Development of Diagnostic Tools for the Seed
Potato Industry
This thesis is presented for the degree of
Doctor of Philosophy of Murdoch University
2010
by
Sheila Mary Mortimer-Jones
BSc. Hons. (Biomedical Sciences)
ii
Thesis declaration
I declare that this thesis is my own account of my research and
contains as its main content work which has not been submitted for a
degree at any tertiary educational institution
_____________________
Sheila Mary Mortimer-Jones
iii
Abstract
The Australian potato industry is threatened by inadequate measures to control the
virus health of seed potatoes. Potatoes are vegetatively propagated; therefore
infection can result in disease spreading through generations. This has the
potential to cause significant economic losses. Virus testing on tuber sprouts is
currently conducted by ELISA, however a significant time delay of several weeks
can occur while tubers sprout. There is a considerable need for a rapid,
quantitative and cost effective virus test directly on bulked samples of dormant
tubers to identify infected lots during seed multiplication.
The potato viruses of economic importance in Western Australia are Potato virus
S, (PVS), Potato virus X, (PVX), Potato leafroll virus, (PLRV) and Tomato
spotted wilt virus (TSWV). The main aim of this project was to develop reliable
PCR-based methods for multiplex real-time quantitative detection of these viruses
in bulked potato tuber samples for seed certification for domestic and export
markets.
Knowledge of the distribution of the viruses within tuber tissue was needed to
develop more effective methods of RNA extraction. The distribution of the
viruses in histological sections of potato tubers was investigated using
immunohistochemistry and in situ hybridization. All four viruses were found to be
distributed at the stolon end of freshly harvested infected potato tubers. Extraction
of RNA from tuber tissue is problematic because it contains starches and
phenolics which inhibit RT-PCR. Extracting RNA from the tuber peelings would
overcome this problem; however one of the viruses, PLRV, is restricted to the
iv
phloem in potato tubers. The distribution of the phloem in the superficial tissue of
potato tubers was therefore investigated using histological staining and
transmission electron microscopy. The vascular tissue was found to be within 2
mm below the epidermis of the tuber. With this knowledge, total RNA was
extracted rapidly and efficiently from bulked potato peelings equivalent to 300
dormant tubers to detect single infections of PLRV, PVX, PVS and TSWV.
For the quantitative detection of these viruses in potato leaves and tuber tissue,
specific primers and fluorescent-labeled TaqMan® probes were designed. A real-
time multiplex, single tube RT-PCR assay was developed. The main tasks
involved primer design, optimization of reagents, standardization of RNA
samples from which standard curves for analysis were generated, and
identification of a baseline on which to interpret results.
Limits of detection sensitivity were established using a range of virus transcript
copy numbers (8 x 101 to 8 x 10
9 copies of PVX and PVS, 1 x 10
2 to 1 x 10
10
copies of PLRV and 1 x 103 to 1 x 10
10 copies of TSWV). The multiplexed assay
was validated in blind studies. This high-throughput test is accurate and sensitive,
and as a result this test is in the process of being commercialized and used by the
seed potato industry of Western Australia as a cost-effective diagnostic tool to
detect viruses reliably in bulked samples of dormant potato tubers.
v
Table of Contents
Thesis declaration ii
Abstract iii
Table of contents v
Publications from this study x
List of abbreviations xi
Acknowledgements xiii
Dedication xv
Chapter 1 Literature review
1.1 Introduction 1
1.2 Cell-to-cell movement of plant viruses 13
1.3 Resistance to viruses in potatoes 14
1.3.1 Gene silencing 16
1.3.2 Pathogen derived resistance 17
1.4 PLRV 17
1.4.1 Resistance to PLRV 19
1.4.2 PLRV morphology and genome organisation 20
1.5 PVX 21
1.5.1 Resistance to PVX 22
1.5.2 PVX morphology and genome organisation 24
1.6 PVS 24
1.6.1 Resistance to PVS 26
1.6.2 PVS morphology and genome organisation 26
vi
1.7 TSWV 27
1.7.1 Resistance to TSWV 28
1.7.2 TSWV morphology and genome organisation 28
1.8 Methods of detection of potato viruses in leaf and 29
tuber tissue
1.8.1. Lateral flow devices 30
1.8.2 Dot-blot hybridization 30
1.8.3 Immunohistochemistry 31
1.8.3.1 β-Glucuronidase reporter gene and green 31
fluorescent protein
1.8.4 In situ hybridization 32
1.9 Reverse transcription polymerase chain reaction 34
1.9.1 Real-time RT-PCR 36
1.10 RNA extraction from potato tuber tissue 37
1.11 Aims 39
Chapter 2 General materials and methods
2.1 Plant materials for virus stocks 40
2.2 Inoculation of host plants 41
2.3 ELISA 41
2.4 RNA extraction 42
2.5 RT-PCR 42
2.6 Agarose gel electrophoresis 44
2.7 Polyacrylamide gel electrophoresis 44
2.8 Sequencing reactions 45
vii
Chapter 3 In situ localisation of PLRV, PVX, PVS and TSWV in
tuber tissue of potato
3.1 Introduction 47
3.2 Materials and methods 48
3.2.1 Plant materials and virus stocks 48
3.2.2 Fixing and embedding of potato tuber tissue 49
3.2.3 Paraffin removal 50
3.2.4 Potato tuber cellular structure 50
3.2.5 Immunohistochemistry 50
3.2.6 Cloning 51
3.2.6.1 Ligation 51
3.2.6.2 Transformation of chemically- 52
competent E. coli cells
3.2.6.3 Purification of plasmid DNA 53
containing PVS sequence
3.2.6.4 Linearization and purification of 54
PVS template
3.2.6.5 DNA precipitation 55
3.2.7 Digoxigenin-labeled RNA probes 55
3.2.7.1 Purification of RNA transcripts 58
3.2.7.2 Labelling efficiency 58
3.2.8 In situ hybridization 59
3.2.8.1 Hybridization 59
3.2.8.2 In situ detection of digoxigenin- 60
labelled RNA probes
3.2.9 Distribution of phloem in superficial tissue of potato tubers 60
viii
3.2.10 PLRV virions in potato tuber peelings 61
3.3 Results 61
3.3.1 Patatin gene sequence 61
3.3.2 Synthesis of digoxigenin-labeled RNA probe for detection 62
of PVS
3.3.3 Dot-blot hybridization to test labelling efficiency 63
3.3.4 Histological sections of potato tuber tissue 64
3.3.5 Distribution of PVS, PVX, PLRV and TSWV in sections 65
of potato tuber tissue
3.3.5.1 Distribution of PVS 65
3.3.5.2 Distribution of PVX 66
3.3.5.3 Distribution of PLRV 66
3.3.5.4 Distribution of TSWV 67
3.3.6 Distribution of phloem below the epidermis in potato 78
tubers
3.3.7 PLRV virions in potato tuber peelings 79
3.4 Discussion 79
3.4.1 Distribution of PVS, PVX, TSWV and PLRV in 79
histological sections of potato tubers
3.4.2 Conclusion 83
Chapter 4 Development of a multiplex, quantitative real-time RT-PCR
Assay for PVX, PVS, PLRV and TSWV
4.1 Introduction 85
4.2 Materials and methods 86
4.2.1 Viruses, RNA extraction and evaluation of RNA quality 86
ix
4.2.2 TaqMan® primer and probe design 88
4.2.3 Conventional RT-PCR 89
4.2.4 Optimization of real-time RT-PCR 90
4.2.5 In vitro RNA synthesis 91
4.2.6 Standard curves and inter-assay reproducibility 91
4.2.7 Validation of multiplex assay 92
4.3 Results 93
4.3.1 Evaluation of RNA quality 93
4.3.2 Optimization of real-time RT-PCR 94
4.3.3 Standard curves and inter-assay reproducibility 98
4.3.4 Testing for RNA contamination 100
4.3.5 Validation of multiplex assay 101
4.4 Discussion 103
Chapter 5 General Discussion
5.1 Conclusion 106
5.2 Delivery of the virus test to the potato industry 108
References 111
Appendix 1 Localisation of viruses in potato tubers 123
x
Publications from this study
Some of the results presented in this thesis have been published and
presented at scientific meetings as indicated below.
Mortimer-Jones, Sheila M., Jones, Michael G.K., Jones, Roger A.C., Thomson,
Gordon and Geoffrey I. Dwyer (2009). A single tube, quantitative real-time RT-
PCR assay that detects four potato viruses simultaneously. Journal of Virological
Methods 161, 289-296.
Mortimer-Jones, Sheila M., Jones, Michael G.K., Jones, Roger A.C. and Geoffrey
I. Dwyer (2008). Development and validation of a high throughput, one-step,
quantitative real-time RT-PCR assay for the simultaneous detection of PLRV,
PVX, PVS and TSWV with a rapid RNA extraction method directly from bulked
potato tuber samples. In: Conference Proceedings of the Eighth Australasian
Plant Virology Workshop, Rotorua, New Zealand. pp. 9.
Mortimer-Jones, S., Dwyer, G.I., Jones, R.A.C. and M.G.K. Jones (2007).
Localisation of viruses in tuber tissues of potato. In: Conference Proceedings of
the Thirteenth European Association for Potato Research, Aviemore, Scotland.
pp. 66.
Mortimer-Jones, S., Dwyer, G.I., Jones, R.A.C. and M.G.K. Jones (2006).
Localisation of viruses in tuber tissues of potato. In: Conference Proceedings of
the Seventh Australasian Plant Virology Workshop, Rottnest Island, Western
Australia. pp. 62.
xi
List of Abbreviations
3’ hydroxyl terminus of DNA molecule
35S RNA transcriptional promoter of CaMV
5’ phosphate terminus of DNA molecule
Bp base pair
BSA bovine serum albumin
cDNA complementary DNA
CP coat protein
C-terminus carboxy terminus
cv cultivated variety (cultivar)
DEPC Diethyl pyrocarbonate
DIG digoxigenin
DMPC di-methyl-propyl carbonate
DNA deoxyribonucleic acid
dNTP deoxynucleoside triphosphate
dsRNA double stranded RNA
E. coli Eschericia coli
EDTA ethylenediaminetetra-acetate acid disodium salt
ELISA enzyme-linked immunisorbent assay
GFP green fluorescent protein
GUS β-glucuronidase gene
IPTG isopropyl-B-D-thiogalactoside
Kb kilobases
KD kilodalton
LB Luria-Bertani
M
Molar
Min minute
MP movement protein
NBT/BCIP 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium
NCR non-coding region
N-terminus amino terminus
NTP nucleoside triphosphate
ORF open reading frame
PCR polymerase chain reaction
PTGS Post-transcriptional gene silencing
PVP Polyvinylpyrrolidone
RdRp RNA dependent RNA polymerase
RNA ribonucleic acid
RNAi RNA interference
RNase ribonuclease
Rpm revolutions per minute
RT reverse transcription
sec second/s
sgRNA subgenomic RNA
xii
siRNA short interfering RNA
TAE tris-acetate-EDTA
TE tris-EDTA
U unit
UTP uracil tri-phosphate
VIGS virus-induced gene silencing
Vol volumes
vRNA viral RNA
X-Gal 5-bromo-4-chloro-3-indolyl-βgalactopyranoside
xiii
Acknowledgements
First of all I would like to thank my principal supervisor Professor Mike Jones for
offering me this scholarship and for being so approachable and supportive.
Thanks also to my supervisors: Adj. Professor Roger Jones for introducing me to
plants and plant viruses, and for editing my literature review and manuscript so
thoroughly, and to Dr Geoff Dwyer for his excellent teaching on primer design
and the molecular biology of viruses. I also thank our research officer, Belinda
Cox, and also Chris Florides and Mark Holland for their support and for part-
funding the project, along with the Agricultural Produce Commission, Potato
Producers Committee, WA. This enabled me to attend conferences at Rottnest
Island, Scotland and New Zealand, which not only gave me invaluable knowledge
but introduced me to such people as Neil Boonham and Annelien Roenhorst who
were so helpful to me. I would also like to thank Fiona Evans, Scottish
Agricultural Science Agency, for advising me on the real-time protocol, but most
especially for her encouragement, and Brendan Rodoni, Department of Primary
Industries, Victoria, for providing me with the TSWV-infected tubers at the last
minute!
Warm thanks are also due to the Plant Biotech Research Group who have become
my friends: Steve Wylie, Craig Webster, Muhammad Saqib and of course the
merry trio Meenu Singh, Jyoti Rana and Susan Philip. I was so lucky to have
shared an office and a lab with John Fosu-Nyarko. He taught me lab techniques,
was keen to answer my questions, and despite being so busy always allowed me
time to bounce ideas off him. I could not have done so well without him. I am
xiv
privileged to have been a part of such a great team. It’s been a lot of fun. I’m glad
I got to share my lab bench with Jing Juan Zhang, working alongside her was a
pleasure. Thanks also to the histology expert, Gordon Thomson. I so enjoyed my
time in the Histology department of Murdoch University. I always felt like I was
coming home when I stepped through those doors.
Finally I would like to thank my man, Rhys Jones, who never wavered in his
belief in me.
xv
Dedication
I would like to dedicate this thesis to my parents Margaret and Geoffrey Mortimer
who strived to give me the best education they could, and to my dear children
Gareth, Lewis and Jennifer. Their vacant mother has some sense after all.
1
CHAPTER 1
LITERATURE REVIEW
1.1 Introduction
The potato species cultivated worldwide is Solanum tuberosum subspecies (ssp.)
tuberosum. It originated in the Andean region of South America where the ssp.
S. tuberosum andigena is widely cultivated with eight other potato species. These
comprise the diploids S. ajanhuiri, S. goniocalyx, S. phureja, and S. stenotomum,
the triploids S. chaucha and S. juzepczukii, the tetraploid S. tuberosum L. and the
pentaploid S. curtilobum (Hawkes, 1978a). There are also many wild potato
species in the region, e.g. S. acaule, S. chacoense, S. demissum, S. goeurlayi, S.
megistcrolobum, S. spegazzinii and S. stoloniferum. The Altiplano region
surrounding Lake Titicaca in the Andes constitutes the main centre of
domestication of potato. Here, wild potato ancestors of the potato species
cultivated today were domesticated about 7,000 years ago (Jones, 1981). Just one
of the potato species cultivated in the Andes, S. tuberosum ssp. tuberosum, is
widely cultivated elsewhere. Following the Spanish conquest of the Inca Empire,
it was taken to Europe in the 16th
century (Hawkes, 1978b) and is now the fourth
largest crop in terms of yield worldwide and a major food staple in many
countries (Stensballe et al., 2008). This includes Australia where the total value of
the Australian potato industry for 2005-06 was $470.8 million (Australian Bureau
of Statistics, 2008).
2
The degeneration of potato seed stocks in England was first recorded in the
eighteenth century. It steadily increased every annual cycle as diseased tubers
were used as seed for the next crop (van der Want, 1972). van der Want (1972)
described the symptoms as curling of the leaves, reduction in plant size and severe
reduction in yield. Other infectious virus diseases causing potato degeneration
were named as streak and mosaic diseases. Resistant types were found which led
to the breeding of new cultivars (Howard, 1978). Modern cultivars, however,
tend to be bred almost entirely for yield requiring control measures to suppress
virus outbreaks (Jones, 1981).
The ecology of viruses infecting wild and cultivated potatoes in the Andean
region of South America was reviewed by Jones (1981). Specialist viruses that
infect potato primarily with complete transmission by tubers evolved in wild
potatoes that grew among communities of wild plants in the Andean region, such
as Potato virus X (PVX, genus Potexvirus) and Potato virus Y (PVY, genus
Potyvirus) (Jones, 1981). The naming of PVY strains which infect potato has been
discussed (Singh et al., 2008) and are currently classified into groups PVYo,
PVYN and PVY
C, with variants PVY
NTN and PVY
N-
Wi (Colavita et al., 2007). In
contrast, generalist viruses that infect many hosts including potatoes naturally are
thought to have evolved to infect a diverse range of hosts with mixed wild species
populations not necessarily in the Andes. These are opportunistic as regards the
hosts they invade, for example Tomato spotted wilt virus (TSWV, genus
Tospovirus) and Alfalfa mosaic virus (AMV, genus Alfamovirus) which have a
wide host range (Beemster and Rozendaal, 1972; Parrella et al., 2003).
3
Potatoes are vegetatively propagated which results in viruses being passed from
one generation to the next via seed tubers (van der Want, 1972). Seed potatoes are
important because when infected tubers are planted they introduce random
infection foci distributed throughout the crop from which the virus can spread;
significant yield losses may result (Ross, 1986). Transmission of potato viruses
occurs by contact or through the activity of specific insect, nematode or fungal
vectors, depending on the virus concerned (Beemster and Rozendaal, 1972).
There are currently 40 viruses known to infect cultivated potatoes naturally. Most
of these viruses are listed in Table 1.1 (Valkonen, 2007). The economical losses
caused by potato viruses were reviewed recently by Valkonen (2007) who stated
that seed certification schemes have drastically reduced the prevalence of viruses
in potato crops in many areas. The potato viruses that are currently distributed
worldwide are the potyviruses PVY and Potato virus A (PVA), PVX, Potato
leafroll virus (PLRV) (genus Poleovirus), and the carlaviruses Potato virus S
(PVS) and Potato virus M (PVM) (Valkonen, 2007). Although PVY is of
economic importance worldwide, Australia is exceptional in that PVY occurs at a
very low incidence in potato crops in eastern Australia and is currently not found
in seed potatoes in Western Australia (Wilson and Jones, 1990; Holland and
Jones, 2005).
4
Table 1.1 Viruses infecting cultivated potatoes. From Valkonen (2007).
Species Occurrence in potato
Alfalfa mosaic virus (AMV) Worldwide
Andean potato latent virus (APLV) S. America
Andean potato mottle virus (APMV) S. America
Arracacha virus B (AVB) Peru, Bolivia
Beet curly top virus (BCTV) Arid areas worldwide
Cucumber mosaic virus (CMV) Worldwide (uncommon)
Eggplant mottled dwarf virus (EMDV) Iran
Potato aucuba mosaic virus (PAMV) Worldwide (uncommon)
Potato black ringspot virus (PBRSV) Peru
Potato deforming mosaic virus (ToYVSV) Brazil
Potato latent virus (PotLV) N. America
Potato leafroll virus (PLRV) Worldwide
Potato mop-top virus (PMTV) N. & C. Europe, Peru
Potato rough dwarf virus (Potato virus P) Argentina, Uraguay
Potato virus A (PVA) Worldwide
Potato virus M (PVM) Worldwide
Potato virus S (PVS) Worldwide
Potato virus T (PVT) S. America
Potato virus U (PVU) Peru
Potato virus V (PVV) N. Europe, S. America
Potato virus X (PVX) Worldwide
Potato virus Y (PVY) Worldwide
Potato yellow dwarf virus (PYDV) N. America
Potato yellow mosaic virus (PYMV) Caribbean region
Potato yellow vein virus (PYVV) S. America
Potato yellowing virus (PYV) S. America
Solanum apical leaf curl virus (SALCV) Peru
Sowbane mosaic virus (SoMV) Worldwide (uncommon)
Tobacco mosaic virus (TMV) Worldwide (uncommon)
Tobacco necrosis virus (TNV) Europe, N. America, Tunisia
Tobacco rattle virus (TRV) Worldwide
Tobacco ringspot virus (TRSV) S. America
Tobacco streak virus (TSV) S. America
Tomato black ring virus (TBRV) Europe
Tomato mosaic virus (ToMV) Hungary
Tomato mottle Taino virus (ToMoTV) Cuba
Tomato spotted wilt virus (TSWV) Hot climates worldwide
5
In 1922, a unique certified scheme involving visual inspection for virus
symptoms, roguing of visibly infected plants and removal of heavily contaminated
seed stocks was introduced in Western Australia. A problem with managing
viruses such as PVS and PVX during seed potato certification is that the plants
often do not show obvious symptoms of infection in the field and can be easily
missed during visual inspection or roguing (Beemster and Rozendaal, 1972;
Holland and Jones, 2006). The scheme therefore worked well in controlling
PLRV but was ineffective with PVX and PVS. Seed potatoes were grown during
the summer in small isolated swamps. There was no crop rotation, but sheep ate
unharvested tubers and the swamps flooded over the winter which prevented
survival of tubers remaining in the soil which otherwise would have grown to
provide infection foci for spread to the following crop (Wilson and Jones, 1990,
1995).
In 1997, a revised certified seed scheme was implemented in Western Australia
by the Department of Agriculture and Food, W.A. (DAFWA) to encourage
healthy stock production (Holland and Jones, 2006). In addition to visual
inspection and roguing, sampling and testing of leaves from plants that showed
symptoms of infection, and collection and testing of random leaf samples in the
third field generation, was initiated. The samples were tested for the presence of
PVX, PVS, PLRV, PVY and TSWV (Holland and Jones, 2006). These tests were
done by enzyme-linked immunosorbent assay (ELISA) as described by Clark and
Adams (1977).
6
In 1999, the originally more rigorous Australian National Standard for
Certification of Seed Potatoes was altered so that it relied solely on visual
inspection for detection of viral symptoms (Department of Primary Industries and
Water, 2006; Holland and Jones, 2006). This resulted in the relaxation of basic
virus control measures in the eastern states. Jones (2006) attributed commercial
pressures, complacency and a lack of focus as the cause of this relaxation. This
change resulted in a rapid increase in incidence of the contact-transmitted viruses
PVX and PVS and, to a lesser extent, of the aphid-borne virus PLRV in the
eastern states, prompting those states to reinstitute compulsory virus testing of
seed stocks.
Worldwide, healthy seed potato production normally relies on certified seed
potato propagation schemes e.g. van der Want (1972) and Stevenson et al. (2001).
A component of many such schemes is the ‘tuber indexing test’ in which cores cut
from the rose end of tubers are grown, and leaf samples from the sprouts that
grow are tested for virus presence by ELISA e.g. de Bokx (1972b). A drawback to
its use is the considerable delay while dormant tubers sprout and produce leaves
that can be sampled for testing. For example, a shipment of potato tubers from
WA was recently held at an international port while waiting for the growing on
test to confirm that the viruses were not present. The tubers ultimately rotted
which resulted in a large economic loss to the WA potato industry (Holland,
2006).
7
There is a need for a cost-effective virus test that can be done directly on dormant
tuber samples at harvest and during storage to ensure early identification of
infected lots of seed tubers. This diagnostic test is needed to:
• Enable farmers purchasing seed tubers to have samples checked to
determine the virus content of the seed before sowing it.
• Ensure that phytosanitary import requirements of importing countries can
be met before ships are loaded with export seed potato consignments.
• Identify infected tuber lots at different generations during seed
multiplication.
Information on virus cellular distribution in potato tubers is crucial to ensure that
the small amounts of tissue needed for pooled sample assays is truly
representative of virus type and concentration. Potato tubers arise from the plant
stems. The heel end is attached to the stolon, and the apical (rose) end contains
most of the eyes. The cortex is a narrow band of storage tissue between the
epidermis and the ring of vascular tissue. It contains mainly protein and starch
(Huamán, 1986). The ring of vascular tissue containing xylem and phloem is
often plainly seen (Figure 1.1).
8
Figure 1.1. A cross section of a potato tuber cv. Royal Blue showing the ring of vascular
tissue between the epidermis and the parenchyma
PLRV is largely restricted to the phloem (Kojima et al., 1969). PLRV invasion of
other cell types is dependent on co-infection with other viruses (Barker, 1987a;
van den Heuvel et al., 1995). In the study by Barker (1987a) PLRV was found to
invade leaf parenchyma protoplasts in Nicotiana clevelandii plants. In addition,
PLRV was found in all types of leaf cells in N. benthamiana plants co-infected
with PVA and PLRV (Savenkov and Valkonen, 2001). Electron microscopy
(Shepardson et al., 1980) and immunostaining techniques (Barker, 1987a; Derrick
and Barker, 1992) have been used to show that PLRV appears to be restricted to
the vascular bundles in potato leaves. A later study by van den Heuvel et al.,
(1995) used immunogold labelling of potato leaves to show that PLRV was found
in the phloem tissue of infected potato leaves and also in mesophyll cells
neighbouring minor phloem vessels. Immunostaining techniques were also used
to show that PLRV is restricted to the vascular bundle in potato tuber tissue
(Weidemann and Casper, 1982; Barker and Harrison, 1986).
storage
parenchyma
pith
Vascular tissue Epidermis
Cortex
9
Tissue printing of potato tuber tissue samples has been used to detect glutamine
synthetase in developing tubers (Pereira et al., 1996). Similar tissue prints have
also been made of stem and leaf tissue from transgenic potato plants and PLRV-
infected untransformed potato plants to identify the location of PLRV in them
(Franco-Lara et al., 1999). For that study, a full-length cDNA copy of the PLRV
genome was cloned into a plasmid used for A. tumefaciens-mediated
transformation. The construct was used to transform the potato tissues of the
highly PLRV-resistant breeding line G8107(1). Tissue prints of the stems of the
transgenic potato plants showed that a large proportion of PLRV-infected cells
were in the epidermis, although stems from infected non-transgenic plant stems
cv. Maris Piper, did not.
The PLRV concentration in vascular tissue at the heel end of tubers of primary
infected plants was found to be similar in a range of genotypes differing in rating
for field resistance to PLRV (Barker and Harrison, 1985). Gugerli (1980)
compared PLRV concentration at the heel and rose ends of dormant tubers cvs
Claustar and Ker Pondy and found that PLRV concentration was higher at the
heel end than the rose end. Three weeks after breaking dormancy by rindite
treatment the tubers from the secondary infected plants showed no difference in
virus concentration between the heel and rose ends, however the concentration of
PLRV in the primary infected tubers remained higher at the heel end than the rose
end. Gugerli (1980) also tested all parts of the tubers to a depth of 8-10mm from
the surface between the heel and the rose ends from the secondary infected plants
and found that PLRV is detectable by ELISA in all parts of the tuber. Gugerli and
10
Gehriger, (1980) used ELISA to detect PLRV in primary and secondary infected
potato tubers cv. Bintje, Desiree and Sirtema, both during dormancy and after
artificial break of dormancy by rindite treatment. They again found that PLRV
occurred in higher concentration in the vascular tissue at the heel end than at the
rose end of infected tubers and the concentration remained nearly unchanged
during 35 days. They found little variation in results obtained before and after
rindite treatment. Gugerli (1980) concluded that the accuracy of ELISA testing for
PLRV is not improved by breaking dormancy.
The distribution of PVX, PVS and TSWV within tubers of potato cultivars has
also been studied by ELISA (de Bokx et al., 1980a; de Bokx et al., 1980b;
Wilson, 2001). Tubers of ten cultivars secondarily infected with PVX were tested
after 39 weeks storage at 4ºC and after 38 weeks at 4ºC followed by one week at
20ºC (de Bokx et al., 1980b). For the tubers stored at 4ºC the average
concentration of PVX at the rose ends was significantly higher than that at the
heel ends. When the temperature was increased to 20ºC for one week, the average
concentration of PVX increased in most of the heel and rose ends. The overall
and individual virus concentration was higher at the rose ends than the heel ends.
In another study by de Bokx et al. (1980a) the concentration of PVS in secondary
infected tubers of nine cultivars was found to decline after 8 weeks storage at 4ºC.
The concentration of virus at the rose ends of dormant tubers and where dormancy
was broken naturally was not significantly higher than the concentration at the
heel ends. Storage at 4ºC or 20ºC had no effect on the detection of the virus.
11
Wilson (2001) used ELISA to detect TSWV in freshly harvested infected tubers.
Tuber tissue was collected from the core, the rose end, the heel end, eyes from
both the heel end and the rose end, and from internal pith within the tuber.
Although no single tuber part consistently detected TSWV, the internal pith
samples had between 75-80% successful detection. Wilson (2001) also observed
an erratic distribution of detectable virus in dormant tubers cv. Russet Burbank
compared to the other cultivars tested (Atlantic, Coliban, Desiree, Kennebec and
Shepody), although a variation in ELISA absorbance values suggested that virus
titre may vary across those tissues.
Although Gugerli and Gehriger (1980) concluded that ELISA is an efficient
method for detecting PLRV in dormant tubers with both primary and secondary
infections, direct tests on dormant potato tuber tissues by ELISA are not always
reliable (Hill and Jackson, 1984; Spiegel and Martin, 1993; Wilson, 2001). When
the advantages and disadvantages of direct tuber testing for PVY by real-time
reverse-transcription polymerase chain reaction (RT-PCR) and ELISA were
compared, real-time RT-PCR provided the more reliable assay (Fox et al., 2005).
To ensure that tuber subsamples contain a high concentration of virus, cores from
the heel and/or rose end are often taken, e.g. Fox et al. (2005) and depths up to
10mm may be taken to ensure the sample contains vascular tissue e.g. Gugerli
(1980). Klerks et al. (2001) used a potato peeler and a punch to take samples
from the heel and rose ends of potato tubers and total RNA was extracted
separately from each homogenized tuber disc. Using this method, PLRV and PVY
was successfully detected in all infected samples.
12
When RNA is extracted from bulked potato tuber tissue samples, polysaccharides
and polyphenols that co-precipitate with RNA can inhibit nucleic acid
amplification, and it is a requirement of the RNA extraction procedure that these
inhibitors are removed if bulk testing of tuber samples is to be reliable (Singh and
Singh, 1996).
Conventional RT-PCR can be used to detect PVY and PLRV successfully in
samples from dormant potato tubers (Singh and Singh, 1996; Singh et al., 1998;
Singh et al., 2000; Singh et al., 2002). However, further analysis relies on time
consuming agarose gel electrophoresis. Mumford et al. (2000) developed a duplex
real-time RT-PCR assay to detect single infections with Tobacco rattle virus
(TRV, genus Tobravirus) and Potato mop-top virus (PMTV, genus Pomovirus) in
potato tubers. Klerks et al. (2001) also used real-time RT-PCR to detect single
and mixed infections with PLRV and PVY in tubers. More recently a two-step
multiplex real-time RT-PCR assay was developed to detect PVY, PLRV, PVX
and PVA directly from potato tuber sap (Agindotan et al., 2007) and Fox et al.
(2005) detected PVY in bulked samples of ten tubers with one PVY-infected
tuber sample using real-time RT-PCR testing.
The principle objective of this project was to develop a reliable PCR based
method for multiplex real time detection of viruses in bulk samples of dormant
tuber tissues that could be used routinely. Its development required a better
understanding of how each virus is distributed in tuber tissues. In addition, the
problem of co-precipitation of polysaccharides and polyphenols needed to be
overcome to enable high quality viral RNA to be extracted rapidly and reliably
13
from bulked tuber samples. For the purpose of this project the emphasis was on
the four main pathogenic viruses of economic importance to seed potato
production in Western Australia – PLRV, PVX, PVS and TSWV.
The following literature review begins with a brief overview of the cell-to-cell
movement of viruses and virus resistance in potato, followed by an in-depth
description of the four viruses being addressed. A review of the methods for
determining the cellular distribution of viruses in potato tubers and RNA
extraction from tuber tissue is followed by information on identification of potato
viruses in potato leaves and tubers by RT-PCR. The specific aims of this project
are listed at the end of the chapter.
1.2 Cell-to-cell movement of plant viruses
Viruses encode movement proteins (MP) to facilitate the movement of the virus
from the initial site of infection to other plant cells (Deom et al., 1992; Carrington
et al., 1996; Lucas and Wolf, 1999). Cell-to-cell movement of plant viruses from
the initial site of infection in cells of plant tissues is through the plasmodesmata to
the vascular bundle. There are two main movement mechanisms involved (Epel,
1994). The mature virus particle moves along virus-induced tubular structures
within the plasmodesma or the movement protein causes a rapid dilation of
existing plasmodesmata to allow movement of the protein and viral nucleic acid.
The proteins involved in virus movement can differ depending on the virus
concerned. For example the MP in Tobacco mosaic virus (TMV, genus
Tobamovirus) is essential for movement of the virus and is a ssRNA binding
14
protein, whereas Cowpea mosaic virus (CPMV, genus Comovirus) encodes two
transport proteins of 58kD and 48kD that are required for movement of the virus
as well as the coat proteins (CP) (Wellink and Van Kammen, 1989). The PVX CP
was found to be transported through the phloem and then unloaded into mesophyll
and epidermal cells (Cruz et al., 1998). The different classes of MPs encoded by
RNA-containing plant viruses have been reviewed (Taliansky et al., 2008).
Initial cell-to-cell movement is not required in phloem-limited viruses such as
PLRV because PLRV is transmitted directly into the phloem by aphids and so
does not need to invade other cells first (Takanami and Kubo, 1979).
Long distance movement of viruses in the plant is through the sieve elements of
the vascular tissue. The xylem can also be involved in movement of viruses as
occurs with Rice yellow mottle virus (RYMV, genus Sobemovirus) which moves
between xylem cells through pit membranes (Opalka et al., 1998).
1.3 Resistance to viruses in potatoes
Genetic resistance to viruses in potatoes has been reviewed (Ross, 1986;
Valkonen, 1994; Solomon-Blackburn and Barker, 2001). There are several types
of virus resistance in potato (Cockerham, 1945). The principal potato species
cultivated outside the centre of origin of the crop (S. tuberosum) is a tetraploid
(2n = 4n = 48 chromosomes). Like many other wild and cultivated tuber-bearing
solanaceous species, it carries virus resistance genes located in its genome such as
Nbtbr on chromosome V (de Jong et al., 1997) and Nstbr chromosome VIII
(Marczewski et al., 2002). Extreme resistance (ER) coded by the R genes can
15
relate to a very low level of infection after graft inoculation which protects against
the spread of the virus in the field (Ross, 1986). Alternatively it reflects infection
of just a few cells with no further spread. This distinguishes it from immunity
where there is no infection or replication in infected cells. For sap inoculation,
infected potato leaves are ground in a mortar and pestle with a buffer and an
abrasive. The sap mixture is rubbed onto young, healthy potato leaves. For graft
inoculation a scion from a virus-infected plant is grafted onto an uninfected potato
plant. Hypersensitive resistance (HR), normally coded by the N genes, relates to
the development of necrosis at or near the site of inoculation which often prevents
spread. The nomenclature of resistance genes in potato has been reviewed
(Valkonen et al., 1996) and will be described in this text as follows: the N gene
resistant to PVX is named Nx, with the potato species in which the gene is found
denoted as a subscript using recommended potato species abbreviations (Huamán
and Ross, 1985). Specific resistance genes relating to PLRV, PVX, PVS and
TSWV are described in the relevant sections below.
Potato plants may be resistant to infection by aphid vectors eg. Cockerham (1945)
or partially resistant, where more viruliferous aphid vectors are needed to infect
the plant successfully than in cultivars without this trait (Davidson, 1973; Wilson
and Jones, 1992). Virus multiplication can be restricted (Jones, 1979; Barker and
Harrison, 1985, 1986), the virus can be slow to move through the phloem (Wilson
and Jones, 1992) or fail to reach tubers (McKay and Clinch, 1951; Hutton and
Brock, 1953). Plants can also become resistant to infection as they mature. Mature
plant resistance in potato plants may be expected about 10 weeks post planting
16
(Beemster, 1972). Once the tuber has been infected there appears to be no specific
mechanisms that impair movement of virus through the tuber (Syller, 2003).
1.3.1 Gene silencing
Gene expression can be suppressed by RNA silencing, a mechanism in eukaryotes
that acts as a means of antiviral defense (Waterhouse et al., 1998; Mansoor et al.,
2006; Itaya et al., 2007). Mansoor et al. (2006) described the process as follows:
Double stranded RNA (dsRNA) formed by hairpin loops is recognized by one of
the processing enzymes (Dicers) that cleave it into 21 to 24 nucleotide short
interfering viral RNA (siRNA) fragments (Itaya et al., 2007). One fragment is
incorporated into an RNA-induced silencing complex (RISC) that forms a
template that binds to homologous messenger RNA (mRNA) which is cleaved
into siRNA preventing translation of the mRNA. The siRNA sequences that are
homologous to promoter sequences can mediate methylation of the promoter
which results in the blocking of gene transcription. Viruses can overcome RNA
silencing by encoding suppressors of gene silencing. For example, the coat protein
of Turnip crinkle virus suppresses post-transcriptional gene silencing at an early
initiation step (Qu et al., 2003). Host gene expression can also be suppressed as a
result of gene silencing. When virus vectors carry exons of host genes, the RNA-
mediated response can target both the viral RNA and the corresponding
endogenous mRNA (Baulcombe, 1999).
17
1.3.2 Pathogen derived resistance
Pathogen derived resistance is a concept whereby the transgenic expression of
viral sequences interferes with the replication of the pathogen (Sanford and
Johnson, 1985). A resistance-conferring gene is placed between a transcriptional
promoter, often the 35S promoter of Cauliflower mosaic virus (CaMV, genus
Caulimovirus) and a transcriptional terminator sequence (Rogers et al., 1987).
This construct is introduced into plant cells in two commonly used ways (Hull,
2002). In the Agrobacterium-mediated approach, the construct is placed in a T-
DNA plasmid of A. tumefaciens which is then cultivated with the plant tissue (Old
and Primrose, 1985). In the biolistic approach the construct is coated onto
microparticles which are propelled into the plant either using a blank cartridge or
using a high pressure pulse of Helium gas (Klein et al., 1987; Kikkert et al.,
2004).
One of the major mechanisms involved in pathogen derived resistance is through
the stimulation of gene silencing targeting the expressed viral genome sequences.
The target gene is cloned in both the sense and antisense orientation, separated by
an intron (Mansoor et al., 2006). After transcription the RNA folds back to form
the double-stranded RNA which initiates gene silencing.
1.4 PLRV
PLRV is a common potato pathogen transmitted in a persistent manner entirely by
aphids, the most efficient vector being Myzus persicae (Sulzer) (the green peach
aphid) (Tamada and Harrison, 1980). Depending on the cultivar and temperature
18
conditions, potato plants grown from PLRV-infected tubers may not show
symptoms for several weeks during which time they are still a source of infection
if aphids are present (Holland and Jones, 2006). Symptoms of primary infection
are often seen in apical young leaves. They usually stand upright and can be
chlorotic and in some varieties have a red tinge. Leaflets are often rolled,
particularly at the base of the plant (Beemster and Rozendaal, 1972). In a few
cultivars, especially the russet types such as Russet Burbank, net necrosis
develops in the tubers during storage resulting in a product that is unsuitable for
processing into crisps or chips (Peters and Jones, 1981). Secondary symptoms of
the disease are more severe and include rolling of the lower leaves that can
become stiff and dry. There may be reddening of the leaf margins and the plant
may develop an upright growth habit (Figure 1.2). Infection can cause devastating
yield losses (Department of Primary Industries and Water, 2006).
. .
Figure 1.2. Symptoms of PLRV infection in a second-generation potato plant of cv.
Ruby Lou. A, reddening of the leaf margins; B, upright growth habit.
A B
19
1.4.1 Resistance to PLRV
Several elements of resistance to PLRV have been identified. These include
resistance to infection operating against infection by aphid vectors (Cockerham,
1945; Wilson and Jones, 1993a, b) and restriction in virus multiplication in plant
tissues (Jones, 1979; Barker and Harrison, 1985, 1986; Wilson and Jones, 1993b),
with the latter being controlled by a single gene (Barker and Solomon, 1990), or
two unlinked dominant complementary genes (Barker et al., 1994). Other types of
resistance to PLRV are inhibition of virus movement from foliage to potato tubers
(Hutton and Brock, 1953; Barker, 1987b), and phloem necrosis e.g. Ross (1986).
Resistance to phloem transport can be independent of resistance to virus
accumulation (Wilson and Jones, 1992) or can be linked (Barker and Harrison,
1986; Syller, 2003). The major quantitative trait locus (QTL) containing several
resistance genes is PLRV.1. This QTL is mapped to potato chromosome XI,
whereas two minor QTLs are mapped to chromosomes V and VI (Marczewski et
al., 2001).
In the study by Syller (2003) two potato clones, M62759 and PS1706, were graft
or aphid inoculated with PLRV. Clone M62759 appeared to be highly resistant to
infection whereas both clones expressed a high level of resistance to virus
multiplication. Samples were taken four and seven weeks after graft-inoculation
with PLRV and tested by ELISA. The concentration of PLRV in leaves of lateral
shoots that developed first and ones that appeared later was found to diminish
between these periods. Furthermore, the movement to the tubers of both clones
was inhibited. In the same study aphid-inoculated and uninoculated sprouts were
20
assayed and there appeared to be no mechanisms impairing the movement of
PLRV through the tubers.
Transgenic replicase-mediated resistance against PLRV in potato plants cv.
Desirée was investigated by Ehrenfeld et al. (2004). The plants were genetically
modified to express the PLRV replicase gene. In plants in which the 35S CaMV
controlled expression of the PLRV replicase gene, infection was detected initially,
but subsequently became undetectable after 40 days. However, in the plants that
contained the RolA promoter from A. rhizogenes, initial resistance was later
overcome. In another transgenic study, potato plants transgenic for the PLRV CP
gene and showing high levels of resistance did not contain detectable levels of the
CP which was thought to suggest that it was the transcript rather than the protein
that was providing protection against PLRV (Kawchuk et al., 1991; Hull, 2002).
1.4.2 PLRV morphology and genome organisation
PLRV particles are icosahedral and approximately 24 nm in diameter (Takanami
and Kubo, 1979). The genome is monopartite consisting of positive-sense, linear,
ssRNA comprising 5987 nucleotides (Accession number NC001747) and has a
genome-linked viral protein (VPg) (Van der Wilk et al., 1997). There are six open
reading frames (ORFs) arranged into two blocks separated by a small intergenic
region (Li et al., 2007), however, according to Taliansky et al. (2003) and Kaplan
et al. (2007) there are eight ORFs. ORF0 encodes the 28kDa P0 protein involved
in virus accumulation (Sadowy et al., 2001). P17 (ORF4) is a putative MP
(Schmitz et al., 1997) and its CP is involved in vector transmission and virus
21
movement (Kaplan et al., 2007). The P1 protein (ORF1) is thought to play a
major role in the replication cycle by promoting the maturation of the VPg
(Nickel et al., 2008). Nickel et al. (2008) also found that inhibition of the P1
protein reduced virus accumulation. The CP and P17 are translated from
subgenomic RNA (Tacke et al., 1990; Taliansky et al., 2003).
1.5 PVX
PVX is a widespread virus infecting many commercial stocks of potatoes
throughout the world (Beemster and Rozendaal, 1972). PVX is transmitted by
plant-to-plant contact and by machinery contact in the field, for example by seed
graders and cutters (Beemster and Rozendaal, 1972; de Bokx, 1972a).
Transmission also occurs when people or other large mammals move through a
crop. It has also been reported to be transmitted by the grasshopper Tettigonia
viridissima (Schmutterer, 1961). PVX often causes symptomless or latent
infection (Wright, 1977), and therefore symptoms may not be visible to the naked
eye. However, this is largely a product of the selection for latent strains that
occurs during roguing and crop inspections for visible symptoms. Where such
selection is not applied e.g. Wilson and Jones (1995), symptoms range from a
mild mosaic (Beemster and Rozendaal, 1972) to severe mottling of the leaf
(Figure 1.3). PVX can cause yield losses of up to 15% in some cultivars (Wright,
1970). When associated with PVY or PVA in mixed infection, it causes the
classic diseases common in the early days of potato virology called ‘rugose
mosaic’ and ‘crinkle’ respectively and yield losses were very high (Beemster and
Rozendaal, 1972).
22
Figure 1.3. PVX-infected potato cv. Eben showing mottling of the leaf.
1.5.1 Resistance to PVX
The potato genes Nx and Nb respond to different strain groups of PVX
(Cockerham, 1945) and the gene Rx confers extreme resistance to PVX infection
(Cockerham, 1970). Nb is named after Potato virus B which was considered a
distinct virus in the early days but later found to be a strain group of PVX
distinguished by its hypersensitive response with Nb but not with Nx. Strains of
PVX are classified into four groups according to their hypersensitive response to
the genes Nb and Nx (Wilson and Jones, 1995) and are described as follows:
group 1 strains elicit a hypersensitive response to genes Nb and Nx; group 2
strains elicit a hypersensitive response to Nb only; group 3 strains elicit a response
to Nx only; and group 4 strains do not elicit a hypersensitive response with either
gene (Cockerham, 1970). After sap inoculation systemic necrosis occurs with Nx
only, however after graft inoculation systemic necrosis occurs with both genes
(Jones, 1982, 1985). The gene Nbtbr in cv. Pentland Ivory has been located on the
intermediate upper arm of chromosome V (de Jong et al., 1997; Marano et al.,
2002).
23
One of the strains, present in the Andes, PVXHB
, not only overcomes the Rx gene
but also genes Nx and Nb (Moreira and Jones, 1980). Hence it is not only a group
4 strain but also a resistance-breaking strain for extreme resistance. When cv.
Atlantic was released in 1976 it was immune to PVX but it became infected with
PVX in a survey in Maine (Tavantzis and Southard, 1983; López-Delgado et al.,
2004). However, the form of cv. Atlantic grown in Western Australia (Rx) is still
immune (Wilson and Jones, 1995; Nyalugwe, 2007). Thus there are two
genotypes of the same cultivar, one with and one without PVX resistance. The cvs
Ruby Lou and Mondial contain the gene RxTBR, and the cv. Nadine contains the
gene NxTBR (Nyalugwe, 2007).
The Rx gene encodes nucleotide-binding site/leucine-rich (LRR) repeat proteins
that mediate recognition of pathogen-derived elicitors (Farnham and Baulcombe,
2006). N. tabacum plants transformed with the gene encoding the PVX 12kD
protein showed pathogen derived resistance when challenged with PVX strain
CP2 (Kobayashi et al., 2001). Inoculation with this strain normally induced mild
mosaic symptoms in the control tobacco plants. Microscopic examination of the
leaves of the transgenic plants revealed concentric rings encircled by necrotic
borders. These novel symptoms arose in both inoculated and uninoculated leaves.
The necrotic rings followed virus spread but disappeared in younger upper leaves.
Examination of the rings revealed accumulation of biochemical compounds
associated with HR. Kobayashi et al. (2001) concluded that the response was
specific, simultaneously requiring expression of the 12kD protein and PVX
24
replication. In another study, transgenic tobacco plants expressing the PVX CP
gene were protected against PVX (Hemenway et al., 1988).
1.5.2 PVX morphology and genome organisation
PVX particles have slightly flexible rods about 11.5 nm in diameter and 515 nm
in length (Varma et al., 1968). The genome is monopartite consisting of linear,
positive-sense, single-stranded RNA approximately 7500 nucleotides long. There
are five open reading frames (ORFs). ORF1 replicase is translated from genomic
RNA. The ORFs 2, 3 and 4 are translated from subgenomic (sg) RNA1 whereas
the ORF5 CP is translated from sgRNA2 (Hull, 2002). The genome has a 5’ CAP
and a polyadenylated tail at the 3’ end. The 5’ untranslated region (UTR)
regulates genomic and subgenomic RNA synthesis, encapsidation and virus
transport, while the 3’ UTR regulates both the plus and minus strand RNA
synthesis (Verchot-Lubicz et al., 2007). ORFs 2, 3 and 4 (25kD NTP-binding
helicase, 12 kD and 8 kD respectively) comprise the triple gene block (TGB) P1,
2 and 3 that encodes the movement proteins. TGB P1 regulates virus translation
and is a suppressor of RNA silencing (Bayne et al., 2005; Verchot-Lubicz et al.,
2007). The granular type vesicles induced by the TGB P2 appear to be necessary
for plasmodesmata transport of PVX (Ju et al., 2007).
1.6 PVS
PVS, family Flexiviridae, genus Carlavirus, is a very common virus of potatoes.
PVS is virtually symptomless in most of the widely grown potato varieties.
25
However progeny plants of infected tubers may sometimes develop subtle leaf
symptoms such as vein deepening, rugosity, and chlorosis and premature aging of
the older leaves that may cause yield losses, especially when the Andean strain is
present (Dolby and Jones, 1987) (Figure1.4). Experiments involving sap
inoculation of potato plants with both PVX and PVS revealed more severe foliage
symptoms due to double infection with these viruses than with single infection
with either virus alone in cv. Royal Blue (Nyalugwe, 2007). However, in these
limited small-scale pot experiments, no increase in yield losses from double
infection was recorded in primary or secondary infected plants.
Like PVX, it is transmitted by plant-to-plant contact and by machinery contact in
the field, such as by seed graders and cutters (Beemster and Rozendaal, 1972).
However, unlike PVX, it can also be transmitted non-persistently by aphids
(Kostiw, 1975; Dolby and Jones, 1987). In the study by Kostiw et al. (1975), the
aphids (Aphis nasturtii) were starved for two hours before being placed on leaves
of PVS-infected potato cv. Baca for four minutes for virus acquisition. They were
then immediately transferred to the test plants on which inoculation feeding
occurred for 4, 32 and 64 min. Presence of PVS in the aphid-inoculated plants
was detected 20 days after inoculation by serological testing. Kostiw et al. (1975)
concluded that PVS is transmitted by the winged aphid A. nasturtii and that its
ability to infect healthy plants within the four min of inoculation feeding confirms
that the transmission is non-persistent.
26
Figure 1.4. A, symptoms of chlorosis in a second generation PVS-infected leaf of cv.
Ruby Lou; B, symptoms of rugosity in a PVS-infected leaf of cv. Atlantic.
1.6.1 Resistance to PVS
The potato cv. Saco carries extreme resistance to PVS (Alfieri and Stouffer,
1957). Studies by Bagnall and Young (1972) indicated that extreme resistance to
PVS in cv. Saco is controlled by a single recessive gene. In contrast, Makarov
(1975) studied the hypersensitive resistance to PVS in Bolivian clones of S.
tuberosum ssp. andigena and concluded that hypersensitivity to PVS is
determined by a single dominant gene, which he called Ns. This gene is located
on chromosome VIII (Marczewski et al., 2002).
1.6.2 PVS morphology and genome organisation
PVS particles are slightly flexible rods about 15 nm in diameter and 650 nm long
(Matthews, 1970). The genome is monopartite consisting of positive-sense,
single-stranded RNA approximately 8500 nucleotides long (isolate Leona
accession number NC 007289). There is a polyadenylated tail at the 3’ end.
A B
27
ORF1 is translated from genomic RNA (Hull, 2002). The ORFs 25K, 12K and 7K
comprise the TGB that encodes movement proteins.
1.7 TSWV
TSWV, family Bunyaviridae, genus Tospovirus, is an economically important
pathogen of many crops with an extensive natural host range including many
weeds (Parrella et al., 2003). TSWV is persistently transmitted by seven species
of thrips, five of which have been recorded in Australia (Moran et al., 1994).
Common vectors of TSWV in Australia include Thrips tabaci (onion thrips),
Frankliniella shultzei (tomato thrips) and F. occidentalis (western flower thrips).
Western flower thrips was first reported in Western Australia in 1993 and is the
most efficient vector of TSWV (Latham and Jones, 1997). Control of western
flower thrips by chemical application is difficult because they readily develop
resistance to insecticides. They are also able to effectively evade contact
insecticide sprays as the eggs are deposited inside the plant tissue and the nymphs
and adults can be hidden within petals while the pupae live in the soil.
Primary symptoms of infection on potato tubers vary between incidence and
severity between cultivars, and can include tuber necrosis and malformation
resulting in considerable losses (Wilson, 2001). A tomato plant, cv. Grosse Lisse,
infected with TSWV after sap inoculation, is shown in Figure 1.5.
28
Figure 1.5. Tomato plants of cv. Grosse Lisse. A, infected with TSWV; B, healthy.
1.7.1 Resistance to TSWV
Wilson (2001) reported that shoots growing from infected tubers became TSWV-
infected after 1-4 weeks growth. Significant cultivar differences in the rate of
foliar systemic infection were observed. Furthermore, substantial cultivar
differences were found in the efficiency of TSWV translocation from infected
plants to tuber and from infected tubers to progeny plants.
1.7.2 TSWV morphology and genome organisation
TSWV particles are spherical with a tripartite genome consisting of single
stranded RNA segments contained within an envelope with glycoproteins G1 and
G2 projecting from its surface (Walkey, 1991). The genetic variability among
Australian isolates is small, with only a 4.3% nucleotide difference within the
nucleoprotein gene among 29 isolates from diverse crops and geographical
locations (Dietzgen et al., 2005). The L segment is of negative polarity and the M
and S segments have an ambisense arrangement (de Haan et al., 1990; de Haan et
A B
29
al., 1991; Kormelink et al., 1992a). The S RNA segment encodes the
nucleocapsid protein in the viral complementary sense (de Haan et al., 1990). The
L protein is responsible for the transcription of the viral mRNAs which involves
cap structures being ‘snatched’ from host mRNAs to prime the transcription
reaction (Kormelink et al., 1992b; van Poelwijk et al., 1993; Prins and Goldbach,
1998). The 33.6 kDa non-structural protein on the M segment is involved in cell-
to-cell movement of the virus (Kormelink et al., 1994; Storms et al., 1995; Prins,
1997).
1.8 Methods of detection of potato viruses in leaf and tuber tissue
Viral diseases in potato crops are often not detected by visual inspection alone
(Jones, 1987). Symptom expression can be influenced by temperature, the latency
or strain of the virus, and whether the infection is current season or tuber-borne
(Holland and Jones, 2006). Possible methods of virus detection include ELISA,
lateral flow devices, dot blot hybridization, tissue printing, in situ hybridization,
immunohistochemistry staining (IHC), array, electron microscopy, host plant
inoculation and RT-PCR. However, only ELISA and real time PCR are used for
large-scale routine testing at present. ELISA, following growing on of tuber eyes,
is the current standard method for the detection of potato viruses in potato leaves
or tubers in most of the world’s potato seed certification schemes (Holland and
Jones, 2006). ELISA is time-consuming and only detects specific viruses with
specific serum in single reactions and therefore cannot detect viroid RNA which
does not code for proteins.
30
1.8.1 Lateral flow devices
Lateral flow devices use antibodies in an immunochromatographic format to
detect plant pathogens on site (Danks and Barker, 2000). These devices have been
useful in the on-site identification of plant viruses including PVY and PVX. They
are useful for on-site preliminary diagnosis however laboratory screening using
ELISA or RT-PCR are preferred for bulk screening and confirmation testing
(Nadar et al., 2009)
1.8.2 Dot-blot hybridization
Hybridization of highly radioactive cDNA with viral RNA bound to a
nitrocellulose membrane has been used successfully for testing tuber samples for
Potato spindle tuber viroid (PSTVd, genus Pospiviroid) infection (Owens and
Diener, 1981). However non-radioactive nucleic acid hybridization subsequently
became more popular. The dot blot method has been developed for the
simultaneous detection of PVX, PVY, PLRV and the viroid PSTVd from plant
extracts (Hopp et al., 1991). A modified method using fluorescent labels and
positively charged glass slides in place of membranes was developed and used for
the detection of TMV, PVY and PSTVd in leaves (Du et al., 2007). This method
was found to be highly specific and four times more sensitive than conventional
dot-blot hybridization on nylon membranes with a 32
P-labeled probe. A
macroarray that can detect up to 11 potato viruses and PSTVd in potato leaves
and stems was developed by Agindotan and Perry (2007; 2008). They found that
four viruses or two viruses plus the viroid were simultaneously detectable in
31
individual potato plants, and that the results were consistent with those obtained
by ELISA. However they suggest that the sensitivity of macroarrays would need
to be increased for the method to replace ELISA for the routine testing of potato
viruses as ELISA has proven to be so effective.
1.8.3 Immunohistochemistry
Immunohistochemistry has been used to detect PLRV in potato tuber sections
(Weidemann and Casper, 1982). In addition, potato tuber tissues fixed with 2.5%
paraformaldehyde (Espelie et al., 1986), 2.5% glutaraldehyde and 2%
paraformaldehyde (Kim et al., 1989), 2% formaldehyde (Sonnewald et al., 1989)
or 4% paraformaldehyde (Xu et al., 1998) have been used for the
immunohistochemical localization of peroxidase, ADPglucose
pyrophosphorylase, patatin and for the detection of mitosis respectively. The
samples were embedded in LR-White resin or polyethylene glycol-1000 (PEG). A
standard method of fixing and embedding plant tissue using 4% formaldehyde and
paraffin first developed by Jackson (1992) is now routinely used for in situ
immunohistochemical staining of plant tissue.
1.8.3.1 β-Glucuronidase reporter gene and green fluorescent protein
Movement of PVX in the leaf trichome cells of N. clevelandii has been reported
(Angell and Baulcombe, 1995). The cells were micro-injected with a PVX-β-
glucuronidase (GUS) vector. GUS activity indicated that PVX had moved from
the injected cell into other trichome cells and into the cells along the leaf margin.
32
As GUS activity was restricted to the cells at the edge of the leaf, this suggested
that PVX was unable to move out of the marginal cells. Angell and Baulcombe
(1995) concluded that the absence of GUS activity in the intervening cells
suggested that PVX was able to move through several cells without replicating
within them.
Green fluorescent protein (GFP) can be used to track viruses in whole plants and
single cells by inserting the gfp gene into the viral genome cells (Oparka et al.,
1997). PVX is commonly used as a vector for GFP expression (Oparka et al.,
1995; Blackman et al., 1998). GFP was used to detect the long-distance
movement and phloem unloading of PVX CP on transgenic N. benthamiana
leaves (Cruz et al., 1998).
1.8.4 In situ hybridization
Detection of nucleic acid at the cytological level using in situ hybridization (ISH)
techniques began in 1969 (John et al., 1969; Pardue and Gall, 1969). Nucleic acid
probes may be labeled with P32, biotinylated or digoxigenin – a steroid isolated
from the plants of the genus Digitalis (Farquharson et al., 1990). The most
sensitive and widely used staining technique for in situ hybridization is nitroblue
tetrazolium (NBT)/5-bromo-4-chloro-3-indolyl phosphate (BCIP) precipitated by
alkaline phosphatase (Jékely and Arendt, 2007).
Oligonucleotide probes can be used to detect PVX in crude leaf sap extracts
within four hours by hybridization in solution, using affinity-based hybrid
collection (Rouhiainen et al., 1991). PVX was isolated from infected leaves of N.
33
glutinosa and purified by centrifugation in a gradient of sucrose 20 to 50% (w/w)
in 0.05M borate-NaOH buffer, pH 8.2. Three probes 40 nucleotides long,
complimentary in sequence to PVX near its 3’ end were synthesized. Two of the
probes were P32 labeled and one was biotinylated. After hybridizing with the
PVX nucleic acid in solution, the formed hybrids were isolated using avidin
polystyrene beads, or captured from the poly(A) tail of the viral RNA on
oligo(dT) cellulose. The maximum signal was obtained after 4 hours
hybridization.
Viral RNA of PVA has been detected in the upper non-inoculated sink leaves of
S. commersonii by in situ hybridization (Rajamaki and Valkonen, 2002a). A
digoxigenin-labeled RNA probe complementary to the PVA CP-encoding
sequence was used. Sections were viewed with a light microscope and the data
obtained indicated that both the major and minor veins may unload PVA in the
sink leaves of potato. A digoxigenin-labeled probe was used for simultaneous
detection of PVYº, PLRV and PSTVd (Welnicki et al., 1994). The cDNA
fragments of all three pathogens were introduced into a pUC18 vector.
Sequencing of the inserts revealed that the cloned fragments covered conserved
parts of the pathogenic genomes. The labeled probe was hybridized to diluted
extracts from infected leaves of potato, tomato and tobacco plants. The three
pathogens were clearly detectable. Welnicki et al. (1994) concluded that the probe
and dot-blot technique are suitable for simultaneous detection of the three
pathogens.
34
1.9 Reverse-transcription polymerase chain reaction
Polymerase chain reaction (PCR) is a method that results in the amplification of a
few copies of DNA across several orders of magnitude (Mullis, 1987). The
method involves thermal cycling consisting of repeated cycles of heating and
cooling temperatures. During these cycles the DNA is denatured allowing short
oligonucleotides (primers) to anneal to the separated strands. Each strand is then
used as the template in DNA synthesis by DNA polymerase. The result is the
amplification of target DNA.
In reverse transcription-PCR (RT-PCR), complementary DNA is synthesized by
reverse transcription of the viral RNA and then amplified by PCR. RT-PCR has
been successfully applied to leaf and potato tuber samples for the detection of
potato viruses and PSTVd (Singh and Singh, 1996; Singh et al., 1998; Weideman
and Buchta, 1998; Singh et al., 2000; Singh et al., 2002; Lopez et al., 2006). A
four-step method was developed for RT-PCR detection of PVS, PVX, PVY and
PLRV in dormant tubers (Singh et al., 2004). The method involved the
preparation of plant crude sap or aphid macerates in a buffered detergent solution;
immobilizing the clarified sap onto a nitrocellulose membrane; reverse
transcription using eluted water extract from a cut-out spot from the membrane;
and PCR. This process was especially suitable for remote areas without PCR
thermal cyclers, as the viral RNA-immobilized membranes could be mailed out
for detection by RT-PCR to centralized laboratories. However this process is
unlikely to be suitable for large-scale routine use due to labor-intensive operation
compared to ELISA.
35
Multiplex RT-PCR combines several pairs of primers in one reaction. A duplex
RT-PCR was developed in Canada to detect PVY and PLRV in dormant tubers
and leaves (Singh et al., 2000) and a multiplex RT-PCR assay using a common
primer, 21-mer oligo(dT), for simultaneous detection of PVS, PLRV, PVX, PVA,
PVY, and PSTVd was successful in detecting all six RNA viral pathogens (Nie
and Singh, 2000). In naturally infected field grown tubers, the multiplex RT-PCR
detected up to three viruses present in tubers with mixed infection. A multiplex
assay using random primers was developed for the simultaneous detection of
PLRV, PVX, PVA, PVY, PVS and PSTVd in potato plants (Nie and Singh,
2001). DNase 1 was used in the RNA extraction method. In that study leaves were
found to be better sources than dormant or sprouted tubers for detection of PVY
and PLRV. A multiplex RT-PCR for the detection of PVY, PVX, PLRV and
PSTVd in potato leaves using specific primers was developed later (Peiman and
Xie, 2006). The multiplex RT-PCR method was compared with double antibody
sandwich (DAS) ELISA and was found to be comparable. Peiman and Xie (2006)
also compared multiplex assay with a simplex assay and were found they gave
consistent results. Pieman and Xie (2006) concluded that multiplex RT-PCR was
a useful tool for the rapid and reliable simultaneous detection of several viruses
and a viroid of potato at a low running cost. More recently, a multiplex RT-PCR
assay has been developed for the detection of the criniviruses Potato yellow vein
virus (PYVV) and Tomato infectious chlorosis virus, and TRV in potato leaves
(Wei et al., 2009). Conventional RT-PCR relies on time consuming agarose gel
electrophoresis for analysis. Moreover, viral load cannot be measured.
36
1.9.1 Real-time RT-PCR
Advances in molecular diagnostics have been reviewed (Mumford et al., 2006;
Boonham et al., 2008). Real-time RT-PCR enables detection of the product
during amplification − in real time, and allows for quantitation assays. In this
method, in addition to primers, a dual-labelled probe is used, with a fluorescent
label at one end and a quencher at the other. The quencher absorbs the
fluorescence whilst the probe is intact. The probe anneals to the sequence internal
to the primers. The 5’ exonuclease activity of the Taq polymerase results in the
fluorescent probe being cleaved. When this happens the quencher no longer
absorbs the fluorescence which is monitored in real time (Holland et al., 1991).
Real-time RT-PCR has been used to detect PYVV in potato leaves (Lopez et al.,
2006) and for large-scale testing of potato leaves for detection of PSTVd
(Roenhorst et al., 2005). Real-time RT-PCR has also been used to detect and
quantify TSWV in leaves of capsicum and Nicotiana spp. (Roberts et al., 2000).
The method was found to be more sensitive than conventional RT-PCR; 1000
molecules of the target transcript were detected. This same assay was validated in
single and bulked leaf samples of a diverse range of crops, and when compared
with DAS-ELISA the RT-PCR assay was found to be more sensitive (Dietzgen et
al., 2005).
A multiplex real-time RT-PCR was developed for detection of TRV and PMTV in
potato tubers (Mumford et al., 2000). All 42 isolates of these viruses from a wide
range of cultivars and locations were detected successfully. The method was more
sensitive in testing potato leaves and tubers than the assays it replaced − TRV by
37
RT-PCR or PMTV by ELISA allowing 100- and 10,000-fold increases in
sensitivity respectively. Moreover, the sensitivity and reliability of direct tuber
testing for the detection of PVY by real time RT-PCR and DAS ELISA was
compared by Fox et al. (2005) with the finding that real-time RT-PCR provided
the more reliable assay − 70% detection compared to around 20% detection by
ELISA after 10 weeks post harvest. Multiplex real-time RT-PCR has also been
used to detect single and mixed infections of PLRV and PVY in seed potatoes
using molecular beacons (Klerks et al., 2001). From each tuber sample, an aliquot
was used for ELISA and another for extracting total RNA. Their multiplex was
more reliable when compared with ELISA as some PVY-infected samples gave
false negative results. More recently, a two-step, real-time RT-PCR assay was
successfully developed for the simultaneous detection of PLRV, PVA, PVX and
PVY from total RNA extracted from one gram of tuber sap (Agindotan et al.,
2007).
1.10 RNA extraction from potato tuber tissue
Reverse transcription of viral nucleic acid requires the extraction of RNA of high
integrity. The presence of RNases and the phenolics and polysaccharides in tubers
inhibit nucleic acid amplification (Singh and Singh, 1996). These compounds
have been removed from tuber tissue samples by diluting nucleic acid prior to
cDNA synthesis, using isopropanol precipitation and phosphate-buffered saline-
Tween in the cDNA mix (Singh and Singh, 1996), incorporating citric acid at the
extraction step (Singh et al., 1998) and by adding sodium sulphite in the
38
extraction buffer (Singh et al., 2002). These inhibitors, phenolics and
polysaccharides can be overcome with the use of magnetic beads. Magnetic
beads were first used to isolate RNA from crude plant extracts by Jakobsen et al.
(1990). Magnetic silica beads (Kingfisher method) have been used to isolate RNA
directly from potato tuber tissue (Fox et al., 2005). One PVY-infected subsample
was detected in bulked samples of ten tubers using this method.
The effectiveness of commercial RNA extraction kits was compared with the
effectiveness of the cetyltrimethyl ammonium bromide (CTAB) (Boonham et al.,
2004) and Kingfisher methods (Roenhorst et al., 2005). The results indicated that
the Kingfisher method performed less well with PCR cycle threshold (Ct) values
approximately three cycles higher than the other methods. The efficiency of
potato virus detection directly from tuber sap obtained from one gram of tuber
tissue was found to be comparable to that of purified total RNA extracted from
tuber tissue using the Qiagen RNeasy Plant Mini Kit (Agindotan et al., 2007).
The use of LiCl precipitation for RNA purification was reviewed by Ambion
(2008) with the conclusion that centrifugation at 16,000 x g should be for at least
20min at 4ºC, and 0.5 M LiCl was just as effective as 2.5 M LiCl. RNA
extraction from potato tubers commonly involves overnight precipitation
(Mumford et al., 2000; Fox et al., 2005).
39
1.11 Aims
The specific hypothesis tested in this study was that a single-tube real-time RT-
PCR assay can be developed for the simultaneous detection of PLRV, PVX, PVS
and TSWV in 100 sub-samples of dormant potato tubers.
The aims of this project were as follows:
1. To identify the cellular distribution of PLRV, PVX, PVS and TSWV in
dormant potato tuber tissue.
2. To develop and validate a single-tube, multiplexed, real time quantitative RT-
PCR assay for simultaneous detection of the PVX, PVS, PLRV and TSWV in
samples of potato leaves and dormant potato tubers.
3. To develop a rapid and efficient method for RNA extraction from bulked tuber
tissue at minimal cost that is suitable for routine use by the potato industry.
40
CHAPTER 2
GENERAL MATERIALS AND METHODS
2.1 Plant materials for virus stocks
Potato plants cv. Atlantic, Eben, Nadine, Royal Blue, Ruby Lou and White Star
were used as the principal hosts for PVS and PLRV because these cultivars are
commonly grown for the seed potato industry in Western Australia. Nadine,
Atlantic and Ruby Lou are resistant to PVX (Nadine has the Nx gene, the latter
two have the Rx gene). Therefore the principal hosts for PVX were Royal Blue,
Eben and White Star.
The virus isolates used in sap inoculations were PVX-XK, PLRV-KK, PVS-SK
and TSWV-Let.T all of which originated in south-west Australia. PVX-XK,
PLRV-KK and PVS-SK were from previous work (Wilson and Jones, 1992,
1993b). They were maintained in potato plants by sequentially planting infected
tubers. The principal host for the TSWV isolate TSWV-Let.T was tomato plant
cv. Grosse Lisse (provided by B.A. Coutts), because it is quick-growing, easily
inoculated and symptoms of infection are observable.
Infected and uninfected potato tubers were obtained from Adj. Professor Roger
Jones and Mr. Mark Holland, Department of Agriculture and Food Western
Australia (DAFWA), and from Elders Ltd., Victoria. The tubers were sprouted in
sandy soil in a glasshouse under natural light. An attempt was made to maintain
the temperature at around 22ºC with the use of an evaporative cooler and sun
screens. The plants were watered by hand every three days during the winter
41
months and more frequently as required during summer. They were fertilized
weekly with Aquasol (Hortico Ltd., Melbourne, Australia).
2.2 Inoculation of host plants
Young, healthy potato plants were sap-inoculated with PVX and PVS. Infected
potato leaves were ground in a chilled mortar and pestle with 30 ml chilled
inoculation buffer (5.75 g Na2HPO4, 1.48 g NaH2PO4 and 500 ml de-ionized
water; pH 7.2). Diatomaceous earth was added as an abrasive. The sap mixture
was rubbed onto the upper leaves and washed off. Damp newspaper was placed
over the plant overnight to prevent dehydration. Tomato plants were inoculated
with TSWV in the same manner using inoculation buffer containing 2.24 g
KH2PO4, 5.87 g K2HPO4, 0.63 g Na2SO3; pH 7.2 in 500 ml de-ionized water.
2.3 ELISA
Potato leaf samples were tested for infection with PLRV, PVX, PVS and TSWV
after extraction (1 g/20 ml) in phosphate buffered saline (10 mM potassium
phosphate, 0.15 M sodium chloride, pH 7.4, containing 5 ml/L Tween 20 and 20
g/L polyvinylpyrrolidone). A leaf press (Pollahne, Germany) was used for
extraction. The extracts were tested by ELISA as described by Clark and Adams
(1977). Potato tuber sections were incubated with antibodies (DSMZ Plant Virus
Collection, Germany) specific to the CP antigens of each of the viruses in a 1:200
dilution as recommended by the manufacturer. Each sample was tested in
duplicate wells in microtitre plates, and infected and healthy sap was included in
42
paired wells as controls. The substrate used was 0.5 mg/ml p-nitrophenyl
phosphate in 10 ml/L of diethanolamine; pH 9.8. Absorbance (A450) values were
measured in a Titertek Multiscan Photometer (Flow Laboratories, Finland).
Samples were considered positive when absorbance values were at least twice
those of the healthy control samples.
2.4 RNA extraction
Total nucleic acids were extracted from 0.1 g of virus-infected leaf tissue. Tissue
samples were ground to powder in liquid nitrogen using a mortar and pestle. The
total RNA was extracted using an RNeasy Plant Minikit (Qiagen) or an
UltraClean Plant RNA Isolation kit (MoBio) according to manufacturers’
instructions. The nucleic acid extract was stored at -20°C or -80°C in RNase-free
water until required.
2.5 RT-PCR
The Applied Biosystem GeneAmp PCR System 2700 or the Perkin Elmer
GeneAmp PCR System 2400 thermal cyclers were used to carry out RT-PCR and
PCR. The reactions were carried out in 0.2 ml tubes under the conditions as
described in Tables 2.1 and 2.2. All primers were synthesized by GeneWorks Pty.
Ltd. (Theburton, South Australia). Real-time RT-PCR was carried out using a
Corbett Rotor-Gene 3000 Rotary Analyzer (NSW, Australia). All TaqMan®
fluorescent-labeled probes were synthesized by Integrated DNA Technologies,
IA, USA.
43
Table 2.1 One-step reaction conditions used in RT-PCR
Component µl
RNAse free water 5.75
5x buffer (Qiagen) 2
dNTP (Qiagen) 0.4
Forward primer (10 pmol/µl) 0.2
Reverse primer (10 pmol/ µl) 0.2
RT-PCR enzyme mix (Qiagen) 0.4
1U RNase inhibitor (Applied Biosystems) 0.05
RNA template 1
10___
The thermal cycling conditions were 50°C for 30 min, 95°C for 15 min, followed
by 30 cycles of 94°C for 30 sec, 50°C for 30 sec, 72°C for 1 min. Extension was
at 72°C for 10 min. The products were held at 14°C until collection.
Table 2.2 Typical two-step reaction conditions used in RT-PCR
RT component____________________________________µl ____
10x buffer (Applied Biosystems) 1
25 mM MgCl2 (Applied Biosystems) 2
10 mM dNTP 1
5U reverse transcriptase MuLV(Applied Biosystems) 0.1
2U RNase inhibitor (Applied Biosystems) 0.1
Reverse primer (10 pmol/ µl) 0.5
RNase free water 0.3
RNA template 5 each
10
PCR component_________________________________________
10x buffer (Applied Biosystems) 2
25 mM MgCl2 (Applied Biosystems) 2
10 mM dNTP 0.5
Forward primer (10 pmol/ µl) 0.5
0.5U Taq polymerase (Applied Biosystems) 0.1
RNase free water 14.9
RT template 5
25 ___
44
The conditions for the reverse transcription reaction were 42°C for 15 min and
99° C for 5 min. The thermal cycling conditions for the PCR reaction were 94°C
for 3 min and 30 cycles at 94°C for 30 sec, Tm for 30 sec and 72°C for 1 min. A
final extension was at 72°C for 10 min. The products were held at 14°C until
collection.
2.6 Agarose gel electrophoresis
Generally, 10 µl of the PCR product and 5 µl of a 100 base pair ladder (Axygen)
were mixed with 2 µl of 6x DNA loading buffer and subjected to electrophoresis
in 1.5% agarose gel in Tris Acetate EDTA (TAE) buffer for 60 min at 85 volts.
For visualization, the gel was immersed for 10 min in a 1.2 µM ethidium bromide
solution. The bands were viewed using ultraviolet light.
2.7 Polyacrylamide gel electrophoresis
Generally, 10 µl of the real-time PCR product and 5 µl of a 100 base pair ladder
were mixed with 2 µl of 6x DNA loading buffer and subjected to electrophoresis
in 8% polyacrylamide gel in Tris Borate EDTA (TBE) buffer for 11 hours at 100
volts. The gel consisted of 6 ml 10x (TBE), 12 ml 40% acrylamide:bis
acrylamide, 0.5ml 10% ammonium persulphate, 45 µl tetramethylethylenediamine
(TEMED) and 60 ml distilled water. For visualization, the gel was immersed for
10 min in a 1.2 µM ethidium bromide solution. The bands were viewed over
ultraviolet light.
45
2.8 Sequencing reactions
PCR products were sequenced in both directions. The PCR products were purified
before sequencing using the Wizard
SV Gel and PCR Clean-up System
(Promega) according to the manufacturer’s instructions. The purified products
were subjected to a PCR dye terminator sequencing reaction using a pre-prepared
Big-Dye dye terminator kit as follows: 2 µl dye terminator reaction mix, 1 µl of
5x dilution buffer, 0.5 µl (10 mol/µl) of the forward or reverse primer, 5 µl of the
purified template and 1.5 µl milli-Q water to make up to a volume of 10 µl.
Thermocycling involved initial denaturation at 96°C for 2:20 min followed by: 25
cycles of 96°C denaturation for 5 sec, annealing for 10 sec at 57°C and final
extension for 4 min at 60°C. The reaction was held at 10°C until collection.
For the final purification of the DNA, the dye terminator product was combined
with 25 µl of absolute ethanol, 1 µl of 3 M sodium acetate (pH 5.2) and 1 µl of
125 mM EDTA (pH 8.0) in a 600 µl microtube. The tube was flicked gently to
mix and stored on ice for 30 min to allow precipitation of the DNA. The products
were then subjected to centrifugation in a microfuge at 14,000 rpm for 20 min at
room temperature. The supernatant was carefully discarded using a pipette. The
pellet was washed with 500 µl of ice-cold 70% ethanol and the supernatant
removed with a pipette. The sample was dried at 37°C for 30 min, or until the
moisture was removed, and stored at -20°C. Sequencing was conducted using a
DNA analyzer in the sequencing section of the Western Australian State
Agricultural Biotechnology Centre by Frances Brigg. The raw sequences were
edited on the Chromas LITE 2.01 (Technelysium Pty Ltd, 1988) computer
46
programme. The sequences were then aligned using ClustalW in the BioEdit
Sequence Alignment Editor version 7.0.5.3 computer programme (Hall, 1999) and
entered into the Molecular Evolutionary Genetics Analysis (MEGA) programme
(Kumar et al., 2004). The sequences were BLAST searched to identify homology
with known sequences in the NCBI database.
47
CHAPTER 3
IN SITU LOCALISATION OF PLRV, PVX, PVS AND TSWV IN TUBER
TISSUE OF POTATO
3.1 Introduction
The localisation of PVS, PVX and TSWV in potato tubers has previously been
investigated by ELISA (de Bokx et al., 1980a; de Bokx et al., 1980b; Wilson,
2001); however the localisation of the RNA of these viruses in potato tubers has
not been investigated at the cellular level. The distribution of PLRV in potato
tubers has also been investigated by ELISA (Gugerli, 1980; Gugerli and Gehriger,
1980) and also at the cellular level by Weidemann and Casper (1982) and Barker
and Harrison (1986) using immunostaining techniques. The virus was found to be
restricted to the phloem in potato tubers. When RNA is extracted from bulked
potato tuber tissue samples, polysaccharides and polyphenols that co-precipitate
with RNA can inhibit nucleic acid amplification (Singh and Singh, 1996). Taking
samples from peels of dormant tubers would overcome this problem due to the
relatively small amount of tuber tissue taken with the peelings in comparison with
core sampling. Therefore, to ensure the reliable detection of PLRV when
extracting RNA from samples of potato tuber peelings, the distribution of phloem
below the epidermis of tubers was investigated. In addition, a sample of potato
peelings was analysed for the presence of PLRV particles using transmission
electron microscopy (TEM).
48
Rajamaki and Valkonen (2002a; 2002b) used immunohistochemical staining and
digoxigenin-labeled RNA probes to detect viruses in potato leaf cells. In this
chapter similar techniques were used to identify the in situ cellular localisation of
PVX and PLRV in secondary infected freshly harvested potato tubers, PVS in
both primary and secondary infected freshly harvested potato tubers, and TSWV
in tubers three months post harvest.
The localisation data obtained in this study is compared with previous localisation
findings. The implication of sampling of potato tuber tissue for RNA extraction of
PLRV, PVX, PVS and TSWV is discussed.
3.2 Materials and Methods
3.2.1 Plant materials and virus stocks
Potato plants, cvs Atlantic, Eben, Nadine, Royal Blue, Ruby Lou and White Star,
and virus stocks, were grown and maintained as described in Section 2.1. To
confirm infection, the plant leaves were tested for infection by ELISA or RT-
PCR. Tubers were harvested following plant senescence. Potato tuber subsamples
were taken from the stolon (heel) end, the rose end and the central core no later
than one week post harvest. Healthy tubers of the same cvs were tested at the
same time.
Nine tubers, cvs Royal Blue (5), White Star (2) and Eben (2) were sampled for in
situ detection of PVX; nine tubers, cvs Nadine (3), White Star (1), Atlantic (4)
and Ruby Lou (1) were sampled for detection of PLRV; twelve tubers; Ruby Lou
49
(2), White Star (2), Royal Blue (3), Atlantic (3) and Nadine (2) were sampled for
detection of PVS.
There was a lack of available TSWV-infected tubers of these cvs, however
TSWV-infected tubers cvs Yardin, Maxine and Eva were supplied by Mr. Mark
Holland (DAFWA). These tubers were tested 3 months post harvest. Healthy
tubers of these same cvs were supplied by Elders Ltd., Victoria, to use as negative
controls. Cores were cut from the rose end of TSWV-infected tubers and grown
for further testing. At the end of this study, six TSWV-infected tubers cv. Atlantic
were provided by Brendan Rodoni (Department of Primary Industries, Victoria,
Australia) and tested for infection by RT-PCR.
3.2.2 Fixing and embedding of potato tuber tissue
Samples (10 mm3) were cut from the heel, rose and central core of the tubers and
fixed in formalin acetic alcohol (Sass, 1958). The sections were subjected to a 19
hour automated processing cycle (Leica Microsystems, New South Wales,
Australia) involving incubation as follows: one hour followed by two hours in
90% ethanol, one hour followed by two hours in 100% ethanol, one hour in 100%
ethanol/chloroform, two changes of three hours in 100% chloroform and two
changes of three hours in wax. Paraplast tissue embedding medium (McCormick
Scientific, St. Louis) was used for the final embedding.
Ribbons (10 µm) of the histological sections were cut with a microtome (Leica),
carefully laid on the surface of the water in a water bath at 53 - 55ºC, and picked
up on silane-coated slides (Lomb Scientific Pty. Ltd., Welshpool, WA). The slides
50
were incubated at 60ºC for two hours. All tests were done in duplicate, with two
ribbons per slide. Negative controls consisted of uninfected sections of potato
tubers of the same cvs as the test samples.
3.2.3 Paraffin removal
The protocol used for paraffin removal and hydration of the tissue sections was as
follows: two changes of three min in xylene, two changes of three min in 100%
ethanol, three min in 70% ethanol, and two dips in distilled water.
3.2.4 Potato tuber cellular structure
After paraffin removal, the cellular structure of the tuber sections was examined
to ensure that the tissue had remained intact throughout the process of fixing and
embedding. The sections were stained with 1% toluidine blue for 1 min, rinsed
with distilled water, and dehydrated in 2 x 3 min 70% ethanol, 2 x 3 min 100%
ethanol and 2 x 3 min xylene. The slides were mounted with dilute DPX and
viewed using an Olympus BX51 compound microscope. Photographs were taken
with an attached Olympus DP70 camera.
3.2.5 Immunohistochemistry
Potato tuber sections were incubated with antibodies (DSMZ Plant Virus
Collection, Germany) specific to the CP antigens of each of the viruses in a 1:200
dilution as recommended by the manufacturer. A detection kit (Dako, Australia)
containing anti-rabbit antibodies, alkaline phosphatase and the colour substrate
51
fuchsin was used according to manufacturer’s instructions. For TSWV detection,
the sections were incubated in blocking solution (Roche) for 30 min prior to
incubation with the antibody to prevent background staining. After staining with
fuchsin the sections were dehydrated in 2 x 2 min 95% ethanol, 2 x 2 min 100%
ethanol and 2 x 2 min xylene. The slides were mounted and viewed as described
in Section 3.2.4. A red colour indicated the presence of the antigen/antibody
complex.
3.2.6 Cloning
The first digoxigenin-labelled RNA probe was synthesized to detect
unencapsidated PVS virions. The primer sequences were designed by Geoff
Dwyer and are listed in Table 3.4. A simpler method was used for the synthesis of
digoxigenin-labelled RNA probes for the detection of PLRV, PVX and TSWV
and is described in Section 3.2.7. Both sense and antisense probes were
synthesized to detect both the positive sense strands and the replicative strands in
the tissue.
3.2.6.1 Ligation
RT-PCR products of 352 base pairs of the targeted PVS sequence were purified
using the Wizard
SV Gel and PCR Clean-up System (Promega). The purified
products were quantified at 39 ng/µl and were ligated in a pGEM®
-T Easy
(Promega) cloning vector and incubated overnight at 4ºC. The ligation reaction
conditions are listed in Table 3.1.
52
Table 3.1 Ligation reaction conditions
Component µl
2x T4 DNA ligase buffer 5
pGEM-T-Easy vector (50ng) 1
DNA insert 3
T4 DNA ligase (3 Weiss units) 1
10
3.2.6.2 Transformation of chemically-competent E. coli cells
Chemically-competent JM109 E. coli cells previously stored at -80ºC were
thawed on ice for 5 min. The plasmid and insert were spun down and 2 µl added
to 20 µl of E. coli cells in a 1.5 µl microcentrifuge tube. The tube was flicked to
mix and left on ice for 20 min. The cells were heat shocked at 42ºC in a water
bath for 55 sec and immediately placed on ice for 2 min. 700 µl of LB broth
(bacto-tryptone (10g/L), yeast extract (5g/L), NaCl (10g/L) pH 7.5) was added to
the cells and incubated for 2 hours on a shaker at 225 rpm at 37ºC. The cells were
streaked onto LB medium plates (bacto-tryptone (10g/L), bacto-yeast extract
(5g/L), NaCl (10g/L), bacto-agar (15g/L)) containing 100 µg/ml ampicillin.
For blue/white colony selection, 100 µl of 100 mM IPTG and 20 µl of 50 mg/ml
X-gal, were spread onto the plates which were pre-warmed at 37ºC for 30 min.
The plates were incubated overnight at 37ºC. Five pure white colonies were
picked after cooling the plates at 4ºC for 10 min. These colonies were placed in
1.5 ml microcentrifuge tubes containing 20 µl water for use as templates for PCR.
PCR was carried out using an SP6 primer with the specific forward primer (SB53)
and a T7 primer with the specific reverse primer (SB54) in order to find out the
53
orientation of the PVS template within the plasmid. The reaction conditions are
listed in Table 3.2. PCR products were run on a 1.5% agarose gel.
Table 3.2 PCR reaction conditions
Component______________ µl ____
0.25U Taq polymerase (Invitrogen) 0.05
10x buffer 2.5
50mM MgCl2 1.0
10mM dNTP 0.5
SP6/T7 primer (10 pmol/ µl) 0.5
Forward/reverse primer (10 pmol/ µl) 0.5
Water 14.95
Template 5.00
25.00___
3.2.6.3 Purification of plasmid DNA containing PVS sequence
The colonies that contained the insert in the forward orientation were selected.
Five µl (100 µg/ml) of ampicillin was added to a McCartney bottle containing 5
ml LB broth. 3 µl of a colony that contained the insert was added to the mixture
and incubated on a shaker overnight at 37ºC.
The cultures (1.2 ml) were placed into 1.5 ml microcentrifuge tubes and spun at
maximum speed for 2 min. The supernatant was removed and pelleted cells were
resuspended in 250 µl of resuspension buffer (50mM Tris HCl, pH 8.0; 10 mM
EDTA; 100 µg/ml RNase A). Then 250 µl of lysis buffer (200 mM NaOH; 1%
SDS) was added to the suspension. The tube was gently inverted to mix. Then
350 µl of neutralization buffer N3 (Qiagen) was added and mixed by inversion.
The suspension was centrifuged at 20,000 x g for 10 min. The plasmid DNA was
purified using the QIAprep Spin Miniprep kit according to manufacturer’s
54
instructions. The DNA was quantified at 198.7 ng/µl using a NanoDrop ND-1000
spectrophotometer (NanoDrop Technologies, DE, USA).
3.2.6.4 Linearization and purification of PVS template
The DNA template was linearised for the generation of digoxigen-labelled RNA
probes. The restriction enzyme Sal1 was used because it leaves a 5’ overhang and
did not cut within the insert. The reaction components are listed in Table 3.3. The
reaction was vortexed, spun down and incubated overnight at 37ºC.
Table 3.3 Protocol for linearizing DNA template
Components µl
10x buffer (Invitrogen) 5.0
DNA (7.5 µg) 25.0
Sal1(12U/µl) 1.6
Water 18.4
50
One volume (50 µl) of TE buffer (10 mM Tris, 0.1 mM EDTA) was added to the
tube. One volume (100 µl) of phenol:chloroform:isomyl alcohol (25:24:1) was
added to the mix and vortexed for one min. The tube was centrifuged at 14000
rpm for 2 min. The upper aqueous phase was transferred to a fresh tube and the
organic phase back-extracted with 100 µl of TE buffer to increase recovery. The
solution was vortexed for one min and centrifuged at 14000 rpm for 2 min. The
upper aqueous phase was transferred to a fresh tube containing the original
aqueous phase.
55
3.2.6.5 DNA precipitation
DNA was precipitated by adding 10% volume of 3 M sodium acetate with 2.5
volume of 100% ethanol. The DNA solution was mixed by pipetting and left at
-20ºC for 30 min after which time it was centrifuged at 12,000 x g for 30 min.
The supernatant was discarded and the pellet washed with ice-cold 70% ethanol
by centrifugation at 12,000 x g for 5 min and the supernatant was discarded. The
DNA pellet was dried at room temperature resuspended in 6 µl of RNase-free
water and quantified using a NanoDrop spectrophotometer. The average of three
concentration measurements for the generation of the PVS probe was 548 ng/µl.
RNA labeling was reaction was carried out using the Roche DIG RNA labeling
kit.
3.2.7 Digoxigenin-labeled RNA probes
Primer sequences for PLRV and PVX were designed by Agindotan et al. (2007)
and PVS primers were designed by Geoff Dwyer (DAFWA). For the synthesis of
a digoxigenin-labeled RNA probes to detect TSWV, oligonucleotide primers were
designed from published sequences of highly conserved regions of the
nucleocapsid gene sequences. The regions were amplified by RT-PCR and
purified before labelling with digoxigen-11-UTP. In the case of PVS, the region
was first cloned into a plasmid vector.
Primers were also designed from published sequences of the Patatin gene family
for the synthesis of a labeled probe to use as a positive control. The Patatin gene
was chosen because the patatin glycoprotein is abundant in potato tubers
56
(Jefferson et al., 1990) and 98 to 99% of the patatin mRNA in tubers is encoded
by Class-1 Patatin genes (Wenzier et al., 1989).
Sense and/or antisense probes complementary or homologous to highly conserved
regions of PLRV, PVX, TSWV, PVS and patatin mRNA were synthesized using
the primer sequences listed in Table 3.4. A T7 or SP6 promoter sequence, TAA
TAC GAC TCA CTA TAG GG or ATT TAG GTG ACA CTA TAG AA respectively, was
added to the 5’ end of the forward or reverse primers. All primers were
synthesized by GeneWorks Pty. Ltd. (Theburton, South Australia). The one-step
RT-PCR reaction contained 12.5 µl Jumpstart Taq Readymix (Sigma), 10 pmol
each of forward and reverse primer, 10U reverse transcriptase (Applied
Biosystems), 2 µl RNA template and water to 25 µl. The thermal cycling
conditions were: 42ºC for 30 min, 95ºC for 15 min, followed by 30 cycles of 94ºC
for 30 sec, 65ºC for 30 sec and 72ºC for 1 min.
Table 3.4 The sequence of primers used to synthesize RNA probes
Name Sequence 5’- 3’ Position
PVX-1 for a
AAGCCTGAGCACAAATTCGC 6110-6129
PVX-1 rev GCTTCAGACGGTGGCCG 6210-6194
PLRV-1 for b AAAGCCGAAAGGTGATTAGGC 5896-5911
PLRV-1 rev CCTGGCTACACAGTCGCGT
5964-5946
PVS-SB53 for c CTCATCAGGTTGATTGAACTCATGGC 7354-7380
PVS-SB54 rev CACTGCGCCTGTTGGGAACTC 7711-7691
TSWV-1 for d AGACAGGATTGGAGCCACTGACAT 249-272
TSWV-1 rev TCCCAGTTTCCTCAACAAGCCTGA 328-305
Patatin-1 fore TGGAGAAACTCGTGTGCATCAAGC 414-437
Patatin-1 rev TGCTGGATCCTCTTGTGCAAGTCT 723-700
PVX and PLRV primers were designed by Agindotan et al. (2007); PVS primers were
designed by Geoff Dwyer.
The position of the primers is based on GenBank accession numbers M3840a D13746
b
NC007289 c AF048714
d DQ274493.1
e
57
The PCR products were purified using the Wizard
SV Gel and PCR Clean-up
System (Promega) and quantified using a NanoDrop ND-1000 spectrophotometer
(NanoDrop Technologies, DE, USA). The average of three concentration
measurements of the RT-PCR products used for the generation of sense probes
were 130.33 ng/µl, 104.77 ng/µl, 94.63 ng/µl for PVX, PLRV and TSWV
respectively. The average of three concentration measurements of the RT-PCR
products for the generation of antisense probes were 112 ng/µl, 97 ng/µl, 102
ng/µl, 98 ng/µl and 123 ng/µl for PVX, PLRV, TSWV, PVS and patatin
respectively. Run-off transcripts were generated using an RNA labelling kit
containing digoxigen-11-UTP (Roche, Castle Hill, New South Wales, Australia).
The protocol is listed in Table 3.5. The RT-PCR products of the targeted Patatin
mRNA region were run on a 1.5% agarose gel and purified using the Wizard
SV
Gel and PCR Clean-up System (Promega). The product was sequenced as
described in Section 2.8 to ensure homology to Class-1 mRNA patatin.
Table 3.5. Protocol for the synthesis of digoxigenin-labeled RNA probes.
Reagent Volume (µl)
10x NTP labelling mixture 2
10x transcription buffer 2
Protector RNase inhibitor 1
RNA polymerase SP6/T7 2
Purified template DNA 1 µg
DMPC-treated water to 20
The reaction was mixed gently, centrifuged briefly and incubated in a thermal
cycler at 37ºC for 2 hours (T7) or 2.5 hours (SP6). DNase 1 (2 µl) was added to
58
remove template DNA, and the reaction was incubated for 15 min at 37 ºC. The
reaction was stopped by adding 2 µl 0.2 M EDTA; pH 8.0.
3.2.7.1 Purification of RNA transcripts
Working on ice, 2.5 µl of 4 M LiCl and 75 µl of pre-chilled (-20ºC) 100% ethanol
was added and mixed by pipetting. The reaction was stored overnight at -20ºC.
The tube was subjected to centrifugation at 13,000 x g for 15 min at 4ºC. The
supernatant was discarded and the pellet washed with 50 µl ice- cold 70% ethanol.
The tube was centrifuged at 13.000 x g for 5 min at 4ºC and the supernatant
discarded. The pellet was dried in a vacuum and dissolved in 100 µl DMPC water
for 30 min in a 37ºC block. The RNA was quantified using a NanoDrop and
stored in 20 µl aliquots at -80 ºC.
3.2.7.2 Labelling efficiency
Labelling efficiency was determined using a DIG Nucleic Acid Detection Kit
(Roche, Mannheim, Germany). Two concentrations, 10 ng/µl and 1 ng/µl, of each
digoxigenin-labelled RNA probe, both sense and antisense, were spotted onto a
positively-charged nitrocellulose membrane. After incubating with blocking
solution and anti-DIG antibody according to manufacturer’s instructions, the
membrane was incubated overnight in the colour substrate 5-bromo-4-chloro-
3indolyl phosphate and nitroblue tetrazolium salt (BCIP/NBT).
59
3.2.8 In situ hybridization
The protocol for in situ hybridization was as described by DeBlock and
Debrouwer (2002) with some modifications. The sections were de-waxed in two
changes of xylene for 3 min each and then rehydrated in the following solutions: 1
x 5 min 100% ethanol, 1 x 5 min 95% ethanol, 1 x 5 min 70% ethanol and 2 dips
in DMPC-treated water. The sections were then incubated for 30 min at 37ºC in a
solution containing 100 mM Tris pH 7.5, 50 mM EDTA and 2 µg/ml Proteinase
K. After the Proteinase K treatment, the slides were washed twice in phosphate
buffered saline (PBS). The sections were then dehydrated in ascending
concentration of ethanol as follows: 2 x 2 min 70% ethanol, 2 x 2 min 95%
ethanol and 2 x 2 min 100% ethanol. All the solutions used for in situ
hybridization were made with DEPC-treated water.
3.2.8.1 Hybridization
The hybridization mixture contained 50% deionized formamide, 2.25x saline-
sodium phosphate-EDTA (SSPE: 300 mM NaCl; 20 mM NaH2 PO 4; 2 mM
EDTA; pH 7.4), 10% dextran sulfate, 2.5x Denhardt’s solution (50x: 1% each
Ficoll 400, bovine serum albumin, polyvinylpyrrolidone), 100 µg/ml tRNA, 5
mM dithiothreitol (DTT), 40 U/ml RNase inhibitor and 1.0 µg/ml probe. The
volume was made up to 1 ml with DMPC-treated water.
Each section on the slide was covered with the hybridization mixture and
incubated in a humidified box at 42ºC overnight. After hybridization, the slides
were washed as follows: 5 min 3x SSC (1x contains 150 Mm NaCl, 15 Mm Na-
60
citrate; pH 7.0), and 5 min NTE (500 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA;
pH 7.5). To remove unhybridized probes, the slides were placed in a humidified
box and covered with 500 µl NTE buffer containing 50 µg/ml RNase A, and
incubated for 30 min at 37ºC. The slides were then washed 5 min x 3 with NTE.
The nonspecifically bound hybridized probes were removed by washing the slides
for 30 min with 2x SSC at room temperature, and then 1 hour with 0.1x SSC at
57ºC.
3.2.8.2 In situ detection of digoxigenin-labelled RNA probes
The slides were prepared according the instructions in the DIG Nucleic Acid
Detection kit (Roche). All slides were prepared in duplicate. This involved
incubating the slides with blocking solution and anti-DIG antibody, after which
the slides were incubated with BCIP-NBT in the dark, overnight, at room
temperature. The colour reaction was stopped by washing the slides 3 x 5 min in
distilled water. The sections were then dehydrated by incubating the slides in 70%
ethanol for 15 sec and 100% ethanol for 15 sec x 2 and air dried. The slides were
mounted and viewed as described in Section 3.2.4.
3.2.9 Distribution of phloem in superficial tissue of potato tubers
Tuber tissue cut from the heel or rose ends of potato tubers cvs Atlantic, Nadine,
Royal Blue, Ruby Lou and White Star was fixed in formal acetic alcohol (Sass,
1958), dehydrated in an ethanol series and embedded in paraffin wax as described
in Section 3.2.2. The sections were cut at 10 µm thickness and placed on silane-
61
coated slides which were dried at 60ºC for two hours and stained with 0.01%
aniline blue for 10 min (Schneider, 1981). All slides were prepared in duplicate
and were examined with an Olympus BX51 compound microscope using
ultraviolet excitation (wavelength 330-385 nm) and photographed using an
Olympus DP70 camera system. The distance between the outer epidermis and the
vascular tissue was measured using associated software.
3.2.10 PLRV virions in potato tuber peelings
The sap from 10 g of cv. Nadine 2nd generation freshly harvested potato peelings
was extracted by crushing the peelings with a mortar and pestle in 20 ml of 0.01
M phosphate buffer; pH7.6. The homogenate was centrifuged at 890 x g for 10
min. A drop of the supernatant was added to a two hundred mesh copper grid
coated with 35% formvar and incubated for 2 min. The grid was then placed on
filter paper to remove excess fluid. A drop of 1% phosphotungstic acid (PTA) in
0.01 M Tris, pH 7.3, was placed on the formvar grid and incubated for 2 min.
Preparations were viewed using a Philips 301 transmission electron microscope
with the technical assistance of Mr. Peter Fallon (Division of Veterinary and
Biomedical Sciences, Murdoch University).
3.3 Results
3.3.1 Patatin gene sequence
The RT-PCR products of total RNA extracted from a potato tuber using primers
targeting patatin mRNA were run on a 1.5% agarose gel (Figure 3.1) and
62
sequenced. The amplified product was 310 bp which was homologous to patatin
Class 1 mRNA (NCBI Accession number M18880.1) (Figure 3.1).
Figure 3.1. 1.5% agarose gel electrophoresis of Patatin mRNA. Lane 1, 100 bp ladder,
Lane 2, no template control, Lane 3, large well, patatin mRNA 310 bp.
3.3.2 Synthesis of digoxigenin-labelled RNA probe for detection of PVS
PCR of products was carried out using an SP6 primer with the specific forward
primer and a T7 primer with the specific reverse primer in order to find out the
orientation of the insert within the plasmid. The PCR products were run on a
1.5% agarose gel (Figure 3.2). Colonies 2, 3, 4 and 5 (Lanes 5-8) contained the
insert in the forward orientation. Colony 1 (Lanes 4 and 9) did not contain the
insert and colony 2 (Lanes 5 and 10) showed bands for both the SP6/forward
primer and T7/reverse primer, indicating that two colonies may have been picked.
The synthesis of digoxigenin-labelled RNA probes for the detection of PVX,
PLRV and TSWV is described in Section 3.2.7.
310 bp
63
Figure 3.2. PCR products showing the orientation of the inserts. Lanes 1 and 13, 100 bp
ladder; Lane 2 and 3, no template control, Lane 4, colony 1 T7/reverse primer; Lane 5,
colony 2 T7/reverse primer; Lane 6, colony 3 T7/reverse primer; Lane 7, colony 4
T7/reverse primer; Lane 8, colony 5 T7/reverse primer; Lane 9, colony 1 SP6/forward
primer; Lane 10 colony 2 SP6/forward primer; Lane 11, colony 3 SP6/forward primer;
Lane 12, colony 4 SP6/forward primer; Lane 13, colony 5 SP6/forward primer.
3.3.3 Dot blot hybridization to test labelling efficiency
Labelling efficiency of the anti-DIG antibody to the DIG-labelled probe was
visualized by spotting two concentrations, 10 ng/µl and 1 ng/µl, of the sense and
antisense probes for each of the four viruses onto a positively charged
nitrocellulose membrane and incubating with anti-DIG antibody and NBT/BCIP
according to the DIG Nucleic Acid Detection Kit protocol. All the sense and
antisense probes were detected which indicated that the anti-DIG antibody could
successfully bind to the digoxigenin-labelled RNA probes. There was less
background staining at the 1 ng/µl concentration (Figure 3.3).
1 2 3 4 5 6 7 8 9 10 11 12 13 14
64
Figure 3.3. Dot blot of digoxigenin-labeled RNA probes for the detection of PVX, PVS,
TSWV, PLRV and Patatin on a positively charged nitrocellulose membrane.
3.3.4 Histological sections of potato tuber tissue
The cellular structure of the histological sections of potato tuber tissue was
examined to ensure that the cells remained intact throughout the process of fixing
and embedding. After staining with 1% toluidine blue the cellular structure was
observed to be intact; the vascular tissue and nuclei plainly seen. An example is
shown in Figure 3.4.
Figure 3.4. Histological section of the vascular tissue of a potato tuber after staining with
1% toluidine blue.
Nuclei
Vascular
tissue
65
3.3.5 Distribution of PVS, PVX, PLRV and TSWV in sections of potato tuber
tissue
Samples were cut from the heel end, rose end and core of 39 potato tubers cvs
Royal Blue, Ruby Lou, White Star, Eben, Nadine, Atlantic, Maxine, Yardin and
Eva. Histological sections from these samples were examined for the presence of
PVS, PVX, PLRV and TSWV. All tests were performed in dubplicat. For
immunological detection of the coat protein of PVS, PVX, PLRV and TSWV,
potato tuber sections were incubated with antibodies specific to the coat protein of
each of the viruses. Immunostaining of the CPs showed a red colouration of
infected tissue.
For in situ hybridization of unencapsidated viral RNA, the sections were
incubated with digoxigenin-labeled RNA probes and anti-DIG antibody before
staining with NBT/BCIP. In situ hybridization showed a blue colouration of virus-
infected tissue. The potato cultivars and viruses tested are listed in Appendix 1. A
summary of the results for each virus is presented below.
3.3.5.1 Distribution of PVS
Twelve tubers of five cvs were tested; Ruby Lou (2), White Star (2), Royal Blue
(3) Atlantic (3) and Nadine (2). Immunochemical staining of the CP showed that
PVS was located in all sections of both primary and secondary infected tubers
except for one primary infected tuber, cv. White Star which had staining at the
heel and rose ends but not at the core. Generally, concentration of the virus was
higher at the heel (Figure 3.5) and rose ends, with less intensive staining at the
core. Distribution of PVS at the heel and rose ends appeared to be similar. Second
66
generation tubers were more highly infected than primary infected tubers, with the
red colouration more widespread. In situ hybridization of both antisense (Figure
3.6) and sense (Figure 3.7) probes showed signals that were comparable to those
shown in the immunological staining of the CP. None of the healthy tuber
sections showed signals (Figures 3.5-3.7).
3.3.5.2 Distribution of PVX
Nine tubers of three cvs were tested; Royal Blue (5), White Star (2) and Eben (2).
Potato tubers secondarily infected with PVX were examined. The virus was
distributed throughout all the infected tubers sampled using
immunohistochemistry, although the signal was stronger at the heel (Figure 3.8)
and rose ends than the central core. Viral RNA was also detected in all samples
when hybridized with the antisense digoxigenin-labeled probe. In situ
hybridization of the sense probe showed signals at the heel and rose ends (Figure
3.9) but not at the core. No signal was seen in the uninfected tuber sections
(Figures 3.8-3.9).
3.3.5.3 Distribution of PLRV
Nine tubers of four cvs were tested: Nadine (3), White Star (1), Atlantic (4) and
Ruby Lou (1). All the PLRV-infected tubers tested were secondarily infected.
Immunostaining of the CP antigen showed signals in the vascular tissue as
expected in all samples except one core sample, cv. Atlantic. Stronger signals
were observed at the heel and rose ends than the core, with stronger signals at the
67
heel ends. In situ hybridization of the antisense probe showed that unencapsidated
PLRV was also restricted to the phloem (Figure 3.10). In situ hybridization of the
sense probe in samples from cv. Nadine showed no signals (data not shown). In
sections from a small, single tuber harvested from cv. White Star, in situ
hybridization of the antisense probe at the heel, rose and central core of the tuber
showed signals in the parenchyma. In situ hybridization of the sense probe at the
rose end of the tuber also showed signals in the parenchyma (Figure 3.11),
although there were no signals at the heel end or the central core. In situ
hybridization of both the sense and antisense probes in uninfected tuber tissue
samples showed no signals (Figures 3.10-3.11).
3.3.5.4 Distribution of TSWV
TSWV-infected tubers cvs Maxine, Yardin and Eva were supplied by Mr. Mark
Holland (DAFWA). The leaves of the mother plants of the tubers tested for
TSWV were confirmed positive by ELISA. The tubers were tested 3 months post
harvest. Three tubers of each cv. were tested. The eyes were cut out of two tubers
per cultivar and grown on. Immunological staining and in situ hybridization of
TSWV-infected tubers showed an erratic distribution of the virus. Two of the
three tubers, cv. Yardin, showed signals at the heel end (Figure 3.12) and central
core but not at the rose end. The third tuber had signals at the heel and rose end
but not at the core. None of the three tubers cv. Eva showed any signals, and only
one of the three tubers cv. Maxine was positive for TSWV, with a signal at the
rose end only.
68
Both the antisense and sense probes generated signals in all the infected sections
although hybridization of the sense strand (Figure 3.13) gave less intense signals
than the antisense strand.
Of the cvs Maxine, Yardin and Eva that were grown on, none of the progeny
plants were positive for TSWV when tested by RT-PCR. The six tubers from an
infected plant provided by Brendan Rodoni, Victoria, were received too late to be
tested for the distribution of TSWV in situ, however the heel and rose ends of the
tubers were tested by RT-PCR. Four of the six tubers were infected, with positive
results obtained from both the heel and rose ends.
69
Figure 3.5. Distribution of PVS in freshly harvested tuber tissue, primary infection, cv.
Ruby Lou, using immunostaining (red colouration) with CP antibodies. A, detection of
CP at heel end of infected tuber; B, uninfected tuber cv. Ruby Lou. S, starch granule.
A
B
S
S
70
Figure 3.6. Distribution of PVS in freshly harvested tuber tissue, primary infection, cv.
Ruby Lou, using in situ hybridization with antisense digoxigenin-labeled RNA probe
(blue colouration). A, heel end of infected tuber showing signal (arrows); B, uninfected
tuber cv. Ruby Lou. No signal detected. E, epidermis; S, starch granule.
B
A
E
S
71
Figure 3.7. Distribution of PVS in freshly harvested tuber tissue, primary infection, cv.
Ruby Lou, using in situ hybridization with sense digoxigenin-labeled RNA probe (blue
colouration, arrows). A, rose end of infected tuber showing signal; B, uninfected tuber cv.
Ruby Lou. No signal detected. E, epidermis.
B
A
E
E
72
Figure 3.8. Distribution of PVX in freshly harvested tuber tissue, second generation, cv.
Royal Blue, using immunostaining (red colouration) with CP antibodies. A, detection of
CP at heel end of infected tuber; B, uninfected tuber cv. Royal Blue. No signal is seen. E,
epidermis.
B
A
E
E
73
Figure 3.9. Distribution of PVX in freshly harvested tuber tissue, second generation, cv.
Royal Blue, using in situ hybridization with digoxigenin-labelled RNA probe. A, rose
end of infected tuber hybridized with antisense probe showing signal (arrows); B, rose
end of infected tuber hybridized with sense probe showing signal (arrows); C, uninfected
tuber cv. Royal Blue hybridized with antisense digoxigenin-labelled RNA probe. No
signal is seen. E, epidermis.
A
B
E
E
C
C
74
Figure 3.10. Distribution of PLRV in vascular tissue of second generation freshly
harvested tubers. A, immunostaining with CP antibody (red colouration) at heel end of
infected tuber cv. Atlantic; B, in situ hybridization of antisense digoxigenin-labelled
RNA probe at central core, cv. White Star. The blue stain indicates presence of viral
RNA; C, uninfected tuber cv. White Star after hybridization with antisense digoxigenin-
labelled RNA probe. No signal is seen. P, phloem; X, xylem.
A
B
C
X
X
P
P
75
Figure 3.11. Distribution of PLRV in the parenchyma (arrows) of freshly harvested
second generation, infected tuber tissue, cv. White Star, using in situ hybridization of A,
sense and B, antisense digoxigenin-labelled RNA probes. The blue stain indicates
presence of viral RNA. A, in situ hybridization of sense probe at the rose end of infected
tuber; B, in situ hybridization of antisense probe at the central core of infected tuber; C,
uninfected tuber hybridized with sense probe. No signal is seen. E, epidermis; V, vascular
tissue
B
C
A
E
V
76
Figure. 3.12. Distribution of TSWV in tuber tissue three months post harvest, cv. Yardin,
using immunostaining with nucleocapsid antibodies (red colouration). A, heel end of
infected tuber; B, uninfected tuber cv. Yardin. No signal is seen.
B
A
77
Figure 3.13. Distribution of TSWV in tuber tissue three months post harvest, cv. Yardin,
using in situ hybridization of sense probe. A, rose end of infected tuber; B, uninfected
tuber cv. Yardin four months post harvest. No signal is seen. E, epidermis.
E
A
B
78
3.3.6 Distribution of phloem below the epidermis in potato tubers
A total of seven sections cut from the outer surface of potato tubers cvs Atlantic,
Nadine, Royal Blue, Ruby Lou and White Star were stained with aniline blue and
examined by epifluorescence microscopy. The sections revealed the presence of
sieve elements with typical fluorescence of callose at plasmodesmata and sieve
plates within 0.8-1.7 mm from the epidermis (Figures 3.14, 3.15). These sections
of potato tubers were shown to contain phloem tissues in which PLRV can be
located.
Figure 3.14. Presence of phloem shown below the epidermis of potato tubers following
staining of sections with aniline blue and epifluorescence microscopy. A, vascular tissue
at the heel end of cv. Royal Blue tuber; B and C, at higher magnification the vascular
tissue shows typical fluorescence of callose at sieve plates (arrows). E, epidermis; S,
starch granules; SP, sieve plate; V, vascular tissue; X, xylem.
Figure 3.15. Histological sections of tuber tissue taken from rose end cv. White Star,
stained with 0.01% aniline blue viewed with UV light. A, cross section of tuber; B, the
same section at higher magnification showing sieve plates and sieve tube. E, epidermis;
V, vascular tissue; ST, sieve tube; SP, sieve plates; X, xylem
E
V
A
X SP
C
X
B
SP
S
A
ST
SP
X
B
E
V
79
3.3.7 PLRV virions in potato tuber peelings
The sap from freshly harvested potato peelings was extracted by crushing the
peelings with a mortar and pestle in phosphate buffer. PLRV virions within the
potato tuber peelings were viewed with TEM (Figure 3.16). As expected the
virions were spherical and were approximately 25 nm in diameter.
Figure 3.16. TEM of virions of PLRV from the sap of the peelings of freshly harvested
potato tuber cv. Nadine.
3.4 Discussion
3.4.1 Distribution of PVS, PVX, TSWV and PLRV in histological sections of
potato tubers
PVS CP was generally located throughout both primary and secondary infected
freshly harvested tubers, with greater signals at the heel and rose ends compared
to the core. As expected, second generation tubers were more highly infected than
primary infected tubers. The distribution of the virus was similar at the heel and
rose ends of the tuber. de Bokx et al. (1980a) used ELISA to study the detection
of PVS at the heel and rose ends of secondary infected tubers and found that the
PLRV virions
80
concentration of PVS at the rose ends of dormant tubers and tubers where
dormancy was broken naturally was not significantly higher than the
concentration at the heel ends. The data obtained in this study confirms those
findings.
In situ hybridization of both the sense and antisense probes gave similar signals.
Negative strand synthesis of subgenomic RNA of positive strand plant viruses has
been described (Miller and Koev, 2000; Hull, 2002; Miller and White, 2006).
The negative strand acts as a template for the synthesis of progeny positive strand
genomes and is always present in replicative form. There is little information on
the subgenomic organisation of PVS, however a negative sense strand has been
identified from another carlavirus, Potato virus M (PVM) (Zavriev et al., 1991)
and the CP of PVM is encoded by subgenomic RNA (Mandahar, 2006). Signals
resulting from in situ hybridization of the sense probe in sections of PVS-infected
tubers were therefore not unexpected.
PVX was present throughout all the secondary infected tubers tested. Signals were
stronger at the heel and rose ends than at the core, with overall little difference in
the distribution of the virus between the heel and rose ends. de Bokx et al.
(1980a; 1980b) used ELISA to study the distribution of PVX in potato tubers after
38 and 39 weeks storage. In that study virus concentration was found to be higher
at the rose ends than the heel. The difference in these findings could be due to the
virus migrating to the rose end of the tubers as the tubers matured or due to the
difference in the cultivars or the method of detection used.
81
Gugerli and Gehriger (1980) used ELISA to detect PLRV in primary and
secondary infected potato tubers during dormancy. They found that PLRV
occurred in higher concentration in the vascular tissue at the heel end than at the
rose end of infected tubers. In this study stronger signals were observed at the
heel and rose ends than the core, with stronger staining at the heel ends.
Only one small PLRV-infected tuber was harvested from a potato plant cv. White
Star. That tuber had strong signals showing unencapsidated viral RNA throughout
the tuber. The viral RNA was unexpectedly detected in the parenchyma below the
epidermis at the rose end and also in the central core of the tuber. Although PLRV
is restricted to the phloem in potato tubers (Weidemann and Casper, 1982; Barker
and Harrison, 1986), PLRV has been found to invade other cell types when co-
infected with other viruses (Barker, 1987a). It is possible that the PLRV-infected
tuber tested was co-infected with another virus which could explain the lack of
progeny from the plant other than the single, small tuber harvested. If co-
infections did occur it may be that the presence of PLRV in peel tissues was more
evident as a result and that sample reliability was overestimated. However, the
presence of phloem tissues in sampled peels and the reliability of the subsequent
blind tests would provide some assurance of sample reliability.
Unencapsidated viral RNA was also detected at the rose end of the tuber when the
sense-labelled probe was used. Miller and Koev (2000) list the Luteoviridae
family as positive sense plant viruses that produce subgenomic RNAs that
generate negative sense strands from the genomic template. The CP of PLRV is
translated from subgenomic RNA (Tacke et al., 1990; Taliansky et al., 2003) and
82
therefore detection of the intermediate strand by in situ hybridization of the sense
strand is not surprising.
PLRV virions were detected in potato peels and importantly phloem was detected
in superficial tissue beneath the epidermis. Thus PLRV should be detected in
RNA extractions from potato tuber peelings.
Wilson (2001) used ELISA to detect TSWV within freshly harvested infected
tubers and found no single tuber part completely reliable for TSWV detection,
although the internal core samples had a high detection rate of 75-80%, with an
erratic distribution of the virus in the cv. Russet Burbank compared to other
cultivars tested. The distribution of TSWV in this study was also not consistent.
The virus was found predominantly in the heel and core of two tubers cv. Yardin,
with no staining at the rose end. A third tuber had strong signals at the heel and
rose ends but not at the core. None of the three tubers cv. Eva were positive for
the virus, and of the three tubers tested, cv. Maxine, there was only one positive
signal at the rose end. This result is not surprising, as TSWV does not always
move through the plant to the tubers (Wilson, 2001). Four of the six tubers, cv.
Atlantic, provided by Brendan Rodoni (Victoria) tested positive by RT-PCR at
both the heel and rose ends.
In situ hybridization showed similar signals to the immunochemical staining of
the nucleocapsid antigens. Both the antisense and sense probes generated signals
in all infected sections. The nucleocapsid of the virus is encoded by the S segment
of the TSWV genome which has an ambisense arrangement (de Haan et al., 1990;
de Haan et al., 1991; Kormelink et al., 1992a) therefore the signals generated
83
from the hybridization of the sense and antisense probes were expected to be
similar.
3.4.2 Conclusion
Extraction of viral RNA directly from cores of potato tubers is problematic
because of the presence of polyphenols and their high polysaccharide content.
Discovery of PLRV virions in potato peels and phloem approximately 2 mm from
the outer epidermis of the heel and rose end of dormant potato tubers ensures that
PLRV can be detected consistently in potato peelings. This overcomes the
problem of extracting good quality RNA from potato tuber tissue as the small
amount of tissue sampled will ensure relatively low levels of inhibitors when
compared to core sampling.
The distribution of TSWV is erratic with only two of the six TSWV-infected
tubers cvs Maxine and Yardin having detectable virus presence at the rose end of
the tubers. Moreover, the progeny of the TSWV-infected tubers were not infected
which suggests poor translocation of TSWV from the tubers to the progeny
plants. None of samples from the heel, rose and core of the three tubers tested cv.
Eva were positive for TSWV infection. All four viruses were consistently
detected at the heel end of the tubers. Therefore it is recommended that when
sampling a tuber for RT-PCR for the detection of PVS, PVX, PLRV and TSWV,
sampling should occur at the heel end of the tubers using a potato peeler, ensuring
that the potato flesh is taken with the peel. These results provide critical
84
information for a knowledge-based approach for specific tissues to subsample for
RNA extraction.
85
CHAPTER 4
DEVELOPMENT OF A MULTIPLEX, QUANTITATIVE REAL-TIME
RT-PCR ASSAY FOR PVX, PVS, PLRV AND TSWV
4.1 Introduction
Worldwide, healthy seed potato production normally relies on certified seed
propagation schemes (van der Want, 1972; Stevenson et al., 2001). A component
of many such schemes is the ‘tuber indexing test’ in which cores cut from the rose
end of tubers are grown and leaf samples from the sprouts which grow are tested
for the presence of virus by ELISA e.g. de Bokx (1972). A drawback to this test is
the considerable delay which occurs while dormant tubers sprout and produce
leaves which can be sampled for testing. There is a need for a cost-effective
multiplex virus test which can be done directly on dormant tuber samples at
harvest or during storage, to ensure early identification of infected lots of seed
tubers. Extraction of viral RNA directly from potato tubers is problematic due to
their high starch content. The extraction of high quality RNA often involves
overnight precipitation (Mumford et al., 2000; Fox et al., 2005). In this chapter
the development of a high throughput, one-step, multiplex, real-time RT-PCR
assay for the detection of PLRV, PVX, PVS and TSWV directly from potato
tubers is described. This involved designing specific primers and fluorescent-
labeled TaqMan®
probes for the detection of PVS and TSWV. Primer and probe
sets for the real-time detection of PVX and PLRV were designed by Agindotan et
86
al. (2007). Efficiency and sensitivity of the assay was evaluated and the inter-
assay reproducibility was determined. The method of RNA extraction directly
from bulked tuber samples is also described. The assay was validated for leaves
and tubers in blind studies.
4.2 Materials and methods
4.2.1 Viruses, RNA extraction and evaluation of RNA quality
Tubers infected with PVX, PVS, PLRV or TSWV were obtained from naturally
infected or sap-inoculated plants of potato cvs Atlantic, Eben, Nadine, Royal
Blue, Ruby Lou and White Star. The isolates used in sap inoculations were PVX-
XK, PLRV-KK, PVS-SK and TSWV-Let.T all of which originated in south-west
Australia. PVX-XK, PLRV-KK and PVS-SK were from previous work (Wilson
and Jones, 1992, 1993b). They were maintained in potato plants by sequentially
planting infected tubers. Isolate TSWV-Let.T was maintained by serial subculture
using sap inoculation to plants of tomato cv. Grosse Lisse (provided by B.A.
Coutts). The overall physiological age range of the potato tubers varied between
freshly harvested tubers to eight months post harvest storage at 4ºC.
For single sample extractions, 100 mg of leaf or tuber tissue was ground to a
powder in liquid nitrogen using a mortar and pestle. Up to four leaves were
bulked for RNA extraction in this way. For dormant bulk tuber extractions, 250
mg or 500 mg of virus-infected tuber tissue was peeled from the heel end of
surface tissues of a known virus-infected potato tuber using a standard potato
peeler. The tubers were washed with tap water prior to peeling and each peeling
87
was up to 2 mm thick. Similar peelings from healthy tubers were then added to
provide a final weight of 50 or 75 g to simulate bulk samples of 100 or 300 tubers
respectively. The potato peelers used were discarded after each sampling to
reduce the risk of virus contamination between batches of tubers. The tissue was
then placed in a large blender (GrindoMix, Retsch, Germany) containing
extraction buffer (1 ml/g of tuber peels) consisting of 0.02 M PBS with 0.05%
Tween, 0.2% BSA and 0.5% PVP 40 (Roenhorst et al., 2005). The mix was
blended for 2 min at maximum speed and the homogenate was transferred to a 50
ml centrifuge tube and subjected to centrifugation at 5250 x g for 2 min at 22ºC.
Six hundred microlitres of the middle layer was transferred to a 2 ml
microcentrifuge tube and a MoBio (CA, USA) UltraClean Plant RNA Isolation
Kit was used for RNA extraction (Figure 4.1).
Figure 4.1. The three layers of the homogenate after centrifugation of tuber tissue.
Nucleic acid extracts were stored at -20°C. After use, the blender vessels and
knives were washed in hot soapy water alone or in hot soapy water and then
incubated in 1% sodium hypochlorite overnight, rinsed and air dried. Carry-over
Top layer
Bottom layer
Middle layer
88
of RNA from the vessels and knives was evaluated as follows: 50 ml of the
extraction buffer was placed in the blender which was run as previously described
and 600 µl of the buffer was used for RNA extraction using the UltraClean Plant
RNA Isolation kit (MoBio) and tested for the presence of virus RNA using
multiplex real-time RT-PCR.
To test the purity of the nucleic acid extracts, a NanoDrop ND-1000
spectrophotometer (NanoDrop Technologies, DE, USA) was used to measure the
absorbency of the RNA at the ratios A260/A230 and A260/A280.
4.2.2 TaqMan®
primer and probe design
The primer and probe sequences used for PVX and PLRV (Table 4.1) were those
of Agindotan et al. (2007). All the CP nucleotide sequences of PVS and TSWV
available from NCBI were aligned and highly conserved regions identified using
BioEdit version 7.0.5.3 (Hall, 1999). The TaqMan
probes were labeled with
Cy5-, FAM-, JOE- and ROX. Transcripts were synthesized and quantified for the
generation of standard curves. Primer and probe combinations were designed
using software by Integrated DNA Technologies, IA, USA (Table 4.1). The
optimum primer Tm was set at 60ºC with the Tm of Taqman®
probes set 10ºC
higher to prevent the formation of primer dimers. The amplicon length was 69-
106 base pairs. The specificity of the primers and probes was investigated using a
BLAST (NCBI, 2008) search of sequences present in GenBank. Software
(Amplify version 1.2.) was used to confirm that the primers did not amplify
sequences in the other virus genomes. Autodimer software (Vallone and Butler,
89
2004) was used to confirm that there was no complementarity at the 3’end
between the four sets of primers and no hairpin hits (score threshold 7). All
primers were synthesized by GeneWorks Pty. Ltd. (Theburton, South Australia)
and probes by Integrated DNA Technologies. The assays were set up and run on a
Corbett Rotor-Gene 3000 Rotary Analyzer (NSW, Australia).
Table 4.1 Sequences of primers and probes1
used in RT-PCR of potato viruses
Name Sequence 5’- 3’ Amplicon position Size (bp) PVX-1 for AAGCCTGAGCACAAATTCGC
PVX-1 rev GCTTCAGACGGTGGCCG 6110-6210 a 101
PVX-1 probe ROX-AATGGAGTCACCAACCCAGCTGCC-BHQ-2
PLRV-1 for AAAGCCGAAAGGTGATTAGGC
PLRV-1 rev CCTGGCTACACAGTCGCGT 5791-5859 b 69
PLRV-1 probe JOE-CTCAACGCCTGCTAGAGACCGTCGAAA-BHQ-1
PVS-1 for AAGTGGTGATCATGTGTGCAAGCG PVS-1 rev ATTGCAATGATCGAGTCCAAGGGC 7629-7734 c 106
PVS-1 probe Cy5-ACTGTGGAGTTCCCAACAGGCGCAGT-BHQ-2
TSWV-1 for AGACAGGATTGGAGCCACTGACAT
TSWV-1 rev TCCCAGTTTCCTCAACAAGCCTGA 249-348 d 80
TSWV-1 probe 6FAM-CCTTCAGAAGGCTTGATAGCTTGATCAGGG-BHQ-1
The position of the primers is based on GenBank accession numbers M3840a
AY138970 b
NC007289 c AF048714
d
1 PVX and PLRV primers and probe sets (Agindotan et al., 2007)
BHQ, black hole quencher
4.2.3 Conventional RT-PCR
Conventional RT-PCR was used to determine the annealing temperature of all
four primer sets. The one-step RT-PCR in a 25µl reaction was set up as follows:
12.5 µl JumpStart Taq Ready Mix (Sigma, NSW, Australia), 2µl MgCl2 (final
concentration 5.5 mM), 400 nM of each forward and reverse primer, 10U MuLV
reverse transcriptase (Applied Biosystems, CA, USA), DMPC-treated water and 2
µl of total RNA. The thermal cycling conditions were: 42ºC for 30 min, 95ºC for
15 min, followed by 30 cycles of 95ºC for 30 sec and 58 ºC or 60ºC for 1 min and
72ºC for 1 min.
90
4.2.4 Optimization of real-time RT-PCR
For optimization of real-time RT-PCR, the lowest concentration of primers and
probes which gave the highest normalized reporter fluorescence and the lowest
threshold cycle (Ct) was determined. The concentrations of primers and probes
used were 300, 400, 500 nM and 100, 200, 250, 300 nM, respectively. The
components for the simplex assay in a 25 µl reaction were: 12.5 µl JumpStart Taq
Ready Mix, 2 µl MgCl2 (final concentration 5.5 mM), the primer/probe
concentrations as above, 10 U MuLV reverse transcriptase, DMPC-treated water
and 2 µl of total RNA. The thermal cycler conditions were: 42ºC for 15 min, 95ºC
for 3 min, followed by 40 cycles of 95ºC for 15 s and 60ºC for 45 s. The negative
control contained total RNA from uninfected potato leaf or tuber tissue. Spiked
samples were used as internal controls. All real-time assays were done in
triplicate. The threshold for quantitation analysis was set at 0.03.
The components for the multiplex assay in a 50 µl reaction were: 25 µl JumpStart
Taq Ready Mix (Sigma), 4 µl MgCl2 (final concentration 5.5 mM), 300 nM
primers and 200 nM probe (4 sets), 20 U MuLV reverse transcriptase, DMPC-
treated water and 2 µl each of total RNA. The thermal cycler conditions were the
same as for the simplex assays. The Ct values of the simplex and multiplex assays
were compared using the same amount of total RNA from the same samples. To
visualise the products of the reaction, the real-time multiplex RT-PCR products
were run on 8% polyacrylamide gels.
91
4.2.5 In vitro RNA synthesis
A T7 promoter sequence TAA TAC GAC TCA CTA TAG GG was added to the 5’ end
of the forward primers. The PCR product was purified using the Wizard
SV Gel
and PCR Clean-up System (Promega, NSW, Australia) and quantified using a
NanoDrop spectrophotometer. Run-off transcripts were generated for use as
standards. A 20 µl reaction mixture containing 1.5 µl of each NTP (100 mM
each), 1µl Protector RNase inhibitor (Roche)), 3 µl T7 RNA polymerase (Roche),
2 µl 10x transcription buffer (Roche), 1µg purified PCR product and DMPC-
treated water, was incubated overnight at 37ºC for in vitro transcription. The
cDNA was removed by digestion with 20 U of RNase-free DNase 1 (Roche) for
15 min at 37ºC. The transcripts were precipitated with 2.5 µl of 4 M LiCl and 75
µl of pre-chilled 100% ethanol and incubated overnight at -20ºC. The tube was
subjected to centrifugation at 13,000 x g for 15 min at 4ºC. The supernatant was
discarded and the pellet washed with 50 µl ice-cold 70% ethanol. The tube was
centrifuged at 13,000 x g for 5 min at 4ºC and the supernatant discarded. The
pellet was dried under a vacuum and dissolved in 100 µl DMPC-treated water for
30 min at 37ºC. The RNA was quantified and the copy number calculated
(Fronhoffs et al., 2002). The transcripts were stored at -80ºC until required.
.
4.2.6 Standard curves and inter-assay reproducibility
To generate standard curves of the viral copy numbers and to evaluate the
sensitivity and efficiency of the assay, tenfold serial dilutions of the transcripts
were prepared in DMPC-treated water at concentrations of 8 x 1013
to 8 x 101
92
copies of PVX and PVS, and 1 x 109 to 1 x 10
2 copies of PLRV and TSWV per 2
µl volume. Simplex real-time RT-PCR was carried out using these standard
solutions to obtain standard curves to quantify virus load. The Ct threshold was
set automatically. To determine the inter-assay accuracy of real-time RT-PCR,
three samples of these solutions with copy numbers from 8 x 109, 8 x 10
7 and 8 x
105 for PVS and PVX, and 1 x 10
10, 1 x 10
8 and 1 x 10
6 for TSWV and PLRV
were tested in triplicate on different days.
4.2.7 Validation of multiplex assay
To validate RNA extraction from leaf samples, a blind study with a total of 28
samples containing 1-4 leaves, each of which were either healthy or singly
infected with PVX, PLRV, PVS or TSWV were prepared at DAFWA or at a
laboratory at the SABC at Murdoch University and forwarded for testing. The
samples were randomly pooled in eleven multiplex reactions in the following
combinations: Test 1 and 2 contained two samples each, tests 3-7 contained four
samples each and tests 8-11 contained one sample each. The health of the leaves
within each sample was unknown to the experimenter and all tests were done in
triplicate. An assay containing previously detected RNA from all four viruses was
used as an RT-PCR control. RNA extracts from healthy potato leaves and healthy
tomato leaves were used as negative controls. RNA extractions from healthy tuber
samples and from no template controls gave Ct values >30, therefore values
above 30 were considered negative.
93
To validate RNA extraction from potato tuber samples, a blind study of 8 samples
each containing 2−4 potato tubers which were either healthy or singly-infected
with PVS, PLRV or PVX were prepared in a laboratory at Murdoch University
for testing in combinations corresponding to a ratio of one infected sample in 100
healthy samples of cvs Nadine or Atlantic. Previously detected RNA from potato
tubers was used as a positive control and RNA from healthy potato tubers of
Nadine or Atlantic were used as negative controls. When Ct values of between 25
and 30 were obtained the assays were repeated. To evaluate the sensitivity of the
multiplex assay, samples from three potato tubers each singly infected with PVS,
PVX or PLRV were combined with healthy tubers to give an infection ratio of 1
in 500.
4.3 Results
4.3.1 Evaluation of RNA quality
The method used to extract RNA from potato tuber tissue yielded good quality
RNA. The A260/A230 ratio of total RNA from 50 g of potato tuber tissue which
contained either PVS or PLRV was 1.83 and 1.98 respectively, and from 75 g
containing both PVS and PLRV was 1.92. The A260/A280 ratio of total RNA from
50 g of potato tuber tissue which contained PVS or PLRV was 2.02 and 2.04
respectively and from 75 g containing both PVS and PLRV was 2.02. These
absorbency ratios were typical and indicate little or no contamination by
polyphenols and carbohydrates or by proteins. The A260/A230 and A260/A280
absorbency ratios of total RNA from 75 g of potato tuber tissue containing all four
viruses PLRV, PVX, PVS and TSWV (1:300) was 2.19 and 2.12 respectively.
94
These absorbency ratios were the average of three readings, and the infected
samples were peeled from tubers up to eight months old.
4.3.2 Optimisation of real-time RT-PCR
All four primer sets annealed at 58 ºC and 60ºC (Figure 4.2).
Figure 4.2. 3% agarose gel electrophoresis of RT-PCR products. Lane1, 100 base pair
ladder; Lane 2, water control; Lane 3, PVS 58ºC (106bp); Lane 4, PVS 60ºC; Lane 5,
PVX 58ºC (101bp); Lane 6, PVX 60ºC; Lane 7, PLRV 58ºC (69bp); Lane 8, PLRV
60ºC; Lane 9, TSWV 58ºC (80bp); Lane 10, TSWV 60ºC.
There was a clear difference in the normalized rate of fluorescence of 100 nM
probes and 200 nM probes for all four viruses, independent of the primer
concentration (Figure 4.3). Increasing the PLRV probe concentration from 100
nM to 200 nM decreased the Ct value by one (Fig 4.3 b). Negative controls
containing RNA extracted from healthy tubers and no template controls gave Ct
values >30. In a multiplex reaction, a virus present at higher concentration may
use up common reagents. Therefore, in order to avoid competition, the lowest
primer concentration was chosen. Initially, a concentration of 300 nM of primers
was combined with 200 nM for the probe. Increasing the probe concentration to
1 2 3 4 5 6 7 8 9 10
95
250 nM in combination with 300 nM primers did not reveal any increase in
normalized fluorescence or alter Ct values.
(a) PVX (b) PLRV
Cycle5 10 15 20 25 30 35 40
No
rm.
Flu
oro
.
0.6
0.4
0.2
0Threshold
Cycle5 10 15 20 25 30 35 40
Norm
. F
luoro
.
0.4
0.3
0.2
0.1
0
Threshold
(c) PVS (d) TSWV
Cycle5 10 15 20 25 30 35 40
No
rm. F
luo
ro.
0.8
0.6
0.4
0.2
0Threshold
Cycle5 10 15 20 25 30 35 40
No
rm. F
luo
ro.
0.3
0.2
0.1
0
Threshold
Figure 4.3. Optimisation of primer/probe combinations: 300, 400 and 500 nM primers
combined with 100 and 200 nM probes show that there is a clear difference in the
normalized rate of fluorescence between the 100 nM probe and 200 nM probe for all four
viruses, independent of the primer concentration.
During the generation of standard curves, however, it became apparent that the
concentration of the probes needed to be increased to 250 nM to achieve the
maximum linear range of amplification. The optimized primer/probe
concentration for quantitation was 300 nM for primers and 250 nM for probes.
For routine qualitative multiplex real-time RT-PCR each primer concentration
was 150 nM with 100 nM probe. This concentration was sufficient to detect the
viruses qualitatively. The Ct values of the multiplex assay at this concentration of
primers and probe were similar to the Ct values of the simplex assay, using the
same RNA templates (Table 4.2). All four viruses were detected simultaneously
both in leaves and potato tubers; at the ratio of 1:100 for PVX, PVS and PLRV
and 1:300 for PVX, PVS, PLRV and TSWV. The copy numbers of PVX, PVS
and PLRV in potato tuber samples in a ratio 1:100 ranged from 1x109 to 3x10
7,
200 nM
100 nM 200 nM
100 nM
200 nM
100 nM
200 nM
100 nM
96
1x1010
to 8x105
and 7x108 to 8x10
7 respectively, and in a ratio of 1:300 the copy
numbers ranged from 3x109 to 1x10
8, 4x10
8 to 1x10
6 and 3x10
8 to 3x10
7
respectively. The copy number of TSWV in a ratio of 1:300 was 2x109.
To demonstrate the products of the reaction, the real-time multiplex RT-PCR
products were run on a 3% agarose gel (Figure 4.4) and an 8% polyacrylamide gel
(PAGE, Figure 4.5) at a) 100 volts for 11 hours b) and 120 volts for16 hours. The
different sizes of the four amplified sequence products are shown (Fig. 4.5a), with
the bands of PVS and PVX separated further (Fig.4.5b).
Table 4.2 Comparison of multiplex and simplex replicate Ct values
Virus template Mean Ct values
Simplex1 Multiplex
2
PVX 16.16 (±SD 0.11) 15.77 (±SD 0.14)
PVS 16.99 (±SD 0.05) 17.21 (±SD 0.10)
PLRV 19.60 (±SD 0.09) 20.22 (±SD 0.15)
TSWV 21.47 (±SD 0.19) 21.51 (±SD 0.07)
1 300 nM primers, 200 nM probe;
2 150 nM primers, 100 nM probe.
SD Standard deviation
Low fluorescence was recorded in the Cy5- channel obtained from using PVS
primers and probes when RNA from healthy tuber tissue of cv. Atlantic was
combined within the samples (Figure 4.6). This fluorescent data was removed
when a No Template Control threshold of 2% was added to the software
parameters. The PCR products were run on an agarose gel and no bands were
detected. The fluorescence was not found with any other potato cultivars tested.
1 2 3
97
Figure 4.4 3% agarose gel electrophoresis of real-time multiplex RT-PCR products. Lane
1, 100 base pair ladder; Lane 2, real-time multiplex products, 69, 80,101,106 base pairs;
Lane 3, negative control (4 sets primers and probes, no template).
Fig.4.5 PAGE (8%) of real-time multiplex RT-PCR products. a) Lanes 1, 5, 100bp ladder
(Axygen); Lane 2 and 3, real-time RT-PCR products, 69bp (PLRV), 80bp (TSWV),
101bp (PVX), 106bp (PVS); Lane 4, healthy tuber. b) Lanes 1, 8, 100bp ladder; Lane 2
real-time RT-PCR products 106bp (PVS) and 101bp (PVX); Lanes 3 to 5, real-time
products diluted in DMPC-treated water 1 in 10, 1 in 100 and 1 in 1000 respectively;
Lane 6, healthy tuber; Lane 7, no template control.
80bp
100bp ladder
L 2 3 4 L
69bp
101bp
106bp
1 2 3 4 5 6 7 8
106bp
101bp
100bp
marker
1 2 3 4 5
106bp and
101bp
80bp and
69bp
100bp
marker
a b
1 2 3
98
Cycle5 10 15 20 25 30 35 40
Norm
. F
luoro
.
0.6
0.5
0.4
0.3
0.2
0.1
0.0 Threshold
Figure 4.6 Low fluorescent data (arrow) obtained from PVS primers and probes
using potato peelings from healthy tuber cv. Atlantic.
4.3.3 Standard curves and inter-assay reproducibility
The sensitivity of the real-time RT-PCR was determined using serial dilutions of
RNA transcripts containing 8 x 101
to 8 x 10
9 copies of PVX and PVS, and 1 x 10
2
to 1 x 1010
copies of PLRV and TSWV in triplicate. Amplification of the
transcripts showed linearity over a range of nine orders of magnitude for PVX,
PVS and PLRV and eight orders of magnitude for TSWV (Figure 4.6). All four
standard curves had a correlation coefficient R2 = 0.99. Real-time RT-PCR could
be used to detect 80 copy numbers of the target sequences of PVX (Figure 4.7a)
and PVS (Figure 4.7b), 100 copies of PLRV (Figure 4.7c) and 1000 copies of
TSWV (Figure 4.7d). It was found that increasing the concentration of the probe
to 300 nM did not increase the sensitivity of the assay for TSWV. The threshold
was set automatically. The inter-assay variability over separate days was low with
a CV of 1.7% (Table 4.3).
1:100
Healthy RNA cv.
Atlantic
Positive
control
99
Fig.4.7 Standard curves for the 10-fold serial dilution of stock solutions using 8 x 109 to
8 x 101 copies of PVX (a) and PVS (b) transcripts, and 1 x 10
10 to 1 x 10
2 copies of
PLRV (c) and TSWV (d) transcripts. Primer/probe concentration 300 nM/250 nM
respectively.
c d
a b
100
Table 4.3 Inter-assaya accuracy of real-time RT-PCR
Auto-find replicate threshold cycle of input copies of transcripts
Replicate 8 x 109 8 x 10
7 8x 10
5
PVX 1 16.04 22.90 29.60
PVX 2 15.81 22.47 29.02
Mean (± SD) 15.92 (±0.1) 22.68 (±0.2) 29.31(±0.3)
CV (%) 0.7 0.9 1.0
PVS 1 16.99 23.82 30.61
PVS 2 16.55 23.44 30.35
Mean (± SD) 16.77 (±0.2) 23.63 (±0.2) 30.48 (±0.13)
CV (%) 1.3 0.8 0.4
________________________________________________________________
Auto-find replicate threshold cycle of input copies of transcripts
Replicate 1 x 1010
1 x 108 1 x 10
6 __
PLRV 1 16.33 22.62 29.04
PLRV 2 16.82 23.28 29.49
Mean (± SD) 16.57 (±0.2) 22.95 (±0.3) 29.26 (±0.2)
CV (%) 1.5 1.4 0.8
TSWV 1 17.24 23.54 29.79
TSWV 2 17.83 24.31 30.38
Mean (± SD) 17.53(±0.3) 23.92(±0.4) 30.08(±0.3)
CV (%) 1.7 1.6 1.0
__________________________________________________________________ a The data are generated from separate assays for each virus performed on different days
4.3.4 Testing for RNA contamination
In tests to check for cross-contamination in the extraction blender, washing the
knives and vessels in hot, soapy water alone eliminated cross-contamination with
PVS and PLRV, but it did not eliminate PVX contamination; PVX was detected
with Ct value 25, PVS and PLRV Ct value >30. However, incubating the vessels
101
and knives in 1% sodium hypochlorite overnight after washing in hot soapy water
eliminated any cross-contamination of PVX.
4.3.5 Validation of multiplex assay
When leaves from ‘blind’ samples were analysed, virus detection in the different
combinations of samples was 100% accurate (Table 4.4). Analysis of the ‘blind’
potato tuber samples was also accurate, except for one result from test sample 6
(Table 4.5). In this case, PVS was detected, but not PLRV which had Ct >30.
When the test for both PVS and PLRV was repeated, the result was positive for
both viruses. When tuber tissue (250 mg) from each of three tubers which were
singly infected with PLRV, PVX or PVS was combined with 125 g of healthy
tuber tissue to a ratio of 1:500, all three viruses were detected. The real-time chart
showing PLRV detection is shown in Figure 4.8.
The one-step, multiplex real-time RT-PCR assay was validated by effectively
detecting PLRV, PVX, PVS and TSWV simultaneously directly from bulked
subsamples of dormant potato tubers using four sets of primers and dual-labeled
probes.
Fig.4.8 Normalized fluorescence in a multiplex reaction showing detection of PLRV in
three triplicate samples. Positive control with Ct value 16; 250 mg from an infected tuber
combined in 75 g of healthy tuber tissue to 1:300 with Ct value 21; 250 mg of infected
tuber in 125 g of healthy tuber tissue to 1:500 with Ct value 22.5; healthy tuber tissue
used to dilute samples and known negative control, Ct values >30;
Cycle5 10 15 20 25 30 35 40
Norm
. F
luoro
.
0.5
0.4
0.3
0.2
0.1
0 Threshold
Positive
control 1:300
1:500
Negative
controls
102
Table 4.4 Results of real-time multiplex RT-PCR analysis of blind studies to detect
viruses in leaves1
Test Cv. (Total no. leaves/sample) Known virus infection Virus detected (Ct values)
1 Atlantic (2); Atlantic (3) Neg; Neg. (>30)
2 Atlantic (2); Nadine, nk (2) Neg; PLRV,PVX. PLRV (17) PVX (13)
3 Atlantic (2); Nadine, nk (2); Neg; PLRV, PVX;
Atlantic (2); Atlantic (3) Neg; Neg. PLRV (17) PVX (12)
4 Ruby Lou (1); Atlantic (1); PVS; Neg;
Ruby Lou (1); nk (1) PVS; PVX. PVS (16) PVX (11)
5 Nadine (1); Nadine (1); PLRV; PLRV;
Atlantic (1); Ruby Lou (1) PLRV; Neg. PLRV (14)
6 Atlantic (1); Nadine (1); PLRV; PLRV
Ruby Lou (1); Atlantic (1) PVS, Neg. PLRV (16) PVS (22)
7 Ruby Lou (1); Nadine (1); PVS; PLRV;
Nk (1); Atlantic (1). PVX; Neg. PVS (23), PLRV (18) PVX (13)
8 Grosse Lisse (4). Neg. (>30)
9 Ruby Lou, Nadine, PVS, PLRV,
Grosse Lisse, Eben (4) TSWV, PVX. PVS (14) PLRV (11) TSWV (10) PVX (12)
10 Eben, Atlantic, PVX, PLRV,
Grosse Lisse, Ruby Lou (4) TSWV, PVS PVX (12) PLRV (13) TSWV (14) PVS (15)
11 Grosse Lisse, Eben, Neg, PVX,
Grosse Lisse, Ruby Lou (4) TSWV, PVS PVX (12) TSWV (11) PVS (15)
Cv: Cultivar, Neg.: Negative, Nk: Not known 1 All leaves were from potato except those from the tomato plant cv. Grosse Lisse.
103
Table 4.5 Results of real-time multiplex RT-PCR analysis of blind studies to detect
viruses in potato tubers1
Test Cultivar Status Known virus infection Ct value
1 Nadine freshly harvested PLRV 20
Eben dormant PVX 15
Ruby Lou dormant healthy
Atlantic dormant PVS 23
2 Atlantic dormant PVS 23
Eben sprouting PVS 23
Ruby Lou dormant healthy
3 Ruby Lou sprouting PVS 19
Atlantic dormant PLRV 20
Eben dormant PVX 18
4 Ruby Lou sprouting PVS 17
Eben dormant PVX 16
5 Nadine dormant PVS 15
Ruby Lou dormant healthy
Ruby Lou dormant healthy
Ruby Lou dormant healthy
6 Ruby Lou sprouting PVS 17
Nadine freshly harvested PLRV >30; repeat 18
7 Eben dormant PVX 14
Nadine dormant PVS 12
8 Nadine freshly harvested PLRV 19
Ruby Lou dormant healthy
Nadine dormant PVS 15
1
Combined with healthy Nadine or Atlantic healthy tuber tissue to a ratio of 1:100
4.4 Discussion
Agindotan et al., (2007) developed a two-step multiplex real-time RT-PCR test to
detect PLRV, PVX, PVA and PVY. Using PVX and PLRV primers and probes
designed by them, a one-step RT-PCR assay has been developed that saves time
and is more economical and has less potential for contamination and pipetting
errors than two-step reactions. To evaluate the accuracy and efficiency of the
assay, standard curves of the viral copy numbers were generated for each virus.
The correlation coefficient obtained, R2
= 0.99, indicates a high degree of
accuracy. The inter-assay accuracy was subsequently determined by testing three
104
samples of known copy numbers on different days. The assay was highly
reproducible with a CV of 1.7%. The mean replicate Ct values of the simplex and
multiplex assays were similar, and this allows the use of the standard curves to
quantitate viral copy numbers for both assays.
The RNA extraction method detected PLRV, PVX, PVS and TSWV infection
directly in bulked samples of 300 dormant tuber peelings. The extraction of high
quality RNA from potato tubers often involves overnight precipitation (Mumford
et al., 2000; Fox et al., (2005). In this study, the time taken to extract RNA from
dormant potato tubers is reduced considerably. The absorbency ratios of A260/A230
of >1.80 and A260/A280 >2.00 indicate that total RNA of high integrity has been
successfully extracted from up to 75 g of tuber tissue. In addition, detection of
PLRV-infected tuber tissue diluted in 125 g of healthy tuber tissue, in a ratio of
1:500, shows the high sensitivity of the assay. The age of the tubers sampled
appeared to have no effect on the quality of RNA extracted. Internal controls
included spiked tuber extractions. This is time-consuming and not suitable for
high-throughput testing. Therefore, to confirm that nucleic acid has been extracted
efficiently, use of an internal control such as Cox primers and a fluorescent-
labelled TaqMan®
probe (Lopez et al., 2006) would be more suitable (Roenhorst
et al., 2005).
The multiplex reaction was validated successfully in ‘blind’ studies. The only
exception was that PLRV was not detected in one of the tuber samples. However,
it was subsequently detected when the test was repeated. In this case, the tuber,
cv. Nadine, was freshly harvested from the soil. Possibly, the peelings did not
105
contain sufficient flesh during initial testing because the skin was easily removed.
Unfortunately TSWV-infected potato plants were unavailable for the blind studies
and so only tubers containing PVX, PVS and PLRV were used, while TSWV-
infected leaf samples were from tomato plants.
Low fluorescence was recorded when RNA extracted from healthy tubers of cv.
Atlantic were combined in the samples. This was not obtained from any other
potato cultivars, and the fluorescence showed a marked difference to the
exponential curves obtained from positive RNA samples. To ensure that the
fluorescence obtained is not interpreted as a positive result, a 2% no template
control threshold should be added to the software parameters.
Washing of the grinder vessels and knives in hot, soapy water eliminated PVS and
PLRV but did not eliminate PVX. This could be due to the high titre sand
stability of PVX. Roenhorst et al., (2005) found that incubating surfaces
contaminated with PSTVd with 1% sodium hypochlorite removed the viroid.
Here, disinfectant and treatment with 1% sodium hypochlorite eliminated cross-
contamination of PVX in between bulk sampling. The problem this may cause for
higher throughput assays can be overcome by utilising additional vessels and
knives. PVS and PLRV were removed by washing the vessels and knives in hot
soapy water. Virus contamination of the disposable plastic peelers was not an
issue as they were discarded after one use.
106
CHAPTER 5
GENERAL DISCUSSION
5.1 Conclusion
The overall aims of the work undertaken in this thesis were to develop a reliable
and sensitive assay to detect major potato viruses directly from potato tubers. This
required knowledge of the distribution of the viruses in tuber tissue, development
of a reliable method of extraction of viral RNAs from bulked tuber tissues, and
development of a multiplex quantitative RT-PCR assay. All these aspects were
achieved successfully, and the assay is now being established as a commercial test
for the detection of plant viruses in potato tubers in Australia.
A real time RT-PCR method was developed which was used to detect four potato
viruses simultaneously in leaves of potato (PLRV, PVX, PVS) or tomato
(TSWV), and four viruses (PLRV, PVX, PVS and TSWV) simultaneously and
quantitatively in potato tubers in a single reaction. This real-time method is more
sensitive than conventional RT-PCR and enabled the pooling of larger numbers of
potatoes into the one sample.
This test involved an efficient and rapid method to extract representative tissue
samples from bulked tubers. The RNA extraction method developed was effective
when used to test bulked tuber samples directly. It enabled detection of PLRV,
PVX, PVS and TSWV infection directly in the equivalent of 300 dormant tubers
which contained a single tuber infected with each virus, and was reliable and
suitable for high throughput testing of bulk tuber samples.
107
Extraction of virus RNA directly in cores from potato tubers is problematic
because of the presence of polyphenols and their high polysaccharide content.
Immunochemistry and in situ hybridization was used to determine the cellular
distribution of the four viruses within tuber tissue. All four viruses were detected
at the heel end of the infected dormant tubers except for one tuber, cv. Maxine,
which was tested 3 months post harvest; TSWV was found to be located at the
rose end of that tuber only. Discovery of phloem approximately 2 mm from the
outer epidermis of the heel and rose end of potato tubers ensures that PLRV can
be detected consistently in potato peelings. This overcomes the problem of
extracting good quality RNA from potato tuber tissue.
Fox et al. (2005) detected PVY in a bulked sample of ten tubers consisting of one
PVY-infected tuber sample using real-time RT-PCR testing. In this multiplex
study tubers singly infected with PLRV, PVX, PVS and TSWV were detected
reliably in bulked samples of the equivalent of 300 tubers. In addition, three
viruses were detected simultaneously in tuber tissue which was infected with
PLRV, PVX and PVS, when combined with healthy tuber tissue to a ratio of
1:500. Validation studies with potato leaves and tubers showed that this real-time
RT-PCR multiplex assay is sensitive, accurate and reliable.
The multiplex RT-PCR assay developed here may not take the place of routine
testing of leaf samples from growing crops by ELISA where testing by ELISA
has long been established. However, it provides an important cost-effective tool
which can replace tuber-indexing tests by ELISA on potato sprouts. Virus copy
numbers can be expected to vary widely depending on whether the tuber was a
108
primary or secondary infection. Further work needs to be done on the range of
virus copy numbers that can be detected for each of the four viruses in infected
tubers in order to estimate low, medium or high infection, as high levels of
infection are more of a concern.
Although PLRV is known to be restricted to the phloem in potato tubers, it was
found to be distributed in the parenchyma of the one small tuber harvested from
cv. White Star. It has been shown that PLRV can move out of the vascular tissue
into other leaf cells when co-infected with another virus (Barker, 1987a). It is
therefore possible that this tuber was co-infected. Further study needs to done on
the movement of PLRV in potato tubers co-infected with other viruses. This test
was validated for sensitive detection of PLRV, PVX, PVS and TSWV. The
inclusion of other important potato pathogens, e.g. PVA and PVY, to this real-
time multiplex RT-PCR assay also warrants further study.
5.2 Delivery of the virus test to the potato industry
This project was jointly sponsored by DAFWA and the Potato Growers
Association of WA in order to improve virus testing of potato tubers in the State
and to help promote export of seed potatoes. The ultimate test would be to
determine the percentage level of virus infection in bulked tuber samples so that
phytosanitary import requirements of importing countries could be met before
ships were loaded with export seed potato consignments. The allowable
percentage of virus presence varies with the importing country, for example the
tolerance level for PVY and PLRV infection for importation into Thailand is 4%
109
(Biosecurity New Zealand, 2009). Therefore, if the test shows a positive result
for one or more viruses, the actual percentage of infection in bulk samples would
need to be measured. The assay described in the study can be used to detect one
virus-infected sample in 300 tubers. One way of estimating the level of infection
is for the farmer to send two separate peel samples in zip-lock bags (or
equivalent); one containing 300 subsamples and another containing 10 bags of 30
subsamples. If there were a positive result from the first (300) test, then the 10
lots of subsamples would need to be tested. With respect to estimating virus
levels, this could be done by less bulking but would involve more work. The
advantage of this assay is that it reduces work; if the samples are negative for
virus infection then this test is useful. If the samples are positive the batches have
to be broken down to determine the source of infection.
The direct tuber test described in this study can save many weeks in comparison
with the ‘growing on’ test, however when percentage of infection is required, it is
most useful if the consignment of potato tubers is healthy. It is currently being
established commercially for large-scale virus detection in bulked tuber samples,
both for production of healthy seed tubers for local planting and for quality
control of seed tubers prior to export or after storage. The commercial application
of this assay is being developed by the agricultural diagnostics company Saturn
Biotech, with methods of supplying tuber peel samples from across Australia,
their stability and avoidance of contamination being assessed. It is probable that
the test will become commercially available to growers in a relatively short
period. This will ensure that the final aims of the work undertaken are
110
successfully implemented to the benefit of the potato industry in WA and
Australia.
111
REFERENCES
Agindotan, B. O., Perry, K. L., 2007. Macroarray detection of plant RNA viruses using
randomly primed and amplified complementary DNAs from infected plants.
Phytopathology 97, 119-127.
Agindotan, B. O., Perry, K. L., 2008. Macroarray detection of eleven potato-infecting
viruses. Plant Disease 92, 730-740.
Agindotan, B. O., Shiel, P. J., Berger, P. H., 2007. Simultaneous detection of potato
viruses, PLRV, PVS, PVX and PVY from dormant potato tubers by TaqMan real-
time RT-PCR. Journal of Virological Methods 142, 1-9.
Alfieri, S. A., Stouffer, R. F., 1957. Evidence of immunity from virus S in the potato
variety Saco. Abstract. Phytopathology 47, 1.
Angell, S. M., Baulcombe, D. C., 1995. Cell-to-cell movement of Potato virus X revealed
by micro-injection of a viral vector tagged with the Β-glucuronidase gene. The
Plant Journal 7, 135-140.
Australian Bureau of Statistics, 2008. Year Book Australia, 2008
www.abs.gov.au/Ausstats
Bagnall, R. H., Young, D. A., 1972. Resistance to virus S in the potato. American Potato
Journal 49, 196-201.
Barker, H., 1987a. Invasion of non-phloem tissue in Nicotiana clevelandii by Potato
leafroll luteovirus is enhanced in plants also infected with Potato Y potyvirus.
Journal of General Virology 68, 1223-1227.
Barker, H., 1987b. Multiple components of the resistance of potatoes to Potato leafroll
virus. Annals of Applied Biology 111, 641-648.
Barker, H., Harrison, B. D., 1985. Restricted multiplication of Potato leafroll virus in
resistant potato genotypes. Annals of Applied Biology 107, 205-212.
Barker, H., Harrison, B. D., 1986. Restricted distribution of Potato leafroll virus antigen
in resistant potato genotypes and its effect on transmission of the virus by aphids.
Annals of Applied Biology 109, 595-604.
Barker, H., Solomon, R. M., 1990. Evidence of simple genetic control in potato of ability
to restrict Potato leafroll virus concentration in leaves. Theoretical and Applied
Genetics 80, 188-192.
Barker, H., Solomon-Blackburn, R. M., McNicol, J. W., Bradshaw, J. E., 1994.
Resistance to Potato leafroll virus multiplication in potato is under major gene
control. Theoretical and Applied Genetics 88, 754-758.
Baulcombe, D. C., 1999. Fast forward genetics based on virus-induced gene silencing.
Current Opinion Plant Biology 2, 109-113.
Bayne, E. H., Rakitina, D. V., Morozov, S. Y., Baulcombe, D. C., 2005. Cell-to-cell
movement of Potato potexvirus X is dependent on suppression of RNA silencing.
The Plant Journal 44, 471-482.
Beemster, A. B. R., 1972. Virus translocation in potato plants and mature-plant
resistance, In: Viruses of potatoes and seed-potato production. de Bokx, J. A.,
(Ed.). Pudoc, Wageningen. pp. 144-151.
112
Beemster, A. B. R., Rozendaal, A., 1972. Potato viruses: properties and symptoms, In:
Viruses of potatoes and seed potato production. de Bokx, J. A., (Ed.). Pudoc,
Wageningen. pp. 115-143.
Biosecurity New Zealand, 2009. Tolerance level for PVY and PLRV infection in potato
tubers www.biosecurity.govt.nz/exports/plants/icpr-standards.htm
Blackman, L. M., Boevink, P., Cruz, S. S., Palukaitis, P., Oparka, K. J., 1998. The
movement protein of Cucumber mosaic virus traffics into sieve elements in minor
veins of Nicotiana clevelandii. Plant Cell 10, 525-538.
Boonham, N., Glover, R., Tomlinson, J., Mumford, R. A., 2008. Exploiting generic
platform technologies for the detection and identification of plant pathogens.
European Journal of Plant Pathology 121, 355-363.
Boonham, N., Perez, L. G., Mendez, M. S., Peralta, E. L., Blockly, A., Walsh, K., Barker,
I., Mumford, R. A., 2004. Development of a real-time RT-PCR assay for the
detection of Potato spindle tuber viroid. Journal of Virological Methods 116, 139-
146.
Carrington, J. C., Kasschau, K. D., Mahajan, S. K., Schaad, M. C., 1996. Cell-to-cell and
long-distance transport of viruses in plants. Plant Cell 8, 1669-1681.
Clark, M. F., Adams, A. N., 1977. Characteristics of the microplate method of enzyme-
linked immunosorbent assay for the detection of plant viruses. Journal of General
Virology 34, 475-483.
Cockerham, G., 1945. Some genetical aspects of resistance to potato virus. Abstract.
Annals of Applied Biology 32, 279-281.
Cockerham, G., 1970. Genetical studies on resistance to potato viruses X and Y.
Abstract. Heredity 25, 309-348.
Colavita, M. L., Massa, G. A., Feingold, S., 2007. In search of recombinant PVY strains.
In The 13th European Association for Potato Research Virology Section Meeting.
EAPR, Aviemore, Scotland.
Cruz, S. S., Roberts, A. G., Prior, D. A. M., Chapman, S., Oparka, K. J., 1998. Cell-to-
cell and phloem-mediated transport of Potato virus X: the role of virions. Plant
Cell 10, 495-510.
Danks, C., Barker, I., 2000. On-site detection of plant pathogens using lateral-flow
devices. Bulletin OEPP 30, 421-426.
Davidson, T., 1973. Assessing resistance to leafroll in potato seedlings. Potato Research
16, 99-108.
de Bokx, J. A., 1972a. Graft and mechanical transmission, In: Viruses of potatoes and
seed-potato production. de Bokx, J. A., (Ed.). Pudoc, Wageningen. pp. 26-35.
de Bokx, J. A., (Ed), 1972b. Viruses of potatoes and seed-potato production. Pudoc,
Wageningen, The Netherlands.
de Bokx, J. A., Piron, P. G. M., Cother, E., 1980a. Enzyme-linked immunosorbent assay
for the detection of potato viruses S and M in potato tubers. European Journal of
Plant Pathology 86, 285-290.
de Bokx, J. A., Piron, P. G. M., Maat, D. Z., 1980b. Detection of Potato virus X in tubers
with the enzyme-linked immunosorbent assay (ELISA). Potato Research 23, 129-
131.
113
de Haan, P., Kormelink, R., Resende, R., De, O., Van Poelwijk, F., Peters, D., Goldbach,
R., 1991. Tomato spotted wilt virus L RNA encodes a putative RNA polymerase.
Journal of General Virology 72, 2207-2216.
de Haan, P., Wagemakers, L., Peters, D., Goldbach, R., 1990. The S RNA segment of
Tomato spotted wilt virus has an ambisense character. Journal of General
Virology 71, 1001-1007.
de Jong, W., Forsyth, A., Leister, D., Gebhardt, C., Baulcombe, D. C., 1997. A potato
hypersensitive resistance gene against Potato virus X maps to a resistance gene
cluster on chromosome V. Theoretical and Applied Genetics 95, 246-252.
DeBlock, M., Debrouwer, D., 2002. RNA-RNA in situ hybridization using DIG-labeled
probes: the effect of high molecular weight polyvinyl alcohol on the alkaline
phosphatase indoxyl-nitroblue tetrazolium reaction. In:, Procedures for in situ
hybridization to chromosomes, cells and tissue sections 172-176
Deom, C. M., Lapidot, M., Beachy, R. N., 1992. Plant virus movement proteins. Cell 69,
221-224.
Department of Primary Industries and Water, 2006. Weeds, Pests and Diseases
www.dpiw.tas.gov.au
Derrick, P. M., Barker, H., 1992. The restricted distribution of potato leafroll luteovirus
antigen in potato plants with transgenic resistance resembles that in clones with
one type of host gene mediated resistance. Abstract. Annals of Applied Biology
120, 451-457.
Dietzgen, R. G., Twin, J., Talty, J., Selladurai, S., Carroll, M. L., Coutts, B. A.,
Berryman, D. I., Jones, R. A. C., 2005. Genetic variability of Tomato spotted wilt
virus in Australia and validation of real time RT-PCR for its detection in single
and bulked leaf samples. Annals of Applied Biology 146, 517.
Dolby, C. A., Jones, R. A. C., 1987. Occurrence of the Andean strain of Potato virus S in
imported potato material and its effects on potato cultivars. Plant Pathology 36,
381-388.
Du, Z., Jin, B., Liu, W., Chen, L., Chen, J., 2007. Highly sensitive fluorescent-labeled
probes and glass slide hybridization for the detection of plant RNA viruses and a
viroid. Acta Biochimica et Biophysica Sinica 39, 326-334.
Ehrenfeld, N., Romano, E., Serrano, C., Arce-Johnson, P., 2004. Replicase mediated
resistance against Potato leafroll virus in potato Desirée plants. Biological
Research 37, 71-82.
Epel, 1994. Plasmodesmata: composition, structure and trafficking. Plant Molecular
Biology 26, 1343-1356.
Espelie, K. E., Franceschi, V. R., Kolattukudy, P. E., 1986. Immunocytochemical
localization and time course of appearance of an anionic peroxidase associated
with suberization in wound-healing potato tuber tissue. Plant Physiology 81, 487-
492.
Farnham, G., Baulcombe, D. C., 2006. Artificial evolution extends the spectrum of
viruses that are targeted by a disease-resistance gene from potato. Proceedings of
the National Academy of Science USA 103, 18828-18833.
Farquharson, M., Harvie, R., McNicol, A. M., 1990. Detection of messenger RNA using
a digoxigenin end-labelled oligonucleotide probe. Journal of Clinical Pathology
43, 423-428.
114
Fox, A., Evans, F., Browning, I., 2005. Direct tuber testing for potato Y potyvirus by
real-time RT-PCR and ELISA: Reliable options for post-harvest testing? Bulletin
OEPP 35, 93-97.
Franco-Lara, L. F., McGeachy, K. D., Commandeur, U., Martin, R. R., Mayo, M. A.,
Barker, H., 1999. Transformation of tobacco and potato with cDNA encoding the
full-length genome of Potato leafroll virus: evidence for a novel virus distribution
and host effects on virus multiplication. Journal of General Virology 80, 2813-
2822.
Fronhoffs, S., Totzke, G., Stier, S., Wernert, N., Rothe, M., Bruning, T., Koch, B.,
Sachinidis, A., Vetter, H., Ko, Y., 2002. A method for the rapid construction of
cRNA standard curves in quantitative real-time reverse transcription polymerase
chain reaction. Molecular and Cellular Probes 16, 99-110.
Gugerli, P., 1980. Potato leafroll virus concentration in the vascular region of potato
tubers examined by enzyme-linked immunosorbent assay (ELISA). Potato
Research 23, 137-141.
Gugerli, P., Gehriger, W., 1980. Enzyme-linked immunosorbent assay (ELISA) for the
detection of Potato leafroll virus and Potato virus Y in potato tubers after artificial
break of dormancy. Potato Research 23, 353-359.
Hall, T., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium 41, 95-98.
Hawkes, J. G., 1978a. Biosystematics of the potato, In: The potato crop. Roberts, E. H.,
(Ed.). Chapman & Hall, London. pp. 15-68.
Hawkes, J. G., 1978b. History of the potato, In: The potato crop. Harris, P. M., (Ed.).
Chapman & Hall, London. pp. 1-13.
Hemenway, C., Fang, R.-X., Kaniewski, W. K., Chua, N.-H., Turner, N. E., 1988.
Analysis of the mechanism of protection in transgenic plants expressing the
Potato virus X protein or its antisense RNA. European Molecular Biology
Organization 7, 1273-1280.
Hill, S. A., Jackson, E. A., 1984. An investigation of the reliability of ELISA as a
practical test for detecting Potato leaf roll virus and Potato virus Y in tubers. Plant
Pathology 33, 21-26.
Holland, M. B. 2006. Shipment of potato tubers. Personal communication. AgWest Plant
Laboratories, Department of Agriculture and Food, WA
Holland, M. B., Jones, R. A. C., 2005. Benefits of virus testing in seed schemes, In:
Proceedings of Potato 2005 - Australian National Potato Conference. Pitt, A. J.
and Donald, C., (Ed.). Cowes, Victoria, Australia. pp. 81-87.
Holland, M. B., Jones, R. A. C., 2006. In Benefits of virus testing in seed schemes.
Department of Agriculture, WA,
Holland, P. M., Abramson, R. D., Watson, R., Gelfand, D. H., 1991. Detection of specific
polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of
Thermus aquaticus DNA polymerase. Proceedings of the National Academy of
Science USA 88, 7276-7280.
Hopp, H. E., Hain, L., Bravo Almonacid, F., Tozzini, A. C., Orman, B., Arese, A. I.,
Ceriani, M. F., Saladrigas, M. V., Celnik, R., del Vas, M., 1991. Development and
application of a nonradioactive nucleic acid hybridization system for
115
simultaneous detection of four potato pathogens. Abstract. Journal of Virological
Methods 3, 11-29.
Howard, H. W., 1978. The production of new varieties, In: The potato crop. Harris, P.
M., (Ed.). Chapman & Hall, London. pp. 607-645.
Huamán, Z., 1986. Systematic botany and morphology of the potato. 2nd edition, revised,
International Potato Center, Lima, Peru. pp. 22.
Huamán, Z., Ross, R. W., 1985. Updated listing of potato species names, abbreviations
and taxonomic status. American Potato Journal 62, 629-641.
Hull, R., 2002. Matthews' Plant Virology. 4th Edition, Academic Press, Sydney.
Hutton, E. M., Brock, R. D., 1953. Reactions and field resistance of some potato varieties
and hybrids to the Potato leafroll virus. Abstract. Australian Journal of
Agricultural Research 4, 256-263.
Itaya, A., Zhong, X., Bundschuh, R., Qi, Y., Wang, Y., Takeda, R., Harris, A. R., Molina,
C., Nelson, R. S., Ding, B., 2007. A structured viroid RNA serves as a substrate
for dicer-like cleavage to produce biologically active small RNAs but is resistant
to RNA-induced silencing complex-mediated degradation. Journal of Virology
81, 2980-2994.
Jackson, D., 1992. In situ hybridization in plants, In: Molecular Plant Pathology. Gun, S.
J., McPherson, M. J. and Bowles, D. J., (Ed.). IRL Press at Oxford University
Press, Oxford. pp. 163-174.
Jakobsen, K. S., Breivold, E., Hornes, E., 1990. Purification of mRNA directly from
crude plant tissues in 15 minutes using magnetic oligo dT microspheres. Nucleic
Acids Research 18, 3669.
Jefferson, R., Goldsbrough, A., Bevan, M., 1990. Transcriptional regulation of a patatin-
1 gene in potato.
Jékely, G., Arendt, D., 2007. Cellular resolution expression profiling using confocal
detection of NBT/BCIP precipitate by reflection microscopy. BioTechniques 42,
751-755.
John, H. A., Birnstiel, M. L., Jones, K. W., 1969. RNA-DNA hybrids at the cytological
level. Nature 223, 582-587.
Jones, R. A. C., 1979. Resistance to Potato leafroll virus in Solanum brevidens. Potato
Research 22, 149-152.
Jones, R. A. C., 1981. The ecology of viruses infecting wild and cultivated potatoes in the
Andean region of South America, In: Pests, Pathogens and Vegetation. Thresh, J.
M., (Ed.). Pitman, London. pp. 89-107.
Jones, R. A. C., 1982. Breakdown of Potato virus X resistance gene Nx: Selection of a
group four strain from strain group three. Plant Pathology 31, 325-331.
Jones, R. A. C., 1985. Further studies on resistance-breaking strains of Potato virus X.
Plant Pathology 34, 182-189.
Jones, R. A. C., 1987. Problems associated with potyvirus in potato certification - field
inspection and serological testing, Bulletin OEPP 17: 61-67
Jones, R. A. C., 2006. Control of plant virus diseases. Advances in Virus Research 67,
205-244.
Ju, H. J., Brown, J. E., Ye, C. M., Verchot-Lubicz, J., 2007. Mutations in the central
domain of Potato virus X TGBp2 eliminate granular vesicles and virus cell-to-cell
trafficking. Journal of Virology 81, 1899-1911.
116
Kaplan, I. B., Ripoll, D. R., Palukaitis, P., F, G., Gray, S. M., 2007. Point mutations in
the Potato leafroll virus major capsid protein alter virion stability and aphid
transmission. Journal of General Virology 88, 1821-1830.
Kawchuk, L. M., Martin, R. R., McPherson, J., 1991. Sense and antisense RNA-mediated
resistance to Potato leafroll virus in Russet Burbank potato plants. Molecular
Plant Microbe Interactions 4, 247-253.
Kikkert, J. R., Vidal, J. R., Reisch, B. I., 2004. In Transgenic Plants: Methods and
Protocols, pp. 61-78.
Kim, W. T., Franceschi, V. R., Okita, T. W., Robinson, N. L., Morell, M., Preiss, J.,
1989. Immunocytochemical localization of ADPglucose pyrophosphorylase in
developing potato tuber cells. Plant Physiology 91, 217-220.
Klein, T. M., Wolf, E. D., Wu, R., Sanford, J. C., 1987. High-velocity microprojectiles
for delivering nucleic acids into living cells. Nature 327, 70-73.
Klerks, M. M., Leone, G. O. M., Verbeek, M., van den Heuvel, J. F. J. M., Schoen, C. D.,
2001. Development of a multiplex AmpliDet RNA for the simultaneous detection
of Potato leafroll virus and Potato virus Y in potato tubers. Journal of Virological
Methods 93, 115-125.
Kobayashi, K., Cabral, S., Calamante, G., Maldonado, S., Mentaberry, A., 2001.
Transgenic tobacco plants expressing the Potato virus X open reading frame 3
gene develop specific resistance and necrotic ring symptoms after infection with
the homologous virus. Molecular Plant Microbe Interactions 14, 1274-1285.
Kojima, M., Shikata, E., Sugawara, M., Murayama, D., 1969. Purification and electron
microscopy of Potato leafroll virus. Virology 39, 162-174.
Kormelink, R., de Haan, P., Meurs, C., Peters, D., Goldbach, R., 1992a. The nucleotide
sequence of the M RNA segment of Tomato spotted wilt virus, a bunyavirus with
two ambisense RNA segments. Journal of General Virology 73, 2795-2804.
Kormelink, R., Storms, M. M. H., Van Lent, J. W. M., Peters, D., Goldbach, R., 1994.
Expression and subcellular location of the NSm protein of Tomato spotted wilt
virus (TSWV), a putative viral movement protein. Virology 200, 56-65.
Kormelink, R., Van Poelwijk, F., Peters, D., Goldbach, R., 1992b. Non-viral
heterogeneous sequences at the 5' ends of Tomato spotted wilt virus mRNAs.
Journal of General Virology 73, 2125-2128.
Kostiw, M., 1975. Transmission of Potato virus S by Aphis nasturtii Kalt. Potato
Research 18, 641-643.
Kumar, S., Tamura, K., Nei, M., 2004. MEGA 3: Integrated software for molecular
evolutionary genetics analysis and sequence alignment. Briefings in
Bioinformatics 5, 150-163.
Latham, L. J., Jones, R. A. C., 1997. Occurrence of Tomato spotted wilt tospovirus in
native flora, weeds and horticultural crops. Australian Journal of Agricultural
Research 48, 359-369.
Li, X., Halpin, C., Ryan, M. D., 2007. A novel cleavage site within the Potato leafroll
virus P1 polyprotein. Journal of General Virology 88, 1620-1623.
Lopez, R., Asensio, C., Guzman, M. M., Boonham, N., 2006. Development of real-time
and conventional RT-PCR assays for the detection of Potato yellow vein virus
(PYVV). Journal of Virological Methods 136, 24-29.
117
López-Delgado, H., Mora-Herrera, M., Zavaleta-Mancera, H., Cadena-Hinojosa, M.,
Scott, I., 2004. Salicylic acid enhances heat tolerance and Potato virus X (PVX)
elimination during thermotherapy of potato microplants. American Journal of
Potato Research 81, 171-176.
Lucas, W. J., Wolf, S., 1999. Connections between virus movement, macromolecular
signaling and assimilate allocation. Current Opinion Plant Biology 2, 192-197.
Makarov, P. P., 1975. Inheritance of resistance to Potato virus S. Potato Research 18,
326-329.
Mandahar, C. L., 2006. Multiplication of RNA plant viruses. Springer, Dordrecht, The
Netherlands. pp. 196.
Mansoor, S., Amin, I., Hussain, M., Zafar, Y., Briddon, R. W., 2006. Engineering novel
traits in plants through RNA interference. Trends in Plant Science 11, 559-565.
Marano, M. R., Malcuit, I., De Jong, W., Baulcombe, D. C., 2002. High-resolution
genetic map of Nb, a gene that confers hypersensitive resistance to Potato virus X
in Solanum tuberosum. Theoretical and Applied Genetics 105, 192-200.
Marczewski, W., Flis, B., Syller, J., Schäfer-Pregl, R., Gebhardt, C., 2001. A major
quantitative trait locus for resistance to Potato leafroll virus is located in a
resistance hotspot on potato chromosome XI and is tightly linked to N-gene-like
markers. Molecular Plant Microbe Interactions 14, 1420-1425.
Marczewski, W., Hennig, J., Gebhardt, C., 2002. The Potato virus S resistance gene Ns
maps to potato chromosome VIII. Theoretical and Applied Genetics 105, 564-
567.
Matthews, R. E. F., 1970. Plant Virology. Academic Press Inc., London.
McKay, R., Clinch, P. E. M., 1951. Observations on the inheritance of field resistance to
leaf roll of potatoes (Shamrock x Skerry Champion). Scientific Proceedings of the
Royal Society, Dublin 25, 225-233.
Miller, W. A., Koev, G., 2000. Synthesis of subgenomic RNAs by positive-strand RNA
viruses. Virology 273, 1-8.
Miller, W. A., White, A., 2006. Long-distance RNA-RNA interactions in plant virus gene
expression and replication. Annual Review of Phytopathology 44, 447-467.
Moran, J., Jones, R. A. C., Tesoriero, L., 1994. Tomato spotted wilt virus in potatoes,
Potato Australia 5: 12-13
Moreira, A., Jones, R. A. C., 1980. Properties of a resistance-breaking strain of Potato
virus X. Annals of Applied Biology 95, 93-103.
Mullis, K. B., 1987. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain
reaction. Methods in Enzymology 155, 335-350.
Mumford, R. A., Boonham, N., Tomlinson, J., Barker, I., 2006. Advances in molecular
phytodiagnostics - new solutions for old problems. European Journal of Plant
Pathology 116, 1-19.
Mumford, R. A., Walsh, K., Barker, I., Boonham, N., 2000. Detection of Potato mop-top
virus and Tobacco rattle virus using a multiplex real-time fluorescent reverse-
transcription polymerase chain reaction assay. Phytopathology 90, 448-453.
Nadar, E.-B., Safwat, E.-H., Elphinstone, J., 2009. Evaluation of a prototype lateral flow
device: Serological test kit for rapid detection of potato ring rot disease, In:
Current research topics in applied microbiology and microbial biotechnology:
Proceedings of the 11 International Conference on Environmental, Industrial and
118
Applied Microbiology. Mendez-Vilas, A., (Ed.). World Scientific, Hackensack,
USA. pp. 545-551.
NCBI, 2008. blast.ncbi.nlm.nih.gov
Nickel, H., Kawchuk, L., Twyman, R., Zimmermann, S., Junghans, H., Winter, S.,
Fischer, R., Prufer, D., 2008. Plantibody-mediated inhibition of the Potato leafroll
virus P1 protein reduces virus accumulation. Virus Research Ahead of print.
Nie, X., Singh, R. P., 2000. Detection of multiple potato viruses using an olig(dT) as a
common cDNA primer in multiplex RT-PCR. Journal of Virological Methods 86,
179-185.
Nie, X., Singh, R. P., 2001. A novel usage of random primers for multiplex RT-PCR
detection of virus and viroid in aphids, leaves and tubers. Journal of Virological
Methods 91, 37-49.
Nyalugwe, E., 2007. Evaluation of potato cultivars for their responses to infection with
common potato viruses in singly or doubly infected plants. Thesis. University of
Western Australia.
Old, R. W., Primrose, S. B., 1985. Principles of gene manipulation : an introduction to
genetic engineering. 3rd Ed., Blackwell Scientific Publications.
Opalka, N., Brugidou, C., Bonneau, C., Nicole, M., Beachy, R. N., Yeager, M., Fauquet,
C., 1998. Movement of Rice yellow mottle virus between xylem cells through pit
membranes. Proceedings of the National Academy of Sciences 95, 3323-3328.
Oparka, K. J., Roberts, A. G., Cruz, S. S., Boevink, P., Prior, D. A. M., Smallcombe, A.,
1997. Using GFP to study virus invasion and spread in plant tissues. Nature 388,
401-402.
Oparka, K. J., Roberts, A. G., Prior, D. A. M., Chapman, S., Baulcombe, D., Santa Cruz,
S., 1995. Imaging the green fluorescent protein in plants - viruses carry the torch.
Protoplasma 189, 133-141.
Owens, R. A., Diener, T. O., 1981. Sensitive and rapid diagnosis of Potato spindle tuber
viroid disease by nucleic acid hybridization. Science 213, 670-672.
Pardue, M. L., Gall, J. G., 1969. Molecular hybridization of radioactive DNA to the DNA
of cytological preparation. Proceedings of the National Academy of Science USA
64, 600-604.
Parrella, G., Gognalons, P., Gebre-Selassiè, K., Vovlas, C., Marchoux, G., 2003. An
update of the host range of Tomato spotted wilt virus. Journal of Plant Pathology
85, 227-264.
Peiman, M., Xie, C., 2006. Development and evaluation of a multiplex RT-PCR for
detecting main viruses and a viroid of potato. Acta Virologica 50, 129-133.
Pereira, S., Pissarra, J., Sunkel, C., Salema, R., 1996. Tissue-specific distribution of
glutamine synthetase in potato tubers. Annals of Botany 77, 429-432.
Peters, D., Jones, R. A. C., 1981. Potato Leafroll Virus, In: Compendium of Potato
Diseases. Hooker, W. J., (Ed.). American Phytopathological Society, St. Paul,
MN. pp. 68-70.
Prins, M., 1997. Transgenic tobacco plants expressing the putative movement protein of
Tomato spotted wilt tospovirus exhibit aberrations in growth and appearance.
Abstract. Transgenic Research 6, 245-251.
Prins, M., Goldbach, R., 1998. The emerging problem of tospovirus infection and
nonconventional methods of control. Trends in Microbiology 6, 31-35.
119
Qu, F., Ren, T., Morris, T. J., 2003. The coat protein of Turnip crinkle virus suppresses
post transcriptional gene silencing at an early Initiation step. Journal of Virology
77, 511-522.
Rajamaki, M.-L., Valkonen, J. P. T., 2002a. Localization of a potyvirus and the viral
genome-linked protein in wild potato leaves at an early stage of systemic
infection. Molecular Plant Microbe Interactions 16, 25-34.
Rajamaki, M.-L., Valkonen, J. P. T., 2002b. Viral genome-linked protein (VPg) controls
accumulation and phloem-loading of a potyvirus in inoculated potato leaves.
Molecular Plant Microbe Interactions 15, 138-149.
Roberts, C. A., Dietzgen, R. G., Heelan, L. A., Maclean, D. J., 2000. Real-time RT-PCR
fluorescent detection of Tomato spotted wilt virus. Journal of Virological Methods
88, 1-8.
Roenhorst, J. W., Jansen, C. C. C., Kox, L. F. F., de Hann, E. G., van den Bovenkamp, G.
W., Boonham, N., Fisher, T., Mumford, R. A., 2005. Application of real-time RT-
PCR for large-scale testing of potato for Potato spindle tuber pospiviroid. Bulletin
OEPP 35, 133-140.
Rogers, S. G., Klee, H. J., Horsch, R. B., Fraley, R. T., 1987. Improved vectors for plant
transformation: expression cassette vectors and new selectable markers. Methods
in Enzymology 153, 253-277.
Ross, H., 1986. Potato breeding - problems and perspectives., In: Journal of Plant
Breeding. Brandes, J., Bartels, R., Völk, J. and Wetter, C., (Ed.). Paul Parey-
Verlag, Berlin and Hamburg. pp. 132.
Rouhiainen, L., Laaksonen, M., Karjalainen, R., Söderlund, H., 1991. Rapid detection of
a plant virus by solution hybridization using oligonucleotide probes. Journal of
Virological Methods 34, 81-90.
Sadowy, E., Juszczuk, M., David, C., Gronenborn, B., Hulanicka, M. D., 2001.
Mutational analysis of the proteinase function of Potato leafroll virus. Journal of
General Virology 82, 1517-1527.
Sanford, J. C., Johnson, S., A, 1985. The concept of parasite-derived resistance - deriving
resistance genes from the parasite's own genome. Journal of Theoretical Biology
113, 395-405.
Sass, J. E., 1958. Botanical Microtechnique. Iowa State University Press.
Savenkov, E. I., Valkonen, J. P. T., 2001. Potyviral helper-component proteinase
expressed in transgenic plants enhances titers of Potato leafroll virus but does not
alleviate its phloem limitation. Virology 283, 285-293.
Schmitz, J., Stussi-Garaud, C., Tacke, E., Prüfer, D., Rohde, W., Rohfritsch, O., 1997. In
situ localization of the putative movement protein (pr17) from Potato leafroll
luteovirus (PLRV) in infected and transgenic potato plants. Virology 235, 311-
322.
Schmutterer, H., 1961. On knowledge of chewing insects as vectors of plant viruses. Part
1. Abstract. Z-angew-Ent 47, 277-301.
Schneider, H., 1981. Plant Cytology, In: Staining Procedures. Clark, G., (Ed.). Williams
and Wilkins, Baltimore, USA.
Shepardson, S., Esau, K., McCrum, R., 1980. Ultrastructure of potato leaf phloem
infected with potato leafroll virus. Virology 105, 379-392.
120
Singh, M., Singh, R. P., 1996. Factors affecting detection of PVY in dormant tubers by
reverse transcription polymerase chain reaction and nuclei acid spot hybridization.
Journal of Virological Methods 60, 47-57.
Singh, R. P., Dilworth, A. D., Singh, M., McLaren, D. L., 2004. Evaluation of a simple
membrane-based nucleic acid preparation protocol for RT-PCR detection of
potato viruses from aphid and plant tissues. Journal of Virological Methods 121,
163-170.
Singh, R. P., Nie, X., Singh, M., 2000. Duplex RT-PCR: reagent concentrations at
reverse transcription stage affect the PCR performance. Journal of Virological
Methods 86, 121-129.
Singh, R. P., Nie, X., Singh, M., Coffin, R., Duplessis, P., 2002. Sodium sulphite
inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus
detection by RT-PCR. Journal of Virological Methods 99, 123-131.
Singh, R. P., Singh, M., King, R. R., 1998. Use of citric acid for neutralizing polymerase
chain reaction inhibition by chlorogenic acid in potato extracts. Journal of
Virological Methods 74, 231-235.
Singh, R. P., Valkonen, J. P. T., Gray, S. M., Boonham, N., Jones, R. A. C., Kerlan, C.,
Schubert, J., 2008. Discussion paper: The naming of Potato virus Y strains
infecting potato. Archives of Virology 153, 1-13.
Solomon-Blackburn, R., Barker, H., 2001. A review of host major-gene resistance to
potato viruses X, Y, A and V in potato: genes, genetics and mapped locations.
Heredity 86, 8-16.
Sonnewald, U., Studer, D., Rocha-Sosa, M., Willmitzer, L., 1989. Immunocytochemical
localization of patatin, the major glycoprotein in potato (Solanum tuberosum L.)
tubers. Planta 178, 176-183.
Spiegel, S., Martin, R. R., 1993. Improved detection of Potato leafroll virus in dormant
potato tubers and microtubers by the polymerase chain reaction and ELISA.
Annals of Applied Biology 122, 493-500.
Stensballe, A., Hald, S., Bauw, G., Blennow, A., Welinder, K. G., 2008. The amyloplast
proteome of potato tuber. FEBS Journal 275, 1723-1741.
Stevenson, W. R., Loria, R., Franc, G. D., Weingartner, D. P., (Eds), 2001. Compendium
of Potato Diseases. 2nd edition, American Phytopathological Society, Minnesota,
USA.
Storms, M. M. H., Kormelink, R., Peters, D., Van Lent, J. W. M., Goldbach, R., 1995.
The nonstructural NSm protein of Tomato spotted wilt virus induces tubular
structures in plant and insect cells. Virology 214, 485-493.
Syller, J., 2003. Inhibited long-distance movement of Potato leafroll virus to tubers in
potato genotypes expressing combined resistance to infection, virus multiplication
and accumulation. Journal of Phytopathology 151, 492-499.
Tacke, E., Prüfer, D., Salamini, F., Rohde, W., 1990. Characterization of a Potato leafroll
luteovirus subgenomic RNA: differential expression by internal translation
initiation and UAG suppression. Journal of General Virology 71, 2265-2272.
Takanami, Y., Kubo, S., 1979. Enzyme-assisted Purification of two Phloem-limited Plant
Viruses: Tobacco necrotic dwarf and Potato leafroll. Journal of General Virology
44, 153-159.
121
Taliansky, M., Mayo, M. A., Barker, H., 2003. Potato leafroll virus: a classic pathogen
shows some new tricks. Molecular Plant Pathology 4, 81-89.
Taliansky, M., Torrance, L., Kalinina, N. O., 2008. Role of plant virus movement
proteins. Abstract. Methods in Molecular Biology 451, 33-54.
Tamada, T., Harrison, B. D., 1980. Factors affecting the detection of Potato leafroll virus
in potato foliage by enzyme-linked immunosorbent assay. Annals of Applied
Biology 95, 209-219.
Tavantzis, S. M., Southard, S. G., 1983. Incidence of Potato Virus X in foundation and
certified seed of seven cultivars. Plant Disease 67, 959-961.
Valkonen, J. P. T., 1994. Natural genes and mechanisms for resistance to viruses in
cultivated and wild potato species (Solanum spp.). Plant Breeding 112, 1-16.
Valkonen, J. P. T., 2007. Viruses: economical losses and biotechnological potential, In:
Potato biology and biotechnology: Advances and perspectives. Vreugdenhil, D.,
Bradshaw J, Gebhardt C, Govers F, MacKerron DKL, Taylor MA, Ross HA,
(Ed.). Elsevier, Amsterdam. pp. 619–641.
Valkonen, J. P. T., Jones, R. A. C., Slack, S. A., Watanabe, K. N., 1996. Resistance
specificities to viruses in potato: standardization of nomenclature. Plant Breeding
115, 433-438.
Vallone, P. M., Butler, J. M., 2004. AutoDimer: a screening tool for primer-dimer and
hairpin structures. BioTechniques 37, 226-231.
van den Heuvel, J. F. J. M., de Blank, C. M., Peters, D., Van Lent, J. W. M., 1995.
Localization of Potato leafroll virus in leaves of secondarily-infected potato
plants. European Journal of Plant Pathology 101, 567-571.
van der Want, J. P. H., 1972. Introduction to plant virology, In: Viruses of potatoes and
seed-potato production. de Bokx, J. A., (Ed.). Pudoc, Wageningen. pp. 19-25.
Van der Wilk, F., Verbeek, M., Dullemans, A. M., van den Heuvel, J. F., 1997. The
genome-linked portein of Potato leafroll virus is located downstream of the
putative proteinase domain of the ORF1 product. Virology 234, 300-303.
van Poelwijk, F., Boye, K., Oosterling, R., Peters, D., Goldbach, R., 1993. Detection of
the L protein of Tomato spotted wilt virus. Virology 197, 468-470.
Varma, A., Gibbs, A. J., Woods, R. D., Finch, J. T., 1968. Some observations on the
structure of the filamentous particles of several plant viruses. Journal of General
Virology 2, 107-114.
Verchot-Lubicz, J., Ye, C.-M., Bamunusinghe, D., 2007. Molecular biology of
potexviruses: recent advances. Journal of General Virology 88, 1643-1655.
Walkey, D. G. A., 1991. Applied Plant Virology. 2nd, Chapman and Hall, London.
Waterhouse, P. M., Graham, M. W., Wang, M.-B., 1998. Virus resistance and gene
silencing in plants can be induced by simultaneous expression of sense and
antisense RNA. Proceedings of the National Academy of Sciences of the United
States of America 95, 13959-13964.
Wei, T., Lu, G., Clover, G. R. G., 2009. A multiplex RT-PCR for the detection of Potato
yellow vein virus, Tobacco rattle virus and Tomato infectious chlorosis virus in
potato with a plant internal amplification control. Plant Pathology 58, 203-209.
Weideman, H. L., Buchta, U., 1998. A simple and rapid method for the detection of
potato spindle tuber. Potato Research 41, 1-8.
122
Weidemann, H., Casper, R., 1982. Immunohistological studies on the occurrence of
Potato leafroll virus in tubers and shoots of the potato plant. Potato Research 25,
99-106.
Wellink, J., Van Kammen, A., 1989. Cell-to-cell transport of Cowpea Mosaic Virus
requires both the 58K/48K proteins and the capsid proteins. Journal of General
Virology 70, 2279-2286.
Welnicki, M., Zekanowski, C., Zagórski, W., 1994. Digoxigenin-labelled molecular
probe for the simultaneous detection of three potato pathogens: Potato spindle
tuber viroid (PSTVd), Potato virus Y (PVY), and Potato leafroll virus (PLRV).
Acta Biochimica Polonica 41, 473-475.
Wenzier, H., Mignery, G., L, F., W, P., 1989. Sucrose-regulated expression of a
chimereic potato tuber gene in leaves of transgenic tobacco plants. Plant
Molecular Biology 13, 347-354.
Wilson, C. R., 2001. Resistance to infection and translocation of Tomato spotted wilt
virus in potatoes. Plant Pathology 50, 402-410.
Wilson, C. R., Jones, R. A. C., 1990. Virus content of seed potato stocks produced in a
unique seed potato production scheme. Annals of Applied Biology 116, 103-109.
Wilson, C. R., Jones, R. A. C., 1992. Resistance to phloem transport of PLRV in potato.
Journal of General Virology 73, 3219-3224.
Wilson, C. R., Jones, R. A. C., 1993a. Evaluation of resistance to Potato leafroll virus in
selected potato cultivars under field conditions. Australian Journal of
Experimental Agriculture 33, 83-90.
Wilson, C. R., Jones, R. A. C., 1993b. Resistance to Potato leafroll virus infection and
accumulation in potato cultivars, and the effects of previous infection with other
viruses on expression of resistance. Australian Journal of Agricultural Research
44, 1891-1904.
Wilson, C. R., Jones, R. A. C., 1995. Occurrence of potato virus X strain group 1 in seed
stocks of potato cultivars lacking resistance genes. Annals of Applied Biology
127, 479-487.
Wright, N., 1977. The effect of separate infections by potato viruses X and S on Netted
Gem potato. American Journal of Potato Research 54, 147-149.
Wright, N. S., 1970. Combined effects of Potato viruses X and S on yield of Netted Gem
and White Rose potatoes. American Potato Journal 47, 475-478.
Xu, X., Vreugdenhil, D., van Lammeren, A. A. M., 1998. Cell division and cell
enlargement during potato tuber formation. Journal of Experimental Botany 49,
573-582.
Zavriev, S. K., Kanyuka, K. V., Levay, K. E., 1991. The genome organization of Potato
virus M RNA. Journal of General Virology 72, 9-14.
Appendix 1
Localisation of viruses in potato tubers using immunohistochemical staining
Virus Cultivar Generation Age Location Virus detected Histology #
PVX Royal Blue 2nd fresh heel � 07/0519
rose � 07/0520
core � 07/0521
Royal Blue 2nd fresh heel � 07/0522
rose � 07/0523
core � 07/0524
Royal Blue 2nd fresh heel � 08/0118
rose � 08/0119
core � 08/0120
Royal Blue 2nd fresh heel � 08/0121
rose � 08/0122
core � 08/0123
Royal Blue 2nd fresh heel � 08/0124
rose � 08/0125
core � 08/0126
White Star 2nd fresh heel � 08/0055
rose � 08/0056
core � 08/0057
White Star 2nd fresh heel � 08/0058
rose � 08/0059
core � 08/0060
Eben 2nd fresh heel � 08/0025
rose � 08/0026
core � 08/0027
Eben 2nd fresh heel � 08/0028
rose � 08/0029
core � 08/0030
PLRV Nadine 2nd fresh heel � 07/0834
rose � 07/0835
core � 07/0836
Nadine 2nd fresh heel � 07/0837
rose � 07/0838
core � 07/0839
Nadine 2nd fresh heel � 07/0840
rose � 07/0841
core � 07/0842
White Star 2nd fresh heel � 08/0181
rose � 08/0182
core � 08/0183
Atlantic 2nd fresh heel � 08/0163
rose � 08/0164
core � 08/0165
Atlantic 2nd fresh heel � 08/0169
rose � 08/0170
core � 08/0171
Atlantic 2nd fresh heel � 08/0172
rose � 08/0173
core � 08/0174
Atlantic 2nd fresh heel � 08/0175
rose � 08/0176
core x 08/0177
Ruby Lou 2nd fresh heel � 08/0486
rose � 08/0487
core � 08/0488
PVS Ruby Lou 1st fresh heel � 07/0597
rose � 07/0596
core � 07/0595
Ruby Lou 1st fresh heel � 07/0598
rose � 07/0599
core � 07/0600
White Star 1st fresh heel � 08/0214
rose � 08/0215
core � 08/0216
White Star 1st fresh heel � 08/0217
rose � 08/0218
core x 08/0219
Royal Blue 1st fresh heel � 08/0232
rose � 08/0233
core � 08/0234
Royal Blue 1st fresh heel � 08/0235
rose � 08/0236
core � 08/0237
Royal Blue 1st fresh heel � 08/0238
rose � 08/0239
core � 08/0240
Atlantic 2nd fresh heel � 08/0471
rose � 08/0472
core � 08/0473
Atlantic 2nd fresh heel � 08/0474
rose � 08/0475
core � 08/0476
Atlantic 2nd fresh heel � 08/0477
rose � 08/0478
core � 08/0479
Nadine 2nd fresh heel � 08/0516
rose � 08/0517
core � 08/0518
Nadine 2nd fresh heel � 08/0519
rose � 08/0520
core � 08/0521
TSWV Maxine 1st 3 months heel x 07/0446
rose x 07/0447
core x 07/0448
Maxine 1st 3 months heel x 07/0449
rose x 07/0450
core x 07/0451
Maxine 1st 3 months heel x 07/0559
rose � 07/0558
core x 07/0560
Yardin 1st 3 months heel � 07/0437
rose x 07/0438
core � 07/0439
Yardin 1st 3 months heel � 07/0564
rose x 07/0565
core � 07/0566
Yardin 1st 3 months heel � 07/0613
rose � 07/0614
core x 07/0615
Eva 1st 3 months heel x 07/0440
rose x 07/0441
core x 07/0442
Eva 1st 3 months heel x 07/0443
rose x 07/0444
core x 07/0445
Eva 1st 3 months heel x 07/0525
rose x 07/0526
core x 07/0527
