+ All Categories
Home > Documents > DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

Date post: 05-Jan-2016
Category:
Upload: evelyn-short
View: 213 times
Download: 0 times
Share this document with a friend
Popular Tags:
14
DNA – How it Works Part 1 Part 1 •The importance of DNA click
Transcript
Page 1: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

DNA – How it WorksPart 1Part 1

•The importance of DNA click

Page 2: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

Chromosomes are made of DNA…

Page 3: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

DNA has two sides, each made of nucleotides…

Page 4: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

Another look at the nucleotide…

Page 5: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

Base Pairs ALWAYS Match Up!

Adenine with Adenine with ThymineThymine and vice versa and vice versa Cytosine with Cytosine with GuanineGuanine and vice versa and vice versa

A & G are A & G are PurinesPurines – – doubledouble rings rings C & T are C & T are PyrimidinesPyrimidines – – singlesingle rings rings

Page 6: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

A look at the base pairs…

                                

Page 7: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

DNA Replication – Making a copy…

Page 8: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

How it works… HelicaseHelicase (an enzyme) (an enzyme)

“unzips” the DNA“unzips” the DNA

Page 9: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

How it Works, con’t… Each strand is used as aEach strand is used as a template template to build a to build a

complementarycomplementary strand strand When the complementary strand is When the complementary strand is

complete, it twists with the template strand complete, it twists with the template strand to form a new to form a new double helixdouble helix!!!!

Page 10: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

Replication of DNA

Click this image to view movie

•Replication of DNA

Page 11: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

Also, keep in mind… The Point where the double helix separates The Point where the double helix separates

is called the is called the replication forkreplication fork ( (looks like alooks like a Y) Y)

Enzymes called Enzymes called DNA polymeraseDNA polymerase move move along each strand adding the corresponding along each strand adding the corresponding nucleotides!nucleotides!

Page 12: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

New DNA – Exactly like the old!

Page 13: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.
Page 14: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA.

You tell me the complimentary strand… ATGGCGTCATGCTTAGATTACAATGGCGTCATGCTTAGATTACA

TACCGCAGTACGAATCTAATGTTACCGCAGTACGAATCTAATGT


Recommended