Differential Regulation of Bvg-Activated Virulence FactorsPlays a Role in Bordetella pertussis Pathogenicity
SUSAN M. KINNEAR, RYAN R. MARQUES,† AND NICHOLAS H. CARBONETTI*
Department of Microbiology and Immunology, University of Maryland School of Medicine, Baltimore, Maryland 21201
Received 28 June 2000/Returned for modification 2 October 2000/Accepted 18 December 2000
Bordetella pertussis, the causative agent of whooping cough, regulates expression of many virulence factors viaa two-component signal transduction system encoded by the bvgAS regulatory locus. It has been shown bytranscription activation kinetics that several of the virulence factors are differentially regulated. fha is tran-scribed within 10 min following a bvgAS-inducing signal, while prn is transcribed after 1 h and ptx is nottranscribed until 2 to 4 h after induction. These genes therefore represent early, intermediate, and late classesof bvg-activated promoters, respectively. Although there have been many insightful studies into the mechanismsof BvgAS-mediated regulation, the role that differential regulation of virulence genes plays in B. pertussispathogenicity has not been characterized. We provide evidence that alterations to the promoter regions ofbvg-activated genes can alter the kinetic pattern of expression of these genes without changing steady-statetranscription levels. In addition, B. pertussis strains containing these promoter alterations that express eitherptx at an early time or fha at a late time demonstrate a significant reduction in their ability to colonizerespiratory tracts in an intranasal mouse model of infection. These data suggest a role for differentialregulation of bvg-activated genes, and therefore for the BvgAS regulatory system, in the pathogenicity of B.pertussis.
Bordetella pertussis, the causative agent of whooping cough,regulates expression of many of its virulence factors via atwo-component signal transduction system encoded by thebvgAS regulatory locus (3, 35). This system mediates the tran-sition of B. pertussis between a virulent Bvg1 phase and anavirulent Bvg2 phase. Recently there have been many insight-ful studies into the mechanisms of BvgAS-mediated regulation(5, 6, 7, 17, 20, 34, 37), but a complete picture of the role thatthis regulation plays in Bordetella virulence has remained elu-sive. It has been speculated that changes in microenvironmentsduring the course of infection may provide modulating signalsthat control virulence gene expression to allow for survival,persistence, evasion of immune response, and transmission.However, the small amount of experimental evidence that ex-ists is inconclusive. In a Bordetella bronchiseptica rabbit modelof infection, the Bvg1 phase was found to be necessary andsufficient for establishment of respiratory tract infection (11).Although the Bvg2 phase did not appear to contribute tovirulence, it was shown to be advantageous for survival in anutrient-deprived environment (11). In addition, a rat modelof B. bronchiseptica infection demonstrated no evidence of invivo expression of Bvg2 phase factors (2). Moreover, the ec-topic expression of a Bvg2 phase flagellar protein during theBvg1 phase resulted in reduced tracheal colonization (2).
In a mouse model of B. pertussis infection, several lines ofevidence indicate that the Bvg2 phase is unnecessary for, andeven detrimental to, virulence. In one study, the Bvg1 phase
was also found to be necessary and sufficient for colonization:a deletion of bvgR (encoding a Bvg-activated repressor of someBvg2 phase genes [24]), resulting in ectopic expression of Bvg2
phase factors, decreased the efficiency of colonization, and areporter system designed to determine in vivo expression in-dicated that vrg6 (a Bvg2 phase gene [18]) expression is low invivo (21). An additional strain in which the bvgR gene wasdeleted induced levels of leukocytosis that were significantlylower than those induced by the wild-type strain in an aerosolchallenge of adult mice (23). These data challenge a role forthe Bvg2 phase in vivo and establish that a function of the bvglocus in pathogenicity may be repression of the bvg-repressedgenes.
In contrast, cell culture experiments have indicated that B.pertussis modulates the expression of adenylate cyclase-hemo-lysin toxin upon cell invasion (22), providing in vitro evidenceof a possible role for bvg regulation in intracellular survival,although the relevance of this for B. pertussis pathogenicity isnot known. Also, the characterization of a Bvg-intermediate(Bvgi) phase of B. pertussis has identified factors specific to thisphase. Some of these antigens are recognized by antibodies insera from children recovering from pertussis (21), suggestingthat the Bvgi phase of B. pertussis is expressed in vivo.
Although it has been known for some time that, based onBvg activation kinetics, there are both early and late classes ofbvg-activated promoters (31), we have recently identified athird, intermediate class of bvg-activated promoters, repre-sented by prn (17), a gene that encodes putative adherencefactor pertactin (19). However, the role that differential regu-lation of bvg-activated promoters plays in pathogenicity has notbeen characterized. It has been hypothesized, based on thekinetic patterns of expression, that the adhesins are expressedearly in order to colonize the respiratory tract of the host andthat the toxins are expressed late when they are needed to
* Corresponding author. Mailing address: University of MarylandSchool of Medicine, Department of Microbiology and Immunology,BRB 13-009, 655 W. Baltimore St., Baltimore, MD 21201-1559. Phone:(410) 706-7677. Fax: (410) 706-2129. E-mail: [email protected].
† Present address: Center for Vaccine Development, University ofMaryland School of Medicine, Baltimore, MD 21201.
avoid host defenses (26). Thus far, as described above, there islittle or no evidence supporting a role for the Bvg2 phase inpathogenicity or the occurrence of modulation in vivo. Wehypothesized that, by making changes to the promoter regionsof bvg-activated genes, we could alter their kinetic patterns ofexpression. We further hypothesized that, if the differentialregulation seen in vitro has a role in the virulence of B. per-tussis, changing the regulatory kinetics between classes of pro-moters should decrease the virulence of the organism.
MATERIALS AND METHODS
Bacterial strains and growth conditions. The bacterial strains and plasmidsused or constructed in this study are described below. Escherichia coli strainswere grown on Luria-Bertani agar. B. pertussis strains were grown on Bordet-Gengou (BG) agar (Difco) supplemented with 15% sheep blood or in Stainer-Scholte liquid medium (33). Magnesium sulfate was added to 50 mM whenmodulation was required. The following antibiotics were added to the concen-trations indicated (micrograms per milliliter) when necessary: ampicillin, 100;chloramphenicol, 20; tetracycline, 10; gentamicin, 10; kanamycin, 50; streptomy-cin, 400; nalidixic acid, 20. Bacterial conjugations were performed as describedpreviously (13) with E. coli S17.1 as the donor strain (32).
DNA manipulations and allelic exchange. DNA manipulations were carriedout by standard molecular methods. Constructs were introduced into the B.pertussis genome by allelic exchange using pSS1129 (35), a mobilizable suicidevector. B. pertussis strain KMC3, which has the fha genes under the control of theptx promoter and upstream BvgA-binding sequence, was constructed as follows.An EcoRV site was introduced by overlap extension PCR (8) just after the fhatranscription start site (by changing sequence GATTTC to GATATC at nucle-otides 184 to 189 downstream from the EcoRI site) in a subclone of the fhaupstream region. A fragment upstream of the ptx genes including the promoterand upstream BvgA-binding sequence (from 2236 to 12 with respect to thetranscription start site) was then amplified by PCR, incorporating an EcoRI siteinto the upstream primer and an EcoRV site into the downstream primer. Thisfragment was then digested with EcoRI and EcoRV and ligated into the modifiedfha subclone between the EcoRI and EcoRV sites, thus replacing the fha pro-moter and upstream sequence with that of ptx. This construct was then intro-duced into B. pertussis Tohama I (15) by conjugation and allelic exchange andconfirmed by PCR.
To recreate the ptx promoter alterations with the wild-type ptx sequence, a930-bp EcoRI-SalI fragment of wild-type ptx was subcloned into pJHCI (17).EcoRI/NcoI fragments of 455 bp from the previously generated altered con-structs (20) were subcloned into the above pJHCI vector, and an additional930-bp SalI/ScaI fragment from the wild-type sequence was included to providehomology. To aid in the screening of ptx promoter conjugants after allelicexchange, Wellcome 28 (W28) (30) with a kanamycin resistance gene replacingS1 was used as a recipient strain. Kanamycin sensitivity was then used as anindicator of successful integration of our engineered sequences, which were thenconfirmed by PCR analysis.
RT-PCR analysis. Total RNA was prepared from B. pertussis strains by ex-traction with Trizol LS reagent (Gibco BRL) and then treatment with RNase-free DNase I (Boehringer Mannheim) to remove any contaminating DNA. Twomicrograms of total RNA was used in reverse transcriptase (RT) reactions (allcomponents were from Gibco BRL) with SuperScript II RT (200 U) and primedwith random hexamers (50 ng) to synthesize first-strand cDNA as describedpreviously (17). Samples without RT were also run to verify the absence of DNAcontamination. After treatment with RNase H (Gibco BRL), 10% of the first-strand reaction product was used as the template in subsequent PCRs. RT-PCRmixtures (50 ml) contained 100 pmol of primers, 13 PCR buffer, 1.5 mM MgCl2,0.4 mM deoxynucleoside triphosphates, and 0.5 ml of Taq DNA polymerase (allcomponents were from Gibco BRL). The prn RT-PCR mixtures also contained5% dimethyl sulfoxide (Fisher Scientific). The reactions were run for 25 cycles of1 min at 94°C for denaturing, 1 min at 52°C for annealing (60°C annealing forrpoA primers), and 1.5 min at 72°C for extension in a thermal cycler. Theproducts were electrophoresed on a 2% agarose gel, stained with ethidiumbromide, and visualized with UV light.
Time course analyses of bvg-activated transcription. B. pertussis strains To-hama I, KMC3, W28, NMD386, and NMD387 were grown on nitrocellulosefilters on BG agar plates containing 50 mM MgSO4 to modulate bvg activity. Attime zero, the filters were transferred to medium without MgSO4 to induce bvgactivity as described previously (17). Total RNA was prepared as described above
from cells at various times after induction, as described in Results. Total RNAwas also prepared when B. pertussis strains W28, NMD386, and NMD387 wereused to inoculate liquid cultures at time zero after being modulated on BG agarplates containing 50 mM MgSO4. RT-PCR, with primers (forward and reverse,respectively) specific for sodB (59CTGCCTTACGCTCTGGATG39 and 59GGACGGGCATTGCGGTAAT39), fha (59CCTAAAACGAGCAGGCCG39 and59GAACTTGTTGTGCGAGAC39), and ptx (59GCACCATCGTCACCG39 and59CCTCGTTCGCACCCATGG39), was used as described above to determinepromoter activation (Tohama I and KMC3 time course analyses). The followingprimer pairs (forward and reverse, respectively) were used for W28, NMD386,and NMD387 time course analyses: rpoA, 59CCGCACGACGTCGAGATCAT39and 59AACACCGAGATCTGGTCCAT39; ptx, 59GCCACGTGAGATCCGAGG39 and 59GTCTATCACAACGGCATC39; prn, 59CGACAAATAGCGTGCGTT39 and 59GGTCGGACGCCTGGATA39. To analyze the RT-PCR data, por-tions of the RT-PCR samples were run on an agarose gel and stained with thefluorescent dye Vistra green (Amersham) and band intensities were quantifiedby analysis on a FluorImager SI system using ImageQuant software (MolecularDynamics). The band intensities were normalized to the sodB standard, a bvg-independent gene encoding superoxide dismutase of B. pertussis (12), or to therpoA standard, the bvg-independent gene encoding the alpha subunit of RNApolymerase (9).
Assay for FHA and PT production. To compare the levels of FHA producedby KMC3 to those produced by B. pertussis strains Tohama I and Tohama Ifha-lac and of pertussis toxin (PT) secreted by the ptx promoter-altered mutantstrains to those secreted by wild-type B. pertussis strain W28, Western immuno-blotting of whole-cell lysates or trichloroacetic acid (TCA)-precipitated super-natant proteins, respectively, was used. Three 15-ml liquid cultures per strainwere inoculated to the same optical density (OD) from cells grown on plates for2 days. After 24 h of growth, FHA strains were diluted to an OD at 600 nm(OD600) of 0.5 units/ml and lysed with sample buffer and further diluted foranalysis. Filter-sterilized culture supernatants containing secreted PT were pre-cipitated by TCA as described previously (8). The precipitated proteins wereresuspended in 1 M Tris-HCL (pH 7)–0.5 N NaOH in volumes normalized to theOD of the cultures at harvest. Sample buffer was added to a series of fivefolddilutions of the precipitated proteins. Samples were run on sodium dodecylsulfate-polyacrylamide gel electrophoresis gels (15% polyacrylamide) and trans-ferred to nitrocellulose by Western blotting. FHA was detected with an FHA-specific goat polyclonal antibody, while the S1 subunit was detected with X2X5,an S1-specific monoclonal antibody (4), followed by a peroxidase-conjugatedsecondary antibody (Boehringer Mannheim) and enhanced chemiluminescencedevelopment (Amersham). Densitometric analysis of the developed films with aBio-Rad GS 700 imaging densitometer allowed the comparison of the levels ofproteins produced by the mutant and wild-type strains.
CHO cell clustering assay. One milliliter of each of the above culture super-natants, following filter sterilization but prior to TCA precipitation, was retainedto compare the levels of secreted PT with a Chinese hamster ovary (CHO) cellclustering assay (14). The supernatant volumes were normalized for differencesin the culture densities and diluted in phosphate-buffered saline (PBS) (GibcoBRL) in a series of fourfold dilutions. One-microliter portions of undilutedsupernatant and 1:4, 1:16, and 1:64 dilutions of supernatants were added to24-well plates with 5 3 104 CHO cells per well. The plates were incubated for 2days, stained with Giemsa stain (Sigma Diagnostics), and scored for clustering ofCHO cells.
Experimental animals and inoculation procedure. Six- to 8-week-old, female,BALB/c mice (Charles River Laboratories) were used in this study. Inocula wereprepared by growing B. pertussis strains at 37°C on BG-blood agar with strepto-mycin for 3 days, after which the strains were passed onto new plates and grownfor two additional days. The harvested cells were then resuspended in sterile PBSplus 1% Casamino Acids (PBS-CAA). Mice were inoculated intranasally with 20ml of PBS-CAA containing approximately 5 3 104 CFU, unless otherwise noted,while the animals were lightly anesthetized with Metofane (Mallinckrodt Veter-inary). For the experiments involving the addition of PT to the bacterial inocu-lum, wild-type and mutant (PT9K/129G [25]) toxins were purified from B. per-tussis culture supernatants by the fetuin affinity method of Kimura et al. (16) andthe PT B oligomer was from CalBiochem. The inocula were diluted and platedon BG-blood agar with streptomycin and viable counts were determined in orderto normalize between inoculated groups of mice. At various times postinocula-tion, mice were sacrificed by carbon dioxide inhalation and the trachea and lungswere removed, homogenized in 2 ml of PBS-CAA, diluted, and plated on BG-blood agar with streptomycin. Four to 5 days later the plates were counted andthe number of CFU per respiratory tract was determined. Statistical significancewas determined by Student’s t test of the normalized data, the natural logarithmsof the normalized data, and the ranking of the natural logarithms of the nor-
malized data. Strains were considered significantly altered when P was #0.05 byall three t tests. The P values shown are from the t tests of the natural logarithmsof the normalized data.
RESULTS
Construction and characterization of an fha promoter re-placement strain. Although it is believed that the promoterregions of bvg-activated genes are responsible for the differen-tial regulation of these genes, there is no direct in vivo evidenceof this. We constructed a strain, KMC3, in which the upstreamregion from the early bvg-activated fha gene, including thepromoter and BvgA-binding sequences (5), was replaced bythe equivalent region from upstream of the late bvg-activatedptx gene (20) by allelic exchange (Fig. 1A). This placed fhaunder the control of the ptx promoter. Previous studies havedetermined that fha is expressed early following an inducingsignal, while ptx is expressed late (17, 31). We used RT-PCR,as previously described (17), to analyze the activation kineticsof strain KMC3. Total RNA was prepared from cells at 0, 60,120, 240, and 480 min. In strain KMC3, fha was expressed late,
similar to ptx expression (Fig. 1B) and different from the early-induction kinetics of fha in wild-type strain Tohama I that wepreviously demonstrated (17). This result confirms the antici-pated switch in promoter control compared to that for wild-type strain Tohama I, in which fha was expressed by 30 min(17). It also provides direct evidence that the promoter regionis responsible for the differential regulation seen in vitro.
Effect of fha promoter exchange on colonization of themouse respiratory tract. In an initial attempt to determine theeffect of fha-to-ptx promoter exchange on the virulence of B.pertussis, we used an intranasal mouse model of infection andexamined the ability of the mutant strain to colonize the re-spiratory tracts of mice. Mice were inoculated intranasally withapproximately 5 3 104 CFU of wild-type strain Tohama I ormutant strain KMC3 in 20 ml of PBS-CAA. After 7 days, themice were sacrificed and the trachea and lungs were removed,homogenized, diluted, and plated to determine levels of colo-nization. Mice inoculated with late-expressing fha strainKMC3 had a statistically significant 86% reduction (approxi-mately 1 log unit) (P 5 0.032) in mean respiratory tract colo-nization compared to mice inoculated with wild-type strainTohama I (Fig. 2).
We performed Western immunoblotting of whole-cell ly-sates of strains Tohama I, KMC3, and NMD170 (an FHA2
strain of B. pertussis) to determine the effect of our promoteralteration. Cultures were grown in triplicate and were dilutedto an OD600 of 0.5. Twentyfold dilutions were analyzed byWestern blotting. FHA was detected with an FHA-specificgoat polyclonal antibody (obtained from Rino Rappuoli) (Fig.
FIG. 1. Promoter exchange activation kinetics. KMC3, a strain inwhich the promoter region of the early bvg-activated gene, fha, wasreplaced with the late bvg-activated ptx promoter region by allelicexchange, was used to determine if the promoter region is responsiblefor temporal transcriptional regulation. (A) Schematic diagram of thefha promoter replacement by the ptx promoter. Bars, BvgA-bindingsequences; P, promoters of the respective genes. (B) RT-PCR analysisof KMC3 was used to detect transcripts of the bvg-independent stan-dard gene (sodB) and fha and ptx at times 0, 60, 120, 240, and 480 minafter induction of the Bvg system. RT-PCR products were run onethidium bromide-stained agarose gels to determine the abundance oftranscript at each time point. In wild-type strain Tohama I, fha tran-scription is present at 30 min after induction and maximal transcriptionis present at 60 min after induction (see Fig. 1 of reference 17).
FIG. 2. Effect of mutation in KMC3 on colonization. Wild-type B.pertussis strain Tohama I and fha promoter mutant strain KMC3 (5 3104 CFU of each) were used to intranasally inoculate groups of sixmice. There was a statistically significant reduction in the ability of thefha mutant strain to colonize the respiratory tracts of mice comparedto that of wild-type strain Tohama I. The P value is shown. Bars,geometric means; dotted line, lower limit of detection.
VOL. 69, 2001 DIFFERENTIAL REGULATION IN B. PERTUSSIS PATHOGENICITY 1985
3); densitometric analysis demonstrated that there was not asignificant difference (P 5 0.8) between levels of FHA pro-duced by KMC3 and Tohama I. In addition, to determine thatthere was no effect of the presence of a duplicate copy of theptx promoter on the production of PT in strain KMC3, we useda CHO cell clustering assay (14) and compared the levels ofactive PT secreted by KMC3 and Tohama I. Dilutions of su-pernatants (undiluted and 1:4, 1:16, and 1:64 dilutions) fromtriplicate cultures were assayed. There were no significant dif-ferences in clustering patterns induced by the supernatants ofthe wild-type and fha promoter mutant strains, indicating thatthere is no defect in PT production in KMC3. These datasuggest that the altered expression of fha is responsible for thecolonization defect of KMC3 in the intranasal mouse model ofinfection (Fig. 2).
Construction and analysis of activation kinetics of ptx pro-moter mutants. We have provided evidence that alteration ofthe kinetic pattern of fha expression from early to late is det-rimental for optimal colonization and thus for full virulence.However, attempts to create the reciprocal strain, in which thelate-activated ptx promoter is replaced by the early-activatedfha promoter, resulted in a slowly growing strain that was notsuitable for further study. As an alternative approach, we de-termined whether two strains with previously characterized ptxpromoter alterations (20) were altered in their ptx activationkinetic patterns. These strains had retained promoter activitiesclose to that of the wild type despite the ptx promoter modi-fications (20). NMD346 had a deletion of 65 bp in the inter-vening sequence, while NMD357 had a replacement of the ptxBvgA-binding heptameric inverted repeats with those of fha,but the native 10-bp sequence between the inverted repeatswas maintained. These promoter alterations fused to the wild-type ptx open reading frame sequence (instead of lac) wereintroduced into the chromosome of B. pertussis strain W28 byallelic exchange to generate NMD386 and NMD387, respec-tively (Fig. 4A), the appropriate construction of which wasconfirmed by PCR.
In order to determine if the deletion of 65 bp within theintervening-sequence region (NMD386) and the replacementof the lower-affinity ptx BvgA-binding repeats with the higher-affinity fha repeats (NMD387) resulted in alterations in ptxactivation kinetics, we again used the RT-PCR assay to detectptx transcripts over the course of time after induction of theBvg system. Total RNA was prepared from cells at times 0, 15,30, 45, 60, 120, 180, 240, and 480 min. RT-PCR, with primers
specific for prn, confirmed the appropriate intermediate ex-pression of prn to verify correct modulation among the strainsand confirmed that other bvg-dependent loci were not affectedby the mutants (data not shown). In wild-type B. pertussis strainW28, ptx was not expressed until 2 h after induction of the Bvgsystem (Fig. 4B), results which are consistent with those de-scribed previously (17, 31). In B. pertussis strains NMD386 andNMD387, we saw reproducible expression of ptx at 15 and 45min after induction, respectively (Fig. 4B). The same kineticpatterns were obtained when the band intensities were nor-malized to the rpoA standard and plotted (Fig. 4C). Therefore,the promoter alterations did indeed result in markedly earlieractivation kinetics of ptx.
Effect of ptx promoter alterations on level of secreted PT. Tocompare the levels of active PT secreted by the strains with ptxpromoter alterations with those secreted by wild-type B. per-tussis W28, we used the CHO cell clustering assay describedabove. There were no significant differences in the overallpatterns of clustering as a function of the supernatant PTconcentrations of W28, NMD386, and NMD387 (Fig. 5A).This provides semiquantitative evidence that the cytotoxic ac-tivity and the levels of PT secreted by these ptx promotermutant strains are the same as those for wild-type strain W28.
In addition, we compared the levels of PT secreted byNMD386 and NMD387 to that secreted by W28 by Westernimmunoblotting of TCA-precipitated supernatant proteins. Cul-tures were grown in triplicate, and TCA-precipitated superna-tant proteins were analyzed by sodium dodecyl sulfate-polyac-rylamide gel electrophoresis and transferred to nitrocellulose.The S1 subunit of PT was detected with monoclonal antibodyX2X5 (courtesy of Drusilla Burns). The Western analysis ofone set of the triplicate cultures is shown in Fig. 5B. NMD384,an additional B. pertussis mutant with a deletion of 21 bp in theintervening-sequence region, was not studied further due to itssimilarity to NMD386. Densitometric analysis demonstratedthat, although there was culture-to-culture variation, there wereno significant differences between the levels of PT secreted byNMD386 (P 5 0.74) or NMD387 (P 5 0.76) and those secret-ed by W28. Therefore, the ptx promoter alterations affect onlythe activation kinetics and not the steady-state production of PT.
Effect of ptx promoter alterations on colonization of themouse respiratory tract. In order to determine the effect of thealtered ptx activation kinetics on the virulence of B. pertussis,we used the intranasal mouse model of infection to examinethe abilities of the mutant strains to colonize the respiratorytracts of mice. Eight or nine mice per group were inoculatedwith approximately 5 3 104 CFU in 20 ml of PBS-CAA on day0. On day 8, the mice were sacrificed and the trachea and lungswere removed, homogenized, diluted, and plated. Four to 5days later colonies were counted and the CFU per respiratorytract were normalized to the initial inoculum level as deter-mined by the viable counts of the inoculum (Fig. 6). Bothmutant strains demonstrated a significant reduction in the abil-ity to colonize the respiratory tracts of mice compared to wild-type strain W28. There was a 92% reduction (approximately 1log unit) in the mean CFU per respiratory tract between W28and NMD386 (P 5 0.0004) and a 64% reduction (approxi-mately 1/2 log unit) between W28 and NMD387 (P 5 0.010)(Fig. 6). The extent of the defect in colonization correlatedwith the extent of alteration of promoter activation kinetics
FIG. 3. Western blot analysis of FHA expression. Whole-cell ly-sates from three cultures each of KMC3 and Tohama I (TohI), as wellas a whole-cell lysate from NMD170 (an FHA2 strain of B. pertussis),were analyzed by Western immunoblotting. FHA was detected with anFHA-specific goat polyclonal antibody. The upper high-molecular-weight band, missing in NMD170, represents FHA, while the predom-inant lower band is presumably a cross-reacting protein. M, rainbowmarker (Amersham).
(NMD386 had the earliest ptx activation). These data indicatethat the altered expression of ptx has an inhibitory effect on theability of B. pertussis to colonize the respiratory tracts of mice.This suggests a role for differential regulation of bvg-activatedgenes in pathogenicity.
To determine the effect of the inoculation dose on the abilityof the ptx promoter mutants to colonize the respiratory tractsof mice, we inoculated mice with either approximately 1 3 104
or 5 3 106 CFU in 20 ml of PBS-CAA and compared theresults to those for the standard inoculum of 5 3 104 CFU(Fig. 6). In other experiments, we found that a dose of 104
CFU is close to the minimum needed to consistently producean infection by this protocol. At this lower dose, colonizationby both NMD386 and NMD387 strains was significantly lowerthan that by W28 (P 5 0.013 and 0.027, respectively) (Fig. 7).In fact, NMD387 showed a 1-log-unit decrease in the meanCFU per respiratory tract at the low dose compared to only a1/2-log-unit decrease at the standard inoculum (Fig. 7). How-ever, the virulence defect of the ptx promoter mutants appearsto be overcome at the high-dose inoculum (Fig. 7). This indi-cates that the phenotype of the ptx promoter mutants is dosedependent.
To determine if the reduction in colonization by the ptxpromoter mutant is affected by the time of harvest of tracheaand lungs during the course of infection, we examined the CFUper respiratory tract at 2, 8 (standard protocol), and 12 daysafter inoculation. There were no significant differences (P 50.4) in the numbers of bacteria (approximately 25% of theinoculum) delivered to the respiratory tracts of mice inocu-lated with NMD386 (1.15 3 105 CFU) versus W28 (1.27 3 105
CFU) at 1 h after inoculation. Colonization at the 1-h timepoint was not determined for NMD387. At 2 days followinginoculation, although there was not a statistically significantdifference between the wild-type and mutant strains due togreater variation at lower infection levels, the pattern of re-duced colonization was already apparent (Fig. 8). As describedpreviously (Fig. 6), at 8 days following inoculation there was astatistically significant reduction in the ability of NMD386 andNMD387 to colonize the respiratory tracts of infected mice. At12 days following infection, the virulence defect of the ptxpromoter mutants, NMD386 (P 5 0.019) and NMD387 (P 50.012), was still apparent (Fig. 8). These data suggest that thepattern of reduced colonization by the ptx promoter mutants ismanifested early and maintained for at least 12 days into the
FIG. 4. RT-PCR analysis of ptx promoter mutant activation kinetics. (A) Schematic diagram of changes made to the promoter and bvg-activating regions of ptx. Changes were introduced to the chromosome of wild-type B. pertussis strain W28. NMD386 has a deletion of 65 bp inthe intervening-sequence region (I), and NMD387 has a replacement of the ptx inverted repeats (arrows) with the inverted repeats of fha(arrowheads) in the repeat region (R). The inverted repeats are sites of primary BvgA binding at these promoters (20). (B) RT-PCR was used todetect transcripts of rpoA and ptx after induction of the Bvg system in wild-type B. pertussis strain W28 and the ptx promoter mutant strains,NMD386 and NMD387. The time course of induction is shown on ethidium bromide-stained agarose gels at 0, 15, 30, 45, 60, 120, 180, 240, and480 min for the bvg-dependent ptx promoter and bvg-independent standard rpoA. Results from a typical experiment are shown. (C) Samples fromthe time course of induction were run on an agarose gel, stained with Vistra green, and quantitated using a FluorImager SI system from MolecularDynamics. }, W28; ■, NMD386; Œ, NMD387. The band intensities were normalized to the rpoA standard and plotted. rfu, relative fluorescence units.
VOL. 69, 2001 DIFFERENTIAL REGULATION IN B. PERTUSSIS PATHOGENICITY 1987
infection. The effect on persistence beyond day 12 was notexamined.
Effect of addition of PT to B. pertussis inoculum on coloni-zation. The above data indicate that the altered expression of
ptx has a negative effect on the ability of B. pertussis to colonizethe respiratory tracts of intranasally infected mice. A recentreport indicated that when a human bronchial epithelial cellline was preincubated with increasing concentrations of puri-fied PT, washed, and then incubated with B. pertussis strains,there was a dose-dependent reduction of adherence of thebacteria to the bronchial cells (38). These data provide evi-dence that PT can inhibit the adherence of B. pertussis toepithelial cells, which led us to the hypothesis that the viru-
FIG. 5. Analysis of PT expression: (A) CHO cell clustering activityof culture supernatants of strains W28, NMD386, and NMD387. (B)The levels of PT secreted by W28, NMD387, NMD384 (a strain similarto NMD386 with a 21-bp deletion in the intervening-sequence re-gion), and NMD386 were compared by Western immunoblotting ofTCA-precipitated supernatant proteins. The S1 subunit of PT was de-tected with monoclonal antibody X2X5. One set of supernatant pro-teins from cultures grown in triplicate are shown here. Densitometricanalysis of bands from all cultures showed no significant difference inthe level of secreted PT. 1, purified PT control.
FIG. 6. Colonization of mice by ptx promoter mutants. Wild-typeB. pertussis strain W28 and ptx promoter mutant strains NMD386(early in vitro ptx activation) and NMD387 (intermediate in vitro ptxactivation) (5 3 104 CFU of each) were intranasally inoculated intogroups of eight or nine mice. P values for comparisons between thewild-type and mutant strains are shown. Bars, geometric means; dottedline, lower limit of detection.
FIG. 7. Effect of inoculation dose on colonization by ptx promotermutants. Groups of six to eight mice were inoculated with approxi-mately 1 3 104, 5 3 104, and 5 3 106 CFU of wild-type B. pertussis strainW28 and the ptx promoter mutant strains, NMD386 and NMD387. Meanvalues are plotted. Asterisk, statistically significant difference betweenthe wild-type and mutant strains within a dose group.
FIG. 8. Time course of colonization. Groups of six to eight micewere intranasally inoculated with 5 3 104 CFU of wild-type B. pertussisstrain W28 or the ptx promoter mutant strains, NMD386 andNMD387. After 2, 8, and 12 days the trachea and lungs of the micewere harvested and plated to determine CFU. Mean values are plot-ted. Asterisk, statistically significant difference between the wild-typeand mutant strains within a time point.
lence defect demonstrated by the ptx promoter mutants couldbe an effect of the altered expression of ptx resulting in inhi-bition of initial bacterial adherence to the respiratory tract byPT. To test this hypothesis, we determined whether the addi-tion of purified PT to the inoculum of wild-type B. pertussismight mimic the virulence defect of the ptx promoter mutants,NMD386 and NMD387, by interfering with initial adherence.We therefore inoculated mice with 5 3 104 CFU of B. pertussisW28 resuspended in buffer alone or with 1 or 10 mg of purifiedPT added. After 7 days, the mice were sacrificed and thetrachea and lungs were removed, homogenized, diluted, andplated. Surprisingly, the addition of 1 and 10 mg of purifiedwild-type PT resulted in statistically significant 7-fold (notshown) and 10-fold (Fig. 9) increases, respectively, in the levelof B. pertussis colonization of the respiratory tracts of theinfected mice.
We hypothesized that this result could be due to the toxicactivity of PT overwhelming the immune system and overcom-ing any inhibitory effect it may have on virulence. To test this,we analyzed the effect of coadministering, with the bacteria,inactive PT or the binding B oligomer, which lacks the ADP-ribosylating activity of PT but which could still bind and po-tentially inhibit the adherence of B. pertussis. We inoculatedmice with 5 3 104 CFU of W28 in buffer alone or with 10 mgof purified wild-type PT holotoxin, 10 or 20 mg of purifiedinactive PT holotoxin, or 10 mg of purified PT B oligomeradded. After 7 days, the mice were sacrificed and the tracheaand lungs were removed, homogenized, diluted, and plated.The CFU per respiratory tracts are shown in Fig. 9. The ad-dition of either 10 mg of purified wild-type PT or 10 mg ofpurified B oligomer resulted in statistically significant increasesin the level of B. pertussis colonization of the respiratory tractsof the infected mice (P 5 0.013 and 0.016, respectively). The
colonization seen when either 10 or 20 mg of mutant PT wasadded to the inoculum was not significantly different from thatseen with no added toxin (Fig. 9). Although these data did notprovide evidence to support an inhibitory role for the earlypresence of PT in the reduced ability of B. pertussis to colonizethe respiratory tracts of mice, it does verify the role of PT as avirulence factor for B. pertussis.
Role of modulation in colonization. In order for the earlyexpression of ptx to have an effect on the virulence of B. per-tussis, we hypothesized that, at some point during the course ofinfection, down-regulation or modulation of ptx expressionwould be required. Using RT-PCR analysis, as described pre-viously, we investigated whether the time of preparation ofthe bacterial inoculum (approximately 45 min to 1 h at roomtemperature in our standard protocol) was enough to down-regulate the expression of ptx. B. pertussis W28 cells wereresuspended in PBS-CAA and maintained either at room tem-perature or at 37°C for 1 h, after which total RNA was isolatedfrom both sets of cells for RT-PCR analysis with primers spe-cific for bvg-independent gene rpoA and for ptx. The experi-ment was repeated three times, and the RT-PCR results areshown in Fig. 10A. The room temperature and 37°C ptx prod-ucts were run on an agarose gel, stained with Vistra green, andnormalized to the rpoA standard. An average 84% reduction inexpression between the 37°C and room temperature ptx prod-ucts was observed. This indicates that room temperature, aknown modulator of the BvgAS system, is able to down-regu-late expression of ptx within 1 h, the average time betweenremoval of B. pertussis cells from the 37°C incubator for prep-aration of inocula and intranasal inoculation of mice.
To examine the effect of this preinoculation down-regulationof ptx by our standard inoculation procedure, we inoculatedtwo groups of mice with W28, one with an inoculum that wasmaintained at room temperature for 1 h prior to inoculation(standard protocol) and one with an inoculum that was main-tained at 37°C for 1 h prior to inoculation. There was nostatistically significant difference between the ability of thebacteria that were maintained at 37°C and that of the bacteriamaintained at room temperature to colonize the respiratorytracts of mice (Fig. 10B). This suggests that, although modu-lation may occur during our standard procedure, it is not nec-essary for full virulence of B. pertussis W28 in mice.
DISCUSSION
In this study we have provided evidence that alterations tothe promoter regions of bvg-activated genes can alter the ki-netic patterns of expression of these genes. In addition, B.pertussis strains containing these promoter alterations demon-strate a reduction in the ability to colonize respiratory tracts inan intranasal mouse model of infection, i.e., a virulence defect.In particular, the altered regulation of the characteristicallyearly-activated fha promoter and that of the characteristicallylate-activated ptx promoter both result in approximately a1-log-unit reduction in the numbers of bacteria colonizing therespiratory tracts of mice. These data suggest a role for differ-ential regulation of bvg-activated genes, and therefore for theBvgAS regulatory system, in the virulence of B. pertussis.
Changes as substantial as the replacement of the entire fhapromoter region with the ptx promoter region, as well as more-
FIG. 9. Effect on colonization of addition of purified PT to inocu-lum. Ten to 20 mg of purified holotoxin, mutant holotoxin, or the Boligomer of PT was added to 5 3 104 CFU of wild-type B. pertussisstrain W28 and intranasally inoculated into groups of five mice. Sig-nificant P values from comparisons to the no-toxin group (W28) areshown. Bars, geometric means; dotted line, lower limit of detection.
VOL. 69, 2001 DIFFERENTIAL REGULATION IN B. PERTUSSIS PATHOGENICITY 1989
subtle changes such as the deletion of 65 bp of the intervening-sequence region and the alteration of 4 bp in the heptamericinverted-repeat sequence in the ptx promoter region, resultedin altered kinetic patterns of expression of fha and ptx, respec-tively. This provides further evidence that the promoter re-gions of bvg-activated genes are responsible for the differen-tial regulation seen in vitro. The early expression of ptx inNMD386, the strain with the deletion of the 65-bp intervening-sequence region, further supports the cooperative bindingmodel of activation by BvgA at the ptx promoter put forth byBoucher and Stibitz (6). In this model, supported by biochem-ical and genetic data, phosphorylated BvgA binds first to a sitewhich includes the heptameric inverted repeats. Subsequentcooperative binding of BvgA dimers along the intervening se-
quence between the initial binding site and the promoter al-lows BvgA to interact with RNA polymerase to promote tran-scription activation (6, 20). Although DNase I footprintinganalysis will have to be performed to confirm this, we expectfrom the altered kinetic pattern that this mutant no longerrequires the extensive cooperative binding, and thus the highconcentration of BvgA, that is needed for activation at thewild-type ptx promoter and is therefore activated earlier (atlower BvgA concentrations) after an inducing signal. The in-termediate kinetics of ptx in NMD387, in which the ptx hep-tameric inverted repeats are replaced by the fha inverted re-peats, suggests that higher-affinity binding of BvgA to theprimary binding sites of bvg-activated promoters also results infaster transcriptional activation. We believe that the alteredactivation kinetics of these strains supports the hypothesis thata combination of the affinity of BvgA for the primary bindingsite and the distance between this site and the core promotersequences at bvg-activated promoters is primarily responsiblefor the differential regulation of bvg-activated genes. By usingvariations in the bvg-activating regions of genes in the Bvgregulon, B. pertussis appears to have optimized its virulence orcolonization abilities through differential regulation of at leastsome of its virulence genes using the products of its two-component signal transduction system.
The above data suggest a mechanism for B. pertussis to beable to respond to subtle changes in the environment andcontrol the expression of its positively regulated virulence fac-tors accordingly. However, a role for differential regulationin the pathogenicity of Bordetella remains elusive. The Bvg1
phase is necessary and sufficient for colonization of animalrespiratory tracts (11, 21), while the Bvg2 phase appears not tohave a role in virulence and may even be detrimental (2, 21,23). These data suggest that there is no role for the Bvg2 phasein vivo and that one function of the bvg locus in pathogenicityis repression of the bvg-repressed genes. However, there issome indication that the Bvgi phase of B. pertussis is expressedin vivo (21). We believed that if regulation by the BvgASsystem is important for pathogenicity, changing the regulatorycircuit between classes of bvg-activated promoters should affectvirulence. We hypothesized that, by making changes to thepromoter regions of bvg-activated genes, we could alter theirpatterns of regulation, manifested as a change in activationkinetics. Furthermore, we hypothesized that, if the differentialregulation characterized in vitro has a role in the pathogenicityof B. pertussis, exchanging the regulatory control betweenclasses of promoters should decrease the virulence of the or-ganism.
Our analysis of B. pertussis mutants altered in their kineticpatterns of expression of fha and ptx indicates that the alteredregulation of bvg-activated virulence factors reduces coloniza-tion of the mouse respiratory tract. In particular, ptx promotermutants NMD386 and NMD387 demonstrate a statisticallysignificant reduction in the ability to colonize the respiratorytracts of intranasally infected mice. Our data indicate that thiscolonization defect is dose dependent and that the pattern ofreduced colonization is apparent throughout the course of a12-day infection. Although the reduction of colonization is notstatistically significant at the 2-day time point, the pattern ofreduced colonization appears to be already established. Ourdata strongly suggest that the colonization defect of NMD386
FIG. 10. Effect of preinoculation temperature on ptx expressionand W28 colonization. (A) RT-PCR was used to detect transcripts ofthe bvg-independent rpoA gene and the bvg-dependent ptx gene after1 h of incubation of resuspended W28 cells at either 37°C or roomtemperature (RT). Results of three independent experiments areshown on ethidium bromide-stained agarose gels. Normalization of theptx products to the rpoA standard indicated an average 84% decreasein ptx expression between 37°C and room temperature incubations. (B)Wild-type B. pertussis strain W28 (5 3 104) preincubated for 1 h ateither room temperature or at 37°C was intranasally inoculated intogroups of seven mice. Bars, geometric means; dotted line, lower limitof detection.
and NMD387 is an effect of the altered regulation of ptx ex-pression in these strains, as there are no significant differencesin the steady-state levels of transcriptional activity or expres-sion of PT between the ptx promoter mutant strains and wild-type strain W28. The colonization defect demonstrated byKMC3, the fha-to-ptx promoter replacement strain, also ap-pears to be an effect of the altered regulation of fha expression.
We contend that, at some point prior to or during the courseof infection, at least partial modulation of Bvg activity in B.pertussis would have to occur in order for the altered regulatorycontrol in our mutants to have a deleterious effect. This couldoccur either in the respiratory tract of the host or prior toencounter with the host. It is possible that modulation occursthroughout the course of infection as the organism is exposedto different microenvironments in the host’s respiratory tract.The immune response to the recently identified Bvgi phasefactors provides evidence to support this (21). Our data indi-cate that 1 h at room temperature is sufficient to reduce ptxtranscription by an average of 84%. However, our results alsoindicate that the maintenance of the wild-type B. pertussisinoculum at 37°C, thus inhibiting the ability of the Bvg systemto modulate its virulence factors prior to inoculation, does notsignificantly affect the ability of the organism to colonize therespiratory tracts of intranasally infected mice. It remains pos-sible that differential regulation is required during the courseof infection within the host for optimal virulence of B. pertussisrather than prior to encounter with the host. Characterizationof differential expression of bvg-activated genes throughout thecourse of infection would have to be examined to address this.Furthermore, we cannot rule out a role for differential regu-lation in the course of transmission between infected individ-uals during which B. pertussis may remain aerosolized for con-siderable periods of time (1). It is possible that an effect of thepreinoculation modulation may be more dramatic at either anearlier or later harvest time point. Use of the aerosol challengemouse model may also offer further insight into the role ofdifferential regulation in transmission as it may provide a morerelevant model of exposure to the organism and the earlystages of infection. It is possible that the virulence defects ofour regulatory mutants may be magnified using this model.
A recent study by van den Berg et al. (38) provided a pos-sible explanation as to why the early presence of PT might havean inhibitory effect on the ability of B. pertussis to colonize therespiratory tracts of mice. This report indicated that, despiteprevious accounts that PT has a role as an adherence factor(36), PT does not augment B. pertussis adherence to culturedhuman cells and, in fact, can even inhibit B. pertussis adherencein vitro (38). However, we did not detect a dose-dependentinhibitory effect of added purified PT in our intranasal mousemodel of infection to support this as a possible reason for thereduced ability of our ptx promoter mutants to colonize. It ispossible that the addition of lower concentrations of the puri-fied toxins or B oligomer may have demonstrated an inhibitoryeffect without enhancing bacterial virulence (presumably byoverwhelming the immune system of the mice). However, theartificial addition of PT to the inoculum is probably quitedifferent from B. pertussis production of PT and the localconcentrations of bacteria and toxins present in a natural in-fection.
One can speculate that the complexity of an organism’s
regulatory mechanisms may correlate with the complexity ofthe bacterium’s life cycle. It is possible that the adaptabilityafforded to B. pertussis by its complex regulatory componentsand phosphotransfer steps enables the bacterium to respond toa series of changing microenvironments throughout the courseof infection. We demonstrate that B. pertussis utilizes differ-ences in the promoters of its bvg-activated virulence factors toallow for differential expression of these genes using only theBvgAS system. Furthermore, we provide evidence that thisdifferential regulation is required for optimal virulence. Webelieve that the temporal expression demonstrated in vitrolikely reflects the sensitivity of a particular bvg-activated pro-moter to modulatory signals. This is consistent with the re-quirement for higher concentrations of transcriptional activa-tor BvgA at the late-acting promoters (31). In further supportof this idea, we have recently found that the intermediatelyactivated prn promoter (17) is most transcriptionally active atintermediate levels of modulator MgSO4 (S. M. Kinnear andN. H. Carbonetti, unpublished data).
Two possible hypotheses may explain the role of differentialregulation of bvg-activated genes during the course of infec-tion. The first is that temporal regulation of virulence geneexpression is important for colonization and the resulting in-fection. Incorporating our data, a possible model to explain therole of temporal regulation of bvg-activated virulence factors isas follows. Following a coughing paroxysm of a pertussis pa-tient, the aerosolized organisms are exposed to the lower tem-perature of the environment and the BvgAS system is therebymodulated or down-regulated. As the aerosol droplet reachesthe nasal passages of the next host, the least-sensitive fhapromoter is either still on or is immediately activated and theintermediately sensitive prn promoter is transcribed at its high-est level to facilitate the ability of FHA to colonize the respi-ratory tract. It has been proposed that pertactin (PRN) acts asan accessory adherence factor, perhaps in conjunction withFHA. PRN may be important as a scaffolding or support com-ponent of an adhesin complex (27, 28, 29). Our data indicatethat, if there is some modulation of the BvgAS system in thetime between aerosolization of the organism and transmissionto the next host, prn expression would be at its peak. At thesame time, the most sensitive ptx promoter is turned off so asnot to have an inhibitory effect on initial adherence.
An alternative hypothesis is that differential regulation ofbvg-activated virulence gene expression occurs in response tospatial rather than temporal cues. This hypothesis suggests thatin vivo microenvironments differ in their modulatory signals.Some microenvironments may present cues that are perceivedas semimodulating and thus would induce expression of ad-hesins (such as FHA and PRN) but repress toxin expression.Other microenvironments may be nonmodulating and thuswould induce expression of both adhesins and toxins. Fromprevious data (21, 23), it seems unlikely that there are fullymodulating in vivo microenvironments that would inhibit theexpression of the bvg-activated factors and induce the expres-sion of the bvg-repressed factors. According to this hypothesisof spatial cues, virulence genes would be differentially regu-lated depending on the location of the bacteria within the hostrespiratory tract to result in optimal infection. The two hypoth-eses are not necessarily mutually exclusive, since the location
VOL. 69, 2001 DIFFERENTIAL REGULATION IN B. PERTUSSIS PATHOGENICITY 1991
of bacteria within a host may be dependent to some extent onthe time after the first encounter with the host.
An additional, more trivial possibility is that the differencesin colonization levels between the wild-type and mutant strainsare due to differences in the steady-state expression levels ofFHA and PT rather than differences in regulatory control.However densitometric analysis of Western blots and cytotox-icity assays for PT activity indicated that there were no signif-icant differences in the levels of FHA and PT expressed be-tween the strains in vitro (Fig. 3 and 5, respectively). While itmay seem surprising that merely altering the regulatory patternof expression of FHA should have a measurable effect onvirulence when it has been demonstrated that FHA2 mutantswere not affected in virulence in a mouse model (39), thesteady-state lack of a virulence factor is different than an al-teration of regulatory patterns, as in our mutants. The perma-nent lack of FHA may be compensated for by an alternativeadherence factor in the animal model, whereas altered regu-lation of FHA may result in inappropriate temporal or spatialexpression and interference with optimal bacterium-host inter-actions for infection. Although we cannot rule out a possibledifference in expression levels in vivo, we believe this to be anunlikely cause of the virulence defect in our mutant strains andtherefore favor either the temporal or spatial hypotheses pre-sented. The ability of the BvgAS system to be sensitive to smallchanges in environmental signals via the complexity of its phos-phorelay together with differences in the promoter regions ofgenes in its regulon may allow B. pertussis to respond to theintricacy of its life cycle through the efficiency of one regulatorysystem.
ACKNOWLEDGMENTS
We thank Kyle McKenna for the construction of KMC3; MonicaCastro and Uli McNamara for technical assistance; Abdu Azad andSuzana Radulovic for mice; Abdu Azad, Drusilla Burns, and RinoRappuoli for reagents; Alla Romashko and the University of MarylandAnimal Facility for assistance with mouse experiments; and ColinO’Connell for help with figures. We also thank Steve Wasserman foradvice on statistics and Jim Kaper and Jim Nataro for critical readingof the manuscript. We are also grateful to both anonymous reviewers,whose painstakingly thorough critiques of the manuscript helped toimprove it significantly.
This work was supported by NIH grants AI32946 and AI38979.
REFERENCES
1. Aintablian, N., P. Walpita, and M. H. Sawyer. 1998. Detection of Bordetellapertussis and respiratory syncytial virus in air samples from hospital rooms.Infect. Control Hosp. Epidemiol. 19:918–923.
2. Akerley, B. J., P. A. Cotter, and J. F. Miller. 1995. Ectopic expression of theflagellar regulon alters development of the Bordetella-host interaction. Cell80:611–620.
3. Arico, B., J. F. Miller, C. R. Roy, S. Stibitz, D. Monack, S. Falkow, R. Gross,and R. Rappuoli. 1989. Sequences required for expression of Bordetellapertussis virulence factors share homology with prokaryotic signal transduc-tion proteins. Proc. Natl. Acad. Sci. USA 86:6671–6675.
4. Bartoloni, A., M. Pizza, M. Bigio, D. Nucci, L. A. Ashworth, L. I. Irons, A.Robinson, D. Burns, C. Manclark, H. Sato, and R. Rappuoli. 1988. Bindingof a protective epitope of pertussis toxin by in vitro refolding of recombinantfragments. Bio/Technology 6:709–712.
5. Boucher, P. E., K. Murakami, A. Ishihama, and S. Stibitz. 1997. Nature ofDNA binding and RNA polymerase interaction of the Bordetella pertussisBvgA transcriptional activator at the fha promoter. J. Bacteriol. 179:1755–1763.
6. Boucher, P. E., and S. Stibitz. 1995. Synergistic binding of RNA polymeraseand BvgA phosphate to the pertussis toxin promoter of Bordetella pertussis.J. Bacteriol. 177:6486–6491.
7. Boucher, P. E., F. D. Menozzi, and C. Locht. 1994. The modular architectureof bacterial response regulators: insights into the activation mechanism of
the BvgA transactivator of Bordetella pertussis. J. Mol. Biol. 241:363–377.8. Carbonetti, N. H., T. J. Irish, C. H. Chen, C. B. O’Connell, G. A. Hadley, U.
McNamara, R. G. Tuskan, and G. K. Lewis. 1999. Intracellular delivery of acytolytic T-lymphocyte epitope peptide by pertussis toxin to major histocom-patibility complex class I without involvement of the cytosolic class I antigenprocessing pathway. Infect. Immun. 67:602–607.
9. Carbonetti, N. H., T. M. Fuchs, A. A. Patamawenu, T. J. Irish, H. Deppisch,and R. Gross. 1994. Effect of mutations causing overexpression of RNApolymerase a subunit on regulation of virulence factors in Bordetella pertus-sis. J. Bacteriol. 176:7267–7273.
10. Cotter, P. A., and J. F. Miller. 1997. A mutation in the Bordetella bronchi-septica bvgS gene results in reduced virulence and increased resistance tostarvation, and identifies a new class of Bvg-regulated antigens. Mol. Micro-biol. 24:671–685.
11. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction:analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in arabbit model. Infect. Immun. 62:3381–3390.
12. DeShazer, D., J. D. Bannan, M. J. Moran, and R. L. Friedman. 1994.Characterization of the gene encoding superoxide dismutase of Bordetellapertussis and construction of a SOD-deficient mutant. Gene 142:85–89.
13. Gross, R., and R. Rappuoli. 1988. Positive regulation of pertussis toxinexpression. Proc. Natl. Acad. Sci. USA 85:3913–3917.
14. Hewlett, E. L., K. T. Sauer, G. A. Meyers, J. L. Cowell, and R. L. Guerrant.1983. Induction of a novel morphological response in Chinese hamster ovarycells by pertussis toxin. Infect. Immun. 40:1198–1230.
15. Kasuga, T., Y. Nakase, K. Ukishima, and K. Takatsu. 1954. Studies onHaemophilus pertussis. Relation between the phase of bacilli and the progressof the whooping cough. Kitasato Arch. Exp. Med. 27:57–62.
16. Kimura, A., K. T. Mountzouros, D. A. Relman, S. Falkow, and J. L. Cowell.1990. Bordetella pertussis filamentous hemagglutinin: evaluation as a protec-tive antigen and colonization factor in a mouse respiratory infection model.Infect. Immun. 58:7–16.
17. Kinnear, S. M., P. E. Boucher, S. Stibitz, and N. H. Carbonetti. 1999.Analysis of BvgA activation of the pertactin gene promoter in Bordetellapertussis. J. Bacteriol. 181:5234–5241.
18. Knapp, S., and J. Mekalanos. 1988. Two trans-acting regulatory genes (virand mod) control antigenic modulation in Bordetella pertussis. J. Bacteriol.170:5059–5066.
19. Leininger, E., M. Roberts, J. G. Kenimer, I. G. Charles, N. Fairweather, P.Novotny, and M. J. Brennan. 1991. Pertactin, an Arg-Gly-Asp-containingBordetella pertussis surface protein that promotes adherence to mammaliancells. Proc. Natl. Acad. Sci. USA 88:345–349.
20. Marques, R. R., and N. H. Carbonetti. 1997. Genetic analysis of pertussistoxin promoter activation in Bordetella pertussis. Mol. Microbiol. 24:1215–1224.
21. Martinez de Tejeda, G., P. A. Cotter, U. Heininger, A. Camilli, B. J. Akerley,J. J. Mekalanos, and J. F. Miller. 1998. Neither the Bvg2 phase nor the vrg6locus of Bordetella pertussis is required for respiratory infection in mice.Infect. Immun. 66:2762–2768.
22. Masure, H. R. 1992. Modulation of adenylate cyclase toxin production asBordetella pertussis enters human macrophages. Proc. Natl. Acad. Sci. USA89:6521–6525.
23. Merkel, T. J., S. Stibitz, J. M. Keith, M. Leef, and R. Shahin. 1998. Contri-bution of regulation by the bvg locus to respiratory infection of mice byBordetella pertussis. Infect. Immun. 66:4367–4373.
24. Merkel, T. J., and S. Stibitz. 1995. Identification of a locus required for theregulation of bvg-repressed genes in Bordetella pertussis. J. Bacteriol. 177:2727–2736.
25. Pizza, M., A. Covacci, A. Bartoloni, M. Perugini, L. Nencioni, M. T. DeM-agistris, L. Villa, D. Nucci, R. Manetti, M. Bugnoli, F. Giovannoni, R.Olivieri, J. T. Barbieri, H. Sato, and R. Rappuoli. 1989. Mutants of pertussistoxin suitable for vaccine development. Science 246:497–500.
26. Rappuoli, R., B. Arico, and V. Scarlato. 1992. Thermoregulation and revers-ible differentiation in Bordetella: a model for pathogenic bacteria. Mol.Microbiol. 6:2209–2211.
27. Relman, D. A., and S. Falkow. 1994. A molecular perspective of microbialpathogenicity, p. 19–29. In G. L. Mandell, R. E. Douglas, and E. Bennett(ed.), Principles and practice of infectious diseases, 4th ed. Churchill Liv-ingstone, New York, N.Y.
28. Relman, D. A. 1995. Bordetella pertussis: determinants of virulence, p. 367–405. In J. Moss, B. Iglewski, M. Vaughn, and A. T. Tu (ed.), Bacterial toxinsand virulence factors in disease. M. Dekker, New York, N.Y. 367–405.
29. Roberts, M., N. F. Fairweather, E. Leininger, D. Pickard, E. L. Hewlett, A.Robinson, C. Hayward, G. Dougan, and I. G. Charles. 1991. Constructionand characterization of Bordetella pertussis mutants lacking the vir-regulatedP.69 outer membrane protein. Mol. Microbiol. 5:1393–1404.
30. Robinson, A. L., A. E. Ashworth, A. Baskerville, and L. I. Irons. 1985.Proceedings of the 4th International Symposium on Pertussis. Dev. Biol.Stand. 61:165–172.
31. Scarlato, V., A. Prugnola, B. Arico, and R. Rappuoli. 1990. Positive tran-scriptional feedback at the bvg locus controls expression of virulence factorsin Bordetella pertussis. Proc. Natl. Acad. Sci. USA 87:6753–6757.
32. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gramnegative bacteria. Bio/Technology 1:784–791.
33. Stainer, D. W., and M. J. Scholte. 1970. A simple chemically defined mediumfor the production of phase I Bordetella pertussis. J. Gen. Microbiol. 63:211–220.
34. Steffen, P., S. Goyard, and A. Ullmann. 1996. Phosphorylated BvgA is suf-ficient for transcriptional activation of virulence-regulated genes in Borde-tella pertussis. EMBO J. 15:102–109.
35. Stibitz, S., and M.-S. Yang. 1991. Subcellular location and immunologicaldetection of proteins encoded by the vir locus of Bordetella pertussis. J.Bacteriol. 173:4288–4296.
36. Tuomanen, E., and A. Weiss. 1985. Characterization of two adhesins ofBordetella pertussis for human ciliated respiratory-epithelial cells. J. Infect.Dis. 152:118–125.
37. Uhl, M. A., and J. F. Miller. 1996. Integration of multiple domains in atwo-component sensor protein: the Bordetella pertussis BvgAS phosphorelay.EMBO J. 15:1028–1036.
38. van den Berg, B. M., H. Beekhuzuizen, R. J. L. Willems, F. R. Mooi, and R.van Furth. 1999. Role of Bordetella pertussis virulence factors in adherence toepithelial cell lines derived from the human respiratory tracts. Infect. Im-mun. 67:1056–1062.
39. Weiss, A. A., and M. S. Goodwin. 1989. Lethal infection by Bordetella per-tussis mutants in the infant mouse model. Infect. Immun. 57:3757–3764.
Editor: V. J. DiRita
VOL. 69, 2001 DIFFERENTIAL REGULATION IN B. PERTUSSIS PATHOGENICITY 1993
