Page 1
DIFFERENTIAL GENE EXPRESSION IN MICE WITH MISEXPRESSION OF Six2
ASSOCIATED WITH FRONTONASAL DYSPLASIA
A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE
UNIVERSITY OF HAWAI‘I IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
IN
BIOMEDICAL SCIENCES (PHYSIOLOGY)
AUGUST 2012
By
Thomas Eugene Hynd, Jr.
Dissertation Committee:
Scott Lozanoff, Chairperson
Vernadeth B. Alarcon
Benjamin C. Fogelgren
Sheri F. T. Fong
Abby C. Collier
Keywords: frontonasal dysplasia, Br mouse, Six2, Six3
Page 2
ii
ACKNOWLEDGEMENTS
Although only my name appears as the author of this dissertation, many people have
contributed to its production and I would like to acknowledge them.
First, I must express my most heartfelt thanks Dr. Scott Lozanoff, whose advice,
patience and guidance made this dissertation possible. Under his mentorship, I have
learned the mindset and skills that will benefit me for the rest of my career.
I am extremely grateful to Dr. Sheri Fong, Dr. Abby Collier and Dr. Vernadeth
Alarcon and the members of the Department of Anatomy, Biochemistry and Physiology
and the Institute for Biogenesis Research. Special thanks to Dr. Ben Fogelgren, Dr. Keith
Fong and Dr. Jack Somponpun for their tremendous support and advice. I must also
thank Mari Kuroyama, John Huckstep, Nora Phillips, Brennan Takagi and Natsumi
Takahashi for their continued support and camaraderie.
I would like to acknowledge the support of the National Institutes of Health (NIH) and
the National Center for Research Resources (NCRR).
Finally, and most of all, I must thank my wonderful and supportive family, who have
laid the foundation for everything I do in life. Their love, support, concern and
encouragement have made me the person I am today. This dissertation is dedicated to
them.
Page 3
iii
ABSTRACT
We have previously described the Br mutant mouse displaying heritable frontonasal
dysplasia. Linkage analysis mapped the mutation near the homeobox transcription factor
Six2, normally expressed in the facial and metanephric mesenchyme during development.
The purpose of this study is to determine expression patterns of Six2, as well as possible
downstream targets of Six2, in the developing midface. The three sets of facial
prominences (medial, lateral, and maxillary) from embryos at gestational day 11.5
(E11.5) were dissected and RNA extracted for qRT-PCR assays and microarray analysis.
Medial nasal prominences (MNP) and E13.5 kidneys were also taken for cell culture.
Results from qRT-PCR indicated Six2 expression is highest in the MNP at E11.5 and
demonstrated haploinsufficient down-regulation in each of the three facial prominence
sets in the Br mouse at this age. Microarray results suggested the misregulation of
several genes in the Br midface, including Six3, another member of the Six family of
transcription factors. MNP and kidney qRT-PCR and immunohistochemistry for Six3
substantiated its upregulation in the microarray. Additionally, Shh and Flrt2 were
confirmed misexpressed in the developing midface, both of which have been previously
shown to play critical roles in craniofacial development. RNA interference on Six2 in
E11.5 MNP and E13.5 embryonic kidney cultures did not demonstrate misexpression of
Six3, suggesting Six2 is not a direct regulator of Six3 and that the Br mutation may be
located in a transcriptional activation domain of Six2 that also inhibits Six3 transcription.
Further sequencing analysis will be needed to confirm the type and location of the Br
mutation.
This work was supported, in part, by NIH R01DK064752 & NCRR 5P20RR024206.
Page 4
iv
TABLE OF CONTENTS
List of Tables............................................................................................................. vi
List of Figures............................................................................................................ vii
List of Abbreviations................................................................................................. ix
Chapter 1. Introduction............................................................................................. 1
Neural crest induction and migration and development of the face.............. 3
Morphogenesis of the cranial base................................................................. 7
Several genetic pathways are implicated in craniofacial malformations....... 8
The Br mouse as a model for abnormal facial development......................... 10
Six2 as a transcription factor..........................................................................16
Known expression patterns of Six2............................................................... 17
Known functions of Six2............................................................................... 18
Known expression patterns of Six3............................................................... 23
Known functions of Six3............................................................................... 24
Objectives...................................................................................................... 25
Chapter 2. Materials and Methods............................................................................ 27
Animals.......................................................................................................... 27
Genotyping..................................................................................................... 27
qRT-PCR for Six2 in facial prominences of WT and Br mice...................... 29
qRT-PCR for Six2 in embryonic and post-natal kidneys............................... 31
Differential gene expression between the WT and Br mouse as
measured by high-throughput microarray analysis............................ 32
Corroboration of p63, Flrt2, Pax6, and Sox2 microarray results via
qRT-PCR........................................................................................... 33
Corroboration of Six3 microarray results via qRT-PCR................................ 35
Corroboration of MNP Six3 qRT-PCR results via IHC................................. 36
qRT-PCR for Six2 and Six3 embryonic Br kidneys....................................... 36
Corroboration of kidney Six3 qRT-PCR results via IHC...............................37
qRT-PCR for Wnt4 in embryonic kidney and MNPs.................................... 37
Six2 expression in a MNP cell culture system as determined by
qRT-PCR and IHC............................................................................. 38
siRNA induced knockdown of Six2 in a MNP cell culture system as
determined by IHC and qRT-PCR..................................................... 40
Kidney organ culture and siRNA................................................................... 41
Chapter 3. Results..................................................................................................... 43
Six2 expression in the facial primordia peaks at E11.5................................. 43
Six2 displays haploinsufficient expression in each of the Br facial
prominences at E11.5......................................................................... 43
Renal Six2 expression decreases during development and is
haploinsufficient in Br mice...............................................................45
DNA microarray analysis suggests misexpression of over three
thousand genes in the Br MNP.......................................................... 47
Page 5
v
Misexpression of p63 suggested in the microarray is not confirmed
upon analysis by qRT-PCR................................................................ 49
qRT-PCR corroborates Six3 is upregulated in E11.5 Br/Br MNPs............... 50
IHC verifies the Six3 protein is upregulated in the E11.5 Br/Br
midface............................................................................................... 52
Six3 is also upregulated in embryonic Br kidneys......................................... 54
IHC verifies the Six3 protein is upregulated in E14.5 Br/+ kidneys............. 54
Pax6 and Sox2, known downstream targets of Six3 and
upregulated in the microarray, are not confirmed to be
misexpressed upon analysis by qRT-PCR......................................... 54
Shh is mildly upregulated in the Br/Br MNP during midfacial
morphogenesis................................................................................... 57
Flrt2 is significantly downregulated in the Br/Br MNP................................ 57
Wnt4 is not misexpressed in the facial primordia or the developing
kidney of Br mouse............................................................................ 59
Six2 is expressed in MNP explant cell culture and can be knocked
down using siRNA............................................................................. 60
Six3 expression is unchanged when Six2 is knocked down in MNP
and kidney organ cultures.................................................................. 67
Chapter 4. Discussion............................................................................................... 73
Appendix. Supplemental Data.................................................................................. 89
References.................................................................................................................. 102
Page 6
vi
LIST OF TABLES
Table Page
3.1 Descriptive statistics derived from Six2 and Ap-2α double-
stained MNP cell cultures in Figure 3.17...........................................65
SD.1 Primers used for qRT-PCR assays............................................................... 90
Page 7
vii
LIST OF FIGURES
Figure Page
1.1 Human child affected with frontonasal dysplasia........................................ 2
1.2 E11.5 +/+ mouse embryo during dissection............................................... 6
1.3 Craniofacial and renal morphology in newborn, 3H1 mice......................... 11
1.4 Linkage analysis and microsatellite recombination data............................. 12
1.5 In situ hybridization for Six2 in whole-mount E11.5 embryos.................... 13
1.6 Six2 expression using immunofluorescence in the midface at E11.5.......... 14
1.7 Six2 expression using immunofluorescence in the metanephric
mesenchyme at E11.5 and E14.5....................................................... 15
2.1 Breeding strategy for obtaining Br/Br mice suitable for genotyping.......... 28
3.1 Relative, temporal Six2 expression in the facial primordia......................... 44
3.2 Relative Six2 expression between facial prominences in Br mice............... 45
3.3 Relative, temporal Six2 expression in the developing kidney of
WT and Br mice................................................................................. 46
3.4 Downregulation confirmation of Six2 in the MNP RNA pool for
microarray analysis............................................................................ 47
3.5 Microarray data shown as comparisons between replicate +/+ and
Br/Br runs.......................................................................................... 48
3.6 Relative p63 expression in E11.5 Br MNPs................................................ 51
3.7 Relative Six3 expression in E11.5 Br MNPs............................................... 52
3.8 Immunofluorescent staining of Six3 in E11.5 WT and Br/Br
midfaces............................................................................................ 53
3.9 Relative Six2 and Six3 expression in E14.5 Br/+ kidneys........................... 55
3.10 Immunofluorescent staining of Six3 in E13.5 WT and Br/+
kidneys............................................................................................... 56
3.11 Relative Pax6 and Sox2 expression in E11.5 Br/+ MNPs........................... 58
3.12 Relative Shh expression in E11.5 Br/Br MNPs........................................... 59
3.13 Relative Flrt2 expression in E11.5 Br/Br MNPs ........................................ 60
3.14 Relative Wnt4 expression in E13.5 Br/Br kidneys and E11.5 Br/Br
MNPs................................................................................................. 61
3.15 Relative Six2 and Ap-2α expression in untreated MNP cell cultures.......... 62
3.16 Immunofluorescent staining for Six2 and Ap-2α in MNP cell culture........ 63
3.17 Representative tessellations of cultures double-stained for Six2
and Ap-2α........................................................................................... 64
3.18 Relative Six2 expression in MNP cell culture following incubation
with test dilutions of Six2 siRNA...................................................... 66
3.19 qRT-PCR and immunofluorescent staining of Six2 in MNP cell culture
following incubation with Six2 siRNA.............................................. 67
3.20 qRT-PCR and immunofluorescent staining of Ap-2α in MNP cell
culture following incubation with Six2 siRNA.................................. 68
Page 8
viii
3.21 Relative Six2 and Six3 expression in MNP cell culture following
incubation with Six2 siRNA...............................................................69
3.22 Relative Six2 expression in untreated MNP cell and kidney organ
cultures............................................................................................... 71
3.23 Relative Six2 and Six3 expression in kidney organ culture following
incubation with Six2 siRNA...............................................................72
4.1 Summary of relative Six2 and Six3 expression in E11.5 Br MNPs............. 83
4.2 Summary of relative Six2 and Six3 expression in E14.5 Br kidneys........... 83
4.3 Threshold cycles of Gapdh in siRNA kidney cultures used for
normalization in Figure 3.23............................................................. 86
SD.1 Photograph of a 4% metaphor gel used for genotyping............................... 89
SD.2 Specificity and efficiency test for the Gapdh primer used the
housekeeping gene for all qRT-PCR assays...................................... 91
SD.3 Specificity and efficiency test for the Six2 primer used in qRT-PCR
assays................................................................................................. 92
SD.4 Specificity and efficiency test for the p63 primer used in qRT-PCR
assays................................................................................................. 93
SD.5 Specificity and efficiency test for the Six3 primer used in qRT-PCR
assays................................................................................................. 94
SD.6 Specificity and efficiency test for the Pax6 primer used in qRT-PCR
assays................................................................................................. 95
SD.7 Specificity and efficiency test for the Sox2 primer used in qRT-PCR
assays................................................................................................. 96
SD.8 Specificity and efficiency test for the Shh primer used in qRT-PCR
assays................................................................................................. 97
SD.9 Specificity and efficiency test for the Flrt2 primer used in qRT-PCR
assays................................................................................................. 98
SD.10 Specificity and efficiency test for the Wnt4 primer used in qRT-PCR
assays................................................................................................. 99
SD.11 Specificity and efficiency test for the Ap-2α primer used in qRT-PCR
assays................................................................................................. 100
SD.12 Control immunostaining for the Six3 primary antibody used in IHC......... 101
Page 9
ix
LIST OF ABBREVIATIONS
Ap-2 activating enhancer binding protein 2
Bmp bone morphogenetic protein
bp base pair
Br Brachyrrhine
cDNA complementary DNA
ChIP chromatin immunoprecipitation
CNCM cranial neural crest mesenchyme
C(t) threshold cycle
DAPI 4',6-diamidino-2-phenylindole
E embryonic day
EMSA electrophoretic mobility shift assay
Eya eyes absent
FEZ frontonasal ectodermal zone
Fgf fibroblast growth factor
Fgfr2 fibroblast growth factor receptor 2
Flrt2 fibronectin leucine-rich transmembrane protein 2
FND frontonasal dysplasia
FNP frontonasal process
Gapdh glyceraldehyde 3-phosphate dehydrogenase
Gdnf glial cell line derived neurotrophic factor
HD homeodomain
IACUC Institutional Animal Care and Use Committee
IHC immunohistochemistry
kb kilobases
LNP lateral nasal prominence
MNP medial nasal prominence
MSCGM Mesenchymal Stem Cell Growth Media
MxP maxillary prominence
NDS normal donkey serum
P postnatal day
Pax6 paired box 6
PBS phosphate buffered saline
PCR polymerase chain reaction
PFA paraformaldehyde
qRT-PCR quantitative real-time polymerase chain reaction
RH renal hypoplasia
RNAi RNA interference
RT room temperature
SD six domain
Shh sonic hedgehog
siRNA small interfering RNA
Sox2 SRY-box 2
TS Theiler stage
WT wild-type
Page 10
1
CHAPTER 1
INTRODUCTION
The development of the mammalian primary palate is crucial for the normal formation
of the midface. Malformations of the midface yield catastrophic results for the fetus:
hypertelorism, broad nasal root, cleft nose and lip, absence of a nasal tip and cranium
bifidum (Gorlin et al. 2001), leading to difficulty in breathing, suckling, mastication and
speech formation. Two types of dysplasia resulting from the improper development of
the midfacial primordia have been previously described:
1. DeMyer sequence: frontonasal deformity associated with hypotelorism,
holoprosencephaly and facial deformity, ranging from cyclopia to midline facial
cleft with premaxillary agenesis (DeMyer et al., 1964; DeMyer 1967; Sedano et
al., 1970; Jaramillo et al., 1988)
2. Median Cleft Face syndrome: median cleft lip associated with nasal deformity,
hypertelorism, with little to no brain deformity, with the exception of corpus
callosum agenesis (Millard and Williams, 1968; Weimer et al., 1978).
“Median Cleft Syndrome,” first described by DeMyer in 1967, is a descriptive, diagnostic
term for the condition in which these features are present. More recently, “Frontonasal
Dysplasia” has refined the diagnosis as two or more of the following: (1) ocular
hypertelorism, (2) broadening of the nasal root, (3) median facial cleft affecting the nose
and/or upper lip and palate, (4) unilateral or bilateral clefting of the alae nasi, (5) lack of
formation of the nasal tip, (6) anterior cranium bifidum occultum and (7) a V-shaped or
Page 11
2
widow’s peak frontal hairline (Figure 1.1; DeMyer, 1967; Sedano et al., 1970; Sedano
and Gorlin, 1988). The Sedano classification of FND grades the severity of the condition
to four degrees (types) based on the presence or absence of median facial clefting and
lateral notching of the alae nasi (Sedano et al., 1970):
A. Hypertelorism, broad nasal root and absent nasal tip sans median facial clefting
B. Hypertelorism, broad nasal root and absent nasal tip with the presence of a
median facial groove affecting the nose and/or upper lip and/or palate
C. Hypertelorism and broad nasal root with uni- or bilateral notching of the alae
nasi
D. Median facial groove, in addition to notching of the alae nasi
Figure 1.1 Human child affected with frontonasal dysplasia. Note
typical, external phenotypic characteristics of FND: hypertelorism, broad
nasal root, and absence of a nasal tip.
Page 12
3
Craniofacial anomalies comprise at least one-third of all birth defects (Trainor, 2005).
Orofacial clefts, the most common human craniofacial malformation, are seen in as many
as 1.2 births per 1000, worldwide (Mossey and Little, 2002). More specifically, Apesos
and Anigian (1993) reported FND has an occurrence of 0.43-0.73% in the human cleft
patient population. Considering the number and complexity of the tissues involved in
craniofacial morphogenesis, it is not surprising these abnormalities account for the
greatest number of congenital malformations in humans.
Neural crest induction and migration and development of the face
Induction of the neural crest mesenchyme takes place at the neural plate border,
positioned between the surface ectoderm and neural plate of the developing embryo. The
induction process consists of an epithelial-to-mesenchymal transition of neuroepithelial
cells, delamination and emigration from the neural tube, a progression that entails
considerable cell adhesion changes. As emigration commences at E8.5, the neural crest
can be divided craniocaudally into cranial, cardiac, vagal and trunk (Jiang et al., 2002).
Each of these divisions migrates anteriorly, along a species- and region-specific pathway
to contribute to specific tissues that is characteristic of their origin. Although neural crest
properties are uniquely species-specific, an overall generalized pattern of CNCM
development is highly conserved in all vertebrates.
Upon their arrival in the upper jaw primordia, the CNCM proliferate to form the
paired MNPs, LNPs and MxPs (Lumsden et al., 1991; Schilling and Kimmel, 1994;
Rossel and Capecchi, 1999). These three sets of prominences are derived from the
migrating CNCM from the midbrain and the first two rhombomeres. The migration
Page 13
4
pattern of the neuroectodermally-derived CNCM was first demonstrated experimentally
by Johnston (1964) using tritiated H-thymidine-labeled CNCM from the mid- and
forebrain of donor embryos that were explanted to the analogous location of the host
embryo. This experiment demonstrated the significant contribution to the formation of
the midfacial prominences by the CNCM. Johnston (1966) again confirmed the
importance of the CNCM to the formation of the midface by removing neural crest cells
before their migration which resulted in severe craniofacial defects involving MNP.
The rate of post-migratory proliferation of the CNCM is maintained by an interaction
at the epithelial-mesenchymal interface. Minkoff (1991) found this interaction, mediated
by developmental factors, is significant for the sustained growth of each of the elements
of the facial primordia. During the early stages of primary palate development, nearly all
mesenchymal cells are in the division cycle with short generation times. However, as
morphogenesis proceeds, some mesenchymal cell populations retain the cell cycle
characteristics of the progenitors while others in adjacent regions experience slowing of
the cycle, some even becoming dormant. Minkoff (1991) suggested this phenomenon of
differing division cycle characteristics is based on the proximity of the mesenchymal
populations to the overlying epithelium. In vitro organ culture studies using epithelial-
mesenchymal separation/recombination experiments showed the viability of the
mesenchyme was dependent on the presence of the epithelium (Minkoff, 1991).
Several molecular markers for the neural crest have been identified, including the
transcription factors from the Snail, Zic, Hox, Pax, Msx, Sox, Fox, bHLH and Ap-2 gene
families (Knecht and Bronner-Fraser, 2002; LaBonne and Bronner-Fraser, 1999; Trainor
and Krumlauff, 2001). Mitchell et al. (1991) identified Ap-2α as an important regulator
Page 14
5
of the neural crest after examining its expression pattern in the developing mouse. Ap-
2α, as a typical member of the Ap-2 family which also includes Ap-2β, -2γ, -2δ and -2ε,
is a basic-helix-span-helix transcription factor capable of binding to the DNA consensus
sequence 5’-GCCNNNGGC-3’ (McPherson and Weigel, 1999; Mohibullah et al., 1999;
Zhao et al., 2001; Cheng et al., 2002; Feng and Williams, 2003). Expression of Ap-2α
has been witnessed in the premigratory neural crest, with expression continuing during
migration (Mitchell et al., 1991). Some tissues, including the frontonasal process,
continue to express Ap-2α during their morphogenesis. The importance of Ap-2α
expression in the developing face was elucidated when Schorle et al. (1996) described an
Ap-2α-/-
mouse that displayed severe craniofacial defects, including failure of the
mandible to fuse at the midline and clefting of the upper jaw and midface caused by
hypoplastic development of the facial primordia (Nottoli et al., 1998).
The midface and primary palate develop as a product of two events. The fusion of the
three sets of facial prominences at the transient nasal fin forms the basis of the primary
palate by providing continuity of the upper jaw (Figure 1.2.; Diewert and Wang, 1992).
Second, the merging of the bilateral MNPs forms the philtrum of the upper lip, the tip of
the nose and completes the primary palate. The secondary palate, derived from a
different embryologic origin and responsible for the development of the hard palate
posterior to the incisive foramen and soft palate, forms later via different environmental
and genetic factors and likely emerges through a different set of mechanisms.
The morphogenesis of the human primary palate begins at roughly 41 days
postfertilization (O’Rahilly, 1978) and in the mouse at approximately 10 days and 18
hours postfertilization (Reed, 1933; Trasler, 1968). Each of the paired facial prominen-
Page 15
6
Figure 1.2 E11.5 +/+ mouse embryo during dissection. Anterior view
showing the MNP, LNP and MxP. NF, nasal fin. MAND, mandibular
prominence. Bar = 500 μm.
ces grows and develops with characteristic patterns. The LNPs increase in size in a
horizontal pattern while the anterior halves of the MxPs increase in size in preparation of
fusing with the MNPs and contributing the lateral aspect of the primary palate (Diewert
and Wang, 1992). The cornerstone of the primary palate, the upper lip, forms, in part,
from the MNPs and MxPs (Diewert and Lozanoff, 1993). The MNPs elongate vertically
by up to seven times their original length while narrowing to half the width. The
continued growth and migration of the CNCM underlying the epithelium of the bilateral
MNPs eliminates the distance between the paired MNPs, distending the epithelium
(simultaneously forming the nasal pits which are continuous with the stomodeum at this
point) and merging the two structures (Patten, 1961; Sperber, 2002). This merging at the
facial midline forms the philtrum, or infranasal depression, of the upper lip (Diewert and
Shiota, 1990; Diewert et al., 1993; Diewert and Lozanoff, 1993; Rude et al., 1994).
Closure of the palate requires the fusion of the lateral aspect of the MNPs with the MxPs
at the nasal fin and the apoptotic disintegration of the epithelial seam to achieve
mesenchymal confluence and provide continuity of the upper lip (Shuler, 1995). This
Page 16
7
completion of the lip also separates the nasal pits from the stomodeum. Proximodistal
growth of the fused MNPs, LNPs and MxPs (now collectively termed the FNP) is
established by the formation of the frontonasal ectodermal zone (Marcucio et al., 2005).
Morphogenesis of the cranial base
The bones of the murine cranial base (ethmoid, presphenoid, basisphenoid and
basioccipital bones) are derived from two different embryologic origins in accordance to
their position relative to the hypophysis. Posterior to the hypophysis, the mesodermally-
derived parachordal cartilage is induced by, and develops adjacent to, the notochord
beginning at E11 (Pourquié et al., 1993; McBratney-Owen et al., 2008). Anterior to the
hypophysis, CNCM populate the presumptive anterior cranial base following their
migration under the forebrain from the frontonasal process (Jiang et al., 2002;
McBratney-Owen et al., 2008). Within the presumed nasal capsule, the paired trabecular
cartilages condense as early as E13, appearing as a single cartilaginous rod that extends
anteriorly to contribute to the nasal septum at the cranium’s basal midline (Depew et al.,
2002). By late E13, the lateral walls of the nasal capsule are defined by the presence of
the paranasal cartilages and the hypophyseal cartilages emerge inferior to the developing
pituitary gland. The trabecular cartilages become evident caudally at E14, in addition to
the appearance of the mesoderm-derived hypochiasmatic cartilages in the optic region,
which link the postoptic roots with the body of the presphenoid at birth. Also at E14, the
midline fusion of the hypophyseal cartilages occurs. By E16, the murine chondrocranium
is fully formed. At E17.5, the basisphenoid begins to ossify, derived from the
hypophyseal cartilage. However, there is no evidence of ossification of the more anterior
Page 17
8
presphenoid bone from the trabecular cartilage at this time (McBratney-Owen et al.,
2008).
Rudnicki and Brown (1997) determined that positional information must be tendered
to the undifferentiated mesenchyme that forms the chondroblasts responsible for the
cartilaginous template of the bones of the cranial base. Several signaling molecules, such
as Shh and Bmp, have been described that act to precisely control chondrogenesis by
mediating the differentiation of the mesenchyme and, subsequently, the size and shape, of
endochondral bones (Hu and Helms, 1999; Reddi, 1994, Abzhanov et al., 2004).
Several genetic pathways are implicated in craniofacial malformations
The differentiation and growth of the mesenchymal cells comprising the facial
primordia and the closure of the primary palate and upper jaw are under the control of
specific spatial and temporal signal transduction pathways, particularly within the FEZ.
Shh, Fgf and Bmp are expressed in the FEZ which act to pattern craniofacial
development (Hu and Marcucio, 2009; Bachler and Neubüser, 2001; Firnberg and
Neubüser, 2002; Zhang et al., 2002).
Shh is crucial for the normal development of the anterior face as it directs left-right
and dorsoventral patterning (McMahon et al., 2003). Within the craniofacial region, Shh
signaling is confined to the left and right MNPs where it binds to Ptch1, its cell surface
receptor, and initiates a signal transduction that concludes with the Gli family of
transcription factors activating downstream gene expression (Hu and Marcucio, 2008,
McMahon et al., 2003). A loss-of-function of Shh was shown to lead to blocked
outgrowth of the frontonasal mass, most likely caused neural crest mesenchymal cell
Page 18
9
death (Hu and Helms, 1999; Ahlgren and Bronner-Fraser, 1999). Holoprosencephaly and
cyclopia have also been noted as a consequence of a loss-of-function of Shh (Cordero et
al., 2004, Hammerschmidt et al., 1996; Cohen and Sulik, 1992). Interestingly, ectopic
Shh expression in the facial mesenchyme brought about mediolateral expansion and
overgrowth in that region (Hu and Helms, 1999).
Fgfs are a family of 22 signaling molecules that play a role in embryonic patterning,
cell proliferation and differentiation (reviewed in Itoh and Ornitz, 2004). During facial
morphogenesis, Fgf8 is expressed around the nasal pits following the outgrowth of the
nasal prominences (Bachler and Neubüser, 2001). In experiments by Firnberg and
Neubüser (2002), Fgf8 was shown to stimulate mesenchymal proliferation and maintain
mesenchymal gene expression in frontonasal explant cultures. These data suggest Fgf8
not only engages in the nasal epithelial/mesenchymal interaction, but also its presence in
the facial primordia regulates its outgrowth (Jiang et al., 2006). Moreover, inactivation
of Fgf8 in the mid-facial ectoderm leads to median cleft of the face, further supporting
the claim that Fgf8 is required for the development of this region (Firnberg and
Neubüser, 2002).
Bmps appear to be involved in upper lip morphogenesis via their interaction with the
homeobox genes Msx1 and Msx2 (reviewed in Jiang et al, 2006). In particular, Bmp2
and Bmp4 expression in the facial ectoderm showed a strong correlation with Msx1 and
Msx2 expression in the underlying mesoderm. Ectopic expression of either Bmp2 or
Bmp4 in the chick embryo up-regulated Msx1 and Msx2, suggesting the latter functions
downstream of the former (Barlow and Francis-West, 1997). Msx1 knockout
experiments performed by Satokata and Maas (1994) and Zhang et al. (2002) showed
Page 19
10
shortened maxilla and mandibles in the mutants. However, the palatal phenotype could
be rescued using a Bmp4 transgene under Msx1 promoter control (Zhang et al., 2002).
These data provided strong evidence that the Bmp/Msx pathway is crucial for facial
morphogenesis.
The Br mouse as a model for abnormal facial development
A mouse mutant on the 3H1 background strain with FND has been previously
identified (Lozanoff, 1993). The FND phenotype is associated with the semidominant Br
mutation, induced during the testing of chromosome structure in response to the
overexposure of gamma radiation (Searle, 1966). The Br mouse displays maxillary
prognathism (or more accurately, retrognathism; similar to a Class III malocclusion in
humans), a severe median facial cleft and ocular hypertelorism, identified as FND in
accordance with the diagnostic criteria described previously by DeMyer (1967)
(Lozanoff, 1993) (Figure 1.3). Three external craniofacial morphologies were
appreciated in the offspring of reciprocal crosses of 3H1Br/+ matings: +/+ (normal
midfacial morphology), Br/+ (midfacial retrognathia) and Br/Br (median midfacial cleft).
Newborn Br/Br mice die soon after birth, suggesting their inability to suckle as a result of
the cleft (McBratney et al., 2003). Moreover, Br/Br mice do not result from reciprocal
matings of 3H1 Br/+ and 3H1 +/+ mice. These data demonstrate the Br mutation has a
high degree of penetrance and also reveals the mutation as autosomal semidominant (Ma
and Lozanoff, 1993).
Linkage analysis with novel primers narrowed the critical region for the Br mutation
to a 170.5 kb sequence on distal murine chromosome 17. Within this critical region, the
Page 20
11
Figure 1.3 Craniofacial and renal morphology in newborn, 3H1 mice.
WT, 3H1 mice (A, B) demonstrate normal facial and renal morphology
compared to 3H1 Br/Br (C, D), which exhibit frontonasal dysplasia and
RH. a, adrenal gland; k, kidney. Scale bar = 5 mm in A, 1 mm in B.
Permission to reproduce this figure courtesy of Fogelgren et al., 2008.
only known gene is the homeobox transcription factor Six2 (Figure 1.4; Fogelgren et al.,
2008). However, it appears the Br mutation affects the transcriptional regulation of Six2
and not the Six2 mRNA molecule itself, as Six2 was reported in the lens of Br mutants via
whole-mount in situ hybridization (Figure 1.5; Fogelgren et al., 2008). A roughly 900
base pair sequence of the Six2 promoter was shown to drive some basal level of Six2
expression when cloned upstream to a lacZ reporter gene. In this experiment, lacZ was
expressed in the metanephric mesenchyme of the embryonic kidney, as well as the first
branchial arch (Brodbeck et al., 2004; Kutejova et al., 2005). However, Fogelgren et al.
Page 21
12
Figure 1.4 Linkage analysis and microsatellite recombination data. Br
mutation mapping data using microsatellite markers along mouse
chromosome 17. Shown are both Cast and BALB/c backcrosses, where X
is number of recombinants among N total backcrossed mice analyzed.
The calculated distance (in centimorgans) and LOD scores are shown on
the right. (B) Schematic of defined critical region on mouse chromosome
17 for the Br mutation based on the results of microsatellite linkage
analysis. Within the 170.5 kb critical region, there is only one gene: Six2.
Permission to reproduce this figure courtesy of Fogelgren et al., 2008.
(2008) detected no mutation in this ~900-bp promoter region when sequenced in the Br
mouse and postulated the Br mutation must be located at a yet unidentified regulatory
region upstream or downstream of Six2 which causes, not a complete loss-of-function,
but a downregulation, or misexpression, of Six2 in tissues where it is endogenously
expressed. Specifically, normal Six2 expression in the developing midface and kidney is
absent in Br/Br mice (Figures 1.6 and 1.7).
Ma and Lozanoff (1993) characterized the morphology of each of the Br phenotypes.
Perhaps the most striking feature of the postnatal Br/Br phenotype was the morphology
of the anterior cranial base in which many of the major midline structures were absent
(nasal septum, presphenoid and presphenoidal synchondrosis) and the malformation of
Page 22
13
Figure 1.5 In situ hybridization for Six2 in whole-mount E11.5 embryos.
(A) In the WT mouse, Six2 is endogenously expressed in the midface,
facial prominences, first branchial arch and urogenital system. (B) In the
Br/Br, Six2 expression is nearly absent in these tissues, while it is
ectopically expressed in the lens. Permission to reproduce this figure
courtesy of Fogelgren et al., 2008.
the basisphenoid posteriorly. Additionally, the primary and secondary palates did not
form the in the Br/Br mutant. Several signaling pathways, such as Bmp and Shh, have
been described that act to precisely control chondrogenesis by mediating the
differentiation of the mesenchyme and, subsequently, the size and shape, of endochondral
bones (Reddi, 1994, Abzhanov et al., 2004; Hu and Helms, 1999). Lozanoff et al. (1994)
observed newborn 3H1 Br/+ mice to have significantly smaller anterior cranial base
surface areas and volumes compared to the 3H1 WT. This discrepancy was attributed to
a restricted pattern of cellular proliferation in the anterior cranial base. Similarly, Singh
et al. (1998) postulated that the secondary palatal defects seen in Br/Br mutants resulted
from a hypoplastic condition caused by the failure of the midline structures to grow du-
Page 23
14
Figure 1.6 Six2 expression using immunofluorescence in the midface at
E11.5. (A, C) Six2 expression is localized in the MNP of WT mice,
extending as far posterior as the chondrocranium. (B, D) Six2 expression
is absent from these same structures in the Br/Br mutant. LNP, lateral
nasal prominence; MNP, medial nasal prominence; OE, olfactory
epithelium. Permission to reproduce this figure courtesy of Fogelgren et
al., 2008.
ring the time of normal palate and chondrocranial development, rather than an absence of
these structures.
Page 24
15
Figure 1.7 Six2 expression using immunofluorescence in the metanephric
mesenchyme at E11.5 and E14.5. (A) Six2 staining is localized in the
condensing mesenchyme around the initial braches of the ureteric bud in
+/+. (B) In Br/Br, Six2 staining was not detected in the metanephric
mesenchyme. Six2 was detected in the nephrogenic zone (perimeter) of
the developing kidney of WT embryos (C) while its expression was absent
in the same tissue of Br/Br littermates (D). Permission to reproduce this
figure courtesy of Fogelgren et al., 2008.
Page 25
16
Six2 as a transcription factor
The Six family of proteins are murine homologs of the Drosophila sine oculis gene
and are comprised of six members, each with a 60 amino acid N-terminal SD and a 110
amino acid central HD, both of which are required for DNA binding (Kawakami et al.,
1996a,b). Based on the similarity of the amino acid sequences in the SD and HD, the Six
family can be subdivided into three groups: Six1/2, Six3/6 and Six4/5 (Kawakami et al.,
2000). A unique feature characteristic of the Six HD is the replacement of an arginine at
position five and a glutamine at position 12; each of these highly conserved residues are
typical of most homeodomains. Since arginine at position five usually is involved with
contacting the DNA homeobox binding core sequence TAAT, this may explain why Six
proteins do not bind to this core sequence (Kawakami et al., 1996b).
Kawakami et al. (1996a) and Ohto et al. (1999) showed the SD of Six2 is capable of
two functions: (1) binding to specific DNA sequences, in cooperation with the
homeodomain, and (2) the interaction with Eya family members for its localization to the
nucleus. In addition, Brodbeck et al. (2004) demonstrated the SD also directs the
localization of Six2 to the nucleus and provided evidence that any protein with the SD
would also localize to the nucleus.
Six2’s function as an activator of transcription while in the nucleus was characterized
by linking the Six2 C-terminus with a reporter gene (Brodbeck et al., 2004). This is also
evidenced by the anatomy of the C-terminus itself, in which the last 113 amino acids of
the C-terminus contain a high serine and proline content, typical of most transcriptional
activation domain sequences. However, additional studies, that included the full-length
Six2 protein including the SD, showed repression of transcription. This was explained by
Page 26
17
the SD’s ability to arbitrate interactions with transcriptional corepressors, such as the
groucho family, as described by Lopez-Rios et al. (2003). This phenomenon suggests
that the entire Six family, including Six2, may act as activators or repressors of
transcription, depending on the presence of cofactors present or the promoter context
(Brodbeck et al., 2004).
Known expression patterns of Six2
Via in situ hybridization, Six2 expression has been shown to be restricted to specific
developmental stages and locations, including the head mesenchyme (Oliver et al.,
1995a). Ohto et al. (1998) gives an exceptional spatial expression timeline for the
appearance of Six2 in the developing embryo using whole-mount and section
immunohistochemistry. The first indication of Six2 expression materialized at E8.5 in
the mesoderm of the hindbrain, however, Six2 expression in the head mesenchyme was
delayed until E9.5 (Ohto et al., 1998). At E10.5, the manifestation of Six2 in the
precursor to the developing kidney, the nephrogenic cords, was appreciated. By E11.5,
Six2 expression increased near the tip of the first branchial arch and in the nasal cavity.
Staining in most tissues remained until E12.5, however staining in the nephrogenic zone
lingered until E13.5. Additionally, Six2 transcript has been reported in the maxillary and
mandibular mesenchymal tissues at E13.5 (Nonomura et al., 2010). Staining in the
frontal region of the head did not subside until E14.5.
The Six family of transcription factors appears to work in combination with the Eya
family of proteins (Zou et al., 2004; Purcell et al., 2005). Eya genes in the mouse and
human have been identified as homologous to the Drosophila eya gene, which is
Page 27
18
responsible for the formation of compound eyes (Bonini et al., 1993). The N-terminal
region of the Eya family of proteins each possess transactivation properties for their
interaction with transcription factors due to the lack of a DNA binding domain of their
own (Xu et al., 1997a; Pignoni, 1997). The conserved Eya domain is composed of 271
amino acids and is thought to be essential, in addition to the conserved Six domain, for
the interaction of Eya and Six family members (Xu et al., 1997a,b). Of the four mouse
Eya homologues identified, each has a specific region of expression in the developing
embryo: Eya1 and Eya2 are expressed in the cranial placodes, branchial arches and
central nervous system (Xu et al., 1997b), and Eya3 expression is the same as Eya1 and
Eya2 with the exception of the cranial placodes (Xu et al., 1997b). At the time of
midfacial merging of the MNPs at E11.5, Eya4 is expressed as a broad strip in the
craniofacial mesenchyme above the nasal process (Borsani et al, 1999). By E12.5, Eya4
expression appears in the urogenital system, as well as continuing its presence in the
developing face. Even though the biochemical nature of Eya4 has been poorly
investigated due to its relatively recent discovery, its similarities with other members of
the Eya family (such as no DNA binding activity) suggest its role as a coactivator of
transcription (Xu et al., 1997a).
Known functions of Six2
Recently, there have been many studies aimed at identifying the physiological
functions of Six2 during kidney morphogenesis. Targets of Six2 have been identified in
the metanephric mesenchyme of the developing kidney, including Gdnf, as well as the
Six2 promoter, itself. In each case, Six2 acts as the transcription factor responsible for
Page 28
19
the initiation of mRNA synthesis (Brodbeck et al., 2004). Gdnf stimulates one half of the
reciprocal induction of renal morphogenesis by inducing branching of the nephric duct
and establishing the ureteric bud. Gdnf also induces secondary branches once the ureteric
bud has entered the metanephric mesenchyme (Sainio et al., 1997). Gdnf -/-
mice
demonstrated renal agenesis and died shortly after birth, as did mice deficient for the
Gdnf receptor, ordinarily located on the bud epithelium (Moore et al., 1996; Pichel et al.,
1996; Sánchez et al., 1996; Gilbert, 2000). The newly formed ureteric buds induce the
second half of the reciprocal relationship by initiating the condensation of the
metanephric mesenchyme around the ureteric bud tips (Grobstein, 1955).
Self et al. (2006) described an in vivo Six2 knockout in which the reciprocal induction
of the metanephric mesenchyme and ureteric buds is disrupted, elucidating Six2’s role in
ensuring progenitor renewal during nephrogenesis by inhibiting tubulogenesis. These
knockout mice demonstrated RH due to an inadequate supply of mesenchymal
progenitors. That is, in WT mice, selected mesenchymal cells are induced to undergo the
mesenchymal-to-epithelial transition while others remain mesenchymal and proliferate in
order to generate nephrons at a later stage. In the knockout, the induction of the
metanephric mesenchyme occurred prematurely and ectopically, in addition to increased
apoptosis, resulting in a diminished pool of mesenchymal precursors by as much as 40%
compared to the WT. TUNEL staining detected increased apoptosis in both the
mesenchyme and the stromal cell populations. In kidney organ culture, Self et al. also
demonstrated that a gain-of-function of Six2 inhibits the mesenchymal-to-epithelial-
transition. Additionally, Six2-expressing progenitors give rise to multiple nephric cell
types for the duration of nephrogenesis and these progenitors are maintained by self-
Page 29
20
renewal (Kobayashi et al., 2008). These experiments were carried out by intercrossing
Six2-Cre mice with mice carrying a loxP-flanked DNA STOP sequence upstream of a
lacZ reporter gene. Upon removal of the STOP sequence by Cre recombinase under the
control of the Six2 promoter, lacZ is expressed in the descendants of the Six2-positive
progenitors.
Self et al. (2006) also showed Wnt4 expression was upregulated in the Six2 knockout.
Wnt4 has previously been shown to induce nephrogenesis in the metanephric
mesenchyme, it is logical to assume Six2 suppresses this inductive factor (Kispert et al.,
1998; Self et al, 2006). Another member of the Wnt family, Wnt9b, is secreted from the
ureteric buds and upregulates Wnt4 in the renal progenitors (Carroll et al., 2005).
Evidence of a relationship between Six2 and Wnt9b during nephrogenesis has also been
suggested. Previously, it was thought Wnt9b is not involved in the renewal of renal
progenitors due to the absence of known Wnt9b downstream targets in uninduced
progenitors. This was thought to be attributed to Six2’s repression of the Wnt9b signal
(Kobayashi et al., 2008). However, it now appears that Six2 acts in cooperation with
Wnt9b in signaling renal progenitors to mediate proliferation and self-renewal in the
same cell type (Karner et al., 2011). It was found that when Wnt9b, signaling through
the canonical Wnt pathway involving β-catenin, is expressed alone, the metanephric
mesenchyme differentiates (epithelializes). However, when Wnt9b is expressed in cells
that also express Six2, renewal of the mesenchyme ensues. Karner et al. (2011)
conjectured that Six2 may regulate other genes that alter the cellular response to
Wnt9b/β-catenin, or Six2 could directly interact with β-catenin to regulate target gene
Page 30
21
expression involving proliferation. Either of these hypotheses would support Wnt9b’s
dual role in promoting differentiation and self-renewal in the same type of cell.
Three years after the original study, Self et al. (2009) determined a role for Six2
during gastrointestinal development using the same Six2-/-
mouse. After examining Six2-
null embryos, it was concluded that amniotic fluid in the stomach was due to
duodenogastric reflex due to a nonfuctional or absent pyloric sphincter. Normal
morphogenesis of the murine pyloric sphincter includes a thickening of a region of
smooth muscle at the junction of the stomach and small intestine at E14.5. However, in
the knockdown mouse, this thickening and narrowing of the gut tube was absent with no
evidence of ectopic apoptosis. Based on these findings, Self et al. proposed Six2 controls
smooth muscle growth during the pyloric sphincter development by regulating a genetic
pathway conserved between chick and mouse. This pathway disruption includes an
upregulation of Bmp4 and downregulation of its modulator, Gremlin, while Nkx2.5 and
Sox9 are also downregulated. It has previously been shown Bmp4 is normally expressed
in the developing chick gut; however, its expression in the stomach is negligible (Moniot
et al., 2004). To that, studies have shown Bmp4 misexpression in the chick stomach
results in thinner-walled stomachs than WT counterparts (Moniot et al., 2004).
Moreover, in chick embryos where Bmp4 constructs were injected, Nkx2.5 and Sox9
expression was augmented and microvilli characteristic of the pyloric sphincter
developed (Smith et al., 2000; Moniot et al., 2004; Theodosiou and Tabin, 2005).
Although Six2 is expressed in the head mesenchyme, very little, in fact, is known of
the physiological relevance of Six2 expression during craniofacial morphogenesis.
Fogelgren et al (2008) suggested Six2 may play a role chondrocranial development of the
Page 31
22
cranial base, based on an observation by Ma and Lozanoff (1999), in which in CNCM
proliferation was decreased in tissues which ultimately form the trabecular and orbital
cartilages in mice that misexpress Six2. Moreover, Fogelgren et al. (2008) also
concluded that due to this decrease in CNCM proliferation (probably due to decreased
mesenchymal tissue), the trabecular cartilages in Six2 deficient mice fail to fuse which
results in the complete presphenoidal absence within the murine cranial base. Thus, it
was hypothesized that Six2 promotes cellular proliferation in the CNCM.
Although not initially reported by Self et al. in their 2006 study, their Six2-/-
construct
also demonstrated a shortened cranial base, as described by He et al. (2010). In their
study, it was determined the facial phenotype Six2-null newborn mice was due to
premature fusion of the cranial bones. The absence of Six2 in the knockout was not
detrimental until E14.5, when the number of proliferating chondrocytes was dramatically
reduced compared to the WT. By E16.5, a majority of the chondrocytes reach terminal
differentiation, following which, rapid cell death and replacement by bone occurs (de
Crombrugghe et al., 2001). As the chondrocyte pool is replaced by bone, the elongation
of the cranial base, dependent on endochondral ossification, fails due to the premature
depletion of osteocyte precursors. The knockout did not demonstrate increased apoptosis
among the chondrocyte population. He et al. (2010) hypothesized one of two scenarios
in the murine cranial base involving Six2: (1) Six2 controls all cell proliferation in the
mesenchymal presphenoid precursor and, when absent, premature terminal differentiation
of chondrocytes occur or (2) only a restricted site of proliferation in the presphenoidal
precursor is under the control of Six2. The latter theory was proposed since it seems only
the mid-posterior region of the presphenoid precursor shows a discrepancy in
Page 32
23
proliferation among the WT and Six2 knockout embryos. The proliferation of
chondrocytes near anterior region of the presphenoid precursor did not change between
the knockout and the WT.
Known expression patterns of Six3
Like Six2, another member of the Six family of transcription factors, Six3, is also
located on distal murine chromosome 17, approximately 1.9 cM from Six2 (Oliver et al.,
1995b). Because of their close proximity and related sequence, Oliver hypothesized the
Six2 and Six3 loci arose via a gene duplication event. Six3’s amino acid sequence is
highly conserved among mouse, zebrafish and chicken. Additionally, its expression
pattern is similar in the three species, leading Kobayashi et al. (1998) to determine Six3
among mouse, zebrafish and chicken to be orthologs.
Oliver et al. (1995b), via in situ hybridization, was the first to determine a spatial and
temporal expression pattern for Six3 in the mouse embryo. The first appearance of Six3
was at E6.5 at the embryo’s most anterior border. The anterior neuroectoderm expressed
Six3 as early as E7.0 and at E8.2, Six3 expression expanded over the anterior neural plate,
further expanding to the adjacent regions of the neural plate by E8.5 (Lagutin et al., 2001,
Oliver et al., 1995b). Structures arising from the anterior neural plate are typically non-
neural in nature (olfactory placodes, nasal cavity ectoderm and Rathke’s pouch) while the
adjacent ectoderm gives rise to neural derivatives (ventral forebrain, hypothalamus and
optic vesicles). Indeed, a day later at E9.5, Six3 expression was found in the ventral
forebrain, optic vesicles, olfactory placodes, and Rathke’s pouch. Within the ventral
forebrain, Six3 was mostly localized to the optic recess which defines the most rostral end
Page 33
24
of the neural tube from which the eye vesicles evaginate (Puelles and Rubenstein, 1993).
Neural retina, lens and optic stalk express Six3 at E11.5 and while the nasal ectoderm
expresses Six3 at E12.5 (Oliver et al., 1995b).
As alluded to previously, Six3 expression is strongly expressed during the construction
of the visual system. In addition to its expression in the optic vesicles and stalks at E9.5,
Six3 expands into the neural retina and lens, where it continues to be expressed until
E13.5, at which time in the retina its expression is unevenly distributed between the
stronger staining inner neuroblastic layer and the weaker, outer layer (Oliver et al.,
1995b). Additionally, in the lens, stronger expression is seen in the anterior epithelial
layer compared to the fibers. By E18.5, Six3 expression is absent, other than weak
expression in the inner neuroblastic layer of the retina.
Known functions of Six3
When Six3 is overexpressed in Medaka embryos, enlarged optic vesicles developed,
suggesting hyperplasia of retinal tissue (Loosli et al., 1999). If Six3 mRNA is injected
into zebrafish embryos, several morphological irregularities develop, including abnormal
diencephalic, mesencephalic and rhombencephalic ventricles, enlargement of the
telencephalon, and increased cell number in the dorsal neural tube (Kobayashi et al.,
1998). These phenotypes lead to the reasoning that an excessive accumulation of cells in
the anterior/dorsal neural tube enlarges the forebrain and compresses midbrain and
anterior hindbrain.
It has also been reported that mutations in sine oculis in Drosophila result in structural
defects in the brain (Serikaku and O’Tousa, 1994). Carl et al. (2002) found that when
Page 34
25
Six3 is inactivated in Medaka via Six3 morphilino injection, eyes and forebrain fail to
develop. This was thought to be attributed to ectopic apoptosis and was essential in
determining Six3’s role in the establishment and maintenance of the anterior
neuroectoderm, which includes the forebrain and retina (Winkler et al, 2000).
Moreover, a Six3 knock-out mouse demonstrated forebrain truncations of the
diencephalon (Jeong et al., 2008). When a knock-in allele of Six3, carrying a
holoprosencephaly-causing point mutation, is carried by mouse embryos, Shh expression
is reduced in the forebrain.
Objectives
The primary objective of this research is to reveal possible pathways leading to FND
as a result of a downregulation of Six2 in the developing midfacial primordia.
Specifically, we will attempt to identify potential candidate genes targeted for
misexpression as a consequence of Six2 misexpression in the MNP using a mouse model
with FND associated with a mutation near the Six2 locus. To achieve this goal, we will
first construct a temporal expression map of Six2 in the developing midface and kidney.
In order to identify preliminary downstream targets of Six2, DNA microarray technology
will be implemented. qRT-PCR will be used to corroborate misexpression recognized in
the microarray, as well as confirmation via immunohistochemistry on cryogenic sections.
Finally, Six2 will be downregulated in MNP cell culture and kidney organ culture
systems using RNAi technology to further reveal Six2 function in the developing embryo
and its role in the morphology of the Br phenotype. The central hypothesis of this
dissertation is that craniofacial development is affected by the Br mutation, which is
Page 35
26
associated with the transcription factor Six2. Reduced expression of Six2 in the midfacial
primordia in a haploinsufficient pattern, results in improper craniofacial morphogenesis
due to the disruption of normal genetic pathways governing the development of the
midfacial structures. The experiments within this study utilize 3H1 +/+ and 3H1 x
BALB/c +/+, Br/+ and Br/Br mice.
Page 36
27
CHAPTER 2
MATERIALS AND METHODS
Animals
All procedures were carried out in accordance with IACUC specifications and were
approved by the Laboratory Animal Services, University of Hawai‛i. Adult 3H1 and
BALB/c mice were housed under standard conditions with a 12-hr light cycle and
supplied with tap water and Purina Mouse Chow ad libitum. Embryos were obtained via
crosses of 3H1 and BALB/c adults. Females were examined for a vaginal plug; if
present, the day was designated E0.5. At the appropriate embryonic stage, the gestational
female was anesthetized with an isoflurane inhalant, cervical dislocation performed and
embryos collected via Caesarian section. All embryos were staged using Theiler criteria
(TS) ensuring the developmental stage of each embryo was equivalent to the E
designation (Theiler, 1989). Only animals of the same E designation and TS were
compared.
Genotyping
Previous physical mapping analysis showed the Br mutation is located in an
approximately 171 kb region of murine chromosome 17 that includes only one known
gene: Six2. Microsatellites were tested for recombination to establish primers suitable for
genotyping (Fogelgren et al., 2008). To generate animals that could be successfully
genotyped, 3H1 Br/+ mice were outbred with inbred lines of BALB/c mice (3H1 Br/+ x
BALB/c WT) (Figure 2.1). Genomic DNA was extracted from embryonic tissue samples
using Proteinase K (Ambion, Carlsbad, CA) digestion and ethanol precipitation.
Page 37
28
Figure 2.1 Breeding strategy for obtaining Br/Br mice suitable for
genotyping. Inbred BALB/c and inbred 3H1 Br/+ mice were mated to
produce F1 generation 3H1 x Balb Br/+ mice. These F1 mice were
intercrossed to obtain F2 generation Br/Br embryos. Also resulting from
these intercrosses were +/+ and Br/+ embryos.
PCR reactions to amplify primers for D17Mit76 (D17Mit76-f: 5’-AGC AAA GCT TAG
TGT TTC GC-3’; and D17Mit76-r: 5’-GGG GAT GCA AGT TAC TCC TC-3’). All
primers were synthesized at the University of Hawai‛i Biotech Core (Honolulu, HI).
Pairs of oligonucleotides were amplified using a Thermo Electron thermocycler with a
PCR profile consisting of an initial denaturation at 94C for 4 minutes, then 35 cycles of
30 seconds at 94C (denaturation), 30 seconds at 55C (annealing), and 30 seconds at
72C (extension), with a final extension at 72C for 4 minutes (Fogelgren et al., 2008).
PCR products were separated by electrophoresis in 4% Metaphor (Lonza, Rockland, ME)
agarose gels and stained with 1% ethidium bromide (Fisher BioReagents, Fair Lawn, NJ).
The gels were photographed with a Kodak Gel Logic 200 photographic module. Each
Page 38
29
gel included a 25 bp ladder (Invitrogen, Carlsbad, CA), water (negative) control, 3H1
(positive) control and BALB/c (positive) control and the experimental embryonic DNA
for scoring (Figure SD.1).
Genotyping was scored on the number of amplimers present. An embryo that
displayed only one 3H1 amplimer was scored a homozygous mutant (Br/Br) since it only
possessed the 3H1 sequence resulting from the outcross. If two amplimers were present,
it was identified as a heterozygous mutant (Br/+) since it possessed both a 3H1 and
outcross allele for D17Mit76 (one 3H1 and one BALB/c). If one amplimer consistent
with the BALB/c allele was present, the sample was identified as a homozygous normal
animal (+/+).
qRT-PCR for Six2 in facial prominences of WT and Br mice
Dissection of the facial prominences for RNA extraction was carried out at E11.5, as
this is the stage at which the MNP merger occurs and contact is established between the
MNP and MxP, beginning the continuity of the upper lip (Sperber, 2002). For temporal
Six2 expression data, faces were also dissected at E10.5 and E12.5. The paired MNP,
LNP and MxP were dissected using microforeceps and placed in RNAlater (Sigma, St.
Louis, MO) until genotypes could be confirmed. The dissection was accomplished under
a dissecting microscope by first staging the embryo, placing it laterally, and then
removing the MxP. The embryo was then placed in the frontal position and the MNP and
LNP were separated from the remaining cranium. The nasal pits were then transected at
the superior and inferior points separating the LNP from the MNP. After each of the
prominences were dissected away from the surrounding structures, any extraneous tissue
Page 39
30
seen still adhering to the edges of the prominence was removed. This ensured RNA was
extracted only from prominence tissue and not surrounding structures. Each pair of facial
prominences was placed immediately and individually in ~400 µL of RNAlater and
stored at 4C for one to three weeks before processing. For the temporal expression
study, six total embryos derived from three reciprocal 3H1 x BALB/c +/+ matings were
collected, three each for E10.5, E11.5 and E12.5 data. A total of twenty-two E11.5
embryos from four litters derived from reciprocal 3H1 x BALB/c Br/+ crosses were
collected for the genotypic study. These litters each contained +/+, Br/+ and Br/Br
embryos, as determined by genotyping. Furthermore, two more litters obtained from
reciprocal 3H1 x BALB/c +/+ matings provided twelve additional, control E11.5
embryos.
RNA from individual pairs of facial prominences was extracted using the RNeasy
Mini Kit (Qiagen, Valencia, CA) according to the included protocol for animal tissues.
Total RNA (200-400 ng) was reverse transcribed to cDNA using the iScript cDNA
Synthesis Kit (Bio-Rad, Hercules, CA) and the included protocol. qRT-PCR reactions
(25 µL final volume) were performed in triple replicates with 1 µL of cDNA, 1 µL of
each 20 μM primer and 12.5 µL of IQ SYBR Green Supermix (Bio-Rad, Hercules, CA)
with the MyiQ iCycler thermocycler and single color real-time PCR detection system
(Bio-Rad, Hercules, CA). Primers to amplify Six2 and the reference gene Gapdh were
used (see Table SD.1 for all primer sequences). The thermocycle profile used was an
initial denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 15 sec
(denaturation), 59°C for 30 sec (annealing), and 72°C for 60 sec (extension). Product-
specific amplification of Six2 and Gapdh was confirmed by melting curve analysis. Six2
Page 40
31
and Gapdh primer efficiency (100% and 100%, respectively) for the above annealing
temperature was confirmed by qRT-PCR on serial dilutions of a positive control (Six2
plasmid, E11.5 torso tissue). The C(t) was established at the linear portion of the log
scale curve and the ratio of Six2 to Gapdh was calculated using the 2-ΔΔC(t)
method (Livak
and Schmittgen, 2001). Statistical analysis was performed using Student’s t-test.
qRT-PCR for Six2 in embryonic and post-natal kidneys
A total of 37 mice derived from reciprocal 3H1 x BALB/c Br/+ crosses were
collected. Each litter contained +/+, Br/+ and Br/Br embryos, as determined by
genotyping. Nineteen total E13.5 and E17.5 embryos from reciprocal 3H1 x BALB/c
Br/+ crosses were collected and placed in PBS. Tissue for DNA extraction and
genotyping was performed as previously described. The viscera of the abdomen were
then removed, with care taken not to damage the posterior abdominal wall. Once the
nephric duct was identified, it was resected laterally to expose the kidney, gonad, and
adrenal gland. With the microforeceps, the kidney was gently loosened from the
underlying and surrounding tissue. Eighteen total postnatal day 2, 7 and 27 (P2, P7 and
P27) mice from BALB/c inbred and 3H1 x BALB/c Br/+ crosses were euthanized, and
microforeceps were used to dissect kidneys from the posterior abdominal wall under
room light.
Total mRNA was extracted from intact E13.5, E17.5, and P2 kidneys. A double-
bladed razor blade (1.5 mm between blades) was used to dissect renal cortex tissue from
approximately the level of the renal pelvis from the P7 and P27 kidneys. All tissue
Page 41
32
samples were placed immediately and individually in 200 μL of RNAlater and stored at
4°C for 1–7 days before processing.
mRNA from kidney tissue samples was extracted and cDNA synthesis was performed
as previously described. qRT-PCR were performed as previously described using
primers for Six2 and Gapdh. The C(t) was established at the linear portion of the log
scale curve, and the ratio of Six2 to Gapdh was calculated using the 2-ΔΔC(t)
method
(Livak and Schmittgen, 2001). Statistical analysis was performed using Student’s t-test.
Differential gene expression between the WT and Br mouse as measured by high-
throughput microarray analysis
Dissection of E11.5 facial prominences has been previously described. Following
their removal, paired MNPs were incubated in dispase (1.0 mg/mL), diluted 1:2 in PBS,
at room temperature for 30 to 45 minutes. This facilitated isolation of the facial
mesenchyme by careful removal of the overlying ectoderm, executed precisely with
microforeceps. Each pair of facial prominences, sans ectoderm, was placed immediately
and individually in ~400 µL of RNAlater and stored at 4°C overnight before storage at -
20C for three to six weeks before processing. A total of twelve embryos from three
litters derived from reciprocal 3H1 x BALB/c +/+ and reciprocal 3H1 x BALB/c Br/+
crosses were collected. Embryo were staged and tissue from 3H1 x BALB/c Br/+
crosses was extracted for genotyping to confirm phenotypic appearance. Of the twelve
embryos collected, five were E11.5 +/+ (from one reciprocal 3H1 x BALB/c +/+ litter)
and seven (from two reciprocal 3H1 x BALB/c Br/+ litters) were scored E11.5 Br/Br.
Page 42
33
MNPs were then pooled according to genotype, forming a one control sample (+/+) and
one experimental sample (Br/Br).
RNA was extracted and cleaned using NucleoSpin kits (Machary Nagel, Bethlehem,
PA). Following RNA extraction, nanodrop spectrometry and bioanalyzer analysis were
used to determine RNA quantity and quality, respectively. Once Six2 was confirmed
downregulated using qRT-PCR as previously described, the samples underwent first- and
second-strand synthesis followed by in vitro transcription, which both amplified and
incorporated Cy3 dye into the new strand.
Single-color microarray analysis was performed by the University of Hawai‛i
Genomics Core Facility (Honolulu, HI). +/+ and Br/Br samples were hybridized on a
single 4X44k Whole Mouse Gene Expression Microarray (Agilent, Santa Clara, CA)
following vendor’s protocol for overnight hybridization. Since only two samples were
being compared and each slide contained four arrays, replicates of each sample were
performed to confirm data generated from Agilent’s GeneSpring software.
Corroboration of p63, Pax6, Sox2, Shh and Flrt2 microarray results via qRT-PCR
A total of eight E11.5 embryos were collected from two litters derived from parents
with the following genetic backgrounds: 3H1 x BALB/c +/+ and 3H1 x BALB/c Br/+.
Following embryo collection, MNPs were dissected placed into RNAlater; RNA
extraction and cDNA synthesis were also carried out as previously described.
Genotyping as previously described was impossible due to the backgrounds of the
parental mice, therefore it was necessary confirm phenotypic appearance with qRT-PCR
to measure Six2 expression as previously described; our lab has previously shown the
Page 43
34
Br/+ mouse exhibits a significant reduction in Six2 expression compared to the WT
(Somponpun et al., 2011). Of the eight embryos collected, it was determined five were
+/+ and three were Br/+ based on Six2 expression. An additional 8 embryos were
collected from reciprocal 3H1 x BALB/c +/+ and reciprocal 3H1 x BALB/c Br/+ crosses
for p63 and Flrt2 qRT-PCR. For the latter cross, genotyping was carried out as
previously described. These crosses generated four E11.5 +/+ and four E11.5 Br/Br
embryos.
qRT-PCR reactions (25 µL final volume) were performed in triple replicates as
described. Primers to amplify p63, Pax6, Sox2, Shh and Flrt2 and Gapdh were used.
Primers for Pax6, Shh and Flrt2 were designed to incorporate the microarray probe
sequence for these genes into the respective amplicon. The thermocycle profile included
an initial denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 15 sec
(denaturation), various annealing temperatures for 30 sec, and 72°C for 30 sec
(extension). Annealing temperatures for each primer used are found in Table SD.1.
Product-specific amplification was confirmed by melting curve analysis; primer
efficiencies for the indicated annealing temperatures were confirmed by qRT-PCR on
serial dilutions of a positive control (Figures SD.4, SD.6, SD.7 SD.8, SD.9). The C(t)
was established at the linear portion of the log scale curve and the ratio of the gene of
interest to Gapdh was calculated using the 2-ΔΔC(t)
method (Livak and Schmittgen, 2001).
Statistical analysis was performed using Student’s t-test.
Page 44
35
Corroboration of Six3 microarray results via qRT-PCR
A total of eleven embryos from four litters derived from reciprocal 3H1 x BALB/c +/+
and reciprocal 3H1 x BALB/c Br/+ crosses were collected and staged. Tissue from 3H1
x BALB/c Br/+ crosses was extracted for genotyping to confirm phenotypic appearance.
Dissection of E11.5 MNPs tissue and removal of overlying ectoderm proceeded as
previously described. Genotyping via genomic DNA extraction, RNA extraction and
cDNA synthesis were also carried out as previously described. Five embryos were
derived from two 3H1 x BALB/c +/+ crosses, and three each were scored Br/+ and
Br/Br from the remaining three heterozygous crosses.
qRT-PCR reactions (25 µL final volume) were performed in triple replicates as
described. Primers to amplify Six3 and Gapdh were used. Primers for Six3 were
designed to incorporate the complete microarray Six3 probe sequence into the 180 bp
amplicon. The thermocycle profile used was an initial denaturation at 94°C for 2 min,
followed by 35 cycles of 94°C for 15 sec (denaturation), 59°C for 30 sec (annealing), and
72°C for 30 sec (extension). Product-specific amplification of Six3 was confirmed by
melting curve analysis. Six3 primer efficiency for the above annealing temperature was
confirmed by qRT-PCR on serial dilutions of a positive control (E11.5 head/eye tissue)
(Figure SD.5). The C(t) was established at the linear portion of the log scale curve and
the ratio of Six3 to Gapdh was calculated using the 2-ΔΔC(t)
method (Livak and
Schmittgen, 2001). Statistical analysis was performed using Student’s t-test.
Page 45
36
Corroboration of MNP Six3 qRT-PCR results via IHC
E11.5 embryos from derived from reciprocal 3H1 x BALB/c +/+ crosses and
reciprocal 3H1 x BALB/c Br/+ crosses were collected. Heads were immediately placed
in OCT Compound (Sakura, The Netherlands), snap frozen and stored at -80°C for one to
two weeks before processing. Remaining tissue from each embryo resulting from the
heterozygous crosses was used for DNA extraction to confirm genotypes as previously
described. Cryosections were cut at 7 μm and fixed with methanol at -20°C for 15
minutes. Sections were permeabilized with 0.25% Triton X-100 followed by blocking
with 5% NDS (Jackson ImmunoResearch, West Grove, PA). Primary incubation was
performed with goat polyclonal anti-Six3 antibodies (Santa Cruz Biotechnology, Santa
Cruz, CA) diluted in 5% NDS and 0.25% Triton X-100. After washing, sections were
incubated with donkey anti-goat secondary antibody (Cy3-labeled; Jackson
ImmunoResearch, West Grove, PA), diluted in 5% NDS and 0.25% Triton X-100,
counterstained with DAPI and mounted in 50% glycerol in PBS. Images were taken on
an Olympus (Center Valley, PA) BX41 fluorescent microscope.
qRT-PCR for Six2 and Six3 embryonic Br kidneys
A total of six E14.5 embryos were collected from one litter derived from parents with
the following genetic backgrounds: 3H1 x BALB/c +/+ and 3H1 x BALB/c Br/+.
Following embryo collection, kidneys were isolated and removed to be placed into
RNAlater. Genotyping as previously described was impossible due to the backgrounds
of the parental mice, therefore it was necessary confirm phenotypic appearance with
qRT-PCR to measure Six2 expression. qRT-PCR for Six2 (for genotyping purposes) and
Page 46
37
Six3 was performed as previously described. qRT-PCR determined two embryos to be
+/+ and four to be Br/+.
Corroboration of kidney Six3 qRT-PCR results via IHC
E13.5 embryos from derived from 3H1 x BALB/c +/+ and 3H1 x BALB/c Br/+
crosses were collected. Torsos were immediately placed in OCT Compound, snap frozen
and stored at -80°C for one to two weeks before processing. Genomic DNA was
extracted from head tissue and genotyping was performed as previously described.
Cryosections were cut at 7 μm and fixed with methanol at -20°C for 15 minutes.
Sections were permeabilized with 0.25% Triton X-100 followed by blocking with 5%
NDS. Primary incubation was performed with rabbit polyclonal anti-Six2 (ProteinTech,
Chicago, IL) and goat polyclonal anti-Six3 antibodies diluted in 5% NDS and 0.25%
Triton X-100. After washing, sections were incubated with donkey anti-rabbit (Alexa
488-labeled) and donkey anti-goat secondary antibody (Cy3-labeled), diluted in 5% NDS
and 0.25% Triton X-100, counterstained with DAPI and mounted in 50% glycerol in
PBS. Images were taken on an Olympus BX41 fluorescent microscope.
qRT-PCR for Wnt4 in embryonic kidney and MNPs
A total of eight E13.5 embryos from two litters derived from reciprocal 3H1 x
BALB/c +/+ and reciprocal 3H1 x BALB/c Br/+ crosses were collected and kidneys
removed and placed in RNAlater. Genotyping, RNA extraction and cDNA synthesis
were carried out as previously described. A total of three embryos were determined +/+
and five Br/Br. A total of eight E11.5 embryos derived from reciprocal 3H1 x BALB/c
Page 47
38
Br/+ crosses were collected and MNPs removed and placed in RNAlater. Genotyping,
RNA extraction and cDNA synthesis were carried out as previously described. A total of
three embryos were determined +/+ and five Br/Br.
qRT-PCR reactions (25 µL final volume) were performed in triple replicates as
described. Primers to amplify Wnt4 and Gapdh were used. The thermocycle profile
included an initial denaturation at 94°C for 2 min, followed by 35 cycles of 94°C for 15
sec (denaturation), 59°C for 30 sec (annealing), and 72°C for 30 sec (extension).
Product-specific amplification was confirmed by melting curve analysis; primer
efficiencies for the indicated annealing temperature were confirmed by qRT-PCR on
serial dilutions of a positive control (Figure SD.10). The C(t) was established at the
linear portion of the log scale curve and the ratio of Wnt4 to Gapdh was calculated using
the 2-ΔΔC(t)
method (Livak and Schmittgen, 2001). Statistical analysis was performed
using Student’s t-test.
Six2 expression in a MNP cell culture system as determined by qRT-PCR and IHC
A total of ten MNPs from five +/+, E11.5 embryos, derived from two litters of
reciprocal 3H1 x BALB/c +/+ crosses, were dissected as previously described, leaving
ectoderm intact. Nine of the explants were seeded in a 96-well culture plate with 150 μL
MSCGM (Lonza, Rockland, ME). Three experimental conditions were tested: (1) 72-
hour culture before RNA extraction with explant, (2) 72-hour culture before RNA
extraction without explant and (3) 48-hour culture before removal of explant from
culture, followed by 72-hour additional culture and RNA extraction. Three explants were
run in parallel for each condition. Following each of the above incubations, cultures were
Page 48
39
washed with PBS and RNA extracted by lysing cells and pooling the lysates from similar
cultures before continuing the extraction to ensure a suitable amount of RNA for qRT-
PCR. The additional, tenth explant was used for RNA extraction (as previously
described) immediately following dissection.
cDNA synthesis and qRT-PCR for Six2 was performed each sample as previously
described. The thermocycle profile for CNCM marker Ap-2α was an initial denaturation
at 94°C for 2 min, followed by 35 cycles of 94°C for 15 sec (denaturation), 59°C for 30
sec (annealing), and 72°C for 30 sec (extension). Product-specific amplification of Ap-
2α was confirmed by melting curve analysis. Ap-2α primer efficiency (101%) for the
above annealing temperature was confirmed by qRT-PCR on serial dilutions of a positive
control (E11.5 head tissue). The C(t) was established at the linear portion of the log scale
curve and the ratio of Six2 and Ap-2α to Gapdh was calculated using the 2-ΔΔC(t)
method
(Livak and Schmittgen, 2001). Statistical analysis was performed using Student’s t-test.
For IHC, cultures were washed with PBS and fixed with 4% PFA. After PBS rinse,
cells were permeabilized with 0.25% Triton X-100 for 15 minutes, followed by blocking
with 5% NDS. Primary incubation was performed with rabbit polyclonal anti-Six2 and
goat anti-Ap-2α (Santa Cruz Biotechnology, Santa Cruz, CA) antibodies diluted in 5%
NDS and 0.25% Triton X-100. After washing, cultures were incubated for 60 minutes at
RT with donkey anti-rabbit (Alexa 488-labeled) and donkey anti-goat (Cy3-labeled)
secondary antibodies diluted in 5% NDS and 0.25% Triton X-100, counterstained with
DAPI and mounted in 50% glycerol in PBS. Images were taken on an Olympus BX41
fluorescent microscope. Captured images were analyzed with SURFtess (Surface
Tessellation Software version 1.0, www.akuaware.com) to determine if a difference
Page 49
40
existed between Six2-postive and Ap-2α-positive cells in each double-stained culture
(Voronoi tessellation analysis summarized in Wong et al., 2010).
siRNA induced knockdown of Six2 in a MNP cell culture system as determined by IHC
and qRT-PCR
Reciprocal 3H1 x BALB/c +/+ crosses yielded nine E11.5 embryos, from which
MNPs were dissected for use in a cell culture system. Each paired prominence was
bisected, generating eighteen, separate tissue explants. For siRNA efficiency tests via
qRT-PCR, explants were seeded into 96-well culture wells with 150 μL MSCGM.
Cultures were divided into six groups of three replicate wells. To ensure an adequate cell
count prior to RNA extraction, it was decided to culture the explants at 37°C for 48 hours
before adding the siRNA reagent. Media was changed 24 hours after seeding. Media
was changed again 24 hours later and included siRNA. One group (three wells) was
incubated with 0.1 μM Accell SMARTpool siRNA against mouse Six2 (Dharmacon,
Lafayette, CO) while another group was incubated with 1 μM of the same siRNA. The
Accell siRNA is designed for use in serum-free media and without the use of transfection
reagent; however, the mechanism by which the siRNAs enter the cell and localize to the
nucleus is made proprietary by the vendor. For controls, two groups were incubated with
0.1 μM and 1.0 μM Accell Non-targeting Pool (NTP) siRNA (Dharmacon, Lafayette,
CO) to determine non-sequence specific effects. The remaining two groups were
designated negative controls and contained no siRNA products. All wells were then
cultured for 72 hours with no subsequent media changes. RNA extraction from
individual cultures proceeded as previously described and included the explant tissue.
Page 50
41
qRT-PCR for Six2 Ap-2α and Six3 was completed as previously described in previous
sections.
For IHC, three explants were seeded into a 4-well slide chamber with 400 μL
MSCGM. Explants were cultured for 24 hours, media changed, and cultured another 24
hours. Media change 48 hours after seeding contained 1.0 μM siRNA against Six2, 1.0
μM NTP siRNA; the third explant received media containing no siRNA products. All
wells were then cultured for 72 hours with no subsequent media changes. The protocol
for immunostaining for Six2 and Ap-2α was previously detailed in previous sections.
Kidney organ culture and siRNA
Previous work in our lab has shown efficient delivery of the previously mentioned
siRNA into whole kidney explant culture (Phillips, 2011). Additionally, Phillips
demonstrated a 50% knockdown of Six2 expression in E13.5 kidney explants using 1.0
μM siRNA. In our experiment, E13.5 WT kidneys were dissected from a total of six
embryos as previously described. Kidneys dissected from 3H1 x BALB/c embryos were
placed in sterile 1.5 mL centrifuge tubes, suspended in 300 μL of media/siRNA solution.
Complete media consisted of DMEM/F12 media, supplemented with 1x Glutamax
(Gibco, Carlsbad, CA), 1 μM transferrin, antibiotics (penicillin-streptomycin), and 1 μM
Six2 siRNA, as described by Phillips (2011). Our lab has previously shown the addition
of transferrin to serum-free culture media resulted in ureteric bud growth similar to that
seen in vivo (Phillips, 2011). Negative controls were run by substituting NTP siRNA for
the Six2-specific siRNA, as well as a second control that omitted all siRNA products.
Each culture, consisting of four kidneys per tube, was incubated at 37°C for 72 hours.
Page 51
42
RNA was collectively extracted from each culture vessel following siRNA incubation
and cDNA and qRT-PCR for Six2 and Six3 was performed as previously described in
previous sections.
Page 52
43
CHAPTER 3
RESULTS
Six2 expression in the facial primordia peaks at E11.5
Six2’s initial appearance in the head mesenchyme manifests at E9.5 (Ohto et al.,
1998). Its expression expands to the first branchial arch and nasal cavity at E11.5 and
remains in the frontal region of the head until its disappearance at E14.5. In order to
construct a specific temporal illustration of Six2’s expression in the facial primordia
during the critical period of midfacial morphogenesis, facial prominences were collected
from +/+ embryos at stages prior to (E10.5), during (E11.5) and after (E12.5) midfacial
merging.
qRT-PCR results revealed Six2 expression is highest in the MNPs of E11.5 embryos,
the precise time of MNP merging; because of this, all other samples were compared
relative to this tissue (Figure 3.1). At the same developmental age, MxP and LNP Six2
expression was nearly 60% and 70%, respectively, of the normalized MNP expression.
At E12.5, following MNP merging, a reduction of Six2 expression greater than 50% is
seen in the MNP. While Six2 expression at E11.5 is not as elevated in the MxP and LNP
as the MNP, a similar pattern of expression is seen in these tissues at the stages tested: a
drop of at least 50% is seen in all prominences after E11.5.
Six2 displays haploinsufficient expression in each of the Br facial prominences at E11.5
Our lab has previously shown Six2 is downregulated in a haploinsufficient pattern
in the Br head at E11.5 (Fogelgren et al., 2008). In this experiment, we undertook a more
specific approach; that is, evaluating Six2 expression in the individual facial prominences
Page 53
44
Figure 3.1 Relative, temporal Six2 expression in the facial primordia.
qRT-PCR results demonstrating a downregulation of Six2 in each of the
facial prominences between E11.5-12.5. At E12.5, each prominence
showed a downregulation of Six2 by at least 50%. This is significant
because midfacial merging occurs at E11.5. Expression of Six2 is shown
relative to expression of Six2 in E11.5 MNP tissue after being normalized
against the amount of Gapdh; calculated using the 2-ΔΔC(t)
method. n=3 for
each stage within each prominence. *p < 0.01.
of E11.5 Br embryos. As previously mentioned, the MNP displays the greatest
expression of Six2 at E11.5 in each of the prominences. Not surprisingly, the +/+ MNP
showed the highest expression of Six2 of the samples tested, thus all other samples were
compared relative to this tissue in Figure 3.2. For each of the prominences assayed, Six2
expression demonstrated a haploinsufficient expression pattern in Br. That is, the relative
expression of Six2 in each of the Br facial primordia was roughly 1.0:0.5:0.0 at E11.5 for
+/+:Br/+:Br/Br. Among the MNPs tested, Six2 expression in Br/+ decreased by 60%,
further dropping to a 93% reduction in the Br/Br, compared to +/+. The Br/+ MxPs
expression dropped 50% while the Br/Br plunged 89% compared to the +/+ MxP. LNP
Page 54
45
Figure 3.2 Relative Six2 expression between facial prominences in Br
mice. qRT-PCR results showing Six2 expression in the three facial
prominences of E11.5 Br mice. Six2 expression decreases in a
haploinsufficient pattern in each prominence. That is, expression dropped
~50% in the heterozygous mutant and ~90-95% in the homozygous
mutant. Also shown is the expression pattern among the prominences.
The MNP displays the most Six2 expression while expression in the MxP
decreases about half and even further in the LNP. Expression of Six2 is
shown relative to expression of Six2 in +/+ MNP tissue after being
normalized against the amount of Gapdh; calculated using the 2-ΔΔC(t)
method. n=3 for each genotype within each prominence. *p < 0.01.
expression of Six2 decreased by 62% in the Br/+ and 87% in the Br/Br compared to the
+/+ LNP.
Renal Six2 expression decreases during development and is haploinsufficient in Br mice
Fogelgren et al. (2008) previously reported the torso of the Br mouse demonstrates
haploinsufficient Six2 expression at E11.5 compared to WT littermates via qRT-PCR.
Additionally, it was reported Six2 expression is significantly lower in newborn mice
compared to E13.5, and even lower in adults (Fogelgren et al., 2009). We took expanded
that work by examining kidney mRNA for Six2 expression in +/+, Br/+ and Br/Br at
Page 55
46
multiple embryonic and postnatal stages. In the +/+ sample, Six2 expression decreased
as development proceeded until P7, at which time its expression was undetectable (Figure
3.3). Br/+ showed a similar Six2 expression pattern, albeit reduced, until its absence by
P7. There was no detectable Six2 expression adult renal tissue in either +/+ or Br/+. In
Br/Br, Six2 expression was undetectable by E17.5. Although haploinsufficient
expression was seen at E13.5 in +/+, that pattern of expression was not maintained in
Br/+. At E17.5, Six2 expression declined more rapidly in the Br/+ tissue than the WT,
suggesting Six2’s haploinsufficient decline in the Br kidney is not linear.
Figure 3.3 Relative, temporal Six2 expression in the developing kidney of
WT and Br mice. qRT-PCR results demonstrating a downregulation of
Six2 over time in the kidney tissue of Br mice. Expression of Six2 shows a
haploinsufficient pattern, as elucidated by Fogelgren et al. (2008), and as
seen in the facial prominences. This data is significant because Six2
expression is peaks during the initiation of nephrogenesis. Expression of
Six2 is shown relative to expression of Six2 in E13.5 +/+ kidney tissue
after being normalized against the amount of Gapdh; calculated using the
2-ΔΔC(t)
method. Note: Br/Br pups do not survive beyond D1, hence
postnatal data is not shown. n ≥ 3 for all stages within each genotype. *p
< 0.01.
Page 56
47
DNA microarray analysis suggests significant misexpression of over three thousand
genes in the Br MNP
Although extreme care was taken to ensure correct genotyping and phenotyping in the
MNP samples pooled and designated for microarray analysis, it was decided to use qRT-
PCR to ensure Six2 was downregulated in the pooled Br/Br sample. As seen in Figure
3.4, the Br/Br sample demonstrated a 90% reduction in Six2 expression compared to the
positive control, not unlike what is seen in Figure 3.2. It was determined these sample
were suitable for further microarray analysis.
A range of expression changes were seen between the +/+ and Br/Br samples, as
illustrated in Figure 3.5. Of the 41,256 total probes on the microarray, 54.9% had
detectable expression in each of the four arrays (two samples [+/+1, Br/Br1] plus two
Figure 3.4 Downregulation confirmation of Six2 in the MNP RNA pool
for microarray analysis. Expression of Six2 is shown relative to
expression of Six2 in the +/+ pooled sample after being normalized
against the amount of Gapdh; calculated using the 2-ΔΔC(t)
method.
Number of paired +/+ MNPs pooled: five. Number of paired Br/Br
MNPs pooled: seven. *p < 0.01.
Page 58
49
replicates [+/+2, Br/Br2]) while 30.5% were undetectable in any array (detection
threshold chosen arbitrarily by GeneSpring software). When the four possible
comparisons were performed (+/+1 vs. Br/Br1, +/+1 vs. Br/Br2, +/+2 vs. Br/Br1, +/+2
vs. Br/Br2) and the expression data averaged, approximately 850 probes demonstrated a
downregulation in the Br/Br and roughly 2750 probes exhibited upregulation. These data
include only those probes demonstrating misregulation with expression differentials
greater than 2.0-fold. Accordingly, only the genes associated with these probes were
considered for further validation using qRT-PCR and IHC assays. Those probes whose
expression did not reach an arbitrary signal threshold (as determined by the Agilent
software) in either the +/+ sample or the Br/Br were omitted from consideration for
validation.
Misexpression of p63 suggested in the microarray is not confirmed upon analysis by
qRT-PCR
In order to confirm possible downstream targets of Six2 suggested to be misexpressed
in the microarray, it was necessary to perform qRT-PCR using novel primers for genes
previously known to be involved in craniofacial morphogenesis, as well as malformations
of the midface. p63, a transcription factor homologue of the tumor-suppressor p53 (Yang
et al., 1998), is normally expressed in embryonic ectoderm. Its deficiency in p63-/-
mice
leads to the absence of structures requiring epithelial-mesenchymal interactions,
specifically, defects in all stratified epithelia, impaired limb formation and facial clefting
(Mills et al., 1999; Yang et al., 1999). p63 was suggested to be the most upregulated
probe in the microarray experiment with an average misexpression in the four
Page 59
50
comparisons of 149-fold in Br/Br compared to +/+ (Figure 3.5). This data and the cited
literature depicting its possible role in facial clefting led us to investigate it further as a
possible candidate gene downstream of Six2 during facial development. In the cDNA
sample scored Br/+ to be used for p63 analysis, Six2 was verified to be downregulated by
50%, confirming the phenotypic appearances of the E11.5 embryos used in the study
(Figure 3.6a). Br/Br samples were derived from samples that could be successfully
genotyped via gel electrophoresis. However, qRT-PCR with novel p63 primers
demonstrated no statistical difference in expression in either Br/+ or Br/Br MNPs
compared to +/+ (Figure 3.6b). Based on this data, we decided not to pursue additional
validation for p63.
qRT-PCR corroborates Six3 is upregulated in E11.5 Br/Br MNPs
Six3 is another member of the Six family of transcription factors and is located
adjacent to Six2 on murine chromosome 17. Its normal pattern of expression suggests it
controls transcription of genes involved in patterning the rostral forebrain and eye
(Lagutin et al., 2003; Jeong et al., 2008; Loosli et al., 1999). While it was ruled out the
Br mutation could be located within the Six3 locus (Figure 1.4; Fogelgren et al., 2008),
the proximity of the Br critical region to the Six3 locus (Figure 1.4a) and the 88-fold
average misexpression of Six3 revealed in the four microarray comparisons (Figure
3.5a,b,c,d) established interest for further investigation. Six3 represented the third highest
probe upregulated in the Br/Br sample. Novel primers were designed to incorporate the
microarray probe into the 180 bp amplicon. qRT-PCR results agreed with the
microarray: Six3 expression was significantly upregulated nearly 12-fold in Br/Br MNP
Page 60
51
Figure 3.6 Relative p63 expression in E11.5 Br MNPs. (A) qRT-PCR for
Six2 confirmed genotypes of samples scored Br/+. These samples were to
be used for qRT-PCR on p63, Pax6 and Sox2 (Figure 3.11). (B) Novel
primers could not confirm the misexpression of p63 established in the
microarray. Expression of p63 is shown relative to their respective
expressions in +/+ MNP tissue after being normalized against the amount
of Gapdh; calculated using the 2-ΔΔC(t)
method. . n ≥ 3 for all genotypes.
*p < 0.01.
tissue while being significantly upregulated almost 7-fold in the same tissue of the
heterozygote (Figure 3.7).
Page 61
52
Figure 3.7 Relative Six3 expression in E11.5 Br MNPs. qRT-PCR results
show a significant upregulation of Six3 in Br/+ and Br/Br MNPs
compared to +/+; this data supports our results from the microarray
experiment. Expression of Six3 is shown relative to expression of Six3 in
+/+ MNP tissue after being normalized against the amount of Gapdh;
calculated using the 2-ΔΔC(t)
method. n ≥ 3 for all genotypes. *p < 0.01.
IHC verifies the Six3 protein is upregulated in the E11.5 Br/Br midface
Following the validation of the upregulation of Six3 in the microarray, IHC was
performed on cryosections from embryos collected at E11.5. Six3 was only slightly
detectable in the mesenchyme composing the MNP in the WT embryos and absent in the
olfactory epithelium (Figure 3.8a,c). In the Br/Br embryos, Six3 expression was greatly
expanded in the mesenchyme, where the median facial cleft was visible (distance
between the nasal pits) as well as the olfactory epithelium of both the MNP and LNP
(Figure 3.8b,d).
Page 62
53
Figure 3.8 Immunofluorescent staining of Six3 in E11.5 WT and Br/Br
midfaces. Six3 staining is shown in red, while nuclei stained with DAPI
are in blue. Six3, as a transcription factor, only localized in the nuclei.
(B, D) In Br/Br embryos, Six3 staining was detected primarily in the
midline mesenchyme and olfactory epithelium of the nasal pits. (A, C) In
WT embryos, Six3 fluorescence dramatically reduced in the mesenchyme
and not detected in the olfactory epithelium. Staining was repeated on at
least sixteen sections using two distinct +/+ embryos and two distinct
Br/Br embryos. OE, olfactory epithelium.
Page 63
54
Six3 is also upregulated in embryonic Br kidneys
Following corroboration of Six3’s upregulation associated with a downregulation in
Six2 expression in the facial primordia using qRT-PCR and IHC, embryonic kidneys
were then examined for Six3 misexpression, as Six2’s role during renal morphogenesis
has been well studied (Brodbeck et al., 2004, Self et al, 2006, Karner et al., 2011). It was
initially necessary to verify the Br/+ phenotypes of the E14.5 embryos used based on
qRT-PCR for Six2 (Figure3.9a). qRT-PCR determined Six3 expression in Br/+ kidneys
was significantly upregulated on the order of 50-fold (Figure 3.9b).
IHC verifies the Six3 protein is upregulated in E13.5 Br/+ kidneys
Once increased Six3 expression was verified in E14.5 MNPs, immunostaining for Six3
proceeded on cryosections from embryos collected at E13.5. As reported by Fogelgren et
al. (2008), Six2 was localized around the nephrogenic zone (periphery) of the kidney in
the WT (Figure 3.10a) and its expression in the Br/+, as well as the overall size of the
kidney, was reduced (Figure 3.10b). Six3 expression was absent in the WT (Figure
3.10c) however its expression was increased in the Br/+ kidney (Figure 3.10d),
substantiating the renal Six3 qRT-PCR data.
Pax6 and Sox2, known downstream targets of Six3 and upregulated in the microarray,
are not confirmed to be misexpressed upon analysis by qRT-PCR
Previous in vitro and in vivo work using EMSA and ChIP assays has shown that Six3
can directly bind to Pax6, and probably also Sox2, regulatory elements during lens
induction to activate their transcription (Liu et al., 2006). Also in this study, it was deter-
Page 64
55
Figure 3.9 Relative Six2 and Six3 expression in E14.5 Br/+ kidneys.
(A) qRT-PCR for Six2 confirmed phenotypic appearance of E14.5 Br/+
embryos. (B) In the same cDNA sample, Six3 expression was upregulated
50-fold in Br/+ kidneys compared to WT. Expression of Six2 and Six3 is
shown relative to their respective expressions in +/+ kidney tissue after
being normalized against the amount of Gapdh; calculated using the 2-
ΔΔC(t) method. n = 2 for +/+, n = 4 for Br/+ in A and B. *p < 0.01.
mined in Six3-/-
mice, Pax6 expression was downregulated and Sox2 expression was
completely absent from the primitive lens tissue, resulting in defective lens induction.
Page 65
56
Figure 3.10 Immunofluorescent staining of Six2 and Six3 in E14.5 WT
and Br/+ kidneys. Six2 and Six3 staining are shown in green, while
nuclei stained with DAPI are in red. (A, B) Six2 staining was detected
primarily in the periphery of WT kidneys and its expression in Br/+
kidneys was reduced. (A, C) Six3 expression is absent in WT while its
appearance in Br/+ substantiates Six3 qRT-PCR results. Staining was
repeated as follows – Six2 +/+: three embryos, eight sections; Six2 Br/+:
two embryos, three sections; Six3 +/+: four embryos, five sections; Six3
Br/+: three embryos, four sections.
Furthermore, Loosli et al. (1999) found expanded Pax6 expression into the midbrain and
cerebellum of Medaka when Six3 mRNA is introduced into the fish embryos.
Page 66
57
The microarray data demonstrated an 8-fold average upregulation of Pax6 in all four
comparisons (Figure 3.5a,b,c,d), while Sox2 displayed upregulation in two of the four
comparisons for an average of 7-fold misexpression (Figure 3.5b,c). In order to
authenticate this misexpression of the two genes, novel primers were designed to assay
their expression in WT and Br/+ MNPs (Six2 was confirmed downregulated in the cDNA
sample tested [Figure 3.6a]). According to the qRT-PCR data, neither Pax6 (Figure
3.11a) nor Sox2 (Figure 3.11b) was significantly misexpressed (Pax6: 0.00-fold relative
misexpression, Sox2: 0.08-fold relative upregulation). These data were not considered
significant enough to pursue additional validation of Pax6 and Sox2.
Shh is mildly upregulated in the Br/Br MNP during midfacial morphogenesis
It has been shown that Six3 is a direct upstream activator of Shh in the ventral
forebrain, where it establishes the ventral midline (Geng et al., 2008). While Shh was
significantly upregulated in the microarray, its absolute expression in the Br/Br was
determined “undetectable” by the microarray software (consequently, its absence from
Figure 3.5). However, in light of our Six3 data and the published literature mentioned,
we decided to design novel primers for Shh for qRT-PCR analysis, the results of which
are seen in Figure 3.12. Although not statistically significant (p = 0.11), there appeared
to be a modest 0.25-fold upregulation of in Br/Br MNP tissue.
Flrt2 is significantly downregulated in the Br/Br MNP
Flrt2 is normally expressed in the developing craniofacial region, specifically in the
CNCM, and has been suggested to play a role in the proliferation and/or migration of the
Page 67
58
Figure 3.11 Relative Pax6 and Sox2 expression in E11.5 Br/+ MNPs.
Novel primers could not confirm the misexpression in Br/+ of either (A)
Pax6 or (B) Sox2 established in the microarray. Expression of Pax6 and
Sox2 are shown relative their respective expressions in +/+ tissue after
being normalized against the amount of Gapdh; calculated using the 2-
ΔΔC(t) method. n ≥ 3 for both genotypes in A and B.
CNCM (Gong et al., 2009). Furthermore, Flrt2 has been proposed to mediate cell-cell
interactions during early craniofacial chondrogenic differentiation (Xu et al., 2011). The
microarray data suggested Flrt2 expression was significantly downregulated in Br/Br
Page 68
59
Figure 3.12 Relative Shh expression in E11.5 Br/Br MNPs. qRT-PCR
results show a slight upregulation of Shh in Br/Br MNPs. Expression of
Shh is shown relative to expression of Shh in +/+ MNP tissue after being
normalized against the amount of Gapdh; calculated using the 2-ΔΔC(t)
method. n = 4 for both genotypes.
MNPs (Figure 3.5), which was validated by qRT-PCR, where its expression was
downregulated 4-fold (Figure 3.13).
Wnt4 is not misexpressed in the facial primordia or the developing kidney of Br mouse
Self et al. (2006) described a Six2-/-
mouse that displayed RH. While not a true
knockout, Br/Br mice displays a similar hypoplastic phenotype associated with a
reduction in Six2 expression. In their study, Self et al. discovered Wnt4 expression was
ectopically expanded via in situ hybridization in the Six2 knockout mouse. However, in
the Br/Br mouse, no significant evidence of increased expression of Wnt4 was
appreciated in either E13.5 kidneys (Figure 3.14a) or E11.5 MNPs (Figure 3.14b;
kidneys: 0.06-fold relative downregulation, MNPs: 0.04-fold relative upregulation).
Page 69
60
Figure 3.13 Relative Flrt2 expression in E11.5 Br/Br MNPs. qRT-PCR
results show a significant downregulation of Flrt2 in Br/Br MNPs.
Expression of Flrt2 is shown relative to expression of Flrt2 in +/+ MNP
tissue after being normalized against the amount of Gapdh; calculated
using the 2-ΔΔC(t)
method. n = 4 for both genotypes.
These data were not considered significant enough to pursue additional validation of
Wnt4.
Six2 is expressed in MNP explant cell culture and can be knocked down using siRNA
To further test whether Six3 is a direct downstream target of Six2, we designed an
experiment utilizing RNAi, specifically siRNA, in order to knock down Six2 expression
in vitro and measure the resulting expression of Six3. First, it was necessary to determine
Six2 expression following 72 hours in untreated culture, as this was the time required for
siRNA incubation. Three experimental conditions were tested against an in vivo control,
which was the amount of Six2 mRNA extracted from MNP tissue immediately after
dissection from an E11.5 explant. Each experimental culture continued at least 72-hours
before RNA extraction. The resulting qRT-PCR data suggested Six2 expression signifi-
Page 70
61
Figure 3.14 Relative Wnt4 expression in E13.5 Br/Br kidneys and E11.5
Br/Br MNPs. Although a Six2-/-
mouse demonstrated renal upregulation of
Wnt4, E13.5the Br mouse showed no evidence of its upregulation in either
the renal (A) or facial primordia (B). Expression of Wnt4 is shown
relative to Wnt4 expression in +/+ kidney and MNP tissue after being
normalized against the amount of Gapdh; calculated using the 2-ΔΔC(t)
method. n ≥ 3 for both genotypes in A and B.
cantly decreased for each culture condition tested (Figure 3.15a). The neural crest
marker Ap-2α expression was also measured and showed a similar decrease in expression
(Figure 3.15b).
Page 72
63
Since it didn’t appear Six2 expression in culture was being influenced by the presence or
removal of the explant from culture, we decided to perform subsequent cultures with the
explant included, since this was this system yielded the most the most RNA after
extraction (Figure 3.15c). Even though qRT-PCR suggested Six2’s decline in culture,
IHC detected positive Six2 staining in the nuclei of cultured cells (Figure 3.16a). Double-
staining for Ap-2α in these same cells (Figure 3.16b) revealed its expression in the
nuclei, as well as the cytoplasm. Even though Ap-2α is a transcription factor, its
presence and sequestration in the cytoplasm of cultured cells is not uncommon as its
transcriptional activity wanes (Mazina et al., 2001). The Ap-2α positive staining
confirmed the cells in culture were neural crest in origin. Further, there was no statistical
difference in the number of Six2-positive and Ap-2α-positive cells, as determined by
tessellation analysis (Figure 3.17; Table 3.1).
Figure 3.16 Immunofluorescent staining for Six2 and Ap-2α in MNP cell
culture. (A) Six2 staining is shown in green, while nuclei stained with
DAPI are in blue. Six2, as a transcription factor, only localized in the
nuclei. (B) Ap-2α staining is shown in red, while nuclei stained with
DAPI are in blue.
Page 74
65
Table 3.1 Descriptive statistics derived from Six2 and Ap-2α double
stained MNP cell cultures in Figure 3.17. p-values less than 0.01 for each
parameter indicate that the number of cells stained for Six2 and the
number of cells stained for Ap-2α is not statistically dissimilar.
Values represent average ± standard error of the mean.
NND, nearest neighbor distance; CD, centroidal distance. aAverage number from 3 cultures.
In vitro knockdown of Six2 in cultured MNP cells was carried out using siRNA
technology upon determining a suitable amount of Six2 protein was being translated, as
indicated by Figure 3.16a. Two siRNA dilutions were tested for knockdown efficiency,
0.1 μM and 1.0 μM. Based on qRT-PCR data, it was determined the higher
concentration of siRNA more efficiently knocked down Six2 expression (Figure 3.18).
Further, the 1.0 μM NTP siRNA-treatment sample did not significantly affect Six2
expression compared to the untreated culture and its deviation was narrower compared to
its 0.1 μM counterpart. IHC data in Figure 3.19 corroborates the knockdown qRT-PCR
data in Figure 3.18b. qRT-PCR for Ap-2α was also run in the 1.0 μM samples to
determine knockdown specificity, as well as cytotoxicity triggered by the siRNA
incubation. As shown in Figure 3.20a, qRT-PCR did not detect any significant change in
Ap-2α expression in either the NTP- or siRNA-treated wells compared to the untreated
sample. IHC for Ap-2α confirmed these data (Figure 3.20b,c,d). Taken all together,
Page 75
66
Figure 3.18 Relative Six2 expression in MNP cell culture following
incubation with test dilutions of Six2 siRNA. (A) qRT-PCR results for
Six2 following 0.1 μM siRNA incubation against Six2 determined a
knockdown of 40%. (B) qRT-PCR results for Six2 following 1.0 μM
siRNA incubation against Six2 determined a knockdown of 70%.
Expression of Six2 is shown relative to Six2 expression in untreated cells
after being normalized against the amount of Gapdh; calculated using the
2-ΔΔC(t)
. n = 3 for each treatment in A and B. †p = 0.05; *p < 0.01.
these results imply the knockdown generated by the 1.0 μM siRNA in the MNP culture
system is specific to Six2 and the neural crest-derived cells in culture are not subject to
the effects of cytotoxicity caused by the introduction of the siRNA.
Page 76
67
Figure 3.19 qRT-PCR and immunofluorescent staining of Six2 in MNP
cell culture following incubation with Six2 siRNA. (A) qRT-PCR results
for Six2 demonstrating a 70% in vitro knockdown following 72-hour
siRNA incubation (same data as Figure 3.17b). (B, C, D) IHC for Six2 in
untreated, NTP- and siRNA-treated MNP cell culture corroborated qRT-
PCR results. Number of cells in B, ~590; C, ~490; D, ~350. Treatments
were repeated twice with three individual MNPs assayed per treatment.*p
< 0.01.
Six3 expression is unchanged when Six2 is knocked down in MNP and kidney organ
cultures
Upon the implication of a genuine Six2 knockdown described in Figures 3.18, 3.19
and 3.20, we wanted to determine if Six3 was also upregulated the siRNA system, as it is
Page 77
68
Figure 3.20 qRT-PCR and immunofluorescent staining of Ap-2α in MNP
cell culture following incubation with Six2 siRNA. (A) qRT-PCR results
for Ap-2α showed no significant misexpression in siRNA treated cells.
Expression of Ap-2α is shown relative to Ap-2α expression in untreated
cells after being normalized against the amount of Gapdh; calculated using
the 2-ΔΔC(t)
method. (B, C, D) IHC for Ap-2α in untreated, NTP- and
siRNA-treated MNP cell culture corroborated qRT-PCR results. Number
of cells in B, ~ 590; C, ~490; D, ~350. Treatments were repeated twice
with three individual MNPs assayed per treatment.
in vivo in the Br midfacial mesenchyme. However, unlike the qRT-PCR data run on the
Br MNPs shown in Figure 3.7, the in vitro knockdown did not demonstrate a significant
misregulation of Six3 (Figure 3.21).
Page 78
69
Figure 3.21 Relative Six2 and Six3 expression in MNP cell culture
following incubation with Six2 siRNA. (A) qRT-PCR results for Six2
demonstrating in vitro knockdown (same data as Figure 3.17b). (B) In
the same cDNA sample, Six3 did not show significant misregulation in
response to the in vitro knockdown of Six2. Expression of Six3 is shown
relative to Six3 expression in untreated cells after being normalized against
the amount of Gapdh; calculated using the 2-ΔΔC(t)
. Treatments were
repeated twice with three individual MNPs assayed per treatment. *p <
0.01.
After contemplating this data and the convincing data in Figure 3.7, we were
concerned the natural decrease in Six2 mRNA seen in Figure 3.15a would render any
knockdown by siRNA inconsequential. That is, we felt Six2 expression may need to be
Page 79
70
sustained near its in vivo concentration over 72 hours in an untreated culture system such
that siRNA can knockdown a suitable, absolute amount of Six2 to the point where
possible downstream genes of Six2 are misexpressed. In this case, we attempted to
establish a kidney organ culture system to measure Six2 expression after 72 hours. As
shown in Figure 3.22b, Six2 was not significantly downregualted in a kidney culture
system and it was decided to attempt siRNA on this tissue. After siRNA incubation,
kidney Six2 mRNA was diminished 55% compared to the untreated control (Figure
3.23a). However, the kidneys incubated with NTP siRNA also demonstrated a
downregulation of Six2. Interestingly, Six3 expression in the each of the samples showed
only a slight discrepency between the samples that was not statistically significant (p >
0.01; Figure 3.23b).
Page 80
71
Figure 3.22 Relative Six2 expression in untreated MNP cell and kidney
organ cultures. (A) Six2 shows significant reduction of expression
following 72 hours in untreated MNP cell culture (same data as Figure
3.15a, experimental condition 1). (B) Kidney organ culture did not show a
significant reduction of Six2 expression following 72-hour untreated
culture incubation. Expression of Six2 is shown relative to Six2
expression in uncultured explant tissue after being normalized against the
amount of Gapdh; calculated using the 2-ΔΔC(t)
method. For B, cell lysates
from two explant kidneys were pooled before RNA extraction; culture was
run with four individual kidneys from four distinct embryos and RNA
extracted collectively from the culture vessel. *p < 0.01.
Page 81
72
Figure 3.23 Relative Six2 and Six3 expression in kidney organ culture
following incubation with Six2 siRNA. (A) qRT-PCR results for Six2
demonstrating a significant in vitro knockdown of Six2. However, NTP-
treated cells also displayed decreased Six2 expression. (B) In the same
cDNA sample, Six3 once again did not show significant misregulation in
response to the in vitro knockdown of Six2. Expression of Six2 and Six3 is
shown relative to their respective expressions in untreated cells after being
normalized against the amount of Gapdh; calculated using the 2-ΔΔC(t)
.
Treatments were repeated twice with four individual kidneys assayed per
treatment. *p < 0.01.
Page 82
73
CHAPTER 4
DISCUSSION
Six2 was first described in the head mesenchyme nearly twenty years ago, however, a
search of published literature has uncovered relatively little describing Six2’s possible
role in facial morphogenesis (Oliver et al., 1995a). Fogelgren et al. (2008) hypothesized
Six2 promotes cellular proliferation in the CNCM within the FNP that ultimately shapes
the trabecular cartilages of the murine cranial base. At E10.5-E11.0 in the mouse, each
of the facial prominences grows in a unique pattern, marking the beginning of
development of the primary palate (Diewert and Wang, 1992; Diewert and Lozanoff,
1993). In this study, we have demonstrated Six2 expression increases from E10.5 to
E11.5 in each of the facial prominences. This increase in Six2 expression corresponds to
the precise interval of enlargement of the prominences, and especially, the subsequent
merging of the bilateral MNPs, supports the theory that Six2 promotes mesenchymal cell
proliferation in the CNCM of the facial primordia.
However, the CNCM continue to proliferate well beyond E11.5, which may elucidate
why Six2 expression only drops by only half at E12.5 in the midfacial mesenchyme.
After fusion at the nasal fin and ensuing confluence of the mesenchyme, these cells
continue to divide as the frontonasal prominence grow in the proximodistal axis
(Marcucio et al., 2005). Additionally, the CNCM emigrate, from the midface, under the
forebrain at E13 in order to lay the foundation for the anterior cranial base and the
CNCM-derived midfacial cartilages (Jiang et al., 2002; McBratney-Owen et al., 2008).
Moreover, the CNCM-derived trabecular cartilages mentioned by Fogelgren et al. (2008)
Page 83
74
don’t condense until E13 and the chondrocranium is not fully developed until E16
(Depew et al., 2002).
Previous work in our laboratory demonstrated the kidney in Br mice demonstrates a
haploinsufficient expression pattern of Six2 utilizing qRT-PCR (Fogelgren et al., 2008).
However, the Br mutant mouse strain had not been tested for Six2 expression in the facial
prominences. Thus, we undertook a qRT-PCR approach to determine whether Six2 is
expressed in a haploinsufficient pattern in the facial prominences at the precise time of
midfacial merging in homozygous mutant, heterozygous and homozygous normal 3H1 x
BALB/c mice. We have shown, in each of the facial prominences, Six2 expression is
reduced in a haploinsufficient pattern; that is, when compared to WT, Six2 expression in
the Br/+ heterozygote is reduced by about fifty percent and even more dramatically
reduced in the Br/Br homozygous mutant, supporting both the semidominant phenotype
and Six2 as the candidate gene hypothesis. In the Br mouse, the deficiency in Six2
expression may disrupt proliferation of the underlying mesenchyme in the MNPs, such
that incomplete merging of the paired structures results in a median orofacial cleft. This
is supported by Lozanoff et al. (1994) who found the facial prominences in the Br/Br
embryo are smaller than their WT counterparts, which may lead to the hypoplastic
phenotype in the Br face.
Six2’s function in the developing kidney is far better understood than its role during
facial morphogenesis. Downstream targets of Six2 have been identified in the
metanephric mesenchyme, including Gdnf, as well as the Six2 promoter, itself (Brodbeck
et al., 2004). Gdnf stimulates one half of the reciprocal induction of renal morphogenesis
by inducing branching of the nephric duct and establishing the ureteric bud (Gilbert,
Page 84
75
2000). The production of a transgenic mouse in which Six2 was absent revealed Six2
mediates the differentiation of the metanephric mesenchyme by inhibiting the
mesenchymal-to-epithelial transition in order to ensure an adequate number of
mesenchymal precursors (Self et al., 2006). These knockouts demonstrate a reduced
number of nephrons leading to RH at birth. However, to our knowledge, there has been
no definitive study on the temporal expression pattern of Six2 in the developing kidney.
In WT mice, Six2 expression decreases during embryogenesis and is absent in adult
kidneys. A similar pattern of Six2 reduction is also seen in Br/+ and Br/Br mice.
Fogelgren et al. (2008) has previously shown the Six2 protein is downregulated at E13.5
in Br mice via Western blot, however the overall levels of Six2 were variable within each
genotype. In this study, we found the amount of Six2 mRNA to be haploinsufficient in
the Br kidneys at E13.5. At E17.5, however, the haploinsufficiency is not maintained, as
the amount of Six2 transcript in the Br/+ mouse falls significantly under 50%. Normally,
the metanephric mesenchyme replenishes itself to accommodate the successive branching
events of the ureteric buds. However, we propose that when Six2 expression drops in Br,
there is an increase in the transition of the mesenchyme to epithelia leading to the prompt
decline of Six2-positive precursors.
DNA microarrays have revolutionized the field of high-throughput gene expression
studies in the last fifteen years. However, the quality of the data obtained from DNA
microarrays can vary depending on several factors and must be interpreted thoughtfully
and with some uncertainty. That is, with as much inherent variability in evaluating tens
of thousands of genes simultaneously (i.e. preparing/stabilization of biological samples,
isolating and purifying RNA, hybridization protocols, target preparation), verification of
Page 85
76
microarray data is vital in order to assign definite patterns of misexpression of specific
genes with confidence (Jaluria et al., 2007). Further, in order to evaluate results found
during microarray analyses, investigators must determine if their results are valid for the
biological system being observed and if the data describes the phenomenon being studied
(reviewed in Chuaqui et al., 2002). Independent confirmation of microarray results can
be done in two ways: in silico analysis (comparing microarray results with those results
found in the literature) and laboratory-based analysis (including qRT-PCR, northern blot,
in situ hybridization and immunohistochemistry). However, validating over forty-
thousand genes would be extremely impractical using the above methods. Instead,
specific genes of interest to the researcher, based on the purpose and scope of the
research being performed, are chosen for verification (Jaluria et al., 2007). For the
corroboration of our microarray data, we undertook an initial laboratory-based validation
preceding the microarray hybridization by examining Six2 expression in the samples that
were to be hybridized. Once it was known the Br/Br sample was deficient in Six2,
hybridization proceeded. Immediately after procurement of the microarray results, we
undertook the in silico approach for corroboration, comparing pathways known to be
involved in the development of FND and possible candidate genetic pathways
misregulated in the microarray.
Quite commonly, investigators choose the genes with the highest levels of
misexpression for further analysis after examining the microarray data (Chuaqui et al.,
2002). Not surprisingly, we chose the gene associated with the probe shown to be most
upregulated for additional analysis via qRT-PCR: p63. Additionally, p63’s presence in
the ectoderm of the branchial arches implies its role in craniofacial morphogenesis (Yang
Page 86
77
et al., 1999). Transgenic p63-/-
mice present with striking craniofacial defects, including
hypoplasia of the craniofacial skeleton, thought to be attributed to a defect in
mesenchymal-epithelial interaction (Yang et al., 1999). However, qRT-PCR with novel
primers failed to detect any p63 misexpression in the Br/Br facial mesenchyme,
challenging results from the microarray. Chuaqui et al. postulated two possible
complications involving microarray target-probe hybridization: (1) non-specific
background signals leading to artificially low mRNA expression values and (2) cDNA
hybridization to multiple, unspecific DNA probes on an array. Such cross-hybridization
would suggest unauthentic upregulation. That p63 showed no differential expression
using qRT-PCR after upregulation in the microarray data possibly alludes to the presence
of contaminating cross-hybridizations in the microarray.
Probably the most intriguing of all the probes with the greatest misexpression in the
microarray was Six3, another member of the Six family of transcription factors, also
located on murine chromosome 17, adjacent to and roughly 70 kb from Six2. In this
report, we have presented qRT-PCR results validating the microarray data for Six3’s
upregulation in the Br midface. This was striking since Six3’s presence in the facial
mesenchyme has not been described in previous reports. Previous work depicts the
normal pattern of embryonic Six3 expression strictly in tissues epithelial in nature that is,
the ventral forebrain, optic vesicles and nasal cavity ectoderm (Oliver et al., 1995b).
Fogelgren et al. (2008) performed qRT-PCR for Six3 on E11.5 heads, however, there was
no significant misexpression among Br/+ or Br/Br embryos. In their study, Fogelgren et
al. extracted mRNA for qRT-PCR from the entire head of E11.5 Br embryos; it is
possible the extraneous tissue included in their mRNA extraction, including the cranial
Page 87
78
tissues where Six3 expression is expected, masked the misexpression of Six3. To prevent
this type of possible miscalculation, our MNP Six3 qRT-PCR assay included only RNA
dissected from MNP tissue, which demonstrated significant upregulation in Br/+ and
further upregulation in Br/Br. Furthermore, Fogelgren et al. did not report the efficiency
of their Six3 primers, thus, it is possible the primers used in this experiment, which were
designed to include the microarray probe sequence for Six3 in the amplicon, were more
efficient for qRT-PCR . Our IHC data for the Six3 protein corroborates the qRT-PCR
data and localizes its misexpression in Br/Br to the midline mesenchyme of the MNP, the
same cells Fogelgren et al. demonstrated via IHC lose Six2 expression in the Br embryo.
Following data from three assays (microarray, qRT-PCR and IHC) that Six3 is
upregulated in the Br/Br midface, we examined the misexpression results from the
microarray further for possible genes known to be downstream of Six3. The upregulation
in the microarray of Pax6 and Sox2 were of interest due to their involvement with Six3 in
eye development (Liu et al., 2006). Six3 is progressively expressed in the mouse,
beginning at E9.0, in the optic stalk, optic vesicle, neuroretina and lens (Oliver et al.,
1995b). These findings led Oliver et al. (1996) to postulate Six3 tenders positional
information to the forebrain such that induction of optic vesicles is initiated in the correct
location. This was established by expressing murine Six3 in fish embryos; these embryos
would later develop ectopic lenses. At E11.5, Pax6 and Six3 are expressed together in
the neural retina, lens and optic stalk, as well as the in the olfactory epithelium (Oliver et
al., 1995b). However, in a conditional Six3 knockout, the lenses failed to form due to the
failure of the thickening and invagination events of the presumptive lens ectoderm,
producing a phenotype similar to that of Pax6-/-
embryos (Liu et al., 2006, Grindley et al.,
Page 88
79
1995). Furthermore, Pax6 was downregulated in these Six3-/-
mutants leading Liu et al.
to suggest Six3 directly Pax6. Pax6, in turn, has been shown to be a direct regulator of
Sox2 in the neural stem cell culture and Sox2 expression decreases in a Pax6 knockout
mouse (Wen et al., 2008). Sox2 has been shown to maintain and promote the self-
renewal of human embryonic stem cells (Fong et al., 2008). EMSA and ChIP assays
confirmed that Six3 directly binds to the regulatory elements Pax6 and, likely, Sox2 (Liu
et al., 2006).
Similar to p63 however, our qRT-PCR results show no significant misexpression of
either Pax6 or Sox2 in the midface of Br/+, with the corresponding increase in Six3
expression previously described. While the Six3-Pax6-Sox2 system seems to play a role
in progenitor maintenance in neural precursors, a similar role Six2 plays in the embryonic
kidney, it seems it does not appear likely Pax6 or Sox2 play a role in the facial phenotype
of Br mice.
One gene selected for further validation known to be downstream of Six3 was Shh
which has been well studied in its role of forebrain development. Loss of Shh function
disrupts gene expression patterns in the ventral midline, resulting in a single telencephalic
vesicle, as well as a single optic vesicle, both classical indications of holoprosencephaly,
the most severe form of which is cyclopia (Chiang et al., 1996). Geng et al. (2008)
proposed Six3 directly activates Shh expression in the midline of the rostral
diencephalon, and in turn, Shh maintains Six3 expression. In transgenic mice with a
single allelic mutation in Six3 causing holoprosencephaly, Shh expression in the rostral
diencephalon was reduced compared to that of the WT (Geng et al., 2008). That is,
haploinsufficiency of Six3 was not sufficient to activate Shh expression in the ventral
Page 89
80
forebrain. In the chick midface, as the CNCM arrive in the MNP, Shh signaling from the
adjacent FEZ epithelium controls growth of the midface (Marcucio et al., 2005). When
Shh signaling is disturbed in the forebrain (prior to outgrowth of the facial prominences),
Shh expression in the FEZ is also reduced, leading to impaired gene expression in the
facial mesenchyme and a narrowed facial phenotype (Marcucio et al., 2005).
Comparably, Young et al. (2010) demonstrated by increasing Shh-signaling activity in
the brain is associated with the facial widening and median clefts. Moreover, Young et
al. theorized that Shh participates in a dose-response relationship with phenotypic
response. That is, the extent of Shh expression in the neuroectodermal epithelia
determines the size and location of the FEZ, while the FEZ size establishes a
morphogenic Shh gradient in the mesenchyme, which, when induced, drives cell
proliferation and creates growth zones in the developing midface (Hu and Marcucio,
2009). Young et al. (2010) expanded that theory by explaining that increased Shh
signaling in the forebrain splits the Shh expression from the midline FEZ, lateralizing the
zone of mesenchyme proliferation in the midline, yielding wider midfaces with median
clefts. Also, it is conjectured linear changes in mesenchymal Shh concentration cause
nonlinear phenotypic responses (Young et al., 2010).
McBratney et al. (2003) was the first to hypothesize the Br mutation may be related to
an interaction with Shh. Based on our data that Six3 is upregulated in the Br midface, we
decided to assay Shh in the Br MNP mesenchyme, even though its expression in the
microarray was deemed “undetectable” by the Agilent analytical software. Additionally,
arrays may be insensitive and imprecise for transcripts with only small discrepancies in
expression, overlooking genes of significant interest (Chuaqui et al., 2002). Novel qRT-
Page 90
81
PCR primers amplified the Shh probe sequence and confirmed a minor upregulation in
Br/Br MNPs. However, if the concentration of Shh is regulated and maintained within a
narrow margin, as suggested by Young et al. (2010), we propose that the upregulation of
Six3 in the Br midface may result in activation of Shh transcription and translation,
disrupting the normal morphogenic gradient of Shh from the FEZ, which contributes to
the Br median cleft phenotype.
Upon our suggestion that Shh may be differentially regulating genetic expression
patterns of the MNP mesenchyme in the Br mouse, we discovered Flrt2, whose
expression has been previously localized to the CNCM by Gong et al. (2009), was
downregulated in the microarray. Our qRT-PCR analysis of Flrt2 confirmed this
assessment. That Flrt2 is expressed in the MNP mesenchyme lead Gong et al. (2009) to
support its role in the proliferation and/or migration of the CNCM. Furthermore, Flrt2 is
co-expressed with Fgfr2 in the frontonasal region. A ligand for Fgfr2, Fgf8, was
identified to act in accord with Shh in directing outgrowth of the frontonasal region
(Abzhanov and Tabin, 2004). Downregulation of Flrt2 may imply a decrease in
mesenchymal proliferation of the midface, which would agree with our hypothesis that
increased Shh expression shifts the proliferative zones of the midfacial mesenchyme,
such that the facial midline becomes hypoplastic, resulting in FND.
Previous work has shown the Six2 protein is downregulated in Br kidneys (Fogelgren
et al., 2008) and we have shown, in this study, the Six2 transcript, is downregulated in the
same tissue. Based on this information and our previous data suggesting Six3 is
upregulated in the developing midface associated with Six2’s downregulation, it was
logical to measure Six3 expression in Br kidneys. In E14.5 kidneys, Six3 expression is
Page 91
82
upregulated in Br/+ mice compared to the WT. Since there is no published record of
Six3 expression in the renal system, it is difficult to project what consequence ectopic
expression of the transcription factor may have, if any, in the urogenital system.
Furthermore, no renal phenotype was reported in a transgenic Six3-/-
mouse (Lagutin et
al., 2003). However, Six3 upregulation associated with a downregulation in Six2 in the
two tissues where Six2 is most highly expressed (midface, kidney) is significant support
for a relationship between the two genes. This relationship is most likely to be one of
two possibilities: (1) a direct, physical interaction between Six2 and Six3 or (2) a cis-
acting regulatory region under which the two genes are transcriptionally controlled.
Wnt4 expression by the metanephric mesenchyme in the developing kidney is
necessary for the epithelialization of the condensed mesenchyme during nephrogenesis
(Stark et al., 1994). Self et al. (2006) reported in a Six2-/-
knockout mouse, Wnt4
expression is ectopically expanded in the expanded in the metanephric mesenchyme,
resulting in premature differentiation and depletion of the mesenchymal progenitor pool.
We have shown with qRT-PCR that Wnt4 in the Br kidney, as well as the midface, is not
differentially expressed in response to a downregulation in Six2. In this case, it is
possible the inhibition of gene function may be disguised by another gene that is
functionally redundant to the repressed gene (Rikin et al., 2010). It was first suggested
by Fogelgren et al. (2008) that there may be a compensatory mechanism in response to a
deficiency in Six2 expression. Figures 4.1 and 4.2 combine data from Figures 3.2 and 3.7
and Figure 3.9(a, b), respectively to demonstrate the inverse relationship between Six2
and Six3 in E11.5 MNPs and E14.5 kidneys upon the downregulation of Six2 in the Br
Page 92
83
Figure 4.1 Summary of relative Six2 and Six3 expression in E11.5 MNPs.
The haploinsufficient expression pattern of Six2 in the MNP is reversed in
terms of Six3 in the same tissue. This figure combines data from Figures
3.2 and 3.7. Expression of Six2 and Six3 is shown relative to expression
of Six2 and Six3 in +/+ tissue after being normalized against the amount of
Gapdh; calculated using the 2-ΔΔC(t)
method. *p < 0.01.
Figure 4.2 Summary of relative Six2 and Six3 expression in E14.5
kidneys. The downregulation of Six2 expression in Br/+ kidneys is
reversed in terms of Six3 in the same tissue. This figure combines the data
in Figure 3.9a and 3.9b. Expression of Six2 and Six3 is shown relative to
expression of Six2 and Six3 in +/+ tissue after being normalized against
the amount of Gapdh; calculated using the 2-ΔΔC(t)
method. *p < 0.01.
Page 93
84
mouse. This data does indeed seem to suggest a functional redundancy in the Six family
of transcription factors is plausible.
While the Br mutation has been mapped to the distal portion of murine chromosome
17, linkage analysis has ruled out the possibility of the Six3 mRNA coding sequence to be
within the critical region for the Br mutation (Fogelgren et al., 2008). The only gene
within the critical region is Six2. However, it is thought the Br mutation is located in a
cis-acting regulatory region upstream or downstream of Six2, affecting Six2 in its
classical areas of expression (Fogelgren et al., 2008). With the data in this study as
evidence, it is becoming increasingly more likely that the Br mutation may also affect the
transcription of Six3. To help further our understanding of the possible relationship
between Six2 and Six3, we undertook an RNAi approach for knocking down Six2 in
vitro.
Our preliminary experiments before performing RNAi was to determine the
expression of Six2 in differing MNP explant culture systems. We observed that Six2
expression declines in culture compared to an explant fixed immediately following
dissection, regardless of the time in culture, or the physical presence of the explant in
culture. Correspondingly, Ap-2α expression in the same cultures also subsided. Since
Ap-2α is a marker for neural crest cells, it is possible these cells are relinquishing their
neural crest properties while in culture. However, IHC revealed the Six2 and Ap-2α
proteins were present in the seeded cells and tessellation analysis confirmed no
significant difference between the number of cells stained for Six2 and Ap-2α.
Fogelgren et al. (2008) has previously shown, using IHC, Six2 localizes to mesenchymal
cells within the WT MNPs. With that, we were confident the cells in culture were
Page 94
85
mesenchymal in nature and derived from the CNCM. We therefore decided to introduce
siRNA into these cultures in order to downregulate Six2 in vitro. It may be possible that
the abatement of Six2 and Ap-2α seen in MNP culture is also seen in vivo in the
differentiating mesenchyme comprising the FNP at E13.5-E14.5; further in vivo analysis
using midfaces from these stages may provide some insight as to Six2’s expression
pattern during later development.
siRNA targeting Six2 was introduced into a MNP cell culture system containing the
MNP explant and qRT-PCR and IHC confirmed Six2 downregulation. qRT-PCR and
IHC also confirmed Ap-2α expression was unchanged in the siRNA culture, suggesting
the siRNA against Six2 was specific and not effectively cytotoxic. Upon the realization
of Six2 downregulation in culture, qRT-PCR determined Six3 was not differentially
expressed when Six2 was knocked down in vitro. This unexpected result led us to
consider the progressive, natural decline of Six2 expression in MNP culture described in
Figure 3.15a may be affecting the expression of Six2 target genes, possibly masking the
effect of a knockdown via siRNA.
Since we have shown Br kidneys also demonstrate an upregulation in Six3 expression
in association with Six2 downregulation, we decided to assay Six2 expression in a kidney
organ culture system. Upon the finding that Six2 expression is not significantly reduced
following 72-hour E13.5 kidney culture, we decided to incubate Six2 siRNA with E13.5
kidneys, followed by qRT-PCR for Six3. Kidneys incubated with Six2 siRNA
demonstrated a 50% reduction in Six2 expression; similar results as those obtained by
Phillips (2011). Interestingly, our NTP siRNA-treated kidneys also showed diminished
Six2 expression. While this control siRNA is normally used to determine non-sequence
Page 95
86
specific effects, our Gapdh C(t) values for these cultures suggests the decrease in Six2
expression seen in these cultures may not be ubiquitous. That is, if a ubiquitous
knockdown was occurring, we would expect to see higher C(t) values for Gapdh in the
NTP-treated culture; as shown in Figure 4.3, there was no significant change in the C(t)
values for Gapdh in any of the culture conditions. Moreover, Six3 expression remained
unaffected in the NTP-treated and siRNA-treated culture. As previously mentioned, the
relationship between Six2 and Six3 is largely unknown, despite their close proximity on
murine chromosome 17. The Br mouse allows us to study this relationship, as we have
shown Six3 is upregulated in tissues where Six2 is deficient. We have two theories
regarding this matter: (1) Six3 expression is dependent on Six2, such that Six2 is a direct
inhibitor of Six3 transcription, or (2) Six2 and Six3 expression are independent and that
the upregulation of Six3 in the Br mouse is due to a mutation, or multiple mutations, in a
Figure 4.3 Threshold cycles of Gapdh in siRNA kidney cultures used for
normalization in Figure 3.23. This data suggests the diminished
expression of Six2 in the NTP-treated kidney culture (Figure 3.23a) is not
ubiquitous. The amount of RNA was quantitated and normalized prior to
cDNA synthesis facilitating this comparison.
Page 96
87
regulatory region that normally activates Six2 and inhibits Six3 transcription. Our RNAi
experiments have indicated that the first theory may be erroneous. If, in fact, Six2
directly regulates Six3, we would have expected to observe an increase in Six3 expression
in the siRNA system. That we did not only rouses two more questions: does a single
mutation in a regulatory region of Six2 also misregulate Six3 or is there a second
mutation in a nearby Six3 regulatory region, in addition to the mutation triggering a
reduction in Six2?
In summary, we have shown Six2 expression in the mesenchyme of the developing
midface peaks at the time of midfacial merging. At this time in Br mice, Six2 is
expressed in a haploinsufficient pattern in each of the facial prominences. In the kidney,
Six2 is most highly expressed at the time corresponding to the initiation of nephrogenesis
and proceeds to wane during development until it is no longer detectable in the adult
mouse. Its expression in the Br mouse is haploinsufficient at E13.5, however, by E17.5,
haploinsufficiency is not maintained, probably due to a decline in the number of renal
progenitors in Br mice.
Microarray analysis detailed the misexpression of more than three thousand genes in
the Br midfacial mesenchyme. One of those genes, Six3, is another member of the Six
family of transcription factors and is located adjacent to Six2 on murine chromosome 17.
While Six3 expression has been extensively studied in neuroepithelial tissues, its
expression and possible function in the midfacial mesenchyme has not been elucidated.
Other genes of interest as a result of this study include Shh and Flrt2. Further work,
including IHC, RNAi and proliferation assays may further our understanding of the
possible role these genes, as well as Fgfr2, which physically interacts with Flrt2 (Gong et
Page 97
88
al., 2009), may play in the development of FND. Additionally, it is possible Wnt9b,
based on its dual role of progenitor renewal and differentiation of the metanephric
mesenchyme in cooperation with Six2 (Karner et al., 2011), may also cooperate with
Six2 in the CNCM during midfacial morphogenesis; future work will be aimed to
uncover a possible mechanism between these genes during facial development.
We have also demonstrated Six2 can be downregulated in vitro in mesenchymal cells
derived from the neural crest. However, although Six3 is upregulated in Br midfaces
associated with a downregulation in Six2 in vivo, Six3 is not misexpressed in our culture
system when Six2 is downregulated using siRNA. Furthermore, renal Six3 misexpression
in Br in vivo is also not seen in a Six2 in vitro knockdown system. Based on these data,
we suggest Six3 expression is independent of Six2. This indicates the Br mutation may
be affecting an enhancer region of Six2 while also affecting a repressor region of Six3.
Further sequencing work will be aimed at identifying the location and type of mutation
responsible for the FND and RH phenotype in the Br mouse.
Page 98
89
APPENDIX
SUPPLEMENTAL DATA
Figure SD.1 Photograph of a 4% metaphor gel used for genotyping.
DNA amplified with primers for D17Mit76, which only showed a single
recombinant in 720 total backcrossed mice (LOD = 213; Figure 1).
Genotypes are scored based on the number of amplimers seen. One band
at Balb is scored +/+, one band at 3H1 is scored Br/Br and a band at both
Balb and 3H1 is scored Br/+.
Page 99
90
Table SD.1 Primers used for qRT-PCR assays. Each primer was initially
tested for specificity via melt curve analysis, which also yielded the
optimal data collection temperature. Efficiency, via serial dilution of a
positive control, defined optimal annealing temperatures. Gapdh, as a
housekeeping gene serving to normalize many unique primer sets, was
tested at several annealing temperatures.
Gene SequenceAnnealing
temperature
Data collection
temperature
F: 5’ – aaggtacaaccacccacttg – 3’
R: 5’ – caaagcccactaaacaggag – 3’
F: 5' – cctggcctacctgtctttac – 3'
R: 5' – ggaaagttggatcctttcag – 3'
F: 5’ – gcatcttgggctacactgag – 3’
R: 5' – ggtggtccagggtttcttac – 3'
F: 5' – catagcatgagctgaaccac – 3'
R: 5' – gctttcccaaggtatgaaac – 3'
F: 5' – aatgggcggagttatgatac – 3'
R: 5' – tctcgatcacatgctctctc – 3'
F: 5' – tatgaacggaccttcaagag – 3'
F: 5' – gaaagcaggagcatagcag – 3'
F: 5’ – ctcaccaccacgcaagtcagcaac – 3’
R: 5’ – caccgacttgccactgccattgag – 3’
F: 5’ – gtcgtcgccttccacaccgg – 3’
R: 5’ – aagtaccgcgtgcgcaagaag – 3’
F: 5' – gagaaccccaagatgcac – 3'
R: 5' – cgggaagcgtgtacttatc – 3'
F: 5' – cgcgctaaaggagaagtttg – 3'
R: 5' – gccgtcaatggctttagatg – 3'
Ap-2 α 75.5°C59.0°C
Gapdh 82.5°C50.3-59.5°C
p63 77.5°C51.0°C
Flrt2 80.5°C52.5°C
Pax6 81.0°C51.0°C
Sox2 84.0°C51.0°C
Six2 85.0°C59.0°C
Six3 88.0°C59.0°C
Wnt4 59.0°C 86.0°C
Shh 50.3°C 77.0°C
Page 110
101
Figure SD.12 Control IHC for the Six3 primary antibody used in IHC.
(A) Positive control demonstrates Six3 staining in the neuroepithelium.
(B) Omission of primary Six3 antibody lead to the absence of staining in
the neuroepithelium. NE, neuroepithelium; LV, lateral ventricle.
Page 111
102
REFERENCES
Abzhanov A, Protas M, Grant BR, Grant PR, Tabin CJ. 2004. Bmp4 and morphological
variation of beaks in Darwin’s finches. Science 305, 1462–1465.
Abzhanov A, Tabin CJ. 2004. Shh and Fgf8 act synergistically to drive cartilage
outgrowth during cranial development. Dev Biol 273, 134-148.
Ahlgren SC, Bronner-Fraser M. 1999. Inhibition of sonic hedgehog in vivo results in
craniofacial neural crest cell death. Curr Biol 9, 1304-1314.
Apesos J, Anigian GM. 1993. Median cleft of the lip: its significance and surgical
repair. Cleft Palate Craniofac J 30, 94-96.
Bachler M, Neubüser A. 2001. Expression of members of the Fgf family and their
receptors during midfacial development. Mech Dev 100, 313-316.
Barlow AJ, Francis-West PH. 1997. Ectopic application of recombinant bmp-2 and
bmp-4 can change patterning of developing chick facial primordia. Development
124, 391-398.
Bonini NM, Leiserson WM, Benzer S. 1993. The eyes absent gene: genetic control of
cell survival and differentiation in the developing Drosophila eye. Cell 72, 379-
395.
Borsani G, DeGrandi A, Ballabio A, Bulfone A, Bernard L, Banfi C, Gattuso C, Mariani
M, Dixon M, Donnai D, Metcalfe K, Winter R, Robertson M, Axton R, Brown A,
van Heyningen V, Hanson I. 1999. EYA4, a novel vertebrate gene related to
drosophila eyes absent. Hum Mol Genet 8, 11-23.
Brodbeck S, Besenbeck B, Englert C. 2004. The transcription factor Six2 activates
expression of the Gdnf gene as well as its own promoter. Mech Dev 121, 1211-
1222.
Carl M, Loosli F, Wittbrodt J. 2002. Six3 inactivation reveals its essential role for the
formation and patterning of the vertebrate eye. Development 129, 4057-4063.
Carroll TJ, Park JS, Hayashi S, Majumdar A, McMahon AP. 2005. Wnt9b plays a
central role in the regulation of mesenchymal to epithelial transitions underlying
organogenesis of the mammalian urogenital system. Dev Cell 9, 283-292.
Chuaqui RF, Bonner RF, Best CJM, Gillespie JW, Flaig MJ, Hewitt SM, Phillips JL,
Krizman DB, Tangrea MA, Ahram M, Linehan WM, Knezevic V, Emmert-Buck
MR. 2002. Post-analysis follow-up and validation of microarray experiments.
Nat Genet 32, 509-514.
Page 112
103
Cheng C, Ying K, Xu M, Zhao W, Zhou Z, Huang Y, Wang W, Xu J, Zeng L, Xie Y,
Mao Y. 2002. Cloning and characterization of a novel human transcription factor
AP-2β like gene (TFAP2BL1). Int J Biochem Cell Biol 34, 78-86.
Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H, Beachy PA. 1996.
Cyclopia and defective axial patterning in mice lacking Sinic hedgehog gene
function. Nature 383, 407-413.
Cohen MMJ, Sulik KK. 1992. Perspectives on holoprosencephaly: Part II. Central
nervous system, craniofacial anatomy, syndrome commentary, diagnostic
approach, and experimental studies. J Craniofac Genetics Dev Biol 12, 196-244.
Cordero D, Marcucio R, Hu D, Gaffield W, Tapadia M, Helms JA. 2004. Temporal
perturbations in sonic hedgehog signaling elicit the spectrum of
holoprosencephaly phenotypes. J Clin Invest 114, 485-494.
de Crombrugghe B, Lefebvre V, Nakashima K. 2001. Regulatory mechanisms in the
pathways of cartilage and bone formation. Curr Opin Cell Biol 13, 721-727.
DeMyer W, Zeman W, Palmar CG. 1964. The face depicts the brain: diagnostic
significance of median facial anomalies for holoprosencephaly (arhinencephaly)
with median cleft lip and palate. Pediatrics 34, 256-263.
DeMyer W. 1967. The median cleft face syndrome. Differential diagnosis of cranium
bifidum occultum, hypertelorism, and median cleft nose, lip, and palate.
Neurology 17, 961-971.
Depew MJ, Tucker AS, Sharpe PT. Craniofacial Development. 2002. In: Rossant J and
Tam PPL (eds.). Mouse development: patterning, morphogenesis, and
organogenesis. London: Academic Press.
Diewert VM, Lozanoff S. 1993. Growth and morphogenesis of the human embryonic
midface during primary palate formation analyzed in frontal sections. J
Craniofac Genet Dev Biol 13, 193-201.
Diewert VM, Lozanoff S, Choy V. 1993. Computer reconstruction of human embryonic
craniofacial morphology showing changes in relations between the face and brain
during primary palate formation. J Caraniofac Genet Dev Biol 13, 193-201.
Diewert VM, Shiota K. 1990. Morphological observations in normal primary palate and
cleft lip embryos in the Kyoto collection. Teratology 41, 663-677.
Diewert VM, Wang, KY. 1992. Recent advances in primary palate and midface
morphogenesis research. Crit Rev Oral Biol Med 4, 111-130.
Page 113
104
Feng W, Williams T. 2003. Cloning and characterization of the mouse AP-2ε gene: a
novel family member expressed in the developing olfactory bulb. Mol cell
Neurosci 24, 460-475.
Firnberg N, Neubüser A. 2002. FGF signaling regulates expression of Tbx2, Erm, Pea3
and Pax3 in the early nasal region. Dev Biol 247, 237-250.
Fogelgren B, Kuroyama M, McBratney-Owen B, Spence AA, Melahn LE, Anawati MK,
Cabatbat C, Alarcon V, Marikawa Y, Lozanoff S. 2008. Misexpression of Six2
is associated with heritable frontonasal dysplasia and renal hypoplasia in 3H1 Br
mice. Dev Dyn 237, 1767-1779.
Fogelgren B, Yang S, Sharp IC, Huckstep OJ, Ma W, Somponpun SJ, Carlson EC,
Uyehara CF, Lozanoff S. 2009. Deficiency in Six2 during prenatal development
is associated with reduced nephron number, chronic renal failure, and
hypertension in Br/+ adult mice. Am J Physiol Renal Physiol, 296, F1166-1178.
Fong H, Hohenstein KA, Donovan PJ. 2008. Regulation of self-renewal and
pluripotency by Sox2 in human embryonic stem cells. Stem Cells 26, 1931-1938.
Geng X, Speirs C, Lagutin O, Inbal A, Liu W, Solnica-Krezel L, Jeong Y, Epstein DJ,
Oliver G. 2008. Haploinsufficiency of Six3 fails to activate Sonic hedgehog
expression in the ventral forebrain and causes holoprosencephaly. Dev Cell 15,
236-247.
Gilbert SF. 2000. Developmental Biology. Sunderland, MA: Sinauer Associates, Inc.
Gong SG, Mai S, Wei CK. 2009. Flrt2 and Flrt3 have overlapping and non-overlapping
expression during craniofacial development. Gene Expr Patterns 9, 497-502.
Gorlin RJ, Cohen MM Jr, Hennekam RCM. 2001. Syndromes of the head and neck.
New York, Oxford University Press.
Grindley JC, Davidson DR, Hill RE. 1995. The role of Pax-6 in eye and nasal
development. Development 121, 1433–1442
Grobstein C. 1955. Induction interaction in the development of the mouse metanephros.
J Exp Zool 130, 319-340.
Hammerschmidt M, Bitgood MJ, McMahon AP. 1996. Protein kinase A is a common
negative regulator of Hedgehog signaling in the vertebrate embryo. Genes Dev
10, 647-658.
He G, Tavella S, Hanley KP, Self M, Oliver G, Grifone R, Hanley N, Ward C, Bobola N.
2010. Inactivation of Six2 in mouse identifies a novel genetic mechanism
controlling development and growth of the cranial base. Dev Biol 344, 720-730.
Page 114
105
Hu D, Helms JA. 1999. The role of sonic hedgehog in normal and abnormal craniofacial
morphogenesis. Development 126, 4873–4884.
Hu D, Marcucio RS. 2009. A SHH-responsive signaling center in the forebrain regulates
craniofacial morphogenesis via the facial ectoderm. Development 136, 107-116.
Hu D, Marcucio RS. 2008. Unique organization of the frontonasal ectodermal zone in
birds and mammals. Dev Biol 325, 200-210.
Itoh N, Ornitz DM. 2004. Evolution of the Fgf and Fgfr gene families. Trends Genet
20, 563-569.
Jaluria P, Konstantopoulos K, Betenbaugh M, Shiloach J. 2007. A perspective on
microarrays: current applications, pitfalls, and potential uses. Microb Cell Fact 6,
4.
Jaramillo C, Brandt SK, Jorganson RJ. 1988. Autosomal dominant inheritance of the
DeMyer sequence. J Craniofac Genet Dev Biol 8, 199-204.
Jeong Y, Leskow FC, El-Jaick K, Roessler E, Muenke M, Yocum A, Dubourg C, Li X,
Geng X, Oliver G, Epstein DJ. 2008. Regulation of a remote Shh forebrain
enhancer by the Six3 homeoprotein. Nat Genet 40, 1348-1353.
Jiang R, Bush JO, Lidral AC. 2006. Development of the upper lip: morphogenetic and
molecular mechanisms. Dev Dyn 235, 1152-1166.
Jiang X, Iseki S, Maxson RE, Sucov HM, Morriss-Kay GM. 2002. Tissue origins and
interactions in the mammalian skull vault. Dev Biol 241, 106-116.
Johnston MC. 1964. Facial malformations in chick embryos resulting from removal of
neural crest. J Dent Res 43, 822.
Johnston MC. 1966. A radiographic study of the migration and fate of the craniofacial
neural crest cells in the chick embryo. Anat Rec 156, 143-155.
Karner CM, Das A, Ma Z, Self M, Chen C, Lum L, Oliver G, Carroll TJ. 2011.
Canonical Wnt9b signaling balances progenitor cell expansion and differentiation
during kidney development. Development 138, 1247-1257.
Kawakami S, Ohto H, Ikeda K, Roeder RG. 1996a. Structure, function and expression
of a murine homeobox protein AREC3, a homologue of Drosophila sine oculis
gene product, and implication in development. Nucleic Acids Res 24, 303-310.
Kawakami S, Ohto H, Takizawa T, Saito T. 1996b. Identification and expression of six
family genes in mouse retina. FEBS Lett 393, 259-263.
Page 115
106
Kawakami K, Sato S, Ozaki H, Ikeda K. 2000. Six family genes--structure and function
as transcription factors and their roles in development. Bioessays 22, 616-626.
Kispert A, Vainio S, McMahon AP. 1998. Wnt-4 is a mesenchymal signal for epithelial
transformation of metanephric mesenchyme in the developing kidney.
Development 125: 4225–4234.
Knecht AK, Bronner-Fraser M. 2002. Induction of the neural crest: a multigene process.
Nat Rev, Genet 3,453-461.
Kobayashi A, Valerius MT, Mugford JW, Carroll TJ, Self M, Oliver G, McMahon Ap.
2008. Six2 defines and regulates a multipotent self-renewing nephron progenitor
population throughout mammalian kidney development. Cell Stem Cell 3, 169-
181.
Kobayashi M, Toyama R, Takeda H, Dawid IB, Kawakami K. 1998. Overexpression of
the forebrain-specific homeobox gene six3 induces rostral forebrain enlargement
in zebrafish. Development 125, 2973-2982.
Kutejova E, Engist B, Mallo M, Kanzler B, Bobola N. 2005. Hoxa2 downregulates Six2
in the neural crest-derived mesenchyme. Development 132, 469-478.
LaBonne C, Bronner-Fraser M. 1999. Molecular mechanisms of neural crest formation.
Annu Rev Cell Dev Biol 15, 81-112.
Lagutin OV, Zhu CC, Furuta Y, Rowitch DH, McMahon AP, Oliver G. 2001. Six3
promotes the formation of ectopic vesicle-like structures in mouse embryos. Dev
Dyn 221, 342-349.
Lagutin OV, Zhu CC, Kobayashi D, Topczewski J, Shimamura K, Puelles L, Russell
HRC, McKinnon PJ, Solnica-Krezel L, Oliver G. 2003. Six3 repression of Wnt
signaling in the anterior neuroectoderm is essential for vertebrate forebrain
development. Genes Dev 17, 368-379.
Livak KJ, Schmittgen, TD. 2001. Analysis of relative gene expression data using real
time quantitative PCR and the 2-ΔΔCt
method. Methods 25, 402-408.
Liu W, Lagutin OV, Mende M, Streit A, Oliver G. 2006. Six3 activation of Pax6
expression is essential for mammalian lens induction and specification. EMBO J
25, 5383-5395.
Loosli F, Winkler S, Wittbrodt J. 1999. Six3 overexpression initiates the formation of
ectopic retina. Genes Dev 13, 649-654.
Page 116
107
Lopez-Rios J, Tessmar K, Loosli F, Wittbrodt J, Bovolenta P. 2003. Six3 and Six6
activity is modulated by members of the groucho family. Development 130, 185-
195.
Lozanoff S. 1993. Midfacial retrusion in adult Brachyrrhine mice. Acta Anat (Basel)
147, 125-132.
Lozanoff S, Jureczek S, Feng T, Padwal R. 1994. Anterior cranial base morphology in
mice with midfacial retrusion. Cleft Palate Craniofac J 31, 417-428.
Lumsden A, Sprawson N, Graham A. 1991. Segmental origin and migration of neural
crest cells in the hindbrain region of the chick embryo. Development 113, 1281-
1291.
Ma W, Lozanoff S. 1993. External craniofacial features, body size and renal
morphology in prenatal Brachyrrhine mice. Teratology 47, 321-332.
Ma W, Lozanoff S. 1999. Spatial and temporal distribution of cellular proliferation in
the cranial base of normal and midfacially retrusive mice. Clin Anat 12, 315-325.
Marcucio RS, Cordero DR, Hu D, Helms JA. 2005. Molecular interactions coordinating
the development of the forebrain and face. Dev Biol 284, 48-61.
Mazina OM, Phillips MA, Williams T, Vines CA, Cherr GN, Rice RH. 2001.
Redistribution of transcription factor AP-2α in differentiating cultured human
epidermal cells. J Invest Dermatol 117, 864-870.
McBratney BM, Margaryan E, Ma W, Urban Z, Lozanoff S. 2003. Frontonasal
dysplasia in 3H1 Br/Br mice. Anat Rec 271A, 291-302.
McBratney-Owen B, Iseki S, Bamforth SD, Olsen BR, Morriss-Kay GM. 2008.
Development and tissue origins of the mammalian cranial base. Dev Biol 322,
121-132.
McMahon AP, Ingham PW, Tabin CJ. 2003. Developmental roles and clinical
significance of hedgehog signaling. Curr Top Dev Biol 53, 1-114.
McPherson LA, Weigel RJ. 1999. AP-2α and AP-2γ: a comparison of binding site
specificity and trans-activation of the estrogen receptor promoter and single site
promoter constructs. Nucleic Acids Res 27, 4040-4049.
Millard DR, Williams S. 1968. Median clefts of the upper lip. Plast Reconstr Surg 42,
4-14.
Page 117
108
Mills AA, Zheng B, Wang XJ, Vogel H, Roop DR, Bradley A. 1999. p63 is a p53
homologue required for limb and epidermal morphogenesis. Nature 298, 708-
713.
Minkoff R. 1991. Cell proliferation during formation of the embryonic facial primordia.
J Craniofac Genet Dev Biol 11, 251-261.
Mitchell PJ, Timmons PM, Hébert JM, Rigby PWJ, Tjian R. 1991. Transcription factor
AP-2 is expressed in neural crest cell lineages during mouse embryogenesis.
Genes Dev 5, 105-119.
Mohibullah N, Donner A, Ippolito JA, Williams T. 1999. SELEX and missing
phosphate contact analysis reveal flexibility within the AP-2α protein: DNA
binding complex. Nucleic Acids Res 27,2760-2769.
Moniot B, Biau S, Faure S, Nielsen CM, Berta P, Roberts DJ, de Santa Barbara P. 2004.
SOX9 specifies the pyloric sphincter epithelium through mesenchymal–epithelial
signals. Development 131, 3795-3804.
Moore MW, Klein RD, Fariñas I, Sauer H, Armanini M, Phillips H, Reichardt LF, Ryan
AM, Carver-Moore K, Rosenthal A. 1996. Renal and neuronal abnormalities in
mice lacking GDNF. Nature 382, 76-79.
Mossey PA, Little J. 2002. Epidemiology of oral clefts: an international perspective. In:
Wyszynski DF (ed.). Cleft lip and palate: from origin to treatment. New York,
Oxford University Press.
Nonomura K, Takahashi M, Wakamatsu Y, Takano-Yamamoto T, Osumi N. 2010.
Dynamic expression of Six family genes in the dental mesenchyme and the
epithelial ameloblast stem/progenitor cells during murine tooth development. J
Anat 216, 80-91.
Nottoli T, Hagopian-Donaldson S, Zhang J, Perkins A, Williams T. 1998. AP-2-null
cells disrupt morphogenesis of the eye, face, and limbs in chimeric mice. Proc
Natl Acad Sci USA 95, 13714-13719.
Ohto H, Takizawa T, Saito T, Kobayashi M, Ikeda K, Kawakami K. 1998. Tissue and
developmental distribution of Six family gene products. Int J Dev Biol 42, 141-
148.
Ohto H, Kamada S, Tago K, Tominaga SI, Ozaki H, Sato S, Kawakami K. 1999.
Cooperation of Six and Eya in activation of their target genes through nuclear
translocation of Eya. Mol Cell Biol 19, 6815-6824.
Page 118
109
Oliver G, Wehr R, Jenkins NA, Copeland NG, Cheyette BN, Hartenstein V, Zipursky SL,
Gruss P. 1995a. Homeobox genes and connective tissue patterning.
Development 121, 693-705.
Oliver G, Mailhos A, Wehr R, Copeland NG, Jenkins NA, Grus P. 1995b. Six3, a
murine homolog of the sine oculis gene, demarcates the most anterior border of
the developing neural plate and is expressed during eye development.
Development 121, 4045-4055.
Oliver G, Loosli F, Köster R, Wittbrodt J, Gruss P. 1996. Ectopic lens induction in fish
in response to the murine homeobox gene Six3. Mech Dev 60, 233-239.
O’Rahilly R. 1978. The timing and sequence of events in the development of the human
digestive system and associated structures during the embryonic period proper.
Anat Embryol 153, 123-136.
Patten BM. 1961. The Normal Development of the Facial Region. In: Pruzansky (ed.).
Congenital Anomalies of the Face and Associated Structures. Springfield, IL:
Thomas.
Pichel JG, Shen L, Sheng HZ, Granholm AC, Drago J, Grinberg A, Lee EJ, Huang SP,
Saarma M, Hoffer BJ, Sariola H, Westphal H. 1996. Defects in enteric
innervation and kidney development in mice lacking GDNF. Nature 382, 73-76.
Pignoni F, Hu B, Zavitz KH, Xiao J, Garrity PA, Zipursky SL. 1997. The eye-
specification proteins So and Eya form a complex and regulate multiple steps in
Drosophila eye development. Cell 91, 881-891.
Phillips NA. 2011. Examination of the effects of siRNA to Six2 on embryonic kidneys
ex vivo. M.Sc. Thesis. University of Hawaiˋi at Mānoa Graduate Program in
Developmental and Reproductive Biology.
Pourquié O, Coltey M, Teillet MA, Ordahl C, Le Douarin NM. 1993. Control of
dorsoventral patterning of somitic derivatives by notochord and floor plate. Proc
Natl Acad Sci USA 90, 5242-5246.
Puelles L, Rubenstein JLR. 1993. Expression patterns of homeobox and other regulatory
genes in the embryonic mouse forebrain suggest a neuromeric organization.
Trends in NeuroSci 16, 472-479.
Purcell P, Oliver G, Mardon G, Donner AL, Maas RL. 2005. Pax6-dependence of Six3,
Eya1 and Dach1 expression during lens and nasal placode induction. Gene Expr
Patterns 6, 110-118.
Reddi, AH. 1994. Bone and cartilage differentiation. Curr Opin Genet Dev 4, 737-744.
Page 119
110
Reed SC. 1933. An embryological study of harelip in mice. Anat Rec 56, 101-110.
Rikin A, Rosenfeld G E, McCartin K., Evans T. 2010. A reverse genetic approach to
test functional redundancy during embryogenesis. J Vis Exp e2020, DOI:
10.3791/2020.
Rossel M, Capecchi MR. 1999. Mice mutant for both Hoxa1 and Hoxb1 show extensive
remodeling of the hindbrain and defects in craniofacial development.
Development 126, 5027-5040.
Rude FP, Anderson L, Conley D, Gasser RF. 1994. Three dimensional reconstructions
of the primary palate. Anat Rec 238:108-113.
Rudnicki JA, Brown AM. 1997. Inhibition of chondrogenesis by Wnt gene expression
in vivo and in vitro. Dev Biol 185, 104-118.
Sainio K, Suvanto P, Davies J, Wartiovaara J, Wartiovaara K, Saarma M, Arumäe U,
Meng X, Lindahl M, Pachnis V, Sariola H. 1997. Glial cell derived neurotrophic
factor is required for bud initiation from ureteric epithelium. Development 124,
4077-4087.
Sánchez MP, Silos-Santiago I, Frisén J, He B, Lira SA, Barbacid M. 1996. Renal
agenesis and the absence of enteric neurons in mice lacking GDNF. Nature 382,
70-73.
Satokata I, Maas R. 1994. Msx1 deficient mice exhibit cleft palate and abnormalities of
craniofacial and tooth development. Nat Genet 6, 348-356.
Schilling TF, Kimmel CB. 1994. Segment and cell type lineage restrictions during
pharyngeal arch development in the zebrafish embryo. Development 120, 483-
494.
Schorle H, Meier P, Buchert M, Jaenisch R, Mitchell PJ. 1996. Transcription factor AP-
2 essential for cranial closure and craniofacial development. Nature 381, 235-
238.
Searle AG. 1966. New mutants. Mouse News Lett 35, 7.
Sedano HO, Cohen MM Jr, Jirasek J, Gorlin RJ. 1970. Frontonasal dysplasia. J Pediatr
76, 906-913.
Sedano HO, Gorlin RJ. 1988. Frontonasal malformation as a field defect and in
syndromic associations. Oral Surg Oral Med Oral Pathol 65, 704-710.
Page 120
111
Self M, Lagutin OV, Bowling B, Hendrix J, Cai Y, Dressler GR, Oliver G. 2006. Six2 is
required for suppression of nephrogenesis and progenitor renewal in the
developing kidney. EMBO J 25, 5214-5228.
Self M, Geng X, Oliver G. 2009. Six2 activity is required for the formation of the
mammalian pyloric sphincter. Dev Biol 334, 409-417.
Serikaku MA, O’Tousa JE. 1994. sine oculis is a homeobox gene required for
Drosophila visual system development. Genetics 138, 1137-1150.
Shuler CF. 1995. Programmed cell death and cell transformation in craniofacial
development. Crit Rev Oral Biol Med 6, 202-217.
Singh GD, Johnston J, Ma W, Lozanoff S. 1998. Cleft palate formation in fetal Br mice
with midfacial retrusion: tenascin, fibronectin, laminin, and type IV collagen
immunolocalization. Cleft Palate Craniofac J 35, 65-76.
Smith DM, Nielsen C, Tabin CJ, Roberts DJ. 2000. Roles of BMP signaling and Nkx2.5
in patterning at the chick midgut-foregut boundary. Development 127, 3671-
3681.
Somponpun SJ, Wong B, Hynd TE, Fogelgren B, Lozanoff S. 2011. Osmoregulatory
defect in adult mice associated with deficient prenatal expression of six2. Am J
Physiol Regul Integr Comp Physiol 301, 682-689.
Sperber GH. 2002. Formation of the primary palate. In: Wyszynski DF (ed.). Cleft lip
and palate: from origin to treatment. New York, Oxford University Press.
Stark K, Vainio S, Vassileva G, McMahon AP. 1994. Epithelial transformation of
metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature
372, 679-683.
Theiler K. 1989. Stage 19. In: The house mouse: atlas of embryonic development. New
York: Springer-Verlag.
Theodosiou NA, Tabin CJ. 2005. Sox9 and Nkx2.5 determine the pyloric sphincter
epithelium under the control of BMP signaling. Dev Biol 279, 481-490.
Trainor PA. 2005. Specification of neural crest cell formation and migration in mouse
embryos. Semin Cell Dev Biol 16, 683-693.
Trainor PA, Krumlauf R. 2001. Hox genes, neural crest and branchial arch patterning.
Curr Opin Cell Biol 13, 698-705.
Trasler DG. 1968. Pathogenesis of cleft lip and its relation to embryonic face shape in
A/J and C57BL mice. Teratology 1, 33-50.
Page 121
112
Weimer DR, Hardy SB, Spira M. 1978. Anatomical findings in the median cleft of the
upper lip. Plast Reconstr Surg 62, 866-869.
Wen J, Hu Q, Li M, Wang S, Zhang L, Chen Y, Li L. 2008. Pax6 directly modulate
Sox2 expression in the neural progenitor cells. Neuroreport 19, 413-417.
Winkler S, Loosli F, Henrich T, Wakamatsu Y, Wittbrodt J. 2000. The conditional
medaka mutation eyeless uncouples patterning and morphogenesis of the eye.
Development 127, 1911-1919.
Wong B, Farrell ML, Yang S, Freitas T, Lozanoff S. 2010. Tessellation analysis of
glomerular spatial arrangement in mice with heritable renal hypoplasia. Anat Rec
293, 280-290.
Xu PX, Cheng J, Epstein JA, Maas RL. 1997a. Mouse Eya genes are expressed during
during limb tendon development and encode a transcriptional activation function.
Proc Natl Acad Sci USA 94, 11974-11979.
Xu PX, Woo I, Her H, Beier R, Maas L. 1997b. Mouse Eya homologues of the
Drosophila eyes absent gene require Pax6 for expression in lens and nasal
placode. Development 124, 219-231.
Xu Y, Wei K, Kulyk W, Gong SG. 2011. FLRT2 promotes cellular proliferation and
inhibits cell adhesion during chondrogenesis. J Cel Biochem 112, 3440-3448.
Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dötsch V, Andrews NC, Caput D,
McKeon F. 1998. p63, a p53 homolog at 3q27-29, encodes multiple products
with transactivating, deathinducing, and dominant-negative activities. Mol Cell 2,
305-316.
Yang A, Schweitzer R, Sun D, Kaghad M, Walker N, Bronsoni RT, Tabin C, Sharpe A,
Caput D, Crum C, McKeon F. 1999. p63 is essential for regenerative
proliferation in limb, craniofacial and epithelial development. Nature 398, 714-
718.
Young NM, Chong HJ, Hu D, Hallgrimsson B, Marcucio RS. 2010. Quantitative
analysis link modulation of sonic hedgehog signaling to continuous variation in
facial growth and shape. Development 137, 3405-3409.
Zhang Z, Song Y, Zhao X, Zhang X, Fermin C, Chen Y. 2002. Rescue of cleft palate in
Msx1-deficient mice by transgenic Bmp4 reveals a network of BMP and Shh
signaling in the regulation of mammalian palatogenesis. Development 129, 4135-
4146.
Page 122
113
Zhao F, Sadota M, Licht JD, Hayashizaki Y, Gelb BD. 2001. Cloning and
characterization of a novel mouse AP-2 transcription factor, AP-2δ, with unique
DNA binding and transactivation properties. J Biol Chem 276, 40755-40760.
Zou D, Silvius D, Fritzsch B, Xu PX. 2004. Eya1 and Six1 are essential for early steps
of sensory neurogenesis in mammalian cranial placodes. Development 131, 5561-
5572.
