Page 1
Development and characterization of a cell line TTCFfrom endangered mahseer Tor tor (Ham.)
K. Yadav • W. S. Lakra • J. Sharma •
M. Goswami • Akhilesh Singh
Received: 7 July 2011 / Accepted: 11 December 2011 / Published online: 28 December 2011
� Springer Science+Business Media B.V. 2011
Abstract Tor tor is an important game and food fish
of India with a distribution throughout Asia from the
trans-Himalayan region to the Mekong River basin to
Malaysia, Pakistan, Bangladesh and Indonesia. A new
cell line named TTCF was developed from the caudal
fin of T. tor for the first time. The cell line was
optimally maintained at 28�C in Leibovitz-15 (L-15)
medium supplemented with 20% fetal bovine serum
(FBS). The propagation of TTCF cells showed a high
plating efficiency of 63.00%. The cytogenetic analysis
revealed a diploid count of 100 chromosomes at
passage 15, 30, 45 and 60 passages. The viability of
the TTCF cell line was found to be 72% after 6 months
of cryopreservation in liquid nitrogen (-196�C). The
origin of the cell lines was confirmed by the ampli-
fication of 578- and 655-bp sequences of 16S rRNA
and cytochrome oxidase subunit I (COI) genes of
mitochondrial DNA (mtDNA) respectively. TTCF
cells were successfully transfected with green fluo-
rescent protein (GFP) reporter plasmids. Further,
immunocytochemistry studies confirm its fibroblastic
morphology of cells. Genotoxicity assessment of
H2O2 in TTCF cell line revealed the utility of TTCF
cell line as in vitro model for aquatic toxicological
studies.
Keywords Tor tor � Cell line: mahseer �Characterization
Introduction
Fish cell lines have increased tremendously in number
covering a wide variety of species and tissues of origin
since the development of the first permanent fish cell
line in 1962 from the gonad tissue of rainbow trout.
Fish cell lines have been significantly used in fish
immunology (Clem et al. 1996; Bols et al. 2001),
toxicology (Babich and Borenfreund 1991; Segner
1998), ecotoxicology (Fent 2001; Castano et al. 2003;
Schirmer 2006), endocrinology (Bols and Lee 1991),
virology (Wolf 1988), biomedical research (Hightow-
er and Renfro 1988), disease control (Villena 2003),
biotechnology and aquaculture (Bols 1991) and radi-
ation biology (Ryan et al. 2008). Most of the
established cell lines have been derived from cold-
water fish of European origin (Lakra and Bhonde
1996). Very few cell lines have been developed from
fish cultured in Asia and South East Asia. However,
the Indian scenario is changing fast, and consistent
K. Yadav (&) � M. Goswami � A. Singh
National Bureau of Fish Genetic Resources (NBFGR),
Lucknow, UP 226002, India
e-mail: [email protected]
W. S. Lakra
Central Institute of Fisheries Education,
Versova, Andheri (W), Mumbai 400061, India
J. Sharma
Department of Biotechnology, Kurukshetra University,
Kurukshetra, Haryana, India
123
Fish Physiol Biochem (2012) 38:1035–1045
DOI 10.1007/s10695-011-9588-7
Page 2
efforts are being made toward developing new cell
lines. Recently, some fish cell lines have been
developed from Tor putitora (Lakra et al. 2006a),
Etroplus suratensis (Swaminathan et al. 2010), Epi-
nephelus coioides and Chanos chanos (Parameswaran
et al. 2007), Lates calcarifer (Lakra et al. 2006b;
Parameswaran et al. 2006), Labeo rohita (Lakra et al.
2010a), Puntius densonii (Lakra et al. 2010b) and
Puntius sophore (Lakra and Goswami 2011).
Tor tor commonly called as Tor mahseer in India,
belonging to the Family Cyprinidae, are described as the
‘‘King of Indian freshwater systems.’’ Mahseer possess
high commercial and recreational value as they are
potential game as well as food fish. About 20 species are
currently recognized within the genus, occurring
throughout Asia from the trans-Himalayan Region to
the Mekong River basin to Malaysia, Pakistan, Bangla-
desh and Indonesia. Over-exploitation of the natural
stocks and the deterioration of environmental conditions
have resulted in significant decline of mahseers in the
wild (Ogale 2002). So, the species is enlisted under
endangered category (CAMP 1998; Lakra and Sarkar
2007).The present study reports development and
characterization of a cell line TTCF from caudal fin of
endanger endangered mahseer T. tor (Ham.) for the first
time. Development of cell lines from T. tor will open
new vistas of in vitro research in genetics and conser-
vation of mahseer species.
Materials and methods
Explant preparation
Fry and fingerlings of live T. tor (15–20 g) were
collected from the Narmada River, Hoshangabad
(M.P.), and were maintained at the wet laboratory of
National Bureau of Fish Genetic Resources (NBFGR),
Lucknow. Live fingerlings (15–20 g) were maintained
in sterile, aerated water containing 1,000 IU/ml pen-
icillin and 1,000 lg/ml streptomycin for 24 h at room
temperature. Before experimentation, the surface of
fish was sterilized by dipping in idophore for 5 min,
and the specimen was euthanized by keeping in ice for
5 min before explants preparation. Then, the caudal
fin was taken out aseptically and washed with PBS
containing 500 IU/ml penicillin and 500 lg/ml strep-
tomycin and 2.5 mg/ml fungi zone. The tissue samples
were then minced with sterile dissecting blades and
scissors at room temperature and washed four times
with PBS containing antibiotic and antimycotic solu-
tion. Then, minced tissues were seeded into 25-cm2
cell culture flasks (Nunc, Denmark) with 50 ll fetal
bovine serum (FBS) (Invitrogen) and allowed to attach
to the surface of the flask. The flasks were incubated at
28�C after 24 h. L-15 medium supplemented with
different concentration of serum (10, 15, and 20%)
was added, and the medium was changed after every
5 days. The flasks were observed daily for attachment
of explants, proliferation and spreading of cells and
other morphological details using an inverted micro-
scope (Olympus Optical Co., Ltd).
Subculture
After reaching 90–95% confluency, the cells were
trypsinized using 0.25% trypsin solution and 0.2%
ethylenediaminetetraacetic acid (EDTA) in PBS. The
subcultured cells were grown in fresh L-15 with 20%
FBS. In the initial 10 subcultures, 50% of the culture
medium was replaced with the fresh medium.
Growth studies
Growth characteristics of the cell line were assessed at
selected temperatures, FBS and bFGF concentrations.
The growth rates were assessed at five different
incubation temperatures (18, 20, 24, 28 and 32�C) for
7 days. A seeding concentration of 1 9 105 cells ml-1
at passage 15 and subsequent passages was used in
25-cm2 tissue culture flasks. On alternate days, 3 flasks
from different temperatures at which they were
incubated were withdrawn, trypsinized and cell
counting performed (4 counts per flask) using a
hemocytometer. Analogous procedures were per-
formed for the effects of various concentrations of
FBS (5, 10, 15 and 20%) and basic fibroblastic growth
factor (bFGF) (13256-029/Invitrogen) (0, 5 and 10 ng/
ml) on cell growth at 28�C for 7 days.
Morphological confirmation
by immunocytochemistry
Confirmation of the fibroblast morphology of the
TTCF cells was made by immunocytochemistry with
monoclonal antibodies directed against vimentin and
cytokeratin (C-18) at sixtieth passage. In brief, cells
were grown to confluency in 12-well plates (Nunc).
1036 Fish Physiol Biochem (2012) 38:1035–1045
123
Page 3
Upon reaching 90–95% confluency, cells were washed
with PBS and were fixed in paraformaldehyde (PFA)
4%. After fixation, the cells were washed in PBS two
times and were blocked with 5% sheep serum and
.01% Triton X in PBS then incubated for 40 min at
37�C. Block was removed and 100 ll of either a 1:40
dilution anti vimentin clone V9 (V6630-CLONE 9
Sigma), and a 1:400 dilution of anti-pan cytokeratin
clone-11 (C2931-Clone C-11Sigma) was added.
Slides were incubated for overnight at 4�C. Next
day, the cells were washed with PBS and were
incubated for 30 m with 100 ll of a 1:300 dilution
of FITC-labeled anti-mouse IgG. Cells were washed in
PBS, were covered with 50% glycerol in PBS under
coverslip and were observed under fluorescence
microscope. Appropriate controls for autofluorescence
and secondary antibodies were included.
Cell plating efficiency
The plating efficiency of cell line was determined at
35th passage. Plating efficiency for the cell line was
determined at seeding concentrations of 200, 500 and
1,000 cells per flask (25-cm2 tissue culture flask) in
duplicate. The cells were incubated at 28�C in L-15
medium with 20% FBS. After 12 days, the medium
was discarded, and the cells were fixed with 5 ml of
crystal violet (1%)–formalin (25%) stain-fixative for
15 min, rinsed with tap water and air-dried. The
colonies were then counted (x) under the microscope,
and plating efficiency (y) was calculated using the
formula x = 100xz-1 (Freshney 1994).
Cryopreservation
The ability of cells to survive in liquid nitrogen (LN2)
and their stability were assessed in three replicates in
freezing medium at 20, 35, 45 and 57 passages. In brief,
cells growing logarithmically were harvested by centri-
fugation and washed with PBS and then suspended in
L-15 medium with 20% FBS and 10% dimethyl
sulfoxide (DMSO) at concentration of 3 9 106 cells
per ml. Aliquots (1.0 ml) were dispensed into 2.0-ml
sterile cryovials (10 numbers) (Nunc) held at 4�C for
2 h, -20�C for 1 h, at -70�C overnight and then
transferred into LN2 (-196�C). The frozen cells were
recovered after 6 months of post-storage by thawing at
28�C in a water bath. After removing the freezing
medium, the cells were suspended in L-15 with 20%
FBS. The viability of the cells was measured by trypan
blue staining, and the number of cells was counted using
hemocytometer. The viable cells were seeded then into
25-cm2 cell culture flask.
Chromosomal analysis
Chromosomal counts were established at passages 15,
30, 45 and 60. Cells were seeded in duplicate 75-cm2
tissue culture flasks in L-15 medium with 20% FBS.
After 24 h of incubation, medium was replaced with
10 ml of fresh medium containing 0.1 ml colcemid
solution (1 lg ml-1), (Sigma, St Louis, MO, USA)
into the 1-day-old cell culture for 2 h at 28�C. After
harvesting by centrifugation (700 g, 5 min), the cells
were suspended in a hypotonic solution consisting of
0.5% KCl for 10 min and fixed in methanol: acetic
acid (3:1). Slides were prepared following the con-
ventional drop-splash technique (Freshney 1994). The
chromosomes were counted under a microscope, after
staining with 5% Giemsa for 10 min.
Molecular characterization
Template DNA for PCR assays was prepared by
extraction from tissues of T. tor and cultured fin cells
following the method described by Lo et al. (1996).
Briefly, the samples were homogenized separately in
lysis solution buffer (100 mm NaCl, 10 mm Tris–
HCl, pH 8.0, 25 mm EDTA, pH 8.0, 0.5% sodium
dodecyl sulfate, 0.1 mg ml-1proteinase K) and then
incubated at 65�C for 1 h; 5 M NaCl was added to a
final concentration of 0.7 M followed by slow addition
of 1/10 volume of N-cetyl N,N,N-trimethyl ammo-
nium bromide (CTAB)/NaCl solution (10% CTAB in
0.7 M NaCl). After incubation at 65�C for 2 h, the
digests were deproteinized by successive phenol/
chloroform/isoamyl alcohol extraction, and DNA
was recovered by ethanol precipitation, drying and
resuspension in TE buffer. The concentration of
isolated DNA was estimated at wavelength of
260 nm using a UV spectrophotometer. The DNA
was diluted to get a final concentration of 100 ng ll-1.
The 578-bp fragment of mitochondrial 16S rRNA
gene was amplified in a 50-ll reaction volume with
5 ll of 19 Taq polymerase buffer, 0.2 mM of each
dNTP, 0.4 lM of each primer, 2.5U of Taq polymer-
ase and 100 ng genomic DNA using the thermal cycler
C-1000 (BIORAD). The primers used for the
Fish Physiol Biochem (2012) 38:1035–1045 1037
123
Page 4
amplification of the partial 16S rRNA gene were
16SAR (50-CGCCTGTTTATCAAAAACAT-30) and
16SBR (50-CCGGTCTGAACTCAGATCACGT-30)(Palumbi et al. 1991). The thermal profile used was
35 repetitions of a three-step cycle consisting of
denaturation at 94�C for 1 min, annealing at 55�C for
1 min and extension at 72�C for 1.5 min including
4 min for initial denaturation at 94�C and 7 min for the
final extension at 72�C.
The 655-bp fragments of cytochrome oxidase
subunit I (COI) gene was also amplified in a 50-ll
reaction volume with 5 ll of 1X Taq polymerase
buffer, 0.2 mM of each dNTP, 0.4 lM of each primer,
2.5U of Taq polymerase and 100 ng genomic DNA
using the thermal cycler C-1000 (BIORAD). The
primers used for the amplification of the COI gene
were FISHF1-50TCAACCAACCACAAAGACATT
GGCAC30 and FISH R1-50TAGACTTCTGG-GTG
GCCAAAGAATCA30 (Ward et al. 2005). The ther-
mal regime consisted of an initial step of 2 min at
95�C followed by 35 cycles of 40 s at 94�C, 40 s at
54�C and 1 min 10 s at 72�C followed by final
extension of 10 min at 72�C.
The PCR products were visualized on 1.2% agarose
gels, and the most intense products were selected for
sequencing. Products were labeled using the BigDye
Terminator V.3.1 Cycle sequencing Kit (Applied
Biosystems, Inc) and sequenced bidirectionally using
an ABI 3730 capillary sequencer following manufac-
turer’s instructions. The obtained sequences of PCR
fragments were compared with the known sequences
of the species.
Transfection with GFP reporter gene
Subcofluent monolayers (70–80% confluency) of
TTCF cells at 50th passage were transected with
pEGFP-C1 plasmid using lipofectamine LTX and Plus
Reagents (Invitrogen). In brief, the cells of TTCF were
seeded at a density of 1 9 105 in 12-well plates
individually and incubated for 18 h at 28�C in normal
atmospheric incubator. Before transfection, the cells
were rinsed with PBS and supplemented with 500 ll
of fresh L-15 medium devoid of serum and antibiotics
at pH 7.4. The plasmid (200 ng of pEGFP-C1) was
dissolved in 100 ll of Optimum, and then, 0.5 ll of
Plus Reagent was added. The mixture was incubated
for 5 min at 30�C, and then, 2 ll of LTX was added
and incubated for 30 min. Then, the mixture was
added dropwise on 70–80% confluent TTCF cells in
12-well plates. The medium was changed after 6 h and
added fresh medium. The green fluorescence signals
were observed after 18 h under a fluorescence micro-
scope (Olympus).
Comet assay
TTCF cells at the passage 50 were regularly cultured in
25-cm2 flask using Leibovitz’s L-15 culture medium,
with 20% fetal bovine serum (FBS). Cells were
trypsinized using TPVG solution (0.1% trypsin, 0.2%
ethylene diamine tetra acetic acid (EDTA) and 2%
glucose in 1x PBS) before being used in the comet assay.
Hydrogen peroxide (H2O2), a genotoxic model com-
pound, was used in order to assess the efficiency of the
comet assay in estimating genotoxicity on these cells.
Comet assay was carried out following the protocol of
Singh et al. (1988) with minor modifications. The
(H2O2)-treated cells were embedded in 0.6% low
melting agarose layers (Sigma-Aldrich Chemicals
Co.) on slide, precoated with 1.0% normal melting
agarose, coated with an additional layer of 0.5% normal
melting agarose and lysed with high salt and detergent
(100 mM EDTA, 2.5 M NaCl, 10 mM tris base, 1%
Triton X-100, adjusted to pH 10) for 1 h. DNA was
allowed to unwind (1 mM EDTA, 10% DMSO,
300 mM NaOH) for 20 min and then subjected to
electrophoresis in the same solution as for unwinding
(25 V, 300 mA) for 15 min. After electrophoresis, the
alkalis in the gels were neutralized by rinsing the slides
with a buffer (0.1 M Tris pH 7.5) for 5 min, dried and
fixed in methanol. The slides were stained with 45 ll of
20 lg/ml ethidium bromide solution and viewed under a
fluorescent microscope (Olympus Optical Co. Ltd).
Results
Morphological observation
Morphological observation under the inverted micro-
scope revealed that cell radiation started from the
explant after 3–4 days of explant preparation, and the
cell proliferating from the explants grew well and
formed a confluent monolayer around the explants
within 7–10 days (Fig. 1a, b). During initial subcul-
tures, cells were of heterogeneous in nature and consist
of both epithelial and fibroblastic cells (Fig. 1c, d).
1038 Fish Physiol Biochem (2012) 38:1035–1045
123
Page 5
After 7th passage, population of fibroblastic cells
dominates over epithelial cells, resulting in homoge-
nous population of fibroblastic cells (Fig. 1e, f).
During the initial 10 subcultures at an interval of
5–7 days, a blend of 50% each of new and old medium
was used. In subsequent subcultures, cells were
subcultured in L-15 with 20% FBS at 5 days of
interval.
Immunocytochemistry
The TTCF cells showed positive reaction for vimentin
and negative reaction for cytokeratin (Fig. 2a, b).
Growth studies
The growth rate of TTCF cells increased as the FBS
concentration was increased from 5 to 20% at 28�C.
Cells exhibited poor growth at 5% concentrations of
FBS, and relatively better growth was observed at
10–15% but maximum growth occurred with the
concentrations of 20% FBS (Fig. 3a). The addition of
bFGF stimulates the proliferation of cells as its concen-
tration is increased from 0 to 10 ng/ml (Fig. 3c). The
absence of bFGF significantly decreased the prolifera-
tion of cells. The growth of cells increased as the culture
temperature increased from 20 to 28�C. The cells were
Fig. 1 Phase-contrast photomicrographs of TTCF cells derived
from the caudal fin of Tor tor. a, b Confluent monolayer around
the explants within 7–10 days (9100), c, d heterogeneous
nature of cells during initial subcultures (9100), e, f subcultured
cells at passage 60 (9100) and (9200) respectively
Fish Physiol Biochem (2012) 38:1035–1045 1039
123
Page 6
also able to grow at temperature range between 24 and
32�C. However, maximum growth was obtained at
28�C. No significant growth was observed at 18 and
20�C in the cell lines (Fig. 3b).
Cell plating efficiency
Plating efficiency for each cell line was determined at
seeding concentrations of 200, 500 and 1,000 cells.
TTCF cells showed plating efficiency of 63.00% with
no significant differences between replicates.
Cryopreservation
Evaluation of the viability of TTCF cells stored in
liquid nitrogen (-196�C) expressed the capability of
the cells to survive following 6 months of storage. The
cells recovered from liquid nitrogen storage showed
70–72% viability and grew to confluency within
7 days. Following storage, no alterations in morphol-
ogy or growth pattern were observed.
Chromosomal analysis
The 113 metaphase plates prepared for karyological
analysis at passage 15, 30, 45 and 60 revealed that the
number of diploid chromosomes in TTCF cells ranged
from 94 to 102 with a model value of 100 (Fig. 4).
Both heteroploidy and aneuploidy were observed in
the cell line, though they were small in proportion.
Molecular characterization
Amplification of 16S rRNA and COI genes of TTCF cell
line yielded 578 and 655 bp, respectively. Subsequent
comparative analysis of the sequences of COI and 16S
rRNA derived from TTCF cells demonstrated a 98–99%
match with the known mitochondrial DNA sequences
from T. tor voucher specimens. GenBank accession no.
for 16S rRNA and COI of TTCF cell line were JN032124
and JN032125 respectively. Our data demonstrated that
TTCF cell line is indeed truly derived from T. tor.
Transfection with GFP reporter gene
The TTCF cell lines were successfully transfected
with pEGFP-C1 plasmid using lipofectamine LTX and
Plus Reagents (Invitrogen). The expression of EGFP
in the TTCF cell line was detected after 16 h of
transfection (Fig. 5a, b).
Comet assay
Exposure of TTCF cells to H2O2 demonstrated a high
level of comet formation whereas there was no comet
observed in control TTCF cells (Fig. 6a, b).
Discussion
In the present study, in vitro cell culture system from
caudal fin of T. tor, designated as TTCF cell line, was
established by explant technique. The tissue of choice
and optimum physicochemical environment-like cul-
ture medium, FBS concentration, growth supplements,
incubation temperature, etc., varies considerably across
fish species. The bFGF growth factor, a potent mito-
genic agent, has been used in previous cell culture
studies (Halaban et al. 1988; Hong et al. 1996; Chen
et al. 2003). Our results demonstrated that bFGF
stimulates the proliferation of TTCF cells, and hence,
it can be used as growth factor in fish cell cultures. The
Fig. 2 Characterization of fibroblastic nature of TTCF cells by immunocytochemistry. a Vimentin-FITC- and b Cytokeratin-FITC-
labeled fibroblast cells. (Scale bar 20 lm)
1040 Fish Physiol Biochem (2012) 38:1035–1045
123
Page 7
TTCF cell line was grown in L-15 medium supple-
mented with 20% FBS. FBS is essential for survival and
optimal growth of cells. In primary cell cultures, FBS at
high concentrations (20%) is favorable for cell growth
and proper attachment. However, 15% concentration of
FBS also provided relatively good growth, and this is an
added advantage to maintain the cell line at low cost.
Relatively good growth of the fish cell lines was
observed at 10% FBS, but maximum growth was
observed with the concentrations of 15 and 20%
(Hameed et al. 2006; Lakra et al. 2006b; Ye et al.
2006). The temperature ranged from 24 to 32�C
supported the growth of TTCF cells with an optimum
temperature of 28�C, which was in conformity with
other fish cell lines reported earlier (Tong et al. 1997;
Lakra et al. 2006a). The highest growth rate of various
tropical fish cell lines was observed at 32�C (Lai et al.
2003), 28�C (Sathe et al. 1995) and 20–25�C (Tong et al.
Fig. 3 a Growth of TTCF
cells at different temperature
(�C). b Growth of TTCF
cells at different
concentration of FBS
(percentage). c Growth of
TTCF cells at different
concentration of bFGF (ng/
ml) (initial plating
density = 1 9 105 cells)
Fish Physiol Biochem (2012) 38:1035–1045 1041
123
Page 8
1997). A temperature of 35–37�C has been reported to
be lethal to many fish cells (Tong et al. 1997). One of the
advantages of cell lines that grow over a wide temper-
ature range is their potential suitability for isolating both
warm-water and cold-water fish viruses (Nicholson
et al. 1987).
The TTCF cell line was subcultured 64 times,
respectively, over a period of one and a half year.
During initial subcultures of TTCF, cells exhibited both
fibroblast-like cells and epithelial-like cells. However,
in subsequent subcultures, fibroblast cells predominated
in the TTCF cell line. The fibroblast morphology of the
TTCF cells was confirmed by cell-specific marker.
Usually, a predomination of fibroblastic cells over
epithelioid cells in cell cultures from fish has been
reported (Bejar et al. 1997; Lai et al. 2003; Lakra et al.
2006a). Ye et al. (2006) developed a fibroblast-like cell
line (LJH-2) from Lateolabrax japonicus. In contrast,
SPH (Sea perch Heart) cells migrating from heart tissue
have been reported to be epithelioid in morphology with
no change during successive propagation (Tong et al.
1998).
The cryopreserved TTCF cell lines were revived
after an interval of 6 months with 70 to 72% viabilityFig. 4 A standard chromosome spread of T. tor cell line TTCF
at passage 45
Fig. 5 Green fluorescent protein expression in transected TTCF cells of T. tor at 50 passage, transfected with 200 ng of pEGFP-C1
vector. a Fluorescent view. b Phase contrast view
Fig. 6 Fluorescence microscopic images of TTCF cells after comet assay. a Without H2O2-treated TTCF cells (control). b TTCF cells
treated with H2O2 for 5 min
1042 Fish Physiol Biochem (2012) 38:1035–1045
123
Page 9
without any significant morphological alteration or
changes in growth rate and cell doubling times after
freezing and thawing. The viability of cryopreserved
cell line was 50% for SAF-1 (S. aurata) (Bejar et al.
1997), 73% for GF-1 (E. coioides) (Chi et al. 1999),
80–85% for SF (L. calcarifer) (Chang et al. 2001) and
75% for PSCF (Puntius sophore) (Lakra and Goswami
2011). This cryopreserved cell line will be instrumen-
tal in conserving biodiversity of this important mah-
sheer species.
The TTCF cell line showed high plating efficiency,
that is, 63.0% in L-15 medium with 20% FBS. Bejar
et al. (1997) recorded 65.3% for the continuous cell
line SAF-1 at 10% FBS. Chi et al. (1999) recorded the
plating efficiency of 21% of the GF-1 cells seeded at a
density of 100 cells per flask at subculture 50, and this
increased to 80% at subculture 80.
The chromosomal analysis revealed that the num-
ber of chromosomes in TTCF cell ranged from 96 to
102 with a model value of 100. Both heteroploidy and
aneuploidy were observed in the cell line though they
were small in proportion. Loss of chromosomes or
additions from nearby cells during chromosome
preparation could be the possible reason for the
abnormal chromosome number in a low percentage
TTCF cells. Karyotype analysis revealed that TTCF
cell lines possessed a diploid chromosome number of
2 N = 100, which was identical to the modal chro-
mosome number of T. tor (NBFGR 1998).
Hebert et al. (2003) have demonstrated the utility of
COI gene as a universal barcode, referred as ‘‘DNA
barcoding’’ for the genetic identification of animal
life. Recently, Cooper et al. (2007) used COI region
for identification of sixty-seven cell lines used for
barcode analysis. Identity of TTCF cell line was
conformed by using 578- and 655-bp fragments of 16S
rRNA and COI.
The TTCF cell lines were successfully transected
with pEGFP-C1 plasmid using lipofectamine LTX and
Plus Reagents (Invitrogen). However, the estimated
transfection efficiency was 7% which is comparable to
PSCF cell line with 10% efficiency (Lakra and
Goswami 2011) and to other fish cell lines (Sha
et al. 2010; Wang et al. 2010). Zhou et al. (2008)
reported 2% transfection efficiency in a CSTF cell line
developed from Chinese sturgeon Acipenser sinensis
Gray. This reveals the importance of TTCF cell line in
transgenesis. When TTCF cells were treated with
H2O2, a well-known genotoxicant, then it resulted in
comet formation which indicates damage in DNA
while no comet was observed in control cells. The
comet formation in the TTCF cell line exposed to
H2O2 justifies the application of TTCF cell line in
various toxicological studies as in vitro model system.
The success in establishing new cell line from T. tor
will open new vistas of in vitro research in genetics
and conservation of endangered mahseer species.
Acknowledgments The authors are grateful to Dr. J.K. Jena,
Director National Bureau of Fish Genetic Resources for his
support and encouragement. The Department of Biotechnology,
Government of India, is thankfully acknowledged for financial
support. We also like to thank Mr. Raj Bahadur Yadav and other
laboratory mates of Molecular Biology and Biotechnology
Division NBFGR for their co-operation and support.
References
Babich H, Borenfreund E (1991) Cytotoxicity and genotoxicity
assays with cultured fish cells: a review. Toxicol In Vitro
5:91–100
Bejar J, Borrego JJ, Alvarez MC (1997) A continuous cell line
from the cultured marine fish gilt-head sea bream (Sparusaurata). Aquaculture 150:143–153
Bols NC (1991) Biotechnology and aquaculture: the role of cell
cultures. Biotechnol Adv 9:31–49
Bols NC, Lee LEJ (1991) Technology and uses of cell culture
from tissues and organs of bony fish. Cytotechnology
6:163–187
Bols NC, Brubacher JL, Ganassin RC, Lee LEJ (2001) Eco-
toxicology and innate immunity in fish. Dev Comp
Immunol 25:853–873
CAMP (1998) Report of the workshop ‘‘Conservation, Assess-
ment and Management Plan for Freshwater fishes of India
1997’’ organized by Zoo Outreach Organization (ZOO)
and National Bureau of Fish Genetic Resources, Lucknow,
held at NBFGR in Sept 1997. p 156
Castano A, Bols NC, Braunbeck T, Dierickx P, Halder M, Iso-
maa B, Kawahara K, Lee LEJ, Mothersill C, Part P, Rep-
etto G, Riego Sintes J, Rufli H, Smith R, Wood C, Segner H
(2003) The use of fish cells in ecotoxicology. ATLA
31:317–351
Chang SF, Ngoh GH, Kueh LFS, Qin QM, Che CL, Lam TJ, Sin
YM (2001) Development of a tropical marine fish cell line
from Asian seabass (Lates calcarifer) for virus isolation.
Aquaculture 192:133–145
Chen SL, Sha ZX, Ye HQ (2003) Establishment of a pluripotent
embryonic cell line from sea perch blastula embryo.
Aquaculture 218:141–151
Chi SC, Hu WW, Lo BJ (1999) Establishment and character-
ization of a continuous cell line (GF-1) derived from
grouper, Epinephelus coioides: a cell line susceptible to
grouper nervous necrosis virus (GNNV). J Fish Dis
22:173–182
Clem LW, Bly JE, Wilson M, Chinchar VG, Stuge T, Barker K,
Luft C, Rycyzyn M, Hogan RJ, van Lopik T, Miller NW
Fish Physiol Biochem (2012) 38:1035–1045 1043
123
Page 10
(1996) Fish immunology: the utility of immortalized
lymphoid cells—a mini review. Vet Immunol Immuno-
pathol 54:137–144
Cooper JK, Sykes G, King S (2007) Species identification in cell
culture: a two-pronged molecular approach. In Vitro Cell
Dev Biol 43:344–351
Fent K (2001) Fish cell lines as versatile tools in ecotoxicology:
assessment of cytotoxicity, cytochrome P4501A induction
potential and estrogenic activity of chemicals and envi-
ronmental samples. Toxicol In Vitro 15:477–488
Freshney RI (1994) Culture of animal cells: a manual of basic
technique. Wiley-Liss, New York
Halaban R, Langdon R, Birchall N, Cuono C, Baird A, Scott G,
Moellman G, Mcguire J (1988) Basic fibroblast growth
factor from human keratinocytes is a natural mitogen for
melanocytes. J Cell Biol 107:1611–1619
Hameed ASS, Parameswaran V, Shukla R, Singh IS, Thir-
unavukkarasu AR, Bhonde RR (2006) Establishment and
characterization of India’s first marine fish cell line from
kidney of sea bass, Lates calcarifer. Aquaculture 257:92–103
Hebert PDN, Cywinska A, Ball SL, Waard JRD (2003) Bio-
logical identifications through DNA barcodes. Proc R Soc
Lond B 270:313–321
Hightower LH, Renfro JL (1988) Recent applications of fish cell
culture to biomedical research. J Exp Zool 248:290–302
Hong Y, Winkler C, Schartl M (1996) Pluripotency and dif-
ferentiation of embryonic stem cell lines from the me-
dakafish (Oryzias latipes). Mech Dev 60:33–44
Lai YS, John JAC, Lin CH, Guo IC, Chen SC, Fang F, Lin CH,
Chang CY (2003) Establishment of cell lines from a trop-
ical grouper, Epinephelus awoara (Temminck and Schle-
gel), and their susceptibility to grouper irido and
nodaviruses. J Fish Dis 26:31–42
Lakra WS, Bhonde RR (1996) Development of primary cell
culture from the caudal fin of an Indian major carp, Labeorohita (Ham). Asian Fish Sci 9:149–152
Lakra WS, Goswami M (2011) Development and character-
ization of a continuous cell line PSCF from Puntius so-phore. J Fish Biol 78:987–1001
Lakra WS, Sarkar UK (2007) Fish diversity of Central India.
NBFGR Publication, Lucknow, pp 1–183
Lakra WS, Bhonde RR, Sivakumar N, Ayyappan S (2006a) A
new fibroblast like cell line from the fry of golden mahseer
Tor putitora (Ham). Aquaculture 253:238–243
Lakra WS, Sivakumar N, Goswami M, Bhonde RR (2006b)
Development of two cell culture systems from Asian sea-
bass Lates calcarifer (Bloch). Aquacult Res 37:18–24
Lakra WS, Swaminathan TR, Rathore G, Goswami M, Yadav K,
Kapoor S (2010a) Development and characterization of
three new diploid cell lines from Labeo rohita (Ham.).
Biotechnol Progr 26:1008–1013
Lakra WS, Goswami M, Yadav K, Gopalakrishnan A, Patiyal R
S, Singh M (2010b) Development and characterization of
two cell lines PDF and PDH from Puntius denisonii (Day
1865) In Vitro Cell Dev Biol Anim. 47(2):89–94. doi:
10.1007/s11626-010-9374-3
Lo CF, Leu JH, Ho CH, Chen CH, Peng SE, Chen YT, Yeh PY,
Huang CJ, Wang CH, Kou GH (1996) Detection of bacu-
lovirus associated with white spot syndrome (WSSV) in
penaeid shrimps using polymerase chain reaction. Dis.
Aquat. Org. 25:133–141
NBFGR (1998) Fish chromosome atlas. National Bureau of Fish
Genetic Resources Special Publication No. 1. Lucknow,
India
Nicholson BL, Danner DJ, Wu JL (1987) Three new continuous
cell lines from marine fishes of Asia. In Vitro Cell Dev Biol
23:199–204
Ogale SN (2002) Mahseer ranching. In: Boopendranath MR,
Meenakumari B, Joseph J, Sankar TV, Pravin P, Edwin L
(eds) Riverine and reservoir fisheries of India. p 458
Palumbi S, Martin A, Romano S, McMillan WO, Stice L,
Grabowski G (1991) The simple fool’s guide to PCR.
Version 2.0. Department of Zoology and Kewalo Marine
Laboratory, University of Hawaii, Honolulu, HI
Parameswaran V, Shukla R, Bhonde RR, Hameed ASS (2006)
Splenic cell line from sea bass, Lates calcarifer: estab-
lishment and characterization. Aquaculture 261:43–53
Parameswaran V, Ahmed VPI, Shukla R, Bhonde RR, Hameed
ASS (2007) Development and characterization of two new
cell lines from milkfish (Chanos chanos) and grouper (Epi-nephelus coioides) for virus isolation. Mar Biotechnol
9:281–291
Ryan LA, Seymour CB, O’Neill-Mehlenbacher A, Mothersill
CE (2008) Radiation-induced adaptive response in fish cell
lines. J Environ Radioact 99:739–747
Sathe PS, Maurya DT, Basu A, Gogate SS, Banerjee K (1995)
Establishment and characterization of a new fish cell line,
MG-3, from the gills of mrigal Cirrhinus mrigala. Ind J
Exp Biol 33:589–594
Schirmer K (2006) Proposal to improve vertebrate cell cultures to
establish them as substitutes for the regulatory testing of
chemicals and effluents using fish. Toxicology 224:163–183
Segner H (1998) Fish cell lines as a tool in aquatic toxicology.
EXS 86:1–38
Sha ZA, Ren G, Wang X, Wang N, Chen S (2010) Development
and characterization of a cell line from the embryos of half
smooth tongue sole (Cynoglossus semilaevis). Acta Ocea-
nologica Sinica 29(2):81–87
Singh NP, McCoy MT, Tice RR, Scheider EL (1988) A simple
technique for quantitation of low levels of DNA damage in
individual cells. Exp Cell Res 175:184–191
Swaminathan TR, Lakra WS, Gopalakrishnan A, Basheer VS,
Khushwaha B, Sajeela KA (2010) Development and
characterization of a new epithelial cell line PSF from
caudal fin of Green chromide, Etroplus suratensis (Bloch,
1790). In Vitro Cell Dev Biol Anim. 46(8):647–656. doi:
10.1007/s11626-010-9326-y
Tong SL, Lee H, Miao HZ (1997) The establishment and partial
characterization of a continuous fish cell line FG-9307
from the gill of flounder Paralichthys olivaceus. Aqua-
culture 156:327–333
Tong SL, Miao HZ, Li H (1998) Three new continuous fish cell
lines of SPH, SPS and RSBF derived from sea perch
(Lateolabrax japaonicus) and red sea bream (Pagrosomusmajor). Aquaculture 169:143–151
Villena AJ (2003) Applications and needs of fish and shellfish
cell culture for disease control in aquaculture. Rev Fish
Biol Fish 13:111–140
Wang XL, Wang N, Sha ZX, Chen SL (2010) Establishment,
characterization of a new cell line from heart of half smooth
tongue sole (Cynoglossus semilaevis). Fish Physiol Bio-
chem. 36(4):1181–1189. doi:10.1007/s10695-010-9396-5
1044 Fish Physiol Biochem (2012) 38:1035–1045
123
Page 11
Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005)
DNA barcoding Australia’s fish species. Philos Trans R
Soc Lond B 360:1847–1857
Wolf K (1988) Fish viruses and fish viral diseases. Cornell
University Press, New York
Ye HQ, Chen SL, Sha ZX, Xu MY (2006) Development and
characterization of cell lines from heart, liver, spleen and
head kidney of sea perch Lateolabrax japonicus. J Fish
Biol 69:115–126
Zhou GZ, Gui L, Li ZQ, Yuan XP, Zhang QY (2008) Estab-
lishment of a Chinese sturgeon Acipenser sinensis tail-fin
cell line and its susceptibility to frog iridovirus. J Fish Biol
73:2058–2067
Fish Physiol Biochem (2012) 38:1035–1045 1045
123
