Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods
j ourna l ho me p ag e: www.elsev ier .com/ locate / jv i romet
evelopment of SYBR Green I based real-time PCR assays for quantitativeetection of Rice tungro bacilliform virus and Rice tungro spherical virus
hweta Sharma, Indranil Dasgupta ∗
epartment of Plant Molecular Biology, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021, India
rticle history:eceived 4 October 2011eceived in revised form 16 January 2012ccepted 24 January 2012vailable online 3 February 2012
a b s t r a c t
Rice tungro disease, caused by simultaneous infection of Rice tungro bacilliform virus (RTBV) and Ricetungro spherical virus (RTSV), is an important cause of reduced rice harvests in South and Southeast Asia.Although various biological, serological and molecular techniques have been reported previously for thedetection of RTBV and RTSV, a method that determines accurately the exact viral load in a tungro affectedplant is still not available. The present study describes a method for the absolute quantitation of RTBV and
eywords:eal-time PCRiceTBVTSV
RTSV using SYBR Green I based real-time PCR. The number of copies of RTBV DNA and RTSV RNA present ina tungro affected rice plant at two different time points after inoculation was determined. The sensitivityof real-time PCR based detection was found 103- and 105-folds higher than dot-blot hybridization andstandard PCR assays respectively. In addition, the method was used for the simultaneous detection ofRTBV and RTSV in a single reaction on the basis of melt curve analysis.
uplex real-time RT-PCR
. Introduction
Rice tungro is the most important viral disease of rice which isidespread in South and Southeast Asia and is one of the major con-
traints to rice cultivation in the region, causing an average annualoss of US$ 1.5 billion (Herdt, 1991). Tungro disease is caused byhe simultaneous infection with; Rice tungro bacilliform virus (RTBV,enus Tungrovirus, family Caulimoviridae), a pararetrovirus with aouble-stranded DNA genome and Rice tungro spherical virus (RTSV,enus Waikavirus, family Secoviridae), a plant picornavirus with aingle-stranded (+)-sense RNA genome (Hibino et al., 1978; Jonest al., 1991; Hay et al., 1991; Shen et al., 1993; Sanfac on et al., 2009).he tungro virus complex is transmitted by the green leafhop-er, Nephotettix virescens Distant, in a semi-persistent manner androduces yellow-orange leaf discoloration and stunting in affectedlants (Rivera and Ou, 1967; Cabauatan and Hibino, 1985).
Several diagnostic techniques have been developed for theetection of RTBV and/or RTSV, such as electron microscopyAnjaneyulu et al., 1994), enzyme-linked immunosorbent assayELISA, Bajet et al., 1985; Takahashi et al., 1991), polymerase chain
eaction (PCR, Takahashi et al., 1993; Dasgupta et al., 1996), reverseranscription-loop mediated isothermal amplification (RT-LAMP,e et al., 2010). However, none of the above methods is able to
provide a quantitative measure of the viral particles present inan infected plant. Accurate quantitation of a pathogen in the hostplant is essential for the characterization and comparison of hostresistance.
Real-time PCR is a method that allows the detection of the ampli-fied product as the reaction progresses, that is, in “real time” bymeasuring the fluorescence generated by intercalating dyes or flu-orescent probes, which sense the increase in the concentrationof target molecules. A standard curve generated by plotting CT(threshold cycle) values versus the calculated copy number enablesthe quantitative measurement of the starting amount of targetnucleic acid. In the last few years real-time PCR has been usedfor the detection and quantitation of several plant DNA and RNAviruses such as Cucumber vein yellowing virus (Pico et al., 2005),Citrus tristeza virus (Ruiz-Ruiz et al., 2007), Tomato yellow leaf curlSardinia virus (Mason et al., 2008), Rice stripe virus (Zhang et al.,2008), Prune dwarf virus (Jarosová and Kundu, 2010) and Wheatdwarf virus (Zhang et al., 2010). Real-time PCR based relative quan-titation of RTBV has also been reported (Dai et al., 2008), but amethod for absolute quantitation of RTBV and RTSV in the tungro-affected plant is not yet available. The present study describes thedevelopment of a SYBR Green I based real-time PCR assay to obtainquantitative estimates of RTBV and RTSV present in an infectedplant. The sensitivity of this method was compared with the dot-blot hybridization, conventional end point PCR and conventional
Simultaneous detection of RTBV and RTSV is highly desirablefor high-throughput and rapid screening of infected plants at thefield level. To date only one method based on multiplex RT-PCR
Table 1Sequence and origin of the primers used in this study.
S. No Primer name Sequence (5′-3′) GenomicPosition
1. RTBV MP F TATGGATCCATGAGTCTTAGACCG 999–1013a
2. RTBV MP R GGAGCTCTTCATCAGAATTTATTTC 1881–1898a
3. RTSV 5F GCTTCAGGGAATTAAAACG 6469–6487b
4. RTSV 5R AGTGGCCTTAACCTTATCTTG 8090–8110b
5. RTBV RT F GAGTCTGAAACAGCAAACAAAGATAAGT 721–748c
6. RTBV RT R TCTGCTGTTGTTTTTATCCCTTGA 768–791c
7. RTSV RT F GCCGAGAAGTCGCGTAAGC 7845–7863d
8. RTSV RT R GCCTGGCGACAAGCCTAAA 7889–7907d
a Movement protein (MP), genomic position derived from RTBV-West Bengal iso-late (accession number AJ314596).
b Q2-Protease region, genomic position derived from RTSV-Orissa isolate (acces-sion number AM234049).
c Open reading frame II (ORF II), genomic position derived from RTBV-West Bengal
S. Sharma, I. Dasgupta / Journal of
Periasamy et al., 2006) has been reported for simultaneous detec-ion of RTBV and RTSV, based on the fact that both involve RNA ineplication. SYBR Green I based real-time PCR coupled with a melturve analysis (MCA) is a method that has been reported for theimultaneous detection of different viruses such as nine virusesithin the family Luteoviridae, namely Soybean dwarf virus, Bean
eafroll virus, Beet chlorosis virus, Beet mild yellowing virus, Beet west-rn yellows virus, Cereal yellow dwarf virus-RPV, Cucurbit aphid-borneellows virus, Potato leafroll virus and Turnip yellows virus (Chomict al., 2011), as well as for the differentiation of strains of Plumox virus (Varga and James, 2005). This method is based on therinciple that the melting temperature (Tm) of a virus-derived PCRroduct (which depends on the GC/AT ratio, fragment length andequence) is used to differentiate distinct viral species (Ririe et al.,997; Nicolas et al., 2002). The present study describes a noveluplex real-time RT-PCR technique, which on the basis of MCAetects both RTBV and RTSV in a single reaction with sensitivityeveral folds higher than reported previously.
. Material and methods
.1. Virus isolate and insect vector
The viral isolates (RTBV and RTSV) used in the present studyere obtained from Directorate of Rice Research, Hyderabad,ndhra Pradesh, India. The isolates were maintained by repeated
ransfer to 15–20 days old seedlings of rice variety Taichung native- (TN-1) and Pusa Basmati-1 (PB-1), using green leafhoppers asector in an insect-proof glasshouse. The green leafhoppers werebtained from Paddy Breeding Station, Tamil Nadu Agriculturalniversity, Coimbatore, Tamil Nadu, India and maintained on TN-1nd PB-1 rice varieties in the same glasshouse.
.2. Virus inoculation and detection
For inoculation of rice plants, non-viruliferous green leafhop-ers were given an acquisition access period of approximately 18 hrom a rice plant infected with both RTBV and RTSV. Rice seedlings,5–20 days old, were inoculated with 3 viruliferous hoppers perlant by giving an inoculation access period of approximately 24 h.he inoculated plants were maintained at 30 ◦C inside a contain-ent glasshouse with 80% relative humidity and supplementedith additional lighting. The inoculated plants were screened for
he presence of RTBV and RTSV at 15–20 dpi by conventional PCRnd RT-PCR respectively (Sections 2.4 and 2.5, respectively). Leafamples were collected at two time points, i.e., 21 and 35 dpi, fromhe second emerging leaf of inoculated plants.
.3. Nucleic acid extraction
For the detection of RTBV and RTSV, total genomic DNA andNA were isolated from infected rice plants using DNeasy Plantini Kit and RNeasy Plant Mini Kit respectively (both from Qiagen,ilden, Germany), as per manufacturer’s instructions. The qualityf DNA and RNA samples was checked by standard agarose gellectrophoresis (Sambrook and Russell, 2001). The concentrationnd purity of DNA and RNA samples was determined using Nano-rop spectrophotometer (NanoVue Spectrophotometer V1.7.3, GEealthcare, Little Chalfont, UK). DNA and RNA samples with A260/280etween 1.7–1.9 and 1.9–2.1 respectively and A260/230 above 2.0ere considered for further analysis.
.4. Conventional PCR
RTBV detection was performed with conventional end-pointCR using 5–10 ng of total genomic DNA of the infected plant as
isolate (accession number AJ314596).d Q2 region, genomic position derived from RTSV-Orissa isolate (accession num-
ber AM234049).
a template and RTBV MP F/R primer pair (Table 1). Thermocyclingconditions were: initial denaturation of 5 min at 94 ◦C, followed by30 cycles of 30 s at 94 ◦C, 30 s at 60 ◦C and 1 min at 72 ◦C, followedby a final extension step of 7 min at 72 ◦C.
2.5. First strand cDNA synthesis and conventional RT-PCR
The first strand cDNA was synthesized from total RNA isolatedfrom infected rice plants using high capacity cDNA reverse tran-scription kit (Applied Biosystems, Carlsbad, CA, USA) as per themanufacturer’s instructions. The cDNA thus obtained was sub-jected to RT-PCR using the primer pair RTSV 5F/5R (Table 1) forRTSV detection. Thermocycling conditions were: initial denatura-tion of 5 min at 94 ◦C, followed by 30 cycles of 30 s at 94 ◦C, 40 s at55 ◦C and 2 min at 72 ◦C, followed by a final extension step of 7 minat 72 ◦C.
2.6. Dot-blot hybridization
Dot-blot analysis for RTBV and RTSV detection was performedusing Manifold® apparatus (Schleicher and Schuell, Keene, N.H,USA) as described earlier (Sambrook and Russell, 2001; Borahet al., 2008). Membrane hybridization was done using DIG highprime DNA labeling and detection starter kit II (Roche, Mannheim,Germany) as per manufacturer’s instructions. A 1.1 kb fragmentencompassing the movement protein region and a 1.6 kb fragmentencompassing the NTP/Q2 region were used as probes for RTBV andRTSV detection respectively.
2.7. SYBR Green I based real-time PCR assay
Primers for real-time PCR based detection and quantitation ofRTBV and RTSV were synthesized using the Primer ExpressTM soft-ware (Applied Biosystems). Amplification efficiency of RTBV andRTSV primers was determined by means of a calibration curve[CT value vs. log of input DNA (for RTBV)/cDNA (for RTSV)] pre-pared in triplicate using a tenfold dilution series. The slope ofthe log-linear phase of the calibration curve was used to cal-culate the percentage efficiency using the formula: efficiency(%) = [10(−1/slope) − 1] × 100. Real-time PCR amplifications were car-ried out in 96-well MicroAmp optical plates (Applied Biosystems)in the ABI Prism® 7000 sequence detection system (Applied Biosys-
tems). Each reaction mix (25 �l) consisted of 1X SYBR GreenPCR master mix (Applied Biosystems), template DNA/cDNA and200 nM of specific primers. For RTBV quantitation, 1 ng of totalgenomic DNA isolated from tungro affected rice plant was used as a
8 Virological Methods 181 (2012) 86– 92
togFw(aspfdtrtif
2
cmdcc[/ddRpiutgwRcaacitptS
2
dpdmFft
2m
faDp
Table 2Absolute quantitation of rice tungro viruses in a tungro affected plant at two differenttime points.
a Days post inoculation.b Mean threshold cycle (CT) ± standard deviation (S.D.) obtained from three repli-
cates.
8 S. Sharma, I. Dasgupta / Journal of
emplate with primer pair RTBV RT F/R. Similarly, for quantitationf RTSV, 1 ng of cDNA prepared from total RNA isolated from tun-ro affected plant was used as a template with primer pair RTSV RT/R. The primer sequences are given in Table 1. Cycling parametersere as follows: 1 cycle at 50 ◦C for 2 min, 1 cycle at 95 ◦C for 10 min
DNA polymerase activation), and 40 cycles, each consisting of 15 st 95 ◦C (denaturation) and 1 min at 60 ◦C (annealing and exten-ion). For each sample, three technical replicates were amplified inarallel. No template control (NTC) was used as a negative controlor determining the background fluorescence. Since SYBR Green Iye binds non-specifically to any double-stranded DNA, dissocia-ion or melting reaction was carried out after every amplificationeaction to determine the specificity of the products on the basis ofhe melting temperature. Dissociation analysis was performed byncubating the reaction at 95 ◦C for 15 s, annealing at 60 ◦C for 20 s,ollowed by slowly increasing the temperature to 95 ◦C over 20 min.
.8. Preparation of standard curve for real-time PCR assay
For preparing a standard curve of RTBV, a full-lengthlone i.e. pRTBV203 (Nath et al., 2002) was used. The plas-id preparation, after linearization by EcoRV, was serially
iluted ten folds to get a range of 1010–102 viral genomicopies per 2 �l. Plasmid copy number per microliter wasalculated as described in Applied Biosystems documenthttp://www3.appliedbiosystems.com/cms/groups/mcb marketingdocuments/generaldocuments/cms 042486.pdf]. The plasmidilutions thus obtained was subjected to real-time PCR asescribed earlier (Section 2.7). For preparing the standard curve ofTSV, a cloned cDNA having NTP-Q2 region (between nucleotideositions 6469-8110 of RTSV-Phil A [Accession no. NC 001632])
n pCR 2.1 TOPO/TA vector (Invitrogen, Carlsbad, CA, USA) wassed (Verma and Dasgupta, 2007). A ten-fold serial dilution ofhe plasmid linearized with EcoRV digestion were prepared toive a range of 1010–102 viral genomic copies per 2 �l whichas then subjected to real-time RT-PCR. The standard curves forTBV and RTSV were constructed by plotting a linear regressionurve with the mean CT values (an average of three) on Y-axisnd logarithm of the copy number on X-axis. To determine thessay reproducibility each dilution of the plasmid DNA used foronstructing the standard curve of RTBV and RTSV was testedn triplicate. The CT values thus obtained were used to calculatehe mean CT, standard deviation (S.D.) and coefficient of variationercentage (CV%) using the Microsoft Excel software. Efficiency ofhe RTBV and RTSV standard curve was calculated as described inection 2.7.
.9. Duplex real-time RT-PCR assay
For simultaneous detection of both RTBV as well as RTSV, auplex real-time RT-PCR was carried out using 10 ng of the cDNArepared from a tungro-affected plant. The reaction mix (25 �l) foruplex real-time RT-PCR consisted of 1× SYBR Green PCR masterix (Applied Biosystems) and 200 nM each of the RTBV (RTBV RT
/R) as well as RTSV (RTSV RT F/R) specific primers. The productsormed after the real-time PCR was subjected to MCA to determinehe Tm of RTBV and RTSV specific products.
.10. Comparison of sensitivity between different detectionethods for RTBV and RTSV
For comparing the sensitivity of three techniques available
or RTBV detection i.e. conventional PCR, dot-blot hybridizationnd real-time PCR, a tenfold dilution series of the total genomicNA from RTBV and RTSV infected plants and uninfected controllants were prepared to get the final DNA amount in the range of
c Coefficient of variation (C.V) between replicates.d Number of viral genomic copies per nanogram of total DNA (in case of
RTBV)/RNA (in case of RTSV).
100 ng–10 fg per reaction. The genomic DNA dilutions thus pre-pared were subjected to each of the three techniques as described inprevious sections (Sections 2.4, 2.6 and 2.7). Similarly for compar-ing the sensitivity of three techniques available for RTSV detectioni.e. conventional RT-PCR, dot-blot hybridization (total RNA) andreal-time RT-PCR a tenfold dilution series of the cDNA synthesizedfrom total RNA isolated from infected and uninfected control plantswas prepared to get a range of 100 ng–10 fg per reaction whichwere then subjected to these three techniques (Sections 2.5–2.7).
3. Results
3.1. Assay performance and reproducibility
In order to optimize the real-time PCR performance, severalprimer concentrations were tested. Of the four concentrationstested (100 nM, 200 nM, 300 nM and 400 nM), 200 nM, whichshowed the lowest CT and highest �Rn (normalized reporter) val-ues, was considered the optimal primer concentration for bothRTBV and RTSV (data not shown).
To determine the accuracy and reproducibility of the real-timePCR assay mean CT, standard deviation (S.D.) and coefficient of vari-ation percentage (CV%) were calculated for all the reactions. A CV%value ranging from 0.19 to 0.67 was obtained for RTBV and RTSV(Table 2). For RTBV, S.D. values ranging from 0.07 to 0.32 and forRTSV 0.04 to 0.27 were obtained (Tables 2 and 3).
3.2. Standard curve
A standard curve was constructed in order to determine theabsolute quantity of RTBV and RTSV nucleic acids present in a tun-gro affected rice plant. Standard curves for RTBV and RTSV wereobtained by preparing 10-fold serial dilutions of plasmid contain-ing complete or partial viral genomes to get a range of 1010–102
copies. Linear regression curves were obtained by plotting mean CTvalues (an average of three) with the logarithm of the copy numberof standard samples. The standard curve of RTBV showed equationof y = −3.329x + 37.93 and coefficient of correlation (R2) of 0.998(Fig. 1A). It showed an amplification efficiency of 99.7% and covereda linear range from 106 to102 copies of viral DNA. The equation ofthe standard curve of RTSV obtained by plotting the CT values withthe logarithm of the copy number was y = −3.472x + 50.07 corre-sponding to an amplification efficiency of 94% (Fig. 1B). It covereda linear range of 109–103 viral genomic copies with an R2 value of0.994.
3.3. Quantitation of RTBV and RTSV in infected rice tissues at two
time points post-inoculation
Total genomic DNA isolated from tungro affected plants at twotime points i.e. 21 days post-inoculation (dpi) and 35 dpi were used
a Repeated thrice with coinciding results.b Dot-blot hybridization, repeated twice with two biological replicates.c Mean threshold cycle (CT) ± standard deviation (S.D.).
re con
fracc31DtaA2soR
3f
tddgru
Fbe
d No template control (NTC).e Undetermined (UND).f Uninfected control; −, negative result; +, positive result; CT values above 32 we
or the absolute quantitation of RTBV and RTSV nucleic acids byeal-time PCR. For RTBV estimation, the sample at 21 dpi showed
CT value of 19.17 ± 0.037, which, on the basis of the standardurve generated for RTBV, corresponds to 4.32 × 105 ± 1.13 × 104
opies of viral DNA per ng of total plant DNA. The sample at5 dpi showed a CT value of 20.63 ± 0.14, which corresponds to.58 × 105 ± 1.48 × 104 copies of RTBV DNA per ng of total plantNA (Table 2). For RTSV quantitation, cDNA synthesized from
otal RNA isolated from the infected plant were used for thessay at the same two time points after inoculation as RTBV.
CT value of 20.94 ± 0.08 corresponding to a copy number of.46 × 108 ± 1.37 × 107 per ng of total RNA was obtained for theample collected at 21 dpi. The sample at 35 dpi showed a CT valuef 20.19 ± 0.12, which corresponds to 4.04 × 108 ± 3.14 × 107 viralNA copies per ng of total RNA (Table 2).
.4. Comparison of the sensitivity of different detection methodsor RTBV and RTSV
In order to compare the sensitivity of real-time PCR withhe conventional PCR and dot-blot hybridization, the end-pointilution, which could be detected by each of these techniques were
etermined. A 10-fold serial dilution was prepared using totalenomic DNA isolated from a tungro affected rice plant to obtain aange between 100 ng and 10 fg. The dilutions thus prepared weresed for RTBV detection using the three techniques. Detection
A By = -3.3 29x + 37.9 3
R² = 0.9 98
25
30
35
(CT)
10
15
20
Thre
shol
dcy
cle
0
5
65432
Log of st ar�ng quan�ty,Cop y nu mber
ig. 1. Standard curve showing a linear relationship between standard DNA concentrationy plotting the CT-values on the X-axis vs. log of the staring quantity (number of copiesquation of the straight line and the coefficient of correlation (R2) are represented on the
sidered as negative result.
limits of dot-blot hybridization and conventional PCR were 100 ngand 1 ng of the total genomic DNA respectively. On the otherhand, real-time PCR was able to detect the viral DNA in a dilutioncorresponding to 1 pg of the genomic DNA (Table 3). Comparingthe detection limits of these three techniques, real-time PCRwas found to be 105- fold and 103-folds more sensitive thandot-blot hybridization and conventional PCR respectively for RTBVdetection.
Similarly, for RTSV detection ten-fold serial dilution, preparedusing total RNA of a tungro affected rice plant (for dot-blothybridization) or cDNA (for conventional RT-PCR and real-timeRT-PCR) to obtain a range of 100 ng–10 fg, were tested using thethree techniques. Detection limit of dot-blot hybridization and con-ventional RT-PCR were found to be 100 ng and 1 ng respectively(Table 3). In contrast, real-time RT-PCR was able to detect RTSV ina dilution containing 1 pg of the cDNA. These results suggest thatreal-time RT-PCR was 105- and 103-folds more sensitive than dot-blot hybridization and conventional RT-PCR respectively for RTSVdetection.
3.5. Duplex real-time RT-PCR assay for simultaneous detection ofRTBV and RTSV
For simultaneous detection of RTBV and RTSV in a single reac-tion, two separate real-time RT-PCR amplifications with single setof primers (singleplex real-time RT-PCR) followed by MCA were
45y = -3. 472x + 50.07
R² = 0.99 4
30
35
40
(CT)
15
20
25
Thre
shol
dcy
cle
0
5
10
9876543Log of Star�ng quan�ty,Copy number
s and CT values for RTBV (A) and RTSV (B). A linear regression curve was generated of the plasmid DNA) on Y-axis. The experiment was performed in triplicate. The
graph.
90 S. Sharma, I. Dasgupta / Journal of Virological Methods 181 (2012) 86– 92
Table 4Melting curve analysis of singleplex and duplex real-time RT-PCR.
a Mean of melting temperature (Tm) ± standard deviation (S.D.).
arried out to determine the Tm for the RTBV and RTSV specificmplification products. A duplex real-time RT-PCR was then per-ormed using equal concentration of the primers specific to RTBVnd RTSV in a single reaction. Following the duplex real-time RT-CR, MCA for the 70 bp and 62 bp amplicons (of RTBV and RTSV,espectively) resulted in distinct Tm values that were similar to thealues obtained by singleplex PCR (Table 4). Significantly differentm values were obtained for both the amplicons in duplex as well asingleplex assays, ruling out any cross-contamination between thewo primer pairs. A graph obtained by plotting the rate of changef fluorescence versus the temperature showed two distinct peaksorresponding to the Tm values of RTBV and RTSV specific ampli-ons. For RTBV the peak was at 78.4 ◦C ± 0.17 whereas for RTSV itas at 73.4 ◦C ± 0.17, which can be used to detect and differentiate
he two viruses simultaneously (Fig. 2).
. Discussion
Several strategies, such as conventional plant breeding, usingesistance sources (Toriyama, 1975; Khush and Virmani, 1985;
oweito et al., 1987; Azzam and Chancellor, 2002) and moreecently, engineering transgenic resistance (Huet et al., 1999;ivamani et al., 1999; Tyagi et al., 2008; Dai et al., 2008) have beensed for the management of rice tungro disease. For evaluating
ig. 2. The dissociation curve plot of SYBR Green I based duplex real-time RT-PCR showieak for 70 bp RTBV amplicon and 62 bp RTSV amplicon was found at 78.4 ◦C ± 0.17 and 7
2 73.26 ± 0.25 78.17 ± 0.23
the effectiveness of these strategies it is necessary to determinethe exact load of RTBV and RTSV in the plants being tested forresistance. Also, in order to contain the spread of this disease it isimportant to develop a sensitive method, which is able to detect theviruses at a very early stage when the viral titres are low. Althougha number of techniques have been developed for their detection,but till date a method able to quantify the viral titres in a tungroaffected plant has not been reported. The present study describes areal-time PCR method for detection and quantitation of both RTBVand RTSV.
The approaches used for real-time PCR based detection andquantitation of a product can be broadly divided into two cat-egories; sequence specific probe based assays (such as TaqManprobes) and non-specific dsDNA intercalating dye based assays(such as SYBR Green I). The probe-based assays require highsequence identity for successful probe binding that frequently leadto false negative results, especially in case of RNA viruses (Papinet al., 2004; Richards et al., 2004). On the other hand, SYBR Green Ibased assay, because of its ability to bind to the minor groove of anydsDNA, is able to detect even those targets that show high sequencevariability or are still uncharacterized. The problem of non-specific
amplification can be addressed by a subsequent MCA (Ririe et al.,1997; Hernandez et al., 2003; Richards et al., 2004) that helps inidentification of specific product, distinct from a non-specific oneon the basis of their melting temperature profiles.
ng two distinct peaks representing the Tm of RTBV and RTSV specific products. The3.4 ◦C ± 0.17 respectively. The three curves represent the replicates.
Virolo
bCwcGMRgarhR(
sislddbpcDwaa
cp2r1csftog
esDmwtetcccdf
ctRsaenoplc
S. Sharma, I. Dasgupta / Journal of
For absolute quantitation, standard curves were constructed foroth the viruses by plotting a linear regression curve with the meanT values on Y-axis and logarithm of the copy number on X-axis. Theide linear range, of over 5–6 log units, covered by the standard
urves of both RTBV and RTSV is similar to the other reported SYBRreen I based assays for virus detection (Plumet and Gerlier, 2005;ason et al., 2008; Ruiz-Ruiz et al., 2009). R2 values obtained for
TBV and RTSV were 0.998 and 0.994 respectively, which indicateood correlation between viral copy numbers and CT values. Themplification efficiency for RTBV and RTSV were 99.7% and 94%espectively, which is well within the permissible range indicatingighly efficient amplification. CV% values (0.19–0.67), obtained forTBV and RTSV, were less than 5, which is considered acceptableIslam et al., 2004) for such tests.
For generating the standard curve of RTSV a plasmid DNA repre-enting the partial clone of RTSV was used as a template. Generally,t is recommended that in vitro transcribed RNAs, instead of DNAhould be used as a template for generating standard curve for abso-ute quantitation of RNA, which makes it a very time consuming andifficult task. Recently, in a study meant to compare the effect ofifferent templates for the absolute quantitation of an RNA virusy real-time RT-PCR, it was observed that the nature of the tem-late has no effect on the standard curve, provided the templateopy number is in excess of 100 copies per reaction (Bowers andhar, 2011). Since the observed RTSV levels in the present studyere in excess of 100 copies per reaction, plasmid DNA was used
s a template for the generation of standard curve, which makes it very quick and simple procedure.
In case of RNA viruses, reliable estimation of genomic RNAopies is hindered due to the interference of non-genomic tem-lates, such as sub-genomic and defective RNAs (Ruiz-Ruiz et al.,007). Two 3′ co-terminal sub-genomic RNAs (sgRNA) has beeneported to be associated with the Phil1 isolate of RTSV (Shen et al.,993). Therefore, in order to avoid overestimation of RTSV gRNAopies present in the total RNA extracted from tungro affected tis-ues due to the presence of these sgRNAs, primers were designedrom a genomic location spanning the NTP/Q2 region. Targeting ofhis RTSV genomic location eliminated the possible amplificationf sgRNAs thus leading to reliable and correct estimation of RTSVRNA copies.
Quantitation of RTBV in infected samples, collected at two differ-nt time points i.e. 21 dpi and 35 dpi, on the basis of standard curvehowed the presence of 4.32 × 105 and 1.58 × 105 copies of viralNA per ng of the total genomic DNA respectively. This approxi-ately 2.7-fold less RTBV titre at 35 dpi than 21 dpi is in agreementith a previous observation (Dai et al., 2008) and possibly reflects
he cyclic pattern of RTBV accumulation reported earlier (Sta Cruzt al., 2003). In contrast, quantitation of RTSV levels at the twoime points i.e. 21 dpi and 35 dpi revealed 2.46 × 108 and 4.04 × 108
opies of viral genomes per ng of the total RNA respectively, indi-ating an approximately 1.6-fold increase in RTSV levels at 35 dpi asompared to 21 dpi. The underlying cause for the differences in theynamics of the viral buildup in RTSV as compared to RTBV meritsurther investigation in the future.
In the present study quantitation of RTBV and RTSV titers indi-ates that RTSV accumulates to much higher levels as comparedo RTBV in a tungro affected plant. The level of accumulation ofTSV is close to the values reported earlier for several RNA viruses,uch as Plum pox virus (Olmos et al., 2005), Broad bean wilt virus-1nd -2 (Ferriol et al., 2011), Tomato spotted wilt virus (Debreczenit al., 2011) and Grapevine fleck virus (Pacifico et al., 2011). Tillow, very little information is available on the absolute levels
f accumulation of RTBV and RTSV. As both RTBV and RTSV arehloem-limited (Saito et al., 1976; Favali et al., 1975), whether the
evels of accumulation of these viruses in an infected plant have anyompeting influence on each other is an open question. Therefore,
gical Methods 181 (2012) 86– 92 91
it would be interesting to determine the factors responsible for thedifferential accumulation of RTBV and RTSV in a tungro affectedplant.
Comparison of the sensitivity of real-time PCR revealed it to beapproximately 105- and 103-folds more than dot-blot hybridiza-tion and conventional PCR/RT-PCR respectively which is similar tothat reported for other viruses (Olmos et al., 2005; Ruiz-Ruiz et al.,2009). Approximately 102 copies of RTBV could be detected usingthe real-time PCR assay as reported earlier (Fabre et al., 2003; Ruiz-Ruiz et al., 2009), which suggests that the sensitivity of this methodis considerably higher than any of the existing diagnostic methodsfor rice tungro viruses. This increased sensitivity will help in thetimely detection of very low viral titres of RTBV and RTSV in plantsas well as the vector green leafhopper, thereby facilitating diseaseforecasting and containment.
With the help of MCA nucleic acid fragments having sequencedifferences can be detected and differentiated from each other onthe basis of their distinct Tm, thus eliminating the need of any post-PCR gel electrophoresis and sequencing (Chomic et al., 2011). Theuses of MCA for genotyping, detection of mutation and gene-dosageanalyses have been reported earlier (Ruiz-Ponte et al., 2000; Burianet al., 2002; Randen et al., 2003). Since both RTBV and RTSV haveRNA phases in their life cycles, the duplex real-time RT-PCR assayfollowed by a subsequent MCA of the products enabled the simul-taneous detection of both RTBV and RTSV in a single reaction. Theduplex real-time RT-PCR assay offers a sensitive, quick and safealternative to multiplex RT-PCR, the only other reported methodfor simultaneous detection of RTBV and RTSV.
Real-time PCR based methods are being used for severalapplications, such as screening programs for virus resistance, epi-demiological surveys of viral population dynamics, viral replicationand virus-vector interaction studies (Mason et al., 2008). Screeningof hybrid rice varieties for tungro resistance by multiplex RT-PCRhas been reported earlier based on the intensity of amplified bands,which is purely a qualitative method (Periasamy et al., 2006). Suchscreening programs, if performed with this newly developed real-time PCR method is expected to be much more informative inevaluating the level of resistance.
In conclusion, a very sensitive and accurate SYBR Green I basedreal-time PCR method has been developed for quantitative detec-tion of RTBV as well as RTSV. The exact viral load of a tungro affectedplant was estimated, which can be very useful for comparing thedisease resistance strategies being designed against tungro, in turnresulting in better management of the disease. The sensitivity ofthis method was several folds higher than dot-blot hybridization,conventional end point PCR, RT-PCR, RT-LAMP described previ-ously, thus indicating a significant step forward in the methodsavailable for early detection of the disease. In addition, a novelduplex real-time RT-PCR assay was also developed for simulta-neous detection of RTBV and RTSV based on the distinct meltingtemperatures profiles of the two viral amplicons. Together, thisnewly developed real-time PCR based quantitative and simultane-ous detection of rice tungro viruses opens up possibilities for timelyand better containment of this devastating disease.
Acknowledgments
SS is indebted to Council of Scientific and Industrial Research,New Delhi for Research Fellowship during this work. This workwas funded by Department of Biotechnology, Government of India(grant no. BT/PR10665/AGR/36/36/2008 to ID).
References
Anjaneyulu, A., Satapathy, M.K., Shukla, V.D., 1994. Disease Detection and Diagnosisin Rice Tungro. Oxford and IBH publishing Co. Pvt. Ltd., New Delhi, pp. 24–28.
9 Virolo
A
B
B
B
B
C
C
D
D
D
F
F
F
H
H
H
H
H
I
J
J
K
L
M
N
N
O
P
2 S. Sharma, I. Dasgupta / Journal of
zzam, O., Chancellor, T.C.B., 2002. The biology epidemiology and management ofRice Tungro disease in Asia. Plant Dis. 86, 88–100.
orah, B.K., Johnson, A.M.A., Sai Gopal, D.V.R., Dasgupta, I., 2008. A comparison offour DNA extraction methods for the detection of Citrus yellow mosaic badnavirusfrom two species of citrus using PCR and dot-blot hybridization. J. Virol. Methods151, 321–324.
owers, R.M., Dhar, A.K., 2011. Effect of template on generating a standard curvefor absolute quantification of an RNA virus by real-time reverse transcriptase-polymerase chain reaction. Mol. Cell. Probes 25, 60–64.
urian, M., Grosch, S., Tegeder, I., Geisslinger, G., 2002. Validation of a new fluoro-genic real-time PCR assay for detection of CYP2C9 allelic variants and CYP2C9allelic distribution in a German population. Br. J. Clin. Pharmacol. 54, 518–521.
abauatan, P.Q., Hibino, H., 1985. Transmission of Rice tungro bacilliform and sphericalviruses by Nephotettix virescens distant. Philippine Phytopathol. 21, 103–109.
homic, A., Winder, L., Armstrong, K.F., Pearson, M.N., Hampton, J.G., 2011. Detectionand discrimination of members of the family Luteoviridae by real-time PCR andSYBR GreenERTM melting curve analysis. J. Virol. Methods 171, 46–52.
ai, S., Wei, X., Alfonso, A.A., Pei, L., Duque, U.G., Zhang, Z., Babb, G.M., Beachy, R.N.,2008. Transgenic rice plants that over express transcription factors RF2a andRF2b are tolerant to rice tungro virus replication and disease. Proc. Natl. Acad.Sci. USA 105, 21012–21016.
asgupta, I., Das, B.K., Nath, P.S., Mukhopadhyay, S., Niazi, F.R., Varma, A., 1996.Detection of Rice tungro bacilliform virus in field and glasshouse samples fromIndia using the polymerase chain reaction. J. Virol. Methods 58, 53–58.
ebreczeni, D.E., Ruiz-Ruiz, S., Aramburu, J., López, C., Belliure, B., Galipienso, L.,Soler, S., Rubio, L., 2011. Detection, discrimination and absolute quantitation ofTomato spotted wilt virus isolates using real time RT-PCR with TaqMan® MGBprobes. J. Virol. Methods 176, 32–37.
abre, F., Kervarrec, C., Mieuzet, L., Riault, A.V., Jacquot, E., 2003. Improvement ofBarley yellow dwarf virus-PAV detection in single aphids using a fluorescent realtime RT-PCR. J. Virol. Methods 110, 51–60.
avali, M.A., Pellegrini, S., Bassi, M., 1975. Ultrastructural alterations induced by ricetungro virus in rice leaves. Virology 66, 502–507.
erriol, I., Ruiz-Ruiz, S., Rubio, L., 2011. Detection and absolute quantitation of Broadbean wilt virus 1 (BBWV-1) and BBWV-2 by real time RT-PCR. J. Virol. Methods177, 202–205.
ay, J.M., Jones, M.C., Blakebrough, M.L., Dasgupta, I., Davies, J.W., Hull, R., 1991. Ananalysis of the sequence of an infectious clone of Rice tungro bacilliform virus, aplant pararetrovirus. Nucleic Acids Res. 19, 2615–2621.
erdt, R.W., 1991. Research priorities for rice biotechnology. In: Khush, G.S., Toen-niessen, G.H. (Eds.), Rice Biotechnology. CABI, Wallingford, pp. pp19–pp54.
ernandez, M., Rodriguez-Lazaro, D., Esteve, T., Prat, S., Pla, M., 2003. Developmentof melting temperature-based SYBR Green I polymerase chain reaction meth-ods for multiplex genetically modified organism detection. Anal. Biochem. 323,164–170.
ibino, H., Roechan, M., Sudarisman, S., 1978. Association of two types of virus parti-cles with penyakit habang (tungro disease) of rice in Indonesia. Phytopathology68, 1412–1416.
uet, H., Mahendra, S., Wang, J., Sivamani, E., Ong, C.A., Chen, L., de Kochko, A.,Beachy, R.N., Fauquet, C., 1999. Near Immunity to Rice tungro spherical virusachieved in rice by a replicase-mediated resistance strategy. Phytopathology89, 1022–1027.
slam, A., Harrison, B., Cheetam, B.F., Mahony, T.J., Young, P.L., Walkden-Brown,S.W., 2004. Differential amplification and quantitation of Marek’s disease virusesusing real-time polymerase chain reaction. J. Virol. Methods 119, 103–113.
arosová, J., Kundu, J.K., 2010. Detection of Prune dwarf virus by one-step RT-PCR andits quantitation by real-time PCR. J. Virol. Methods. 164, 139–144.
ones, M.C., Gough, K., Dasgupta, I., Rao, B.L., Cliffe, J., Qu, R., Shen, P., Kaniewska, M.,Blakebrough, M., Davies, J.W., Beachy, R.N., Hull, R., 1991. Rice tungro disease iscaused by an RNA and a DNA virus. J. Gen. Virol. 72, 757–761.
hush, G.S., Virmani, S.S., 1985. Breeding rice for disease resistance. In: Russell, A.E.(Ed.), Progress in Plant Breeding, vol. 1. Butterworths, London, pp. 239–279.
e, D.T., Netsua, O., Uehara-Ichikia, T., Shimizua, T., Choic, I.-R., Omuraa, T., Sasayaa,T., 2010. Molecular detection of nine rice viruses by a reverse-transcription loop-mediated isothermal amplification assay. J. Virol. Methods 170, 90–93.
ason, G., Caciagli, P., Accotto, G.P., Noris, E., 2008. Real-time PCR for the quanti-tation of Tomato yellow leaf curl sardinia virus in tomato plant and in Bemisiatabaci. J. Virol. Methods 147, 282–289.
ath, N., Mathur, S., Dasgupta, I., 2002. Molecular analysis of two complete Rice tun-gro bacilliform virus genomic sequences from India. Arch. Virol. 147, 1173–1187.
icolas, L., Milon, G., Prina, E., 2002. Rapid differentiation of old world Leishmaniaspecies by light cycler polymerase chain reaction and melting curve analysis. J.Microbiol. Methods 51, 295–299.
lmos, A., Bertolini, E., Gil, M., Cambra, M., 2005. Real-time assay for quantitativedetection of non-persistently transmitted Plum pox virus RNA targets in singleaphids 128, 151–155.
acifico, D., Caciagli, P., Palmano, S., Mannini, F., Marzachi, C., 2011. Quantitation ofGrapevine leafroll associated virus-1 and -3, Grapevine virus A Grapevine fan leaf
gical Methods 181 (2012) 86– 92
virus and Grapevine fleck virus in field-collected Vitis vinifera L. ‘Nebbiolo’ byreal-time reverse transcription-PCR. J. Virol. Methods 172, 1–7.
Papin, J.F., Vahrson, W., Dittmer, D.P., 2004. SYBR green-based real-time quantitativePCR assay for detection of West Nile virus circumvents false-negative results dueto strain variability. J. Clin. Microbiol. 42, 1511–1518.
Periasamy, M., Niazi, F.R., Malathi, V.G., 2006. Multiplex RT-PCR, a novel techniquefor the simultaneous detection of the DNA and RNA viruses causing rice tungrodisease. J. Virol. Methods 134, 230–236.
Pico, B., Sifres, A., Nuez, F., 2005. Quantitative detection of Cucumber vein yellowingvirus in susceptible and partially resistant plants using real-time PCR. J. Virol.Methods 128, 14–20.
Plumet, S., Gerlier, D., 2005. Optimized SYBR green real-time PCR assay to quantifythe absolute copy number of measles virus RNAs using gene specific primers. J.Virol. Methods 128, 79–87.
Randen, I., Sorensen, K., Killie, M.K., Kjeldsen-Kragh, J., 2003. Rapid and reliable geno-typing of human platelet antigen (HPA)-1, -2, -3 -4, and -5 a/b and Gov a/b bymelting curve analysis. Transfusion 43, 445–450.
Richards, G.P., Watson, M.A., Kingsley, D.H., 2004. A SYBR green real time RT-PCRmethod to detect and quantitate Norwalk virus in stools. J. Virol. Methods 116,63–70.
Ririe, K.M., Rasmussen, R.P., Wittwer, C.T., 1997. Product differentiation by analysisof DNA melting curves during the polymerase chain reaction. Anal. Biochem.245, 154–160.
Rivera, C.T., Ou, S.H., 1967. Transmission studies of the two strains of rice tungrovirus. Plant Dis. Rep. 51, 877–881.
Ruiz-Ponte, C., Loidi, L., Vega, A., Carracedo, A., Barros, F., 2000. Rapid real-time fluo-rescent PCR gene dosage test for the diagnosis of DNA duplications and deletions.Clin. Chem. 46, 1574–1582.
Ruiz-Ruiz, S., Moreno, P., Guerri, J., Ambrós, S., 2007. A real-time RT-PCR assay fordetection and absolute quantitation of Citrus tristeza virus in different planttissues. J. Virol. Methods 145, 96–105.
Ruiz-Ruiz, S., Ambrósa, S., María del Carmen Vives a, Navarroa, L., Morenoa, P., Guer-ria, J., 2009. Detection and quantitation of Citrus leaf blotch virus by TaqManreal-time RT-PCR. J. Virol. Methods 160, 57–62.
Saito, Y., Iwaki, M., Usugi, T., 1976. Association of two types of particles with tungrogroup of disease in rice. Ann. Phytopathol. Soc. Japan 43, 375.
Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd ed.Cold Spring Harbor Laboratory Press, Plainview, NY.
Sanfac on, H., Wellink, J., Le Gall, O., Karasev, A., van derVlugt, R., Wetzel, T., 2009.Secoviridae: a proposed family of plant viruses within the order Picornaviralesthat combines the families Sequiviridae and Comoviridae the unassigned generaCheravirus and Sadwavirus, and the proposed genus Torradovirus. Arch. Virol.154, 899–907.
Shen, P., Kaniewska, M., Smith, C., Beachy, R.N., 1993. Nucleotide sequenceand genomic organization of Rice tungro spherical virus. Virology 193,621–630.
Sivamani, E., Huet, H., Shen, P., Ong, C.A., de Kochko, A., Fauquet, C., Beachy,R.N., 1999. Rice plants (Oryza sativa L.) containing Rice tungro spherical virus(RTSV) coat protein transgenes are resistant to virus infection. Mol. Breed. 5,177–185.
Soweito, T., Sahi, I., Harahap, Z., 1987. Varietal improvement for resistance to ricetungro virus. In: Proceedings of workshop on Rice tungro virus. Ministry ofAgriculture, AARD Maros Research Institute for Food Crops, Maros, Indonesia.
Sta Cruz, F.C., Hull, R., Azzam, O., 2003. Changes in level of virus accumulation andincidence of infection are critical in the characterization of Rice tungro bacilliformvirus (RTBV) resistance in rice. Arch. Virol. 148, 1465–1483.
Takahashi, Y., Tiongco, E.R., Cabauatan, P.Q., Koganezawa, H., Hibino, H., Omura,T., 1993. Detection of Rice tungro bacilliform virus by polymerase chain reac-tion for assessing mild infection of plants and viruliferous vector leafhoppers.Phytopathology 83, 655–659.
Takahashi, Y., Omura, T., Shohara, K., Tsuchizaki, T., 1991. Comparison of four sero-logical methods for practical detection of ten viruses of rice in plants and insects.Plant Dis. 75, 458–461.
Toriyama, K., 1975. Breeding for resistance to rice virus diseases in South East Asiaand Japan, in: Rice in Asia. The Assoc. Japan Agric. Sci. Soc., Univ. Tokyo Press,600 pp.
Tyagi, H., Rajasubramaniam, S., Rajam, M.V., Dasgupta, I., 2008. RNA-interference inrice against Rice tungro bacilliform virus results in its decreased accumulation ininoculated rice plants. Transgenic Res. 17, 897–904.
Varga, A., James, D., 2005. Detection and differentiation of Plum pox virus using real-time multiplex PCR with SYBR Green and melting curve analysis: a rapid methodfor strain typing. J. Virol. Methods 123, 213–220.
Verma, V., Dasgupta, I., 2007. Sequence analysis of the complete genomes of twoRice tungro spherical virus isolates from India. Arch. Virol. 152, 645–648.
Zhang, X., Wang, X., Zhou, G., 2008. A one-step real time RT-PCR assay for quantifying
Rice stripe virus in rice and in the small brown plant hopper (Laodelphax striatellusfallen). J. Virol. Methods 151, 181–187.
Zhang, X., Zhou, G., Wang, X., 2010. Detection of Wheat dwarf virus (WDV) in wheatand vector leafhopper (Psammotettix alienus Dahlb.) by real-time PCR. J. Virol.Methods 169, 416–419.
