+ All Categories
Home > Documents > DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations...

DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations...

Date post: 17-Jan-2016
Category:
Upload: curtis-warner
View: 215 times
Download: 0 times
Share this document with a friend
Popular Tags:
38
DNA d a little quick histor
Transcript
Page 1: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA…and a little quick history…

Page 2: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

1866

Gregor Mendel published the results of his investigations

of the inheritance of

"factors" in pea plants.

Page 3: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

1950'sMaurice Wilkins (1916- ), Rosalind Franklin (1920-1957), Francis H. C. Crick

(1916- ) of Britain and James D. Watson (1928- )

of the U.S. discover chemical structure of DNA,

starting a new branch of science--molecular

biology.

Page 4: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

1953Watson and Crick made a model of the DNA molecule and proved that genes

determine heredity.

Page 5: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

The Late 1980'sAn international team of scientists began the

project to map the human genome. The first crime conviction based on DNA

fingerprinting, in Portland Oregon.

Page 6: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

1994The FDA approved the first

genetically engineered food -- FlavrSavr tomatoes engineered for

better flavor and shelf life.

Page 7: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

1995DNA testing in forensics cases gains fame in the

O.J. Simpson trial.

Page 8: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

1997Dolly the Sheep - the first adult animal clone.

Page 9: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

2000J. Craig Ventor, along with Francis Collins, jointly

announce the sequencing of the entire human genome.

Page 10: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA

DNA stands for deoxyribonucleic acid.

Page 11: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Where is DNA found?

James Watson and Francis Crick discovered that

chromosomes are made up of DNA and

called it a double helix. These

chromosomes are located in the

nucleus!!

Page 12: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

The Double Helix…

…was determined to be a twisted

ladder of nucleotide

bases.

Page 13: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Nucleotide

Page 14: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

NucleotideSugar

Phosphate

Base

Page 15: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA nucleotides are made up of…

Sugar

Phosphate

Base

Deoxyribose sugar

AdenineGuanineCytosineThymine

Page 16: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

When the nucleotides

are assembled,

adenine pairs with thymine. Cytosine pairs with guanine.

Page 17: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Quick Quiz• Who discovered the arrangement of the

DNA molecule?Watson and Crick

• DNA is considered a ____ helix.double

• DNA is made up of what subunits?nucleotides

• What are the 3 components of a nucleotide?

sugar, phosphate, base

• In DNA, adenine pairs with____?thymine

Page 18: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA replication

• In order for cells to replicate during mitosis, the DNA must make a copy of itself. Why?

• Which phase of the cell cycle does the replication of DNA take place?

a) G1 - Interphaseb) S - Interphasec) G2 – Interphased) Prophase

Page 19: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Replication Sequence

1. Enzymes unwind the helix

2. Enzymes pull apart the DNA molecule

3. Exposed bases attract their complementary bases

4. Polymerase joins all the nucleotides together on each new strand

5. Mitosis begins in the cell

Page 20: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.
Page 21: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.
Page 22: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Replicationanimations

• Short version: http://www.lewport.wnyric.org/jwanamaker/animations/DNA%20Replication.html

• Long version: http://www.lewport.wnyric.org/jwanamaker/animations/DNA%20Replication%20-%20long%20.html

• preAP: http://www.johnkyrk.com/DNAreplication.html

Page 23: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Fingerprint

• With technology today, scientists use DNA for many reasons: convict criminals, release criminals, and even determine paternity.

• A DNA fingerprint is created in these cases. DNA fingerprinting is a technique used to distinguish between individuals of the same species using only samples of their DNA.

Page 24: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Fingerprint

• In order to create a DNA fingerprint, scientists have to cut the DNA with an enzyme specifically known as a restrictive enzyme.

• Once it is cut, the DNA is then placed into an electrophoresis chamber.

Page 25: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Fingerprint

• Electricity is added to the chamber, and the DNA segments will move. Since DNA is negatively charged, it will run away from the negative electrode.

http://www.lewport.wnyric.org/JWANAMAKER/animations/Chrom%26Elpho.html

Page 26: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Which of the following do YOU think is a DNA fingerprint?

Page 27: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

A blood stain was found in Mrs.

Lowery’s classroom.

Which student was the blood

stain most likely from?

Page 28: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA samples were taken from a crime scene, the female victim and two suspects in a sexual

assault case. The victim’s boyfriend was also tested. The DNA ladders are used

to judge the sizes of the DNA fragments. Control samples are also run, to

ensure that the experiment is done correctly. Can you determine which suspect is

likely the criminal?

Page 29: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Do the children inherit ALL of the traits from ONLY 1 parent?

Page 30: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Is the D2 daughter actually the Dad’s child?

Page 31: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

What is the deal with the S2 son?

Page 32: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Results from a single DNA fingerprint

analysis for a man and his four

different children are shown in the

figure. Which lane contains the DNA

of the father?

Page 33: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Fingerprinting Activity

Page 34: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Fingerprinting Activity It was early Thursday morning when the police were called out to

investigate a crime scene. Apparently, someone had broken into a jewelry store and stolen a case of Crown Jewels. Unfortunately, some

blood was left behind on the window sill. The suspect list has been narrowed to 4 people:

Suspect 1: Scandalous Stueart A widely known as a successful crime chief. Stueart has been known to brag that he could get by any security system. He said that he would prove it by someday taking the crown jewels. No stone has been known to have higher security.

Suspect 2: Mischievous McCurley She would kill to own the largest and most precious stone in the world. She has been known to run with the worst jewelry thieves in the US. She wants a diamond ring on her left hand so bad that she once threatened to cut the ring finger off of her own partner in crime.

Suspect 3: Maniac Melton Owns the largest private collection of precious stones in the world. He has offered millions of dollars for the Crown Jewels. Having been a member of the prestigious Ninja S.W.A.T. team, he has the talent and guts to pull of such a crime.

Suspect 4: Sir Shabay He is known for his vast collection of “bling bling”. He is one of Hollywood’s most famous jewelry dealers. Although he has never been caught in the act, it has long been suspected that he is, in some way, responsible for many large jewelry thefts in the area.

Page 35: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

Restriction Enzyme1. Find the pattern below in your DNA sample. 2. Use a pipe cleaner and lay it down on all of

the “cut sites”.

CCGGGGCC

For example:

TACCGGAATTCCGGTAAAATGGCCTTAAGGCCATTT

Page 36: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

3. Count the number of BASE PAIRS between each “cut site”

4. Draw a line on your chart to represent the fragments.

Restriction Enzyme

TACCGGAATTCCGGTAAAATGGCCTTAAGGCCATTT

4 8 6

Page 37: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Fingerprinting Activity

46

8

Page 38: DNA …and a little quick history…. 1866 Gregor Mendel published the results of his investigations of the inheritance of "factors" in pea plants.

DNA Fingerprinting Activity


Recommended