples are usually collected from the scapula, over

the iliac crest or calf (Murdoch, 2012). It is prone to low sensitivity in light infection when MF

tend to be more aggregated in host skin. Studies have shown that sensitivity of skin snip

microscopy depends on the number of snips taken, the anatomic site from which samples are

taken, the composition of the medium and the duration of snip incubation (Collins et al., 1980;

Taylor et al., 1987). Skin snip microscopy however, is very specific but is becoming gradually

unacceptable for many people because of its invasiveness (Boatin et al., 1998).

2.7.2 Mazzotti test

This is an indirect method to demonstrate the presence of MF in the skin by the administration

of diethylcarbamazine (DEC). The diethylcarbamazine inhibits neuromuscular transmission in

nematodes leading to the death of O. volvulus to produce such reactions as itching, rash and

sometimes lymphadenitis (often referred to as Mazzotti reactions) which demonstrates the

presence of MF in the skin (Toè et al., 2000). In the initial method, one 50 mg oral dose of DEC

was used. This test is sensitive but yields false negative and false positive results. The false

positive results according to Awadzi et al. (2015) may be due to the presence of other skin

dwelling MF, for example Mansonella streptocerca which are sensitive to DEC. The oral test is

seldom used because of the potential adverse reactions such as vomiting, hypotension and, in

rare cases, sudden death (Bari & Rahman, 2007). To avoid the systemic issues associated with


26

oral administration of DEC, a major modification of the test has been made where it is applied

topically as a “patch” which produces a local reaction to the dying MF at the patch site (Bari &

Rahman, 2007).

2.7.3 Immunological tests

These tests cannot differentiate between previous and current infections but have found utility

in control programmes as surveillance tool. Initial protocols suffered from cross reactivity with

other nematodes but following the use of specific recombinant O. volvulus antigen, Ov16

towards the IgG4 subclass of antibodies, sensitivity and specificity of these tests have improved

significantly. Many antibody tests have been identified as candidate tests for diagnosis of

human infection and as surveillance tools for control programmes but the major drawback is the

need for laboratory infrastructure to support performance of Enzyme Linked Immunosorbent

Assay (ELISA) tests (Weil et al., 2000). However, a rapid format immunochromatographic test

which is a point of care test to detect antibodies to Ov16, a recombinant O. volvulus antigen has

led to significant improvement in performance of these antibody tests (Chandrashekar et al,.

1996).

2.7.4 Molecular techniques

The direct skin snip microscopy for O. volvulus MF remains the gold standard but as has been

discussed elsewhere are relatively not sensitive when MF densities are low (Taylor et al., 1987).

Amplification of the parasite DNA in skin snips by Polymerase Chain Reaction (PCR)

techniques targeted at the O-150 repeat sequence provides high sensitivity for diagnosis of

onchocerciasis (Boatin et al., 2002). The PCR technique can be conventional or quantitative. In

the conventional method, PCR products are separated on 2% agarose gel and the results


27

determined as positive or negative based on the presence of a specific visible band sizes using

UV light. In the quantitative or the Real Time PCR the results are determined using automated

measurements of fluorescence and so are less prone to contamination (Lloyd et al., 2015).

Another molecular technique which is currently being used in the detection of O. volvulus is the

isothermal amplification method which in contrast to the PCR test does not require temperature

cycles. The loop mediated isothermal amplification (LAMP), is one of the most commonly used

isothermal amplification technologies currently in use. The principle is based on use of two

primer sets that recognized six different sites on the DNA of interest and an optional third set of

primers, often referred to as loop primers to accelerate the reaction (Notomi et al., 2015). The

loop mediated isothermal amplification technology offers many advantages over other

molecular diagnostic techniques because it is rapid, simple and very specific. Using LAMP on

skin biopsies collected from endemic areas in Ghana, Lagatie et al. (2016) found the sensitivity

of LAMP to be 88.2% and specificity of 99.2% compared with qPCR. Molecular techniques

now provide the most sensitive tool for monitoring success of mass drug administration (MDA)

using pool screening of blackflies (Lagatie et al., 2016).

2.8 Onchocerciasis control

In response to the rampant blindness in the savannah regions of West Africa, the World Health

Organization (WHO) in collaboration with other United Nations agencies launched the

Onchocerciasis Control Programme (OCP) in 1974 with the objective of eliminating

onchocerciasis as a public health problem. This programme was initially carried out in 7

countries but was later expanded to cover 4 additional countries bringing the total number of

countries covered by the OCP to 11. This was a vector control programme using weekly aerial


28

spraying of breeding sites of the blackflies with insecticides. This programme was

phenomenally successful in reducing the transmission, incidence and blindness in these

countries (Levine, 2007). In 1988, the OCP supplemented the aerial spraying with mass

distribution of ivermectin (Molyneux et al., 1995; Boatin, 2008). By the end of the programme

in 2002, it was estimated that 600,000 cases of blindness was averted with about 18 million

children born in regions free from the risk of blindness. Also, about 25 million hectares of land

have been reclaimed and safe for resettlement (Hopkins, 2005).

The success of OCP notwithstanding, the disease still remains uncontrolled in other countries

endemic for onchocerciasis especially in the forest regions of West, Central and Eastern Africa

where aerial spraying was not considered to be cost-effective or technically feasible (Levine,

2007). As a result, a second and much expanded control programme called the African

Programme for Onchocerciasis Control (APOC) was established in 1995 to extend treatment to

the remaining 19 endemic countries in Africa based on annual or biannual mass administration

of ivermectin in the affected communities (WHO, 2011). In 1992, the Onchocerciasis

Elimination Programme for the Americas (OEPA) was launched with the target to eliminate

transmission and morbidity by 2012 through biannual large-scale treatment with ivermectin.

This programme has been largely successful in that Colombia (2013), Ecuador (2014), and

Mexico (2015) and Guatemala (2016) have all been certified by WHO as having successfully

eliminated onchocerciasis (Carter Center, 2016).

Ghana was one of the initial countries that benefited from the OCP from its inception. The main

strategy of this programme was to interrupt transmission of parasites by adopting vector control

method for a period in excess of the maximum lifespan of adult O. volvulus in the human host


29

(Remme et al., 1989). Following the licensing of ivermectin for use in humans in 1987, Ghana

became one of the countries to start mass drug administration (MDA) (Basáñez et al., 2008).

Onchocerciasis control is now being implemented under the Neglected Tropical Disease

Control Programme (NTDCP) whose control activities officially started in 5 regions in Ghana

on pilot basis in 2007 (Taylor et al., 2009).

Despite all these years of onchocerciasis control activities in Ghana, the disease is still endemic

in the country (Taylor et al., 2009). The persistence of onchocerciasis in these communities

despite many years of control efforts has been attributed to poor response of the adult worms to

ivermectin (Osei-Atweneboana et al., 2011). However, other researchers attributed the

continued prevalence of onchocerciasis to poor ivermectin distribution coverage leading to

residual transmission (Cupp et al., 2007; Mackenzie, 2007). In a recent epidemiological studies

(2014) in 56 onchocerciasis sentinel villages along the Black Volta, Tano ,Pru, ,Tain,

Asukawkaw, Oti, Daka,Bia, Densu, Birim and Densu river basins, the standard prevalence

ranges from 0% to 17.2% with 14 out of the 56 villages having prevalence above 1% . Also, one

significant observation from this study was a general reduction in the MF loads. It was

concluded therefore that these low counts offer some hope for elimination of onchocerciasis.

However, there are still communities with high prevalence of onchocerciasis despite control

efforts with ivermectin use over the years which needs to be given a closer attention (GHS,

2015).

In order to curb the socioeconomic consequences and public health problems associated with

onchocerciasis, the Neglected Tropical Disease Control Programme of the Ghana Health


30

Service (GHS) initiated biannual ivermectin distribution in hyper endemic communities and

annual distribution in meso and hypo endemic areas (Turner et al., 2013).

In its five-year strategic plan, 2013-2017, the NTDCP of the GHS, reaffirmed its commitment

to a national goal of using community directed treatment with ivermectin (CDTI) and other

effective interventions for elimination of onchocerciasis(GHS, 2012).


31

CHAPTER THREE

3.0 MATERIALS AND METHODS

3.1 Study area and population

The study was conducted in four (4) communities located in the Nkwanta North District of

Ghana. These communities were Kabonwole, Kofinyi, Lemina and Kanjo. The district which

has a total population of 64, 553 is one of the twenty five (25) districts in the Volta Region. It

lies between latitudes 7°30ʹN and 8°45ʹN and longitudes 0°45ʹE and 0°10ʹW. The Nkwanta

North district shares boundaries with the Nkwanta South district to the south, the Nanumba

South district to the north, the Kpandai district to the west and the Republic of Togo to the east.

The district Capital, Kpassa is located 270 km to the north of Ho (the regional Capital) (GSS,

2014).

The Nkwanta North district is located in the tropical climatic zone, and experiences double

maxima of rainfall (i.e. between April and July; August and September) and experiences both

the wet and dry seasons with the dry season occurring between November and March. The

district lies in the transitional vegetation zone and is covered by savannah woodland and

grassland. Pockets and remnants of semi-deciduous forest also exist. The district is endowed

with a number of rivers and streams, the most important of which are River Oti and River

Kpassa. The streams and rivers exhibit a dendritic pattern, which forms the Oti basin and so

provide favourable breeding grounds for the vectors of O. volvulus (GSS, 2014).


32

Figure 3.1 Map of the Nkwanta North District (Source: GSS, 2014)


33

3.2 Sample size calculation

The highest prevalence among the onchocerciasis sentinel communities in the Nkwanta North

district was 6.9% (Unpublished data from NTDCP, 2012). The minimum sample size was

determined to be 98 using the formula,

N=z2p(1-p)/e2 , where

N= minimum sample size required;

Z= confidence level at 95% (standard value of 1.96);

P= estimated prevalence of onchocerciasis;

e= 5 % margin of error; (Sullivan, 2016).

Based on this sample size, a total of 218 samples were collected to increase the power of the

study.

3.3 Sampling techniques

3.3.1 Community selection and inclusion criteria

Information about study population, IVM treatment history and prevalence was obtained from

the District Disease Control Officer of the Nkwanta North District Health Directorate of the

Ghana Health Service (GHS). The four (4) communities for this study were selected based on

disease prevalence and community accessibility


34

3.3.2 Participants selection

Selected communities were informed through their Chiefs. The study participants in each

community were mobilized by the district health information officer and the purpose of the

study explained to them. Those who consented were all recruited for the study. Each individual

was given a unique identification number and clinical assessment by an experienced Physician

Assistant was conducted on all subjects as follows: the study subjects were examined physically

for clinical signs of onchocerciasis such as skin rashes, depigmentation (leopard skin), visible

and palpable nodules. The visual acuity of participants at far and near distances was determined

using the Snellen chart and the ability to count figures at distance up to 6 m was also

determined.

In addition, a structured questionnaire was administered to each participant to collect their

personal data, clinical history and to determine their treatment status.

3.3.3 Sample collection and storage

All participants who consented from each community were skin snipped. Briefly, one skin snip

from each iliac crest was collected using sterilized Walzer type corneo-scleral punch from each

patient. Each snip was placed separately into a well of a microtitre plate containing 200 µl of

physiological saline and incubated for 12-24 hours (overnight) at room temperature. The

microtitre plates were sent to the laboratory and examined under an inverted microscope. The

emergent MF were identified and enumerated. The MF from the positive wells were transferred

into Eppendorf tubes containing 10% formalin and stored at room temperature. The residual

skin snips were also put into Eppendorf tubes containing 80% ethanol and stored for further

works.


35

3.3.4 DNA extraction of O. volvulus from skin snips

The DNA extraction was done using Quick-gDNA™ MiniPrep (Zymo Research Corporation,

USA) according to the manufacturer’s instructions with slight modifications. Briefly, skin snips

were cut into smaller pieces on a clean glass slide using a sterile scalpel. With the aid of sterile

forceps, the macerated skin snips were transferred into appropriately labeled 1.5 ml micro

centrifuge tubes. Genomic Lysis Buffer, 200 µl and 10 µl of proteinase K were added to the

sample and vortexed for 30 seconds to ensure mixing of the lysing reagent with the skin snips.

The mixture was incubated at 60°C for 1 hour with intermittent vortexing at 30 minute-

intervals. The homogenate was pipetted into Zymo-Spin Column with 2 ml collection tube and

spun at 10,000 xg for 60 seconds and the flow-through discarded. The Zymo-spin columnn was

transferred into another 2 ml collection tube and 200µl of DNA Pre-Wash Buffer added, and

centrifuged at 10,000 xg for 60 seconds. The Zymo-spin column was again transferred to

another new 2 ml collection tube and 500 µl of g-DNA Wash Buffer added, and centrifuged at

10,000 xg for 60 seconds. The flow-through was discarded and the silica membrane was further

dried by repeating the centrifugation at 10,000 xg for 60 seconds. The Zymo-Spin Column was

placed in a sterile 1.5 ml microcentrifuge tube and 30µl DNA Elution Buffer was pipetted

directly onto the Zymo-Spin Column membrane, incubated at room temperature for 10 to 15

mins, and then centrifuged at 8,000 rpm for 60 seconds to elute the DNA. For maximum yield

of the DNA, the elution was repeated as described above into another tube as second elution.

3.3.5 Onchocerca volvulus DNA amplification using diagnostic primer

Polymerase chain reaction amplification for O. volvulus identification was carried out in Quanta

Green SYBR buffer in a volume containing 7.5 µl of B-R One-Step SYBR Green (Quanta

Biosciences, USA), 0.2 µl of each primer, 2.1 µl of nuclease free water and 5 µl of control and


36

test sample genomic DNA. The thermocyclying programme started with 3 minutes denaturation

at 94°C followed by 45 cycles of denaturation at 94°C for 30 seconds, 48°C annealing for 30

seconds and 72°C extension of 40 seconds with final extension for 5 minutes (PTC-200,

BioRad, USA). The sequences of the primers used are OV_sd_diag-F1: 5'-

GTCTTATAGGAGTTTCTGT-3' and OV_sd_diag-R1: 5'-ACCCATCAACTTATCAAAAC-3'

(Atweneboana and colleagues (CSIR, 2016), unpublished).

3.3.6 Gel electrophoresis

The obtained PCR products were run on 2 % w/v agarose gel. Briefly, 2 g of agarose powder

was added to 100 ml 1X TE buffer and dissolved by boiling in a microwave oven. It was

allowed to cool to 60°C and 3 µl of ethidium bromide was added, swirled to mix and dispensed

gently into the casting mold with combs and allowed to set.

Finally, 8 µl of the PCR products were checked by agarose gel electrophoresis with appropriate

molecular weight markers (1 kb in multiples of 100 bp) inserted to determine the expected size

relative to the marker. The marker, positive (forest and savannah) and negative controls as well

as samples were loaded. Electrophoresis was run at 100V for 45 minutes. Gel was observed

under a UV Trans-illuminator (BioDoc-it Imaging System, Cambridge, UK) and the molecular

weights analyzed.

3.3.7 Nested PCR for Onchocerca volvulus strain identification.

Samples that were identified as O. volvulus with the diagnostic primers were selected for nested

PCR for identification of strain type according to the protocol and primers used by Fischer et al,

(1996) with slight modifications. Also, known forest and savannah strain samples were used as

controls. Nest 1 was performed in a 15 µl volume containing 7.5 µl of B-R One-Step SYBR


37

Green (Quanta Biosciences, USA) mix, 0.2µl of each primer, 2.1 µl nuclease free water and 5

µl of genomic DNA. The thermocyclying programme (PTC-200, BioRad, USA) started with 3

minutes denaturation at 98°C followed by 40 cycles of denaturation at 98°C for 30 seconds,

58°C annealing for 30 seconds and 72°C extension of 30 seconds and final extension for 5

minutes. The primers used are S3 5'-ATCATTTTGCAAAATGCG-3' and S4 5'-

AATAACTGATGACCTATGACC-3'.

The product of the first PCR (nest 1) was diluted 1:20 and 5 µl was used for strain specific

amplification in a 15 µl volume containing 7.5 µl of B-R One-Step SYBR mix (Quanta

Biosciences, USA), 0.2 µl of each primer and 2.1 µl of nuclease free water using the following

cycling conditions: initial 3 minutes denaturation at 98°C followed by 45 cycles of denaturation

at 98°C for 30 seconds 58°C annealing for 30 seconds and 72°C extension of 30 seconds with

extended extension for 5 minutes (96 Universal Gradient PeQSTAR, UK) . The following are

the primers used: FA: 5'- GCGGCATAAATCTGCAAATTC-3' and FB:

5'GATTTTTCCGACGAACAGCGC3'

3.4 Statistical Analysis

The data obtained were entered into Excel and validated. The analysis was performed using R

statistical software. Test of statistical significance was determined using the Chi-square test.


38

CHAPTER FOUR

4.0 RESULTS

4.1 Analysis of skin snip microscopy and O. volvulus DNA PCR results

Skin snips from a total of 218 participants were examined for the presence of O. volvulus MF by

inverted microscopy and conventional PCR for O. volvulus DNA on residual skin snips. Of the

218 samples examined 3.7% (8/218) were positive for MF by skin snip microscopy and 9.2%

(20/218) were positive for O. volvulus DNA by PCR on residual skin snips. Of the 8

microscopy positive samples, DNA from 7 residual skin snip samples showed amplification

with O. volvulus DNA and one (1) did not show any amplification. The difference in

performance of skin snip microscopy and PCR was statistically significant (p<0.05).

4.1.1 Analysis of Onchocerca volvulus positive results for skin snip microscopy and DNA PCR by

age and sex

Males constitute 54.1% (118/218) and females 45.9% (100/218) of the study participants

surveyed. About 60% (12/20) of those positive for O. volvulus by DNA PCR are females and

40% (8/20) being males while by microscopy, males were the majority with 62.5% (5/8) with

females trailing with 37.5% (3/8). The age group with the highest prevalence by PCR was 11-20

year group with 35% (7/20) and the least being 51-60 year with 0%. However, among the 11-20

year group, only 12.5% (1/8) was positive by microscopy with the age groups having highest

prevalence rates being 21-30 and 31-40 groups, both with 37.5% (3/8). Again the 51-60 age

group had the lowest prevalence by microscopy with 0.0%.


39

4.1.2 Analysis of skin microscopy and DNA PCR results by occupation

In the Nkwanta North district, farming is the predominant occupation with 70.2% (153/218) of

the respondents engaged in it. Majority of those positive for O. volvulus, 60% (12/20) by PCR

and 75% (6/8) by microscopy are farmers. The civil/public servants had the least with positive

rate for both PCR and microscopy of 0.0%.

4.2 Analysis of results of Clinical manifestations of onchocerciasis

Clinical manifestations identified in this study are skin rashes/itches, visual impairment and

nodules. The most predominant clinical manifestation among the 218 participants screened was

skin rashes/itches with a prevalence of 15.1% (33/218) followed by visual impairment with a

prevalence of 8.3% (18/218). Of the 18 participants who had visual impairment, 55.6% (10/18)

had low vision (≤6/60 ≤ 6/18), 38.9% (7/18) had severe low vision (≤3/60-6/60) and 5.6%

(1/18) had profound low vision (3/60-NPL). Thus, overall, only, 0.5 % (1/218) (WHO criteria

of acuity of <3/60) of the participants was suffering from blindness. Palpable nodules was found

in only one person (1/218). Lizard skin and leopard skin lesions were not found among the

participants examined.

4.2.1 Analysis of subjects manifesting onchocercal lesions by sex

Of the 33 participants who had rashes/itches 66.7% (22/33) were males and 33.3% (11/33) were

females. Among those with visual impairment 72.2% (13/18) were males and 27.8% (5/18)

were females. Also, of the 18 participants who were classified as having visual impairment, 10

had low vision of which 80% (8/10) were males and 20% (2/10) females. Severe low vision was

found among 57.1% (4/7) males and 42.9% (3/7) female with the profound visual impairment.

The only participant with blindness is a male.


40

4.2.2 Analysis of subjects manifesting onchocercal lesions by age groups

This section describes the distribution of onchocercal lesions in the four communities of

Nkwanta North district by age. Of the 33 participants who had skin rashes/itches, the age group

with most predominant lesion is 31-40 years, 27.3% (9/33) followed closely by 10-20 and 21-30

year groups both with 18.2% (6/33). As expected, visual impairment is commonest among the

elderly group, 33.3% (6/18) and the least being among the 11-20 and 21-30 year groups with

5.6% (1/18) each.

4.2.3 Analysis of subjects manifesting onchocercal lesions by occupation

Of the 33 participants who had rashes/itches, 45.5% (15/33) were farmers. Students/pupils and

traders both had 18.2% (6/33). Only one person in the public/civil servant category had

rashes/itches. When the proportion of farmers with skin rashes/itches is compared with traders,

fishermen and Civil/Public servants, the difference is significant (p<0.05).

A significant proportion, as high as 83.3% (15/18) of participants with visual impairment were

farmers (p<0.05) including all the severe forms of low vision with only one participant each

from student/pupil, public/civil servant and fisherman categories.

4.2.4 Analysis of demographic and treatment records of the study participants

The total number of participants recruited for this study was 218 made of 54.1% (118/218)

males and females 45.9% (100/218) with the median ages of 35 and 30 respectively. The

average length of stay of participants in the communities sampled were approximately 20 years

for males and 18 years for females. The communities sampled were rural settings with majority,


41

69.3% (151/218) with no formal education and just 0.92% (2/218) with a tertiary education. The

main occupation is farming 70.2% (153/218).

About 95% (207/218) of the participants have ever taken ivermectin treatment, as part of the

community directed treatment with ivermectin programme, with the most recent being about

one year prior to the sample collection.

4.3 DNA results analysis

4.3.1 Detection of O. volvulus using Diagnostic primers

The PCR assay used in this study amplified DNA from microfilariae in the skin snip using O.

volvulus mitochondrial DNA primers OV_sd_diag-F1: 5'-GTCTTATAGGAGTTTCTGT-3'

and OV_sd_diag-R1: 5'-ACCCATCAACTTATCAAAAC-3'. Amplification of DNA from skin

snips from Nkwanta north district and the control samples with the diagnostic primers confirms

the PCR products as belonging to O. volvulus.

Figure 4.1 shows successful amplification from skin snips from one of the communities in the

Nkwanta north district, Kabonwole (KA in lanes 3, 4, 7, 8 and 9) as depicted by visible bands

on the agarose gel and figure 4.2 shows successful amplification from another community in the

study area, Lemina (LM in lanes 3 and 4) and forest controls (FSP in lanes 5, 10, 11 and 12) and

savannah controls (AB1, AB2, AB3, ASU 1, ASU 2 and ASU 3 in lanes 6, 7, 8, 9, 13 and 14

respectively.


42

Figure 4.1. Agarose gel electrophoresis pattern for amplification products of samples from

Kabonwule (KA) in lanes 3, 4, 7, 8 and 9 by OV Diagnostic primers

Figure 4.2. Agarose gel electrophoresis pattern for amplification products of samples from

Lemina (LM) in lanes 3, 4, and Controls from Agborlekame ABI, AB2 AB3 in lanes 6, 7, 8 and


43

Asubende ASU 1, ASU 2, ASU 3 in lanes 9, 13, and 14 and forest controls FSP 1,FSP 2, FSP 3

and FSP 4 in lanes 5,10, 11, 12 respectively by OV diagnostic primer.

.

4.3.2 Analysis of PCR test results for determination of O. volvulus strain using forest

strain specific primers

Differentiation of the isolates was done using a 107 bp long fragment of forest strain-specific

DNA sequence on O. volvulus positive samples from the four (4) communities in the Nkwanta

North district and controls from Agborlekame (AB) and Asubende (ASU) (all savannah) and

samples from Cameroun (FSP) (forest samples). The test samples and the savannah control

samples did not amplify with the forest specific primers whereas controls from the forest

regions show amplification (Fig. 4.3), suggestive of the samples from the Nkwanta North

district belonging to savannah strains.


44

Figure 4.3. Agarose gel electrophoresis pattern of two isolates from Nkwanta North district (KA

47 and LM 52) in lanes 3 and 4 and savannah controls in lanes 5, 6, 7, 8 and 9 showing no

amplification with nested PCR primers. Lanes 2, 10, 11, 12 and 13 amplified with the forest-

strain specific primer producing amplicon size of 153 bp.


45

CHAPTER FIVE

5.0 DISCUSSION, CONCLUSION AND RECOMMENDATIONS

5.1 Discussion

The application of molecular techniques have aided in the description of O. volvulus isolates

from different geographical regions. The close examination of the tandem repeat O-150 DNA

sequences in particular has been useful in the differentiation of O. volvulus from other

Onchocerca species (Meredith et al., 1989; Zimmerman et al., 1993) as well as the separation

of O. volvulus parasites into savannah and forest strains (Meredith et al., 1991).

This study produced results which suggest that all the O. volvulus isolates from the Nkwanta

North district were savannah strains. This is not surprising given the current climatic condition

prevailing in the Nkwanta North district which lies in the savannah-forest mosaic where both

forest and savannah strains are sympatric. As a result of human activities, these areas have been

seriously deforested. The rampant deforestation in Ghana was confirmed by Wilson et al.

(2002), who observed that as a result of human activities there has been substantial increase in

the proportion of savannah vectors of O. volvulus in southern part of Ghana and Togo. The

increase in the savannah vectors according to them will lead to increased transmission of

savannah strains of the parasites in deforested areas. Nkwanta North district is not spared the

effect of deforestation, hence this outcome.

This finding is not consistent with the observations made by Dordor and colleagues

(unpublished data) where they found both savannah and forest strains among black flies caught

in some communities in the Nkwanta North district. However, they found the predominant


46

strain to be that of savannah; 7 out of the 9 isolates characterized were suggestive of savannah

strains and the remaining 2 being forest strains. Given the mobile nature of the flies, the

identification of both forest and savannah strains of O. volvulus is not strange as those vectors

habouring forest strains could be making occasional incursion into the district at the time of fly-

catch. Again, this finding is not consistent with the findings of Oyibo et al. (2002) in a study

they conducted in the Lade District (in Kwara state) which is in the forest-savannah transition

zone of Nigeria on adult worms harvested from nodules. They found both savannah and forest

strains of O. volvulus in the same individual. They explained this occurrence to be due to either

the simultaneous transmission of both savannah and forest parasites or existence of a “hybrid”

form of O. volvulus. Participants in the Nkwanta North district of Ghana being in the forest-

savannah transition zone could also have been exposed to simultaneous transmission of both

forest and savannah strains of the parasite, however, only the savannah strains were able to

possibly establish infection in the individuals sampled. Given that nodules contain a number of

adult worms, it is possible to have a mix of parasites of different strains due to individuals being

exposed to bites of both savannah and forest vectors provided both parasites are able to

establish infection in that individual.

By skin snip microscopy, this study revealed that more males than females were infected with

O. volvulus. This result is consistent with the findings of Wogu and Okaka (2008) who in their

study observed that more males (27.5%) suffer from onchocerciasis than females (20%). Similar

observations were made by Uttah (2010) who found 39.2% of the study participants to be males

and 34.9% females and Nmorsi et al. (2002) who found more males (49.4%) than females

(33.3%). The explanation for this observation is that males are more exposed to the bites of the

vectors of the disease either as they go about their occupational activities such as farming and


47

fishing or by living close to the breeding sites. Akinboye et al. (2010) attributed this observation

to the fact that men are less clad as they go about their activities compared to females and so are

more liable to bites of the blackflies. In the Nkwanta North district, farming is the predominant

occupation in which males are expected to be engaged than females. This observation is a

contradiction to what was found by Akinbo and Okaka (2010) who found more females (93.1%)

infected than males (74.5 %) infected by Onchocerca volvulus in a study conducted in Ovia

Northeast LGA in Edo state of Nigeria. The observation by Akinbo and Okaka of more females

being infected than males is corroborated by the PCR results in our study where more females

(60 %) than males (40 %) were classified positive using DNA PCR. Nkwanta North district is

inhabited mostly by Konkombas (GSS, 2014) and among these tribes females are also engaged

in farming just as the men if not more. Females in these communities do farming in addition to

going to the river side to fetch water or wash by the river side with the attendant frequent

exposure to insect bites. Therefore the result was expected.

This study revealed that prevalence of onchocerciasis was highest among farmers than any other

occupational groups by both microscopy and DNA PCR. Similar observations were made by

Okoro et al. (2014) who found a significantly higher prevalence (combined prevalence of 22.2

% in the two Senatorial Districts in Ebonyi State, Nigeria) among farmers than traders, civil

servants, and students. This difference in prevalence is due to risk of occupational exposure to

the bites of the vectors. Civil/public servants did not record any infection with O. volvulus either

by microscopy or DNA PCR in this study. The reason for this low prevalence is that this

category of individuals are mostly working indoors during the day which is normally the biting

period for the black flies and so are less exposed to the bites of these flies.


48

The commonest skin manifestation among the participants in the communities studied was

rashes/itches) and is most prevalent among the 31-40 age bracket. The possible explanation for

this observation is that this category of people are mostly the active working group and so are

more exposed to frequent bites as they go about their farming, fishing or water fetching

activities which are major risk factors of O. volvulus infection.

From the gross examination of the eye using Snellen chart, visual impairment was observed

among 8.3% of the study subjects mostly among those above age 51 years. This is consistent

with the observations made by Kamalu & Uwakwe (2014) where they found that ocular

manifestations of onchocerciasis was more prevalent among the 50-62 year group. Blindness,

visual acuity of <3/60 (WHO, 2005) was detected among 0.5% of the participants examined

compared to 0.75% found in 3 sites sampled in Asante Akim district in Ashanti region of Ghana

(Taylor et al, 2009).

This study revealed skin snip microscopy prevalence which is lower than the data obtained from

the 5 onchocerciasis sentinel sites in the Nkwanta North district in 2012 (unpublished data from

NTDCP) which has the highest prevalence at 6.9%. This low prevalence can be attributed to the

impact of continued onchocerciasis control activities in the communities since about 95 % of

the participants had ever had treatment with ivermectin as part of the CDTI with the most recent

distribution done just about a year before sample collection. This finding is also consistent with

epidemiological data obtained in 2014 from Asubende where the prevalence dropped from 5.9

% in 2007 to 3.2 % in 2014 (GHS, 2015).


49

The prevalence of clinical signs of onchocerciasis is generally low in the communities studied

which corresponds to the low microscopy prevalence. This low prevalence is a good testament

of the impact of ivermectin treatment in the district, nevertheless, the presence of skin MF is

suggestive of the continued disease transmission.

Skin snip microscopy has been the method of choice for monitoring onchocerciasis control

activities in Ghana. The sensitivity of microscopy depends largely on microfilaria load (Taylor

et al, 1987; Basanez et al 2008). Therefore with the sustained IVM mass drug administration

and the reduction in microfilarial load as evidenced in the 2014 epidemiological data (GHS,

2015) calls into question the utility of microscopy for disease mapping as elimination

programmes are expanded to cover areas of low endemicity given that the PCR method in this

study identified 12 more additional samples previously classified as negative by microscopy.

5.2 Conclusion

The results from this study suggest that Nkwanta north district is endemic for savannah strains

of O. volvulus. The prevalence of the savannah strains in these communities may indicate a

changing trend in vector population as a consequence of deforestation and climate change.

The predominant clinical manifestation found among the study subjects was skin rashes/itches.

The generally low prevalence of clinical manifestations and skin snip microscopy is an

indication of success of several years of control activities in these communities in spite of

evidence of disease transmission in the area.


50

5.3 Limitations

Owing to logistical challenges, refraction, slit lamp examination and ophthalmoscopy

examinations were not done on the participants.

5.4 Recommendations

Further molecular characterization studies should be done in the other communities in the

region to determine strain type(s) prevalent in these communities using both forest and

savannah probes.

Also, more extensive study should be carried out in these communities with full ophthalmology

examinations done on the participants to determine the true extent of visual impairment

Based on evidence of the PCR test detecting more skin snip positive samples than microscopy,

PCR-based techniques or more sensitive tools should be employed for monitoring

onchocerciasis control activities.


51

REFERENCES

Abiose, A. (1998). Onchocercal eye disease and the impact of Mectizan treatment. Annals of

Tropical Medicine and Parasitology, 92 Suppl 1, S11-22. Retrieved from

http://www.ncbi.nlm.nih.gov/pubmed/9861263.

Adewale, B., Mafe, M. A., & Oyerinde, J. P. O. (2005). Identification of the forest strain of

Onchocerca volvulus using the polymerase chain reaction technique. West African Journal

of Medicine, 24 (1): 21–5.

Akinbo, F.O. and Okaka C.E. (2005). Prevalence and Socio-Economic Effects of

Onchocerciasis in Ovia North East Local Government Area of Edo State, Nigeria. Rivista

Parasitologic., 22 (3): 215-221.

Akinboye, D.O., Okwong, E., Ajiteru, N., Fawole, O., Agbolade, O.M., Ayinde, O.O., Amosu,

A.M., Atuloma, N.O.S., Odula, O., Owodunni, B.M., Rebecca, S.N. and Falade, M. (2010).

Onchocerciasis among inhabitants of Ibarapa Local Government community of Oyo state,

Nigeria. Biomedical Research, 21 (2):174-178.

Alonso, L. M., Murdoch, M. E., & Jofre-Bonet, M. (2009). Psycho-social and economic

evaluation of onchocerciasis : a literature review . Social Medicine, 4 (1): 8–31.

Anderson, R. C. (2000). Nematode parasites of vertebrates: their development and

transmission. Wallingford: CABI. http://doi.org/10.1079/9780851994215.0000.


52

Andre, A. v. S., Blackwell, N. M., Hall, L. R., Hoerauf, A., Brattig, N. W., Volkmann, L., …

Pearlman, E. (2002). The Role of Endosymbiotic Wolbachia Bacteria in the Pathogenesis

of River Blindness. Science, 295 (5561): 1892–1895.

http://doi.org/10.1126/science.1068732.

Anosike, J. C., & Onwuliri, C. O. (1995). Studies on filariasis in Bauchi State, Nigeria. 1.

Endemicity of human onchocerciasis in Ningi Local Government Area. Annals of Tropical

Medicine and Parasitology, 89 (1): 31–8. Retrieved from


Armoo, S., Doyle, S. R., Osei-Atweneboana, M. Y., & Grant, W. N. (2017). Significant

heterogeneity in Wolbachia copy number within and between populations of Onchocerca

volvulus. Parasites & Vectors, 10 (1): 188. http://doi.org/10.1186/s13071-017-2126-4.

Aroian, R. V, Levy, A. D., Koga, M., Ohshima, Y., Kramer, J. M., & Sternberg, P. W. (1993).

Splicing in Caenorhabditis elegans Does Not Require an AG at the 3’ Splice Acceptor Site.

Molecular And Cellular Biology, 13 (1): 626–637. Retrieved from

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC358941/pdf/molcellb00013-0652.pdf.

Awadzi, K., Opoku, N. O., Attah, S. K., Lazdins-Helds, J. K., & Kuesel, A. C. (2015).

Diagnosis of O. volvulus infection via skin exposure to diethylcarbamazine: clinical

evaluation of a transdermal delivery technology-based patch. Parasites & Vectors, 8 (1):

515. http://doi.org/10.1186/s13071-015-1122-9.


53

Baker, R. H., Guillet, P., Sékétéli, A., Poudiougo, P., Boakye, D., Wilson, M. D., & Bissan, Y.

(1990). Progress in controlling the reinvasion of windborne vectors into the western area of

the Onchocerciasis Control Programme in West Africa. Philosophical Transactions of the

Royal Society of London. Series B, Biological Sciences, 328 (1251): 731–47, discussion

747-50.

Bari, A. & Rahman, S. B. (2007). Onchocerciasis : A review of a filarial disease of significant

importance for dermatologists and ophthalmologists. Journal of Pakistan Association of

Dermatologists, 1 (17): 32–45.

Basáñez, M.-G., Pion, S. D., Boakes, E., Filipe, J. A., Churcher, T. S., & Boussinesq, M.

(2008). Effect of single-dose ivermectin on Onchocerca volvulus: a systematic review and

meta-analysis. The Lancet Infectious Diseases, 8 (5): 310–322.

http://doi.org/10.1016/S1473-3099(08)70099-9.

Basáñez, M.-G., Pion, S. D. S., Churcher, T. S., Breitling, L. P., Little, M. P., & Boussinesq, M.

(2006). River Blindness: A Success Story under Threat? PLoS Medicine, 3 (9): e371.

http://doi.org/10.1371/journal.pmed.0030371.

Basáñez, M. G., Yarzábal, L., Frontado, H. L., & Villamizar, N. J. (2000). Onchocerca-

Simulium complexes in Venezuela: can human onchocerciasis spread outside its present

endemic areas? Parasitology, 120 (2): 143–60.


54

Basáñez, M. G., & Boussinesq, M. (1999). Population biology of human onchocerciasis.

Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences,

354 (1384): 809–26. http://doi.org/10.1098/rstb.1999.0433.

Boakye, D. A., Back, C., Fiasorgbor, G. K., Sib, A. P. P., & Coulibaly, Y. (1998). Sibling

species distributions of the Simulium damnosum complex in the West African

Onchocerciasis Control Programme area during the decade 1984-93, following intensive

larviciding since 1974. Medical and Veterinary Entomology, 12 (4), 345–358.

http://doi.org/10.1046/j.1365-2915.1998.00118.x.

Boakye, D. A. (1993). A pictorial guide to the chromosomal identification of members of the

Simulium damnosum Theobald complex in west Africa with particular reference to the

Onchocerciasis Control Programme Area. Tropical Medicine and Parasitology : Official

Organ of Deutsche Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur

Technische Zusammenarbeit (GTZ), 44 (3), 223–44.

Boatin, B. (2008). The Onchocerciasis Control Programme in West Africa (OCP). Annals of

Tropical Medicine & Parasitology, 102 (sup1): 13–17.

http://doi.org/10.1179/136485908X337427.

Boatin, B. A., Toé, L., Alley, E. S., Nagelkerke, N. J. D., Borsboom, G., & Habbema, J. D. F.

(2002). Detection of Onchocerca volvulus infection in low prevalence areas: a comparison

of three diagnostic methods. Parasitology, 125 (6): 545–52.


55

Boatin, B. A., Toé, L., Alley, E. S., Dembélé, N., Weiss, N., & Dadzie, K. Y. (1998).

Diagnostics in onchocerciasis: future challenges. Annals of Tropical Medicine and

Parasitology, 92 Suppl 1: S41-5.

Brattig, N. W. (2004). Pathogenesis and host responses in human onchocerciasis: impact of

Onchocerca filariae and Wolbachia endobacteria. Microbes and Infection, 6 (1): 113–28.

Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/14738900.

Brattig, N. W., Krawietz, I., Abakar, A. Z., Ertman, R D., Kruppa, T. K. and Massaougbodji, A.

(1994). A strong immunoglobulin G isotope antibody response in sowdah type

onchocerciasis. Journal of Infectious Disease, 170: 995-961.

Burnham, G. (1998). Onchocerciasis, 351: 1341–1346.

Cabrera, Z., Buttner, D. W., National, R. M. E. P., & Hill, M. (1988). Unique recognition of a

low molecular weight Onchocerca volvulus antigen by IgG3 antibodies in chronic hyper-

reactive oncho-dermatitis ( Sowda ), 223–229.

https://www.cartercenter.org/news/pr/guatemala-092916.html downloaded 3 July, 2017


https://www.cartercenter.org/news/pr/guatemala-092916.html

56

Chandrashekar, R., Ogunrinade, A. F., & Weil, G. J. (1996). Use of recombinant Onchocerca

volvulus antigens for diagnosis and surveillance of human onchocerciasis. Tropical

Medicine & International Health : TM & IH, 1 (5): 575–80.


Cheke, R. A., & Garms, R. (2013). Indices of onchocerciasis transmission by different members

of the Simulium damnosum complex conflict with the paradigm of forest and savanna

parasite strains. Acta Tropica, 125 (1), 43–52.

http://doi.org/10.1016/j.actatropica.2012.09.002.

Cianchi, R., Karam, M., Henry, M. C., Villani, F., Kumlien, S., & Bullini, L. (1985).

Preliminary data on the genetic differentiation of Onchocerca volvulus in Africa

(Nematoda: Filarioidea): Acta Tropica 42 (4) 1985: 341-351.

Collins, R. C., Brandling-Bennett, A. D., Holliman, R. B., Campbell, C. C., & Darsie, R. F.

(1980). Parasitological diagnosis of onchocerciasis: comparisons of incubation media and

incubation times for skin snips. The American Journal of Tropical Medicine and Hygiene,

29 (1): 35–41.

Cotton, J. A., Bennuru, S., Grote, A., Harsha, B., Tracey, A., Beech, R., … Lustigman, S.

(2016). The genome of Onchocerca volvulus, agent of river blindness. Nature

Microbiology, 2 (November 2016), 16216. http://doi.org/10.1038/nmicrobiol.2016.216.



57

Crosskey, R. W. (1990). The Natural History of Blackflies. Wiley Chichester. Retrieved from

https://www.abebooks.co.uk/Natural-History-Blackflies-Crosskey-R.W-

Wiley/16841599303/bd.

Crump, A., Morel, C. M., & Omura, S. (2012). The onchocerciasis chronicle: From the

beginning to the end? Trends in Parasitology, 28 (7): 280–288.

http://doi.org/10.1016/j.pt.2012.04.005.

Cupp, E., Richards, F., Lammie, P., Eberhard, M., & Prichard, R. (2007). Efficacy of ivermectin

against Onchocerca volvulus in Ghana. Lancet (London, England), 370 (9593), 1123;

author reply 1124-5. http://doi.org/10.1016/S0140-6736(07)61501-3.

Dadzie, K. Y., Remme, J., Rolland, A., & Thylefors, B. (1989). Ocular onchocerciasis and

intensity of infection in the community. II. West African rainforest foci of the vector

Simulium yahense. Tropical Medicine and Parasitology : Official Organ of Deutsche

Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur Technische

Zusammenarbeit (GTZ), 40 (3), 348–54. Retrieved from


De Leon, J. R. & Duke, B. O. L. (1966). Experimental studies on the transmission of

Guatemalan and West African strains of Onchocerca volvulus by Simulium ochraceum, S.

metallicum and S. callidum. Transactions of the Royal Society of Tropical Medicine and

Hygiene, 60 (6): 735–752. http://doi.org/10.1016/0035-9203(66)90223-9.


58

Donelson, J. E., Duke, B. O., Moser, D., Zeng, W. L., Erondu, N. E., Lucius, R., … Flores, G.

Z. (1988). Construction of Onchocerca volvulus cDNA libraries and partial

characterization of the cDNA for a major antigen. Molecular and Biochemical

Parasitology, 31 (3): 241–50. Retrieved from


Duke, B. O. (1993). The population dynamics of Onchocerca volvulus in the human host.

Tropical Medicine and Parasitology : Official Organ of Deutsche Tropenmedizinische

Gesellschaft and of Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ), 44 (2):

61–8. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8367667.

Duke, B. O. (1981). Geographical aspects of onchocerciasis. Annales de La Societe Belge de

Medecine Tropicale, 61 (2): 179–86. Retrieved from


Duke, B. O. L. (1976). Strains of Onchocerca volvulus and their pathogenicity. Tropical

Medicine and Parasitology, 27, 21-22.

Duke, B. O., & Anderson, J. (1972). A comparison of the lesions produced in the cornea of the

rabbit eye by microfilariae of the forest and Sudan-savanna strains of Onchocerca volvulus

from Cameroon. I. The clinical picture. Zeitschrift Fur Tropenmedizin Und Parasitologie,

23 (4): 354–68.


59

Duke, B. O. L. (1966). Onchocerca-Simulium complexes. Annals of Tropical Medicine &

Parasitology, 60 (4): 495–500. http://doi.org/10.1080/00034983.1966.11686442.

Duke, B. O., Lewis, D. J., & Moore, P. J. (1966). Onchocerca-Simulium complexes. I.

Transmission of forest and Sudan-savanna strains of Onchocerca volvulus, from

Cameroon, by Simulium damnosum from various West African bioclimatic zones. Annals

of Tropical Medicine and Parasitology, 60 (3): 318–26.

Eberhard, M. L., Ortega, Y., Dial, S., Schiller, C. A., Sears, A. W., & Greiner, E. (2000). Ocular

Onchocerca infections in two dogs in western United States. Veterinary Parasitology, 90

(4): 333–8. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10856819.

Egyed, Z., Sréter, T., Széll, Z., Nyiro, G., Márialigeti, K., & Varga, I. (2002). Molecular

phylogenetic analysis of Onchocerca lupi and its Wolbachia endosymbiont. Veterinary

Parasitology, 108 (2): 153–61. Retrieved from


Erttmann, K. D., Meredith, S. E., Greene, B. M., & Unnasch, T. R. (1990). Isolation and

characterization of form specific DNA sequences of O. volvulus. Acta Leidensia, 59 (1–2):

253–60. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2378208.

Erttmann, K. D., Unnasch, T. R., Greene, B. M., Albiez, E. J., Boateng, J., Denke, A. M., …

Williams, P. N. (1987). A DNA sequence specific for forest form Onchocerca volvulus.

Nature, 327 (6121): 415–417. http://doi.org/10.1038/327415a0.


60

Fischer, K., Beatty, W. L., Jiang, D., Weil, G. J., & Fischer, P. U. (2011). Tissue and stage-

specific distribution of Wolbachia in Brugia malayi. PLoS Neglected Tropical Diseases, 5

(5). http://doi.org/10.1371/journal.pntd.0001174.

Fischer, P., Bamuhiiga, J., Kilian, a H. D., & Buttner, C. W. (1996). Strain differentiation of

Onchocerca volvulus from Uganda using DNA probes. Parasitology, 112: 401–408.

Retrieved from isi:A1996UF33300006.

Forgione, M. A. Jr. (2002). Introduction to clinical differentials of Onchocerciasis.

Excerpt from Medicine.com, Inc (abstracts).

Garner, A., Duke, B. O., & Anderson, J. (1973). A comparison of the lesions produced in the

cornea of the rabbit eye by microfilariae of the forest and Sudan-savanna strains of

Onchocerca volvulus from Cameroon. II. The pathology. Zeitschrift Fur Tropenmedizin

Und Parasitologie, 24 (4): 385–96.

Ghana Health Service (2015). Ghana Health Service 2014 Annual Report, (July).

GHS (2012). Ghana Neglected Tropical Diseases Programme Master Plan; Five year strategic

plan, 2013-2017.

GSS (2014). The District Analytical Report, Nkwanta North District: 2010 Population and

Housing Census Report.


61

Gillette-Ferguson, I., Hise, A. G., Sun, Y., Diaconu, E., McGarry, H. F., Taylor, M. J., &

Pearlman, E. (2006). Wolbachia- and Onchocerca volvulus-Induced Keratitis (River

Blindness) Is Dependent on Myeloid Differentiation Factor 88. Infection and Immunity, 74

(4): 2442–2445. http://doi.org/10.1128/IAI.74.4.2442-2445.2006.

Greene, B. M., Fanning, M. M., & Ellner, J. J. (1983). Non-specific suppression of antigen-

induced lymphocyte blastogenesis in Onchocerca volvulus infection in man. Clinical and

Experimental Immunology, 52 (2): 259–65. Retrieved from


Hailu, A., Balcha, F., Birrie, H., Berhe, N., Aga, A., Mengistu, G., … Gemetchu, T. (2002).

Prevalence of onchocercal skin disease and infection among workers of coffee plantation

farms in Teppi, southwestern Ethiopia. Ethiopian Medical Journal, 40 (3): 259–69.

Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12602250.

Hall, L. R., & Pearlman, E. (1999). Pathogenesis of onchocercal keratitis (River blindness).

Clinical Microbiology Reviews, 12 (3): 445–53. Retrieved from

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=100248&tool=pmcentrez&rend

ertype=abstract.


62

Higazi, T. B., Filiano, A., Katholi, C. R., Dadzie, Y., Remme, J. H., & Unnasch, T. R. (2005).

Wolbachia endosymbiont levels in severe and mild strains of Onchocerca volvulus.

Molecular and Biochemical Parasitology, 141 (1): 109–112.

http://doi.org/10.1016/j.molbiopara.2005.02.006.

Higazi, T. B., Katholi, C. R., Mahmoud, B. M., Baraka, O. Z., Mukhtar, M. M., Qubati, Y. Al,

& Unnasch, T. R. (2001). Onchocerca volvulus: Genetic Diversity of Parasite Isolates from

Sudan. Experimental Parasitology, 97 (1): 24–34. http://doi.org/10.1006/expr.2000.4589.

Hoerauf, A., Satoguina, J., Saeftel, M., & Specht, S. (2005). Immunomodulation by filarial

nematodes. Parasite Immunology, 27 (10–11), 417–429. http://doi.org/10.1111/j.1365-

3024.2005.00792.x.

Hoerauf, A., Büttner, D. W., Adjei, O., & Pearlman, E. (2003). Onchocerciasis. BMJ (Clinical

Research Ed.), 326 (7382): 207–10. Retrieved from

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1125065&tool=pmcentrez&ren

dertype=abstract.

Hopkins, A. D. (2005). Ivermectin and onchocerciasis: is it all solved? Eye, 19 (10): 1057–

1066. http://doi.org/10.1038/sj.eye.6701962.

Kale, O. O. (1998). Onchocerciasis: the burden of disease. Annals of Tropical Medicine and

Parasitology, 92 Suppl 1: S101-15. Retrieved from



63

Kamalu, N. A., & Uwakwe, F. E. (2014). Evaluation of different Onchocerciass manifestation

by age and gender among residents in selected endemic villages in Okigwe Local

Government Area of Imo State , Nigeria, 20: 139–150.

http://doi.org/10.18052/www.scipress.com/ILNS.20.139.

Keddie, E. M., Higazi, T., & Unnasch, T. R. (1998). The mitochondrial genome of Onchocerca

volvulus: sequence, structure and phylogenetic analysis. Molecular and Biochemical

Parasitology, 95 (1): 111–127. http://doi.org/10.1016/S0166-6851(98)00102-9

Kron, M. A., & Ali, M. H. (1993). Characterization of a variant tandem repeat from Sudanese

Onchocerca volvulus. Tropical Medicine and Parasitology : Official Organ of Deutsche

Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur Technische

Zusammenarbeit (GTZ), 44 (2): 113–5.

Lagatie, O., Merino, M., Batsa Debrah, L., Debrah, A. Y., & Stuyver, L. J. (2016). An

isothermal DNA amplification method for detection of Onchocerca volvulus infection in

skin biopsies. Parasites & Vectors, 9 (1): 624. http://doi.org/10.1186/s13071-016-1913-7.

Levine R: Millions Saved.In Controlling onchcocerciais in Sub-Saharan-Africa. Edited by

Danvers R Levine. Burlinton: Jones and Bartlett; 2007.


64

Little, M., Breitling, L., Basáñez, M.-G., Alley, E., & Boatin, B. (2004). Association between

microfilarial load and excess mortality in onchocerciasis: an epidemiological study. The

Lancet, 363 (9420): 1514–1521. http://doi.org/10.1016/S0140-6736(04)16151-5.

Lloyd, M. M., Gilbert, R., Taha, N. T., Weil, G. J., Meite, A., Kouakou, I. M. M., & Fischer, P.

U. (2015). Conventional parasitology and DNA-based diagnostic methods for

onchocerciasis elimination programmes. Acta Tropica, 146: 114–118.

http://doi.org/10.1016/j.actatropica.2015.03.019.

Lustigman, S., & McCarter, J. P. (2007). Ivermectin Resistance in Onchocerca volvulus:

Toward a Genetic Basis. PLoS Neglected Tropical Diseases, 1 (1), e76.

http://doi.org/10.1371/journal.pntd.0000076.

Mackenzie, C. D. (2007). Efficacy of ivermectin against Onchocerca volvulus in Ghana. The

Lancet, 370 (9593): 1123. http://doi.org/10.1016/S0140-6736(07)61502-5.

Marin, B., Boussinesq, M., Druet-Cabanac, M., Kamgno, J., Bouteille, B., & Preux, P.-M.

(2006). Onchocerciasis-related epilepsy? Prospects at a time of uncertainty. Trends in

Parasitology, 22 (1): 17–20. http://doi.org/10.1016/j.pt.2005.11.006.

McKechnie, N. M., Gürr, W., & Braun, G. (1997). Immunization with the cross-reactive

antigens Ov39 from Onchocerca volvulus and hr44 from human retinal tissue induces

ocular pathology and activates retinal microglia. The Journal of Infectious Diseases, 176



65

Meredith, S. E. O., Lando, G., Gbakima, A. A., Zimmerman, P. A., & Unnasch, T. R. (1991).

Onchocerca volvulus: Application of the polymerase chain reaction to identification and

strain differentiation of the parasite. Experimental Parasitology, 73 (3), 335–344.

http://doi.org/10.1016/0014-4894(91)90105-6.

Meredith, S. E. O., Unnasch, T. R., Karam, M., Piessens, W. F., & Wirth, D. F. (1989). Cloning

and characterization of an Onchocerca volvulus specific DNA sequence. Molecular and

Biochemical Parasitology, 36 (1): 1–10. http://doi.org/10.1016/0166-6851(89)90194-1.

Michael, E., Bundy, D. A., & Grenfell, B. T. (1996). Re-assessing the global prevalence and

distribution of lymphatic filariasis. Parasitology, 112 (4): 409–28. Retrieved from


Molyneux, D. H. & Davies, J. B.et al. (1995). Onchocerciasis control in West Africa: Current

status and future of the onchocerciasis control programme. Parasitology Today, 11 (11),

399–402. http://doi.org/10.1016/0169-4758(95)80016-6.

Murdoch, M.E. (2012). Onchocerciasis up to date

http//www.uptodate.com/contents/onchocerciasis. Retrieved on 25/05/2017


66

Murdoch, M. E., Asuzu, M. C., Hagan, M., Makunde, W. H., Ngoumou, P., Ogbuagu, K. F., …

Remme, J. (2002). Onchocerciasis: the clinical and epidemiological burden of skin disease

in Africa. Annals of Tropical Medicine & Parasitology, 96 (3): 283–296.

http://doi.org/10.1179/000349802125000826.

Murdoch, M. E., Hay, R. J., Mackenzie, C. D., Williams, J. F., Ghalib, H. W., Cousens, S., …

Jones, B. R. (1993). A clinical classification and grading system of the cutaneous changes

in onchocerciasis. The British Journal of Dermatology, 129 (3): 260–9. Retrieved from


Nmorsi, O. P. G., Oladokun, I. A. A., Egwunyenga, O. A., & Oseha, E. (2002). Eye Lesions

And Onchocerciasis In A Rural Farm Settlement In Delta State , Nigeria. Southeast Asian

Journal Of Tropical Medicine And Public Health 33 (1).

Notomi, T., Mori, Y., Tomita, N., & Kanda, H. (2015). Loop-mediated isothermal amplification

(LAMP): principle, features, and future prospects. Journal of Microbiology, 53 (1): 1–5.

http://doi.org/10.1007/s12275-015-4656-9.

Nwoke, B.E.B. (1992). Ivermectin, the incredible Drug against Human Onchocerciasis.

Medicare Journal; 5: 1 -2.

Ogunrinade, A., Boakye, D., Merriweather, A., & Unnasch, T. R. (1999). Distribution of the

Blinding and Nonblinding strains of Onchocerca volvulus in Nigeria. The Journal of

Infectious Diseases, 179: 1577–1579. http://doi.org/JID981504 [pii].


67

Okoro, N., Nwali, U. N., Nnamdi, O. A., & Innocent, O. C. (2014). The Prevalence and

Distribution of Human Onchocerciasis in Two Senatorial Districts in Ebonyi, 2 (2): 39–44.

http://doi.org/10.12691/ajidm-2-2-3.

Okulicz, J. F., Stibich, A. S., Elston, D. M., & Schwartz, R. A. (2004). Cutaneous

onchocercoma. International Journal of Dermatology, 43 (3): 170–172.

http://doi.org/10.1111/j.1365-4632.2004.02279.x.

Osei-Atweneboana, M. Y., Awadzi, K., Attah, S. K., Boakye, D. a., Gyapong, J. O., & Prichard,

R. K. (2011). Phenotypic Evidence of Emerging Ivermectin Resistance in Onchocerca

volvulus. PLoS Neglected Tropical Diseases, 5 (3), e998.


Oyibo, W. A., Fagbenro-Beyioku, F. A., Merriweather, A. and Unnasch, T. R. (2002).

Molecular characterization of Onchocerca volvulus in a middlebelt state of Nigeria.

African journal of Science and Technology, Science and Engineering Series, volume 3 (1),

22-24.

Pearlman, E., & Hall, L. R. (2000). Immune mechanisms in Onchocerca volvulus-mediated

corneal disease (river blindness). Parasite Immunology, 22 (12): 625–31.

http://doi.org/pim345 [pii].


68

Pion, S. D. S., Kaiser, C., Boutros-Toni, F., Cournil, A., Taylor, M. M., Meredith, S. E. O., …

Boussinesq, M. (2009). Epilepsy in Onchocerciasis Endemic Areas: Systematic Review

and Meta-analysis of Population-Based Surveys. PLoS Neglected Tropical Diseases, 3 (6):

e461. http://doi.org/10.1371/journal.pntd.0000461.

Post, R. (2005). The chromosomes of the Filariae. Filaria Journal, 4 (1): 10.

http://doi.org/10.1186/1475-2883-4-10.

Ranganathan, B. (2012). Onchocerciasis - An Overview, 8: 5–9.

Remme, J. H. F. (2004). Research for control: the onchocerciasis experience. Tropical Medicine

& International Health : TM & IH, 9 (2): 243–54. http://doi.org/10.1046/j.1365-

3156.2003.01192.x.

Remme, J., Dadzie, K. Y., Rolland, A., & Thylefors, B. (1989). Ocular onchocerciasis and

intensity of infection in the community. I. West African savanna. Tropical Medicine and

Parasitology : Official Organ of Deutsche Tropenmedizinische Gesellschaft and of

Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ), 40 (3): 340–7. Retrieved

from http://www.ncbi.nlm.nih.gov/pubmed/2617045.

Rolland, A. and Balay, G. (1986). L'Onchocercose dans Ie foyer Bissa. O.C.C.G.E. Centre

Muraz. Technical Report no.lll/ONCHO. Unpublished mimeographed document,

translation in English by OCP, Ouagadougou.


69

Schulz-Key, H. (1990). Observations on the reproductive biology of Onchocerca volvulus. Acta

Leidensia, 59 (1–2), 27–44. Retrieved from


Semba, R. D., Murphy, R. P., Newland, H. S., Awadzi, K., Greene, B. M., & Taylor, H. R.

(1990). Longitudinal study of lesions of the posterior segment in onchocerciasis.

Ophthalmology, 97 (10): 1334–41. Retrieved from


Sullivan, L. (2016). Power and sample size determination. Boston University School of Public

Health. Last modified in 2016 by Wayne W. LaMorte.

Takaoka, H., Tada, I., Hashiguchi, Y., Baba, M., Korenaga, M., Ochoa A., J., … Yarzabal, L.

(1986). A cross-compatibility study of Guatemalan and north Venezuelan Onchocerca

volvulus to Simulium metallicum from two countries. Japanese Journal of Parasitology,

351: 35–41.

Tamarozzi, F., Halliday, a., Gentil, K., Hoerauf, a., Pearlman, E., & Taylor, M. J. (2011).

Onchocerciasis: the Role of Wolbachia Bacterial Endosymbionts in Parasite Biology,

Disease Pathogenesis, and Treatment. Clinical Microbiology Reviews, 24 (3): 459–468.

http://doi.org/10.1128/CMR.00057-10.


70

Taylor, M. J., Awadzi, K., Basáñez, M.-G., Biritwum, N., Boakye, D., Boatin, B., … Adjei, O.

(2009). Onchocerciasis Control: Vision for the Future from a Ghanian perspective.

Parasites & Vectors, 2 (1): 7. http://doi.org/10.1186/1756-3305-2-7.

Taylor, H. R., Keyvan-Larijani, E., Newland, H. S., White, A. T., & Greene, B. M. (1987).

Sensitivity of skin snips in the diagnosis of onchocerciasis. Tropical Medicine and

Parasitology : Official Organ of Deutsche Tropenmedizinische Gesellschaft and of

Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ), 38 (2): 145–7.

Thylefors, B., Négrel, A. D., Pararajasegaram, R., & Dadzie, K. Y. (1995). Global data on

blindness. Bulletin of the World Health Organization, 73 (1): 115–21. Retrieved from


Toè, L., Adjami, A. G., Boatin, B. A., Back, C., Alley, E. S., Dembélé, N., … Unnasch, T. R.

(2000). Topical application of diethylcarbamazineto detect onchocerciasis recrudescence in

West Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene, 94 (5):

519–525. http://doi.org/10.1016/S0035-9203(00)90073-7.

Turner, H. C., Churcher, T. S., Walker, M., Osei-Atweneboana, M. Y., Prichard, R. K., &

Basanez, M. G. (2013). Uncertainty Surrounding Projections of the Long-Term Impact of

Ivermectin Treatment on Human Onchocerciasis. PLoS Neglected Tropical Diseases, 7 (4).



71

Udall, D. N. (2007). Recent Updates on Onchocerciasis: Diagnosis and Treatment. Clinical

Infectious Diseases, 44 (1): 53–60. http://doi.org/10.1086/509325.

Unnasch, T. R., & Williams, S. A. (2000). The genomes of Onchocerca volvulus. International

Journal for Parasitology, 30 (4): 543–552. http://doi.org/10.1016/S0020-7519(99)00184-8.

Uttah, E.C. (2010). Onchocerciasis in the Upper Imo River Basin, Nigeria: Prevalence and

comparative study of waist and shoulder snips from mesoendemic communities. Iranian

Journal of Parasitology, 5 (2), 33-41.

Wagbatsoma, V. A., & Okojie, O. H. (2004). Psychosocial effects of river blindness in a rural

community in Nigeria. The Journal of the Royal Society for the Promotion of Health, 124


Webster, J. P., Molyneux, D. H., Hotez, P. J., & Fenwick, A. (2014). The contribution of mass

drug administration to global health: past, present and future. Philosophical Transactions

of the Royal Society B: Biological Sciences, 369 (1645): 20130434–20130434.

http://doi.org/10.1098/rstb.2013.0434.

Weil, G. J., Steel, C., Liftis, F., Li, B., Mearns, G., Lobos, E., & Nutman, T. B. (2000). A

Rapid‐Format Antibody Card Test for Diagnosis of Onchocerciasis. The Journal of

Infectious Diseases, 182 (6): 1796–1799. http://doi.org/10.1086/317629.


72

Wilson, M. D., Cheke, R. A., Flasse, S. P. J., Grist, S., Osei-Ateweneboana, M. Y., Tetteh-

Kumah, A., … Post, R. J. (2002). Deforestation and the spatio-temporal distribution of

savannah and forest members of the Simulium damnosum complex in southern Ghana and

south-western Togo. Transactions of the Royal Society of Tropical Medicine and Hygiene,

96(6), 632–639. http://doi.org/10.1016/S0035-9203(02)90335-4.

Winthrop, K. L., Furtado, J. M., Silva, J. C., Resnikoff, S., & Lansingh, V. C. (2011). River

blindness: an old disease on the brink of elimination and control. Journal of Global

Infectious Diseases, 3(2), 151–5. http://doi.org/10.4103/0974-777X.81692.

Wogu, M. D., & Okaka, C. E. (2008). Prevalence and socio-economic effects of onchocerciasis

in Okpuje , Owan West Local Government Area , Edo State , 4 (3).

World Health Organisation (2017). Onchocerciasis. Retrieved from

http:www.who.int/mediacentre/factsheets/fs374/en/.

World Health Organisation. (2016, 9th April). Onchoverciasis-the disease and its impact. Retrieved

from http://www.who.int/apoc/onchocerciasis/disease/en/.

World Health Organisation. (2011). APOC magazine, Geneva. available at

http://www.who.int/entity/apoc/magazine_final_du_01_juillet_2011.pdf.

WHO. (2010). WHO | Status of onchocerciasis in APOC countries. WHO. Retrieved from

http://www.who.int/apoc/onchocerciasis/status/en/.


http://www.who.int/apoc/onchocerciasis/disease/en/

http://www.who.int/entity/apoc/magazine_final_du_01_juillet_2011.pdf

73

World Health Organisation. (2008). Status of Onchocerciasis in African Programme for

Onchocerciasis Control (APOC) Countries, TDR/AFR/RP/951.6, Geneva.

World Health Organization. (2005). State of the world's sight: vision 2020: the Right to Sight:

1999-2005.

World Health Organisation. (2003). The prevention of blindness, World

Health Organisation Technical Report, No. 518.

World Health Organisation. (2001). Onchocerciasis (river blindness). Report from the Tenth

InterAmerican Conference on Onchocerciasis, Guayaquil, Ecuador. Weekly Epidemiology

Recommendations, 76, 205-212.

World Health Organisation. (1995) Expert Committee on Onchocerciasis. Third Report. Technical

Report Series 752. World Health Organisation. Geneva. Switzerland.

World Health Organisation (1995): Onchocerciasis and its Control. In: WHO technical report

series. No. 852.Geneva.

World Health Organisation. (1987). WHO Expert Committee on Onchocerciasis. Third Report.

Technical Report Series 752. Geneva. Switzerland.


74

Zeng, W. L., Alarcon, C. M., & Donelson, J. E. (1990). Many transcribed regions of the

Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis

elegans. Molecular and Cellular Biology, 10 (6), 2765–73.

http://doi.org/10.1128/MCB.10.6.2765.

Zimmerman, P. A., Toe, L., & Unnasch, T. R. (1993). Design of Onchocerca DNA probes

based upon analysis of a repeated sequence family. Molecular and Biochemical

Parasitology, 58 (2), 259–67. Retrieved from


Zimmerman, P. A., Dadzie, K. Y., De Sole, G., Remme, J., Alley, E. S., & Unnasch, T. R.

(1992). Onchocerca volvulus DNA probe classification correlates with epidemiologic

patterns of blindness. The Journal of Infectious Diseases, 165 (5), 964–8.


75

APPENDICES

APPENDIX 1

PARTICIPANT INFORMATION FORM

Note: To be read or translated to the study subjects in a language they understand.

Dear Participant,

Your permission is kindly being sought to take part in a research study to determine the strain of

Onchocerca volvulus prevalent in your area. This study is being conducted by Rowland

Adukpo, an MPhil candidate from the School of Biomedical and Allied Health Sciences

(SBAHS). I am asking you to take part because you live in this area and so could have been

infected by the parasite.

What the study is about: There is evidence that, at least, two strains of Onchocerca volvulus,

the parasite which causes onchocerciasis exist in West Africa and are transmitted by different

types of blackflies. They are also different in the severity of disease they cause. The savannah

strain found in West Africa is associated with blindness in large proportions of individuals it

infects but the forest strains on the other hand, have been found to be less likely to cause ocular

disease, even in individuals with high parasite load. Reports from field officers working on

onchocerciasis research project in the North Nkwanta district suggested that judging from the

morphological features the microfilariae type present are most probably of the savannah type.

However, the preponderance of the ocular manifestations that are usually associated with


76

infection with savannah strains is absent. The purpose of this study is to characterize the strain

type of O. volvulus prevalent in Kpassa and its environs.

What we will ask you to do: If you agree to be in this study, we will ask you a few questions

and then take skin snips from your buttocks. The skin snips will be examined for the presence of

microfilariae. Further investigations will be conducted on the microfilariae.

Risks and benefits: The risk associated with the skin snipping includes small cut, pain,

discomfort and possible infection. The laboratory scientists and clinicians will take care of any

such complications. Results of the tests will be communicated to health authorities in the district

for appropriate action.

Voluntary participation and confidentiality: Taking part in this study is completely

voluntary. You are free to withdraw at any time from the study. The information you give us

will be used only for the study and not in any way that will harm you. The records of this study

will be kept private. In any sort of report we make public we will not include any information

that will make it possible to identify you. Research records will be kept in a locked file; only the

researchers will have access to the records.

Contact: If you have any questions concerning the study you may contact Dr. Simon K. Attah

at [email protected] or at 0277 520813 or Rowland Adukpo at [email protected] or at

0243 485320.

You will be given a copy of this form to keep for your records.


77

APPENDIX 2

INFORMED CONSENT FORM

I…………………………………………………………of……………………………………….

hereby certify that the contents of the above information has been read by me/ interpreted to me

in the………………………language by…………………………………………………………..

I have perfectly understood the same, and thereby appended my signature/mark (Right

thumbprint) to this consent form as an evidence of my agreement to participate in this project. I

will be given a copy of this consent form after it is completed and signed.

Signature or thumb print of Participant/Guardian ______________________

Date ________________________

Your Name __________________________________________________________

Signature of person obtaining consent ____________________ Date _____________________

Printed name of person obtaining consent _________________ Date _____________________


78

APPENDIX 3

ETHICAL CLEARANCE


79

APPENDIX 4

QUESTIONNAIRE

Study Number___________________________ Date_________________________

Section A: Personal Data

Date of Birth ___________________

Gender: [ ] M [ ] F

Level of education attained

No formal Education [ ]

Primary [ ]

Secondary [ ]

Tertiary [ ]

Other (specify) [ ]

Occupation

Farmer (Crop or animal) [ ]

Fisherman [ ]


80

Hunter [ ]

Trader [ ]

Public/Civil servant [ ]

Other (Student/pupils) [ ]

For how long have you been living in this community?

Have you ever received treatment for onchocerciasis? Yes/No

If yes, when was the last time?

Section B: Assessment of clinical signs and symptoms of onchocerciasis

Does the subject have? Please tick as appropriate

YES NO

Nodule(s) [ ] [ ]

Rashes/Itching [ ] [ ]

Leopard skin [ ] [ ]

Lizard skin [ ] [ ]

Ocular lesion/visual impairment [ ] [ ]

Blindness [ ] [ ]

Other (specify)


Date post:	05-Jan-2022
Category:	Documents
Upload:	others
View:	2 times
Download:	0 times

Determination of Onchocerca volvulus strains prevalent in ...

Documents